Expression, Assembly, and Proteolytic Processing of Helminthosporium Victoriae 190S Totivirus Capsid Protein in Insect Cells

VIROLOGY 234, 130–137 (1997) ARTICLE NO. VY978631

Expression, Assembly, and Proteolytic Processing of Helminthosporium victoriae 190S Totivirus Capsid Protein in Insect Cells

Shaohua Huang,* Ana I. Soldevila,* Bruce A. Webb,† and Said A. Ghabrial*,1

*Department of Plant Pathology and †Department of Entomology, University of Kentucky, Lexington, Kentucky 40546-0091 Received March 19, 1997; returned to author for revision April 25, 1997; accepted May 8, 1997

The dsRNA genome (5.2 kbp) of Helminthosporium victoriae 190S totivirus (Hv190SV) consists of two large overlapping -open reading frames (ORFs). The 5؅ proximal ORF codes for the capsid protein (CP) and the 3؅ ORF codes for an RNA dependent RNA polymerase. Although the capsid of Hv190SV is encoded by a single gene, it is composed of two major closely related polypeptides, either p88 and p83 or p88 and p78. Whereas p88 and p83 are phosphoproteins, p78 is nonphosphorylated. Expression of the CP ORF in insect cells generated both p78 and p88 which assembled into virus-like particles. The finding that p78, p83, and p88 share a common N-terminal amino acid sequence is consistent with the determination that N-terminal, but not C-terminal, CP deletions were incompetent for assembly. Evidence was obtained that p78 is derived from p88 via proteolytic cleavage at the C-terminus. Proteolytic processing may play a regulatory role in the virus life cycle since it leads to dephosphorylation of CP and a subsequent decrease in virion transcriptional activity. ᭧ 1997 Academic Press

INTRODUCTION assembly, and interrelationships of the capsid proteins p78 and p88 are emphasized in this study. Helminthosporium victoriae 190S virus (Hv190SV) is a In this communication, we report that both p78 and member of the genus Totivirus in the family Totiviridae p88 were produced in insect cells when the Hv190SV (Ghabrial et al., 1995). Other genera in the family are: CP gene was expressed in a baculovirus expression sys- Giardiavirus and Leishmaniavirus, the members of which tem and that the expressed p78 and p88 assembled into infect parasitic protozoa (Ghabrial et al., 1995). The com- virus-like particles. C-terminal, but not N-terminal, CP mu- plete nucleotide sequence of several totiviruses have tants expressed in insect cells, retained the ability to been determined and some of these viruses have been assemble into virus-like particles. Furthermore, evidence well characterized at the molecular level (Diamond et al., is presented that p78 is derived from p88 via proteolytic 1989; Huang and Ghabrial, 1996; Icho and Wickner, 1989; processing at the C-terminus. Because expression of the Park et al., 1996; Stuart et al., 1992; Scheffter et al., 1994, CP ORF in bacteria generated only p88 which assembled 1995; Wang et al., 1993). into empty capsids we propose that neither phosphoryla- Although the capsid of Hv190SV, like other totiviruses, tion nor proteolytic processing is required for assembly. is encoded by a single gene, it is composed of two closely related major capsid proteins (CPs), either p88 MATERIALS AND METHODS and p83 or p88 and p78. The capsids of all other totiviruses so far characterized appear to contain only a single Baculovirus constructs and generation of major CP. Purified Hv190S virion preparations contain recombinants for expression in insect cells two types of particles, 190S-1 and 190S-2, that differ DNA manipulations were performed using standard slightly in sedimentation rates and capsid composition. procedures (Sambrook et al., 1989). All nucleotide (nt) The 190S-1 capsids contain p88 and p83, occurring in numbering refers to the Hv190S dsRNA genome se- approximately equimolar amounts, and the 190S-2 cap- quence (Huang and Ghabrial, 1996). Constructs for ex- sids are composed of similar amounts of p88 and p78 pression of wild-type and deletion mutants of the CP (Ghabrial and Havens, 1992). p88 and p83 are phospho- gene in insect cells (see Fig. 1 for schematic representa- proteins, whereas p78 is nonphosphorylated. Typically, tion) were generated by PCR using the oligonucleotide the 190S-2 virions comprise the predominant particles primers described below. The baculovirus transfer vector isolated from 14-day stationary cultures of H. victoriae pVL1393 was used in all cases. To generate the wild- (Ghabrial and Havens, 1992). Therefore, the expression, type CP construct (CP-WT), plasmid pHV-4, a near full- length cDNA clone (nt 4–5178) of Hv190SV dsRNA (Hu- 1 To whom correspondence and reprint requests should be ad- ang and Ghabrial, 1996) was digested with EcoRV and dressed. Fax: (606) 323-1961. E-mail: [email protected]. NotI and the cDNA fragment (nt 234–5178) isolated by

0042-6822/97 $25.00 130 Copyright ᭧ 1997 by Academic Press All rights of reproduction in any form reserved.

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY PROTEOLYTIC PROCESSING OF H. VICTORIAE 190S TOTIVIRUS 131 low melting point (LMP) agarose gel electrophoresis and 502–931) were ligated into SpeI-digested-NdeI (filled-in) cloned into SmaI–NotI-digested pVL1393. pBS2 to produce pBS2mut. The wild-type SpeI–StuI frag- To generate the N-terminal deletion mutant CP-N71, ment (nt 2204–2990) in the CP-WT construct was then an upstream primer, 5؅ CCGGCCATGGAGGCTCCCT- replaced with the comparable mutant fragment from TAGT 3؅, containing Hv190S sequence from nt 498 to nt pBS2mut to generate the CP-F110 fusion construct. The 519 in which the extra C (bold) was added to generate a TGA at nt position 2766–2768 (Huang and Ghabrial, recognition site for NcoI (underlined) and a downstream 1996) in the CP-F110 construct serves as the stop codon primer, T3 promoter primer, were used. The primer pair for the fusion protein (see Fig. 1). The expressed fusion along with plasmid pBS1 (nt 4–941; Huang and Ghabrial, protein migrated in SDS–polyacrylamide gels with ap- 1996) as a template were used to direct the amplification parent molecular mass of 110 kDa. of a NcoI–SalI fragment by PCR. The PCR product was Maintenance of the lepidopteran cell line, S. frugiperda digested with NcoI, filled in with Klenow fragment, redi- (Sf9), transfer vector construction and general baculovi- gested with SalI, and isolated by LMP agarose gel elec- rus manipulations were performed using previously de- trophoresis. The digested PCR fragment (nt 502–941) scribed procedures (Webb and Summers, 1990; Soldevila along with two other viral cDNA fragments (derived from and Webb, 1996). Recombinant viruses were generated plasmid pHV-4 by digestion with appropriate restriction by cotransfection in Sf9 cells with Baculogold linearized enzymes and isolation by LMP agarose gel electrophore- virus DNA (PharMingen), following manufacturer’s in- sis), a SalI–PstI fragment (nt 941–3328) and a PstI–NotI structions. Recombinant viruses were plaque-purified fragment (nt 3328–5178) were ligated into SmaI–NotI- and the single-plaque isolates verified by dot hybridiza- digested pVL1393. The C-terminal mutant CP-C132 was tion using P32-labeled CP-specific probes. Expression of generated by digesting the transfer construct for CP-WT wild-type and mutant CP was evaluated by Western blot with SpeI, filling-in with Klenow fragment, and religating analysis. to introduce an in-frame termination codon (bold) at nt 2204–2209 (ACTAGT r ACTAGCTAGT). Preparation of an antiserum to bacterially expressed To present evidence that the primary translation prod- N-terminal peptide of Hv190SV CP uct of the CP ORF (capsid protein p88) undergoes prote- A cDNA fragment (nt 278 to 492) containing the coding olysis to generate the related capsid proteins p83 and sequence for the N-terminal peptide of p88 was gener- p78, the construct CP-F110 (full-length CP ORF fused to ated by PCR using plasmid pBS1 as a template and the a cDNA fragment encoding an internal CP peptide) was -following primer pair: an upstream primer, 5؅ CCCTAA made. Two pairs of primers were used. The first pair ATTTCCATATGTCTC 3؅, containing the sequence nt consisted of an upstream T7 universal primer and a 278–296 in which a restriction site for NdeI was gener- -downstream primer, 5؅ CGTTCCATGGTCACCCATTGT -ated and a downstream primer, 5؅ GAAGATCTGCCAAC -CCCTC 3؅, containing Hv190SV sequence complemen GCCTTTCCT 3؅, containing the sequence nt 492–478 in tary to nt 2624 to 2597 in which mutations were made to which a restriction site for BglII was generated. The PCR generate a recognition site for NcoI (underlined) and to product was digested with NdeI–BglII and ligated into change the TGA at position 2606–2608 (one nt change, the bacterial expression vector pET22b previously di- boldface type) to a sense codon (TGG). The primer pair gested with NdeI–BamH1. The 10-kDa N-terminal CP was used with plasmid pBS2 (nt 2204–3328; Huang and fusion peptide was expressed in the bacterial strain BL21 Ghabrial, 1996) as a template to prime the amplification (Novagen). The peptide was purified by electroelution of a cDNA fragment (nt 2204–2624) by PCR. The PCR from SDS–polyacrylamide gel bands and used to pro- product was digested with SpeI and NcoI and the SpeI– duce polyclonal antibodies in a rabbit. NcoI (nt 2204–2613) fragment was isolated by LMP agarose gel electrophoresis. The second primer pair con- Western blot analysis -sisted of an upstream primer (5؅ CCGGCCATGGAGG CTCCCTTAGT 3؅), containing Hv190SV sequence from To assess the level of CP expression, 106 SF9 cells in nt 498 to nt 519 in which one nucleotide (bold) was in- 6-well tissue culture dishes were infected with high-titer serted to generate a recognition site for NcoI (underlined) recombinant baculovirus [multiplicity of infection (m.o.i.) and a downstream T3 universal primer. The primer pair 20]. Cells were collected at 64 hr postinfection and lysed was used with plasmid pBS1 as a template to prime the by addition of 80 mlof11Laemmli sample buffer. The cell amplification of the cDNA fragment (nt 498–941) by PCR. lysate was denatured at 100Њ for 3 min. Unless otherwise The PCR product was digested with NcoI and SmaI, and stated, samples (3 ml) were electrophoresed in a 7.5% isolated by LMP agarose gel electrophoresis. Plasmid SDS polyacrylamide gel. Western blot analysis was per- pBS2 containing nt 2204–3328 was digested with NdeI, formed by transferring the proteins from the SDS–gel filled in with Klenow fragment, redigested with SpeI, and to Immobilon-P membrane (Millipore) using a Bio-Rad isolated by LMP agarose gel electrophoresis. The frag- electrotransfer unit. The blot was blocked overnight at 4Њ ments SpeI–NcoI (nt 2204–2613) and NcoI–SmaI (nt in TBS (0.9% NaCl, 0.02 M Tris, pH 7.4) containing 5%

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY 132 HUANG ET AL.

FIG. 1. Schematic representation of Hv190SV CP constructs for expression of wild-type and mutant CP in the baculovirus/insect system. (A) Hv190SV genome (5,178 bp) consisting of two large overlapping ORFs: the CP-ORF (nt 290–2608) and the RDRP-ORF (nt 2605–4917). Translation initiation and termination sites are indicated (nucleotide numbering and restriction sites on the ORFs are as given in Huang and Ghabrial, 1996). (B) Wild-type (CP-WT) and mutant CP constructs used for expression in insect cells. Constructs were generated in the baculovirus transfer vector, pVL1393. CP-N71 is a 71-amino acid N-terminal deletion and CP-C132 is a 132-amino acid C-terminal deletion. The CP-F110 construct consists of the full-length CP ORF (in which the CP stop codon at nt 2606–2608 was mutated from TGA to TGG) fused to an internal CP fragment (129 codons, ICP; nt 503–931) /27 codons in frame with wild CP (nt 2685–2765) /TGA (2766–2768). nonfat dry milk. The blot was incubated with either the solution (50 mM Tris, pH 8.0, 150 mM NaCl, and 2% Noni- antiserum to the capsid protein p88 or with the antiserum det P-40) for 30 min. The insect cells were then incubated to the N-terminal CP peptide (diluted 1:1000 in TBS) for for 30 min and 0.5 ml of 0.2 M sodium phosphate buffer, 2 hr at room temperature and washed for 30 min in TBS pH 7.2, were added. One milliliter of the lysis solution was at room temperature with at least three changes of wash. floated onto 4 ml of the CsCl solutions (36% w/w in 0.1 M The membrane was then incubated with 1:1000 dilution sodium phosphate buffer, pH 7.2) and centrifuged for 17 of goat anti-rabbit IgG alkaline phosphatase conjugate hr at 45,000 rpm in a Beckman SW50.1 rotor at 4Њ. The (Sigma) in TBS containing 5% nonfat milk for 1 hr at room centrifuged gradients were fractionated using an ISCO temperature and washed as before. The bound antibody density gradient fractionator and UV analyzer. The frac- was detected using 5-bromo-4-chloro-3-indolyl phos- tions were numbered from top to bottom. The collected phate p-toluidine salt and p-nitro blue tetrazolium (Pro- fractions were diluted with phosphate buffer to a final mega) as substrates. volume of 5 ml and centrifuged at 45,000 rpm in a Beck- man 50Ti rotor for 2 hr at 4Њ. The pellets were resuspended CsCl equilibrium density gradient analysis in 0.2 ml of the phosphate buffer. Following dialysis against the same phosphate buffer, the various CsCl gra- Baculovirus-infected Sf9 cells were harvested (5 1 106 dient fractions were examined by Western blotting using cells in 100-mm2 tissue culture dishes, m.o.i. of 20) at 64 an antiserum against p88 and by electron microscopy for hr postinfection and lysed with addition of 0.5 ml of lysis the presence of virus-like particles.

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY PROTEOLYTIC PROCESSING OF H. VICTORIAE 190S TOTIVIRUS 133

the AUG at position 503, an antiserum to the N-terminal peptide encoded by the sequence from nt 290 to nt 502 was produced in rabbits and used for Western blot analysis. The antiserum to the N-terminal peptide reacted equally well with virion p78, p83, and p88 (Fig. 2A, lane 1) and also with the p78 and p88 expressed in insect cells from the 290–2608 full-length CP ORF (Fig. 2A, lane 2). The N-terminal peptide antiserum, however, did not react with the 78K protein expressed in insect cells from the 503–2608 ORF nested in the CP ORF (Fig. 2A, lane 3). As expected, the capsid p88 antiserum reacted with the 78K polypeptide (Fig. 2B, lane 3), all three virion capsid proteins (Fig. 2B, lane 1), and the p78 and p88 expressed in insect cells from the full-length CP ORF (Fig. 2B, lane 2). These results indicate that the capsid pro- FIG. 2. Western blot analysis of products expressed in recombinant baculovirus-infected Sf9 insect cells. Expression products of the full- teins p88, p83, and p78 have common N-terminal amino length HV190SV CP-ORF construct (nt 290–2608) and an in-frame dele- acid sequences and that initiation of translation from the tion (nt 503–2608) are shown in lanes 2 and 3, respectively. Purified AUG at nt position 503–505 does not occur in vivo. virions (lanes 1) were included as a positive control. The blots were probed with an antiserum to the N-terminal peptide of CP (A) and with The capsid protein p78 is a product of proteolytic an antiserum to purified virions (B). The positions of virion p78, p83, and p88 are indicated to the left. processing To determine whether p78 is derived from p88 via proteolytic processing, we fused a cDNA fragment (nt 503– RESULTS to the 3؅ end of the full-length CP ORF to generate (931 Both capsid proteins p78 and p88 are expressed in a fusion protein of about 110 kDa. If p78 is derived from insect cells When the full-length CP ORF of Hv190SV (from nt 290 to nt 2608, CP-WT, Fig. 1) was expressed in insect cells, both p88 and p78 were produced (Fig. 2, lanes 2). Thus expression of the CP ORF in the eukaryotic baculovirus system differed from that in a prokaryotic system since expression of the CP ORF in bacteria generated only p88 (Huang and Ghabrial, 1996). Because the CP ORF contains, in addition to the initiator AUG at nt position 290–292, an in-frame AUG at nt 503–505, we investigated the possibility that p78 is expressed as a result of initiation of translation at the 503–505 AUG. Synthetic transcripts derived from a cDNA construct containing nt 503–2605, placed under the control of a T7 RNA polymerase promoter, were translated in a rabbit reticulocyte lysates system. The major translation product of the synthetic transcripts had an estimated size of 78 kDa (78K) and comigrated with virion p78 in SDS–polyacrylamide gels (Fig. 3), suggesting that p78 might be produced via an alternative translational event. Similar results were obtained when this cDNA construct was expressed in bacteria (results not shown) or in insect cells (Fig. 2B, lane 3). FIG. 3. Autoradiogram of translation products of synthetic transcripts derived from a cloned cDNA to an in-frame deletion of Hv190SV CP- p78 and p88 have common-N terminal amino acid ORF. cDNA to sequences from nt position 503 to 2608, an in-frame ORF nested within the CP-ORF was cloned in a transcription vector sequence under the control of a T7 polymerase promoter and the in vitro run- off transcripts from two replicate clones were translated in a rabbit If p78 is produced from the AUG at nt 503–505, the reticulocyte lysates system (lanes 1 and 2). Positions of the virion N-termini of p78 and p88 should differ. Thus, to determine capsid proteins p78, p83, and p88 were marked with radioactive ink whether the capsid protein p78 is indeed expressed from (lane 3) and indicated to the right.

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY 134 HUANG ET AL.

in insect cells were similar to those of the empty capsids commonly detected in purified virion preparations (Sand- erlin and Ghabrial, 1978). p78 and p88 were present only in lysates from cells expressing recombinant capsid protein and were not detected in cells infected with wild- type baculovirus.

Assembly of N- and C-terminal CP mutants The N-terminal mutant CP-N71 in which 71 N-terminal amino acids were deleted was highly expressed in insect cells as shown by Western blotting of total lysates using an antiserum to capsid protein p88 (Fig. 4, lane 3). How- ever, no mutant CP was detected throughout the CsCl gradient by Western blotting and no virus-like particles FIG. 4. Western blot analysis of products from baculovirus recombi- were observed with the electron microscope (data not nant expression in Sf9 insect cells. Expression products of full-length Hv190SV CP construct (CP-WT), an N-terminal truncated CP (CP-N71), shown). and a fusion protein consisting of CP fused to an internal CP fragment The C-terminal deletion mutant CP-C132 in which the (CP-F110) are shown in lanes 2, 3, and 4, respectively. Blots were 132 C-terminal amino acids were deleted, on the other probed with an antiserum against capsid protein p88. The positions of hand, retained the ability to assemble, as determined by p88, p83, and p78 from purified virions (lane 1) are indicated to the Western blot analysis of the gradient fractions (Fig. 6B) right. Positions of stained protein standards are indicated to the left. A polypeptide unique to the expression and processing of the fusion and electron microscopy (Fig. 7B). Although the C-termi- protein is indicated with an arrowhead. nal mutant CP was smaller in size than p78, the assembled virus-like particles banded in the CsCl gradients with a peak in fraction 4 and resembled those assembled p88 by proteolytic processing, cleavage of the 110-kDa from the full-length CP. The virus-like particles assem- fusion protein should produce p78 and a polypeptide of bled from the C-terminal truncated CP, however, were about 32 kDa. Analysis of the expression products by fewer in number and swollen (compare Figs. 7A and 7B). Western blotting revealed that, in addition to the 110-kDa fusion protein, a polypeptide comigrating with p78 was DISCUSSION detected (Fig. 4). The second cleavage product was iden- tified as a polypeptide of approximately 32 kDa that re- Previous results of partial peptide mapping of Hv190SV acted with the antiserum to p88 (Fig. 5B), but not with capsid proteins p78, p83, and p88 indicated that they the antiserum against the N-terminal peptide (Fig. 5A). The origin of the band migrating ahead of p78 (arrowhead, Figs. 4 and 5) is unknown; it appears to be unique to expression and processing of the fusion protein since it was not detected when the wild-type CP ORF was expressed (Fig. 4, lane 2).

Assembly of expressed p78 and p88 into virus-like particles Lysates from insect cells infected with recombinant baculovirus containing the full-length Hv190SV CP ORF were subjected to CsCl equilibrium density gradient centrifugation and the gradient fractions were analyzed by Western blot analysis and by electron microscopy. The capsid proteins p78 and p88 were most abundant in FIG. 5. Western blot analysis of products from recombinant baculovirus expressing fusion protein CP-F110 in Sf9 insect cells. Blots of 12.5% fraction 4 of the gradients (Fig. 6A), suggesting that the SDS gels were probed with an antiserum against the N-terminal CP proteins have assembled into virus-like particles. This peptide (A) or with an antiserum to the capsid protein p88 (B). Expres- was confirmed by electron microscopy (Fig. 7A). Empty sion products of the fusion protein CP-F110 construct are shown in capsids present in purified virion preparations that were lanes 2; positions of the fusion protein and putative cleavage products centrifuged in sister tubes banded in fraction 4, whereas of apparent molecular masses of 110, 78, and 32 kDa are indicated to the right. Purified virions (lanes 1) were included as a positive control; the full virions were detected in fraction 6 of the gradients positions of p88 and p78 are indicated to the left. A polypeptide unique (data not shown). Thus, sedimentation properties and to the expression and processing of the fusion protein is indicated with particle morphology of the virus-like particles assembled an arrowhead (see also lane 4, Fig. 4).

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY PROTEOLYTIC PROCESSING OF H. VICTORIAE 190S TOTIVIRUS 135

FIG. 6. Western blot analysis of fractions from CsCl gradients of lysates from recombinant baculovirus-infected insect cells. Gradient fractions are numbered 1 through 8 from the top to bottom of the gradient. (A) Lysates were from Sf9 cells infected with recombinant baculovirus for expression of full-length Hv190SV CP (CP-WT); fractions 1 and 2, like fractions 6–8, were devoid of CP. (B) Lysates were from cells infected with recombinant baculovirus for expression of the C-terminal CP deletion mutant (CP-C132). CP was most abundant in the CsCl fraction corresponding to empty capsids of Hv190SV (fraction 4). The positions of capsid proteins p88, p83, and p78 from purified virions (lane V) are indicated to the left. Blots were probed with an antiserum against capsid protein p88. are closely related polypeptides (Ghabrial et al., 1987). is closer to that of p78 and p83 than to p88 and because Nucleotide sequencing data predict that the CP ORF of p78, unlike p83 and p88, is nonphosphorylated, we have Hv190SV dsRNA (2,319 bp) can encode a protein of 772 previously proposed that p78 is the primary translational amino acid residues with molecular mass of 81.2 kDa product of the CP ORF and that p83 and p88 represent (Huang and Ghabrial, 1996). Because the value of 81 kDa postranslational phosphorylation products of p78 (Gha- brial, 1994; Ghabrial and Havens, 1992). We further spec- ulated that the separation of these three closely related proteins (p78, p83, and p88) in SDS–polyacrylamide gels was due to their differential binding to SDS as a conse- quence of their state of phosphorylation (Ghabrial, 1994). It was recently determined, however, that p88 was the only product expressed in bacteria from the CP ORF (Huang and Ghabrial, 1996). Since bacterially expressed eukaryotic phosphoproteins are not expected to be phosphorylated (assuming autophosphorylation does not occur), these results suggest that p88 is the primary translation product of the CP ORF and that phosphorylation may not influence its electrophoretic mobility in SDS gels. It was of interest to note that the bacterially expressed product of the in-frame ORF (nt positions 503–2608), nested within the CP ORF (nt 290–2608), comigrated with virion p78 in SDS gels because the AUG at nt position 503–505 (GGCAUGG) is in a more favorable context (Ko- zak, 1989) than that of the initiator AUG at nt position 290–292 (UCCAUGU). The expression of the CP ORF from the AUG at position 290–292 has been proposed to occur by an internal initiation mechanism (Huang and Ghabrial, 1996). The possibility that p78 was produced as a result of initiation of translation from the AUG at nt position 503–505, however, was ruled out because virion p78, but not the bacterially expressed product of the FIG. 7. Electron micrographs showing self-assembled capsids of nested ORF, shares a common N-terminal amino acid Hv190SV CP expressed in Sf9 insect cells. Cells were infected with sequence with p88. Furthermore, a protein that is ex- recombinant baculovirus for expression of full-length CP (CP-WT; A) pressed from the AUG starting at nt position 503 is in- and C-terminal truncated CP (CP-C132; B). Virus-like particles were not observed in insect cells infected with recombinants expressing the N- competent for assembly (this study). terminal truncated CP (CP-N71; data not shown). Bar, 50 nm. The finding that the CP N-terminal deletion CP-N71

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY 136 HUANG ET AL. which lacked 71 amino acid residues was incapable of portant in the packaging of the RNA-dependent RNA assembly was not surprising in view of the results of a polymerase (RDRP) and viral genome into Hv190SV cap- similar study with the totivirus LRV1-4 (Cadd et al., 1994). sids as has been reported for some other viruses (Lazin- These authors concluded that the CP amino terminal ski and Taylor, 1993). Although the constructs we used region is important for assembly, but deletion of a few in expressing the CP in insect cells were dicistronic and N-terminal amino acids (6–7 amino acids) were not suffi- contained the RDRP ORF (as an overlapping downstream cient to abolish assembly. That the N-terminal residues ORF), we were not able to detect RDRP in the lysates are more critical for assembly of Hv190SV capsids than nor associated with the gradient-purified empty capsids the C-terminal residues was clearly demonstrated with (data not shown), suggesting that a fungal host factor the C-terminal deletion mutant, CP-C132, which lacked may be required for expression of the downstream ORF. 132 C-terminal amino acid residues but was still compe- We therefore plan to express the CP (or CP mutants tent for assembly. lacking the G/P-rich region) and RDRP ORFs from sepa- Because deletion of C-terminal amino acids from the rate recombinant baculovirus constructs in doubly in- CP of two totiviruses, LRV1-4 and Hv190SV, did not ap- fected insect cell to study the role of the G/P-rich region pear to interfere with its ability to self-assemble (Cadd in packaging of RDRP. et al., 1994, and this study), the possibility that Hv190SV p78 and p83 might be derived by proteolytic cleavage of ACKNOWLEDGMENTS p88 at the C-terminus, possibly at different sites, was We thank Wendy Havens for technical assistance and Ulla Jarlfos investigated. The generation in insect cells of a polypep- for assistance with electron microscopy. This research was supported tide that comigrated with virion p78 from the CP-F110 by a grant from the USDA NRI Competitive Grants Program (Grant fusion protein (full-length CP fused at its C-terminus with 9601228 to S.A.G.) and is published with the approval of the Director an internal CP peptide, Fig. 4), provided strong evidence of Kentucky Agricultural Experiment Station as Journal Article 97- that p78 is a product of proteolytic processing. 12-30. Since p78 is nonphosphorylated while the precursor p88 is phosphorylated, one may deduce that CP phos- REFERENCES phorylation sites reside in the C-terminal polypeptide Cadd, T. L., Macbeth, K., Furlong, D., and Patterson, J. L. (1994). Muta- fragment generated as a result of proteolytic cleavage tional analysis of the capsid protein of Leishmania RNA virus LRV1- of p88. Proteolytic processing of p88 may thus play a 4. J. Virol. 68, 7738–7745. Diamond, M. E., Dowhanick, J. J., Nemeroff, M. E., Pietras, D. F., Tu, C., regulatory role in the life cycle of the virus since it leads and Bruenn, J. A. (1989). Overlapping genes in a yeast double- to CP dephosphorylation and subsequent decrease in stranded RNA virus. J. Virol. 63, 3983–3990. virion transcriptional activity (Ghabrial and Havens, 1992 Ghabrial, S. A. (1994). New developments in fungal virology. Adv. Virus and unpublished). Res. 43, 303–388. At present, there is no indication, from database Ghabrial, S. A., and Havens, W. M. (1992). The Helminthosporium victoriae 190S mycovirus has two forms distinguishable by capsid protein searches, that Hv190SV genome encodes any protease- composition and phosphorylation state. Virology 188, 657–665. like protein. There are examples of cellular proteases Ghabrial, S. A., Bibb, J. A., Price, K. H., Havens, W. M., and Lesnaw, J. A. that are required for maturation cleavage of viral proteins (1987).The capsid polypeptides of the 190S virus of Helminthospor- including those encoded by totiviruses (Krausslich and ium victoriae. J. Gen. Virol. 68, 1791–1800. Wimmer, 1988; Yu et al., 1995). In the case of the totivirus Ghabrial, S. A., Bruenn, J. A., Buck, K. W., Wickner, R. B., Patterson, J. L., Stuart, K. D., Wang, A. L., and Wang, C. C. (1995). Totiviridae. In ‘‘Virus Giardia lambia virus (GLV), the N-terminal 33 amino acid Taxonomy: Sixth Report of the International Committee on Taxonomy residues are removed and that has been reported to be of Viruses’’ (F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Gha- necessary for GLV maturation (Yu et al., 1995). brial, G. P. Martelli, M. A. Mayo, and M. D. Summers, Eds.), pp. 245– As previously reported, expression of the CP ORF in 252. Springer-Verlag, New York. bacteria generated only p88 (Huang and Ghabrial, 1996). Huang, S., and Ghabrial, S. A. (1996). Organization and expression of the double-stranded RNA genome of Helminthosporium victoriae Analysis of recombinant CP in bacterial lysates by CsCl 190S virus, a totivirus infecting a plant pathogenic filamentous fun- density gradient centrifugation and examination of the gus. Proc. Natl. Acad. Sci. USA 93, 12541–12546. gradient fractions by Western blot analysis and by elec- Icho, T., and Wickner, R. B. (1989). The double-stranded RNA ge- tron microscopy revealed that the expressed p88 assem- nome of yeast virus L-A encodes its own putative RNA polymerase bled into empty capsids (data not shown). Since the bac- by fusing two open reading frames. J. Biol. Chem. 264, 6716– 6723. terially expressed p88 is not expected to be phosphory- Kozak, M. (1989). The scanning model for translation: an update. J. Cell lated, one may conclude that neither phosphorylation nor Biol. 108, 229–235. proteolytic processing is required for self-assembly. Krausslich, H.-G., and Wimmer, E. 1988. Viral proteases. Annu. Rev. The C-terminal region of the capsid protein of Hv190S Biochem. 57, 701–754. virus is glycine and proline (G/P) rich, as illustrated by Lazinski, D. W., and Taylor, J. M. (1993). Relating structure to function in the hepatitis delta virus antigen. J. Virol. 67, 2672–2680. the amino acid sequence of the stretch from amino acid Park, C. M., Lopinski, J. D., Masuda, J., Tzeng, T. H., and Bruenn, J. A. positions 700 to 741: 700GGGGNVPLPPAPGAAPPPP- (1996). A second double-stranded RNA virus from yeast. Virology PGPPNGPPAGPPP741. The G/P-rich region may be im- 216, 451–454.

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY PROTEOLYTIC PROCESSING OF H. VICTORIAE 190S TOTIVIRUS 137

Sambrook, J., Fritsch, E., and Maniatis, T. (1989). ‘‘Molecular Cloning: fected with baculovirus recombinants. J. Gen. Virol. 77, 1379– A Laboratory Manual,’’ 2nd ed. Cold Spring Harbor Laboratory Press, 1388. Cold Spring Harbor, NY. Stuart, K. D., Weeks, R., Guilbride, L., and Myler, P. J. (1992). Molecular Sanderlin, R. S., and Ghabrial, S. A. 1978. Physicochemical properties organization of the Leishmania RNA virus LRV1. Proc. Natl. Acad. of two distinct types of virus-like particles from Helminthosporium Sci. USA 89, 8596–8600. victoriae. Virology 87, 142–151. Wang, A. L., Yang, H.-M., Shen, K. A., and Wang, C. C. (1993). Giardia- virus double-stranded RNA genome encodes a capsid polypeptide Scheffter, S., Ro, Y. T., Chung, I. K., and Patterson, J. L. (1995). The and a gag-pol-like fusion protein by a translation frameshift. Proc. complete sequence of Leishmania RNA virus LRV2-1, a virus of an Natl. Acad. Sci. USA 90, 8595–8599. Old World parasite strain. Virology 212, 84–90. Webb, N. R., and Summers, M. D. (1990). Expression of proteins using Scheffter, S., Widmer, G., and Patterson, J. L. (1994). Complete se- recombinant baculovirus. Technique J. Methods Cell Mol. Biol. 2, quence of Leishmania RNA virus 1-4 and identification of conserved 173–188. sequence. Virology 199, 479–483. Yu, D., Wang, C. C., and Wang, A. L. (1995). Maturation of Giardiavirus Soldevila, A. I., and Webb, B. A. (1996). Expression of polydnavirus capsid protein involves posttranslational proteolytic processing by a genes under polydnavirus promoter regulation in insect larvae in- cysteine protease. J. Virol. 69, 2825–2830.

AID VY 8631 / 6a3b$$$361 07-01-97 14:57:26 vira AP: VY