Plant Genomics & Breeding for Health & Nutrition Security Chittaranjan Kole

Total Page:16

File Type:pdf, Size:1020Kb

Load more

1/25/2019 Plant Genomics & Breeding for Health & Nutrition Security Chittaranjan Kole Raja Ramanna Fellow, Govt. of India ICAR-NRCPB, India 1 1/25/2019 Future Research Priority • Harnessing agriculture for Health & Environment A Sweet Story with Bitter Melon as the Model • Popular vegetable ‘food crop’ • Contains anticancer & antidiabetic ‘bioactives’ • Produces large quantity of ‘biomass’ • Grown under ‘organic’ cultivation • Possesses ‘genome elasticity’ • A new crop for step-wise genome elucidation & improvement 2 1/25/2019 Bitter Melon as a Model Phytomedicines in Bitter Melon (31) Momordicosides Plant Insulin Trypsin inhibitors Momordin Family Cucurbitaceae Proteins Rosmarinic Uracil Sc. Name Momordica charantia Multiflorenol acid Rubixanthin Vacine Myristic acid Nerolidol Spinasterol V-Insulin Synonyms Bitter gourd, Balsam pear, Steroidal glycosides Balsam apple, Snap melon Oleanolic acid Stigmasta-diols Verbascoside 2n 2x=22 Oleic acid Stigmasterol Vicine 1C Value 2.05 pg Oxalic acid Taraxerol Trehalose Zeatin Pentadecans Zeatin riboside Mbp 2009 Peptides Zeaxanthin Petroselinic acid Zeinoxanthin Some Ethnomedical Uses Research Documentation on Properties Abortions Gout Menstrual • Anticancerous Hypoglycemic Birth control Hepatitis disorders Hypocholesteromic Burns & wounds Hydrophobia Pneumonia • Antitumorous Constipation Hyperglycemia Psoriasis • Antileukemic Antifertility Rheumatism Dermatitis Impotency Leprosy Immune stimulant Scabies • Antiprotozoal Diabetes Jaundice Abortive Kidney stones Snakebite Diarrhea • Antibacterial Contraceptive Tumor Eczema Liver problems • Antiviral Vaginal discharge Fat loss Malaria Worm Flue Phytomedicines in Bitter Melon (32) Alkaloids Galacturonic acids Lauric acid Charantin Gentisic acid Linoleic acid Linolenic β-Carotene Goyaglycosides acid Charine Goyasaponins Lycopene Cryptoxanthin Guanylate MAP-30 Cucurbitins Gyclase inhibitors Momorcharasides Cucurbitacins Gypsogenin Hydroxytryptamines Momorcharins Cycloartenols Karounidiols Momordenol Diosgenin Momordicilin Elaeostearic acids Lanosterol Momordicins Erythrodiol Momordicinin 3 1/25/2019 1.6 Cucurbitacin-B 1.4 Charantin 1.2 1 0.8 0.6 0.4 0.2 0 Genotype Origin FRWt (g) CCR-B CHR Size Color CHR CHR CCR-B Hyb. Beauty Winner China 74.81 0.70 1.10 E11M47b12 E11M48b9 E11M47b8 E11M50b20 E11M47b1 Hong Kong Green Hong Kong 70.61 0.50 0.90 E11M49b5 E11M48b25 E11M47b14 E11M50b23 E11M49b12 Hyb. Taiwan White Taiwan 63.6 0.40 0.80 Taiwan White Taiwan 146.33 0.35 0.75 E11M51b25 E11M49b6 E11M47b18 E11M50b36 E11M49b25 Hyb. White Pearl Taiwan 82.37 0.55 0.95 E11M51b27 E11M49b14 E11M47b19 E11M50b43 E11M50b43 Hyb. Jumbo Thailand 70.87 0.30 0.70 E12M48b1 E11M49b15 E11M47b25 E11M51b12 E11M51b5 Hyb. Bangkok Large Thailand 78.50 0.55 0.95 E12M48b28 E11M49b25 E11M48b9 E11M51b29 E12M47b6 Hyb. India Star India 74.83 0.40 0.70 E11M50b23 E11M48b14 E12M47b3 E12M49b1 Hyb. India Baby India 4.28 0.45 0.80 Shape E11M50b43 E11M48b19 E12M47b6 Hyb. India Pearl India 72.26 0.40 0.65 India Long Green India 22.64 0.45 0.75 E11M47b12 E12M48b5 E11M48b25 E12M47b10 Hyb. India Green Queen India 25.29 0.45 0.80 E11M51b25 E12M49b10 E11M49b1 E12M48b1 Japan Green Spindle Japan 16.1 0.50 0.90 E11M51b27 E12M51b1 E11M49b5 E12M48b5 Japan Long Japan 78.69 0.45 0.80 E11M49b6 E12M49b1 Small Baby Thailand 3.48 0.65 0.95 Surface Luster E11M49b12 E12M49b20 Hyb. Baby Doll Thailand 5.1 0.35 0.7 E11M47b12 E12M49b10 E11M49b15 E12M51b1 CBM10 USA 4.9 1.00 1.35 E11M49b4 E12M51b1 E11M49b17 E12M51b6 CBM12 USA 3.84 0.70 1.10 E11M50b6 E11M49b25 E12M51b10 CBM18 USA 5.89 0.750 1.10 E12M49b16 E11M50b18 E12M51b12 Publication number US20120079618 A1 Publication type Application Application number US 13/179,952 Publication date Mar 29, 2012 Filing date Jul 11, 2011 Priority date Jul 16, 2010 Inventors Chittaranjan Kole, Phullara Kole, Bode A. Olukolu, Albert G. Abbott Original Assignee Clemson University Export Citation BiBTeX, EndNote, RefMan Referenced by (1), Classifications (10), Legal Events (2) External Links: USPTO, USPTO Assignment, Espacenet 4 1/25/2019 Improvement (%) over Inferior Parents CBMH12 Cucurbitacin-B 180.77 Lycopene 77.27 β-Carotene 192.31 Charantin 27.00 Insulin 160.87 Fruit Weight 1836.00 Dual-Purpose Hybrid: CBM12 Performance of the DPV SNP Development • Genome reduction followed by 454 pyrosequencing CCR LYC CAR CHR PLIN FRWT TW 0.13 0.01 0.13 5.99 0.12 146.3 • 5,190 SNPs CBM12 0.44 0.05 1.83 7.88 0.26 3.84 CBMH12 0.37 0.02 0.38 7.60 0.30 74.36 • 2,519 contigs • Coverage: 19.74× • 785 SSRs 5 1/25/2019 Fluidigm SNP Platform Take-Home Messages Wild allied species are Wild genetic Wild genetic wealthy reservoir of backgrounds provide backgrounds provide useful donor genes genome elasticity genomic heterosis Augmentation of food, Cloning of Association mapping feedstock & phytomedicinal genes could provides genetic therapeutic SMs could facilitate handles for fast-track towards multipurpose biopharming & breeding crop cisgenics Whole genome sequencing could facilitate precise breeding for designed crop Insulin Gene Cloning Changes (%) in Content of Phytomedicines AGCCTTTGTGAACCAACACCTTACGGCACGAGCTGACGACAGCCAT Cucurbitacin-B Lycopene Charantin Insulin GCACCACCTGTGTCCGCGTTCCCGAAGGCACCCCTCTCTTTCAAGA GGATTCGCGGCATGTCAAGCCCTGGTAAGGTTCTTCGCTTTGCATC GAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTC C1 -15.79 -36.36 -20.58 31.82 CTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAA CGCGTTAGCTACAGCACTGCACGGGTCGATACGCACAGCGCCTAGT C2 5.26 0.00 8.22 9.09 ATCCATCGTTTACGGCTAGGACTACTGGGGTATCTAATCCCATTCGC TCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTG CTTTCGCCGTTGGTGTTCTTTCCGATCTCTACGCATTTCACCGCTCC C3 -26.32 -9.09 -29.79 63.64 ACCGGAAATTCCATCTGCTCCCTCTACCAGC C4 73.68 9.09 -33.00 90.91 C5 5.26 81.82 -30.64 45.45 6 1/25/2019 Nanotechnology towards Crop of the Future Food Security Nutrition Energy Security Security Environment Security I dedicate my talk to: Dr. Norman Borlaug & The Farming Community of the World! 7 1/25/2019 Nanotechnology towards Crop of the Future Food Security Nutrition Energy Security Security Environment Security Acknowledgements to My Colleagues at USA Correlation inter se End Products • Phullara Kole • Dr. Virendra Rao • Dr. Bode Olukolu • Dr. Anju Bajpai BM CCRB LYC CHR INS WC • Prof. Albert G. Abbott • Dr. Backiyarani Fruit Yield 0.031 0.100 0.351 0.417 -0.096 -0.108 • Prof. Richard K. Marcus Suthanthiram Biomass Yield -0.033 0.146 -0.676 0.784 0.783 • Dr. Pu-Chun Ke • Dr. Jogendra Singh Cucurbit-acin- 0.230 0.205 0.522 -0.540 • Dr. R. Elanchezian • Prof. Apparao M. Rao B • K. Manoj Randunu • Prof. Peter J Maughan of Lycopene -0.370 0.146 -0.279 Brigham Young University • Poonam Choudhary Charantin -0.413 -0.583 • • Ramakrishna Podila And Several UG & Insulin 0.311 Research students • Dr. Samuel D. Forrest Marker-Trait Association • # of associated markers: Size: 6, shape: 3, surface: 4, Color: 11, luster: 2, CHR: 34, CCR-B: 7 • 2 markers linked to luster also linked to color • 3 markers linked to shape also linked to size • 5 markers common for CHR and CCR-B • 2 common markers for CCR-B & CHR also linked to color • CHR and color shared another 7 markers 8 1/25/2019 Population Structure Characterization of Fullerol • 4 Sub-populations with fixation indices of Sample 0.785, 0.663, 0.542 & 0.582 0 C0 C1 C2 C3 C4 C5 -10 -20 • Each sub-population includes both charantia & -30 muricata genotypes -40 -50 Zeta potential (mV) potentialZeta • No correlation between population structure & -60 geographical origin -70 Trait LG SI (cM) LOD R2 (%) A D Fruit length 2 365-380 3.53 4.84 - 0.85 R2 = 13.4 ± 5.3 % LOD = 6.90 7 190-230 3.02 10.21 -0.47 - Fruit Diameter R2 = 12.9 ± 6.1 % 1 5-35 4.35 12.88 -0.60 - LOD = 7.73 Fruit Weight R2 = 11.1 ± 4.9 % 1 0-35 3.73 11.11 -0.56 - LOD = 6.88 1 100-140 6.84 4.75 - -0.86 1 555-580 7.52 6.77 0.48 - Fruit Number 2 R = 39.7 ± 6.3 % 2 190-210 6.99 7.51 - -1.39 LOD = 16.05 -0.84 5 30-55 6.47 6.44 - 1 160-185 6.06 7.38 - -1.24 Fruit Yield 1 550-580 4.50 6.47 - 0.76 R2 = 38.1 ± 6.3 % LOD = 15.19 2 190-210 8.12 15.32 - -1.99 3 330-350 3.32 4.42 - 0.87 Characterization of Fullerol Accumulation of Fullerol in Petiole C0 C3 C5 9 1/25/2019 Clustered regularly FTIR Data Showing Fullerol Signatures interspaced short palindromic repeats (CRISPRs) and CRISPR- associated (Cas) proteins CRISPR/Cas9 System 58 To: [email protected] What is it? Subject: Bitter Melon Kristopher & Gina Legge [[email protected]] Dear Sir, My 17 year old son is a diabetic but continues to be active in church 4-H Teen CERT as well as other programs thanks to your great works on bitter melon. This week my family started a Youth Diabetes Wellness group for Beaufort County, SC. I would greatly appreciate advise derived from a natural process found in on where we can obtain seeds for this melon and any additional information you can offer. bacteria to protect themselves from Thank you for your time and service to others. I hope your endeavor to research this topic reaps many benefits. pathogens V/R targets genes for editing and regulating Kris Finally, brethren, whatever things are true, whatever things are noble, whatever things are comparable to Photoshop just, whatever things are pure, whatever things are lovely, whatever things are of good report, if there is any virture and if there is anything praiseworthy--meditate on these things. Phillipians 4:8 Horizon Licenses Harvard University Gene-Editing Technology. (2013). Drug Discovery & 59 Development. METHODS for GENOME EDITING To initiate gene modification, Finger nucleases RNA interference Transcription activator-like effector nucleases
Recommended publications
  • The Use of Plants in the Traditional Management of Diabetes in Nigeria: Pharmacological and Toxicological Considerations

    The Use of Plants in the Traditional Management of Diabetes in Nigeria: Pharmacological and Toxicological Considerations

    Journal of Ethnopharmacology 155 (2014) 857–924 Contents lists available at ScienceDirect Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep Review The use of plants in the traditional management of diabetes in Nigeria: Pharmacological and toxicological considerations Udoamaka F. Ezuruike n, Jose M. Prieto 1 Center for Pharmacognosy and Phytotherapy, Department of Pharmaceutical and Biological Chemistry, School of Pharmacy, University College London, 29-39 Brunswick Square, WC1N 1AX London, United Kingdom article info abstract Article history: Ethnopharmacological relevance: The prevalence of diabetes is on a steady increase worldwide and it is Received 15 November 2013 now identified as one of the main threats to human health in the 21st century. In Nigeria, the use of Received in revised form herbal medicine alone or alongside prescription drugs for its management is quite common. We hereby 26 May 2014 carry out a review of medicinal plants traditionally used for diabetes management in Nigeria. Based on Accepted 26 May 2014 the available evidence on the species' pharmacology and safety, we highlight ways in which their Available online 12 June 2014 therapeutic potential can be properly harnessed for possible integration into the country's healthcare Keywords: system. Diabetes Materials and methods: Ethnobotanical information was obtained from a literature search of electronic Nigeria databases such as Google Scholar, Pubmed and Scopus up to 2013 for publications on medicinal plants Ethnopharmacology used in diabetes management, in which the place of use and/or sample collection was identified as Herb–drug interactions Nigeria. ‘Diabetes’ and ‘Nigeria’ were used as keywords for the primary searches; and then ‘Plant name – WHO Traditional Medicine Strategy accepted or synonyms’, ‘Constituents’, ‘Drug interaction’ and/or ‘Toxicity’ for the secondary searches.
  • A Review on Biological Attributes of Momordica Charantia

    A Review on Biological Attributes of Momordica Charantia

    Advances in Bioscience and Bioengineering 2021; 9(1): 8-12 http://www.sciencepublishinggroup.com/j/abb doi: 10.11648/j.abb.20210901.12 ISSN: 2330-4154 (Print); ISSN: 2330-4162 (Online) Review Article A Review on Biological Attributes of Momordica charantia Zermina Khalid 1, Syeda Mona Hassan 1, Shahzad Sharif Mughal 1, *, Syed Khurram Hassan 2, Huma Hassan 3 1Department of Chemistry, Lahore Garrison University, Lahore, Pakistan 2Institute of Quality and Technology Management, University of the Punjab, Lahore, Pakistan 3Department of Chemical Engineering, NFC Institute of Engineering and Fertilizer Research, Faisalabad, Pakistan Email address: *Corresponding author To cite this article: Zermina Khalid, Syeda Mona Hassan, Shahzad Sharif Mughal, Syed Khurram Hassan, Huma Hassan. A Review on Biological Attributes of Momordica charantia . Advances in Bioscience and Bioengineering. Vol. 9, No. 1, 2021, pp. 8-12. doi: 10.11648/j.abb.20210901.12 Received : June 22, 2020; Accepted : November 2, 2020; Published : March 26, 2021 Abstract: Momordica charantia is an herbal climber grown in tropical and subtropical regions, belonging to the Cucurbitaceae family. M. charantia can be used as remedyagainst various diseases from ancient time. It has been used in various Asian traditional medicines for the treatment of cholera, bronchitis, anemia, blood diseases, ulcer, diarrhea, dysentery, gonorrhea rheumatism, gout, worms, colic, disease of liver and spleen, cancer and diabetes etc. The main constituents of M. charantia are triterpene, protein, steroid, alkaloid, inorganic, lipid, and phenolic compounds, which are responsible for biological and pharmacological activities including anti-diabetic, anti-cancerous and anti-tumorous, anti-microbial, anti-viral, anti-helmintic, antimalarial, anti-ulcerative and immunomodulatory.
  • International Journal of Ayurveda and Pharma Research

    International Journal of Ayurveda and Pharma Research

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by International Journal of Ayurveda and Pharma Research ISSN: 2322 - 0902 (P) ISSN: 2322 - 0910 (O) International Journal of Ayurveda and Pharma Research Review Article A REVIEW OF HYPOGLYCEMIC EFFECT OF MOMORDICA CHARANTIA W.S.R. TO MADHUMEH Bhageshwary Janagal1*, Chandan Singh2, Rajendra Prasad Purvia3, Manoj Adlakha3 *1MD Scholar, 2H.O.D.,3Assistant Professor, Dept. of Dravyaguna, Dr.S.R. RAU, Jodhpur, India. ABSTRACT Diabetes mellitus is a group of metabolic diseases characterized by hyperglycemia resulting from defects in insulin secretion, insulin action, or both processes are involved in the development of diabetes. Diabetes is also known as Madhumeha in Ayurveda. Diabetes Mellitus has become a global problem in spite of advances in modern science. Ancient science of Ayurveda has discussed diabetes at length thousands of years ago. Number of diabetic patients are increasing in very high range. Year by year, its growing speed is very fast. In Ayurveda there are many ways to prevent diabetes mellitus and to cure its complications. Ayurvedic medications and management is very helpful and very effective in specially for diabetes. In this paper, trying to explain the hypoglycemic effect of Momordica (Karela) in diabetes mellitus (Madhumeh). Karela is specifically used as a folk medicine for diabetes. Several researches proved that it contains a hypoglycaemic or insulin-like principle, designated as 'plant-insulin', which has been found highly beneficial in lowering the blood and urine sugar levels. KEYWORDS: Karela, Momordica Charantia, Diabetes mellitus, Madhumeh, Ayurveda. INTRODUCTION Diabetes mellitus is considered as one of the Sedentary habits, consumes food and drinks which five leading causes of death in the world.
  • Momordica Charantia) Fruits As Ecofriendly Corrosion Inhibitor for Mild Steel in 1 M Hcl Solution

    Momordica Charantia) Fruits As Ecofriendly Corrosion Inhibitor for Mild Steel in 1 M Hcl Solution

    Int. J. Electrochem. Sci., 14 (2019) 6814 – 6825, doi: 10.20964/2019.07.75 International Journal of ELECTROCHEMICAL SCIENCE www.electrochemsci.org Electrochemical Studies of Bitter Gourd (Momordica charantia) fruits as Ecofriendly Corrosion Inhibitor for Mild Steel in 1 M HCl Solution Aijuan Zhao1, Haijie Sun1,*, Lingxia Chen1, Yufang Huang1, Xingjie Lu2,*, Bing Mu1, Hairong Gao1, Shaoqing Wang1, Ambrish Singh3 1 Institute of Environmental and Catalytic Engineering, College of Chemistry and Chemical Engineering, Zhengzhou Normal University, Zhengzhou 450044, Henan, China. 2 Henan Institute of Metrology, Zhengzhou-450000, Henan, China. 3 School of Materials Science and Engineering, Southwest Petroleum University, Chengdu, Sichuan 610500, China. *E-mail: [email protected], [email protected] Received: 9 March 2019 / Accepted: 22 April 2019 / Published: 10 June 2019 Fruits extract of Momordica charantia (MCFE) was characterized using gas chromatography (GC), and mass spectrometry (MS) methods. The influence of MCFE on corrosion of mild steel in 1M HCl solution was evaluated using static electrochemical methods. Electrochemical Impedance Spectroscopy (EIS) and polarization studies were performed to derive the kinetic mechanism taking place at the electrodes. Micro-electrochemical tests were performed using scanning electrochemical microscopy (SECM) technique. The surface was further examined by scanning electron microscope (SEM). The EIS results suggested that the increase in the concentration of MCFE increased the inhibition efficiency. Polarization statistics pointed towards the changes in the anodic and cathodic kinetics, but overall shift of –Ecorr was less than 85 mV suggesting the MCFE inhibitor belongs to mixed type category. SEM studies revealed that the surface of the mild steel was quite unaffected with MCFE film on it in 1M HCl solution.
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0271923 A1 Reid (43) Pub

    (12) Patent Application Publication (10) Pub. No.: US 2014/0271923 A1 Reid (43) Pub

    US 20140271923A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0271923 A1 Reid (43) Pub. Date: Sep. 18, 2014 (54) COMPOSITIONS & FORMULATIONS FOR (52) U.S. Cl. PREVENTING AND TREATING CHRONIC CPC ............. A6 IK3I/122 (2013.01); A61 K38/063 DISEASES THAT CLUSTER IN PATIENTS (2013.01); A61 K3I/496 (2013.01); A61 K SUCH AS CARDIOVASCULAR DISEASE, 45/06 (2013.01); A61 K31/4164 (2013.01); DLABETES, OBESITY, POLYCYSTIC OVARY A61K 31/12 (2013.01); A61 K3I/375 SYNDROME, HYPERLIPIDEMIA AND (2013.01); A61 K3I/355 (2013.01) HYPERTENSION, ASWELLAS FOR USPC ..... 424/651: 514/690: 514/21.9; 514/254.07; PREVENTING AND TREATING OTHER 514/383: 514/365: 514/256; 514/398: DISEASES AND CONDITIONS 514/236.2: 514/314: 514/154: 514/311; 514/31; 514/77; 514/39; 514/275; 514/253.08 (71) Applicant: Christopher Brian Reid, Los Angeles, CA (US) (57) ABSTRACT Patients inflicted with various clustering chronic diseases (72) Inventor: Christopher Brian Reid, Los Angeles, require treatment with multiple drugs having distinct mecha CA (US) nisms of action. Accordingly, patients with multiple condi tions suffer from cumulative side effects of multiple drugs as (21) Appl. No.: 13/815,664 well as drug-drug interactions. Embodiments, agents, com pounds or drugs of the present invention, such as sesquiter (22) Filed: Mar 14, 2013 penes, e.g., Zerumbone, replace an equal or larger number of approved drugs during patient treatment. Examples of disor Publication Classification ders prevented or ameliorated by administration of the for mulations of this invention include but are not limited to (51) Int.
  • Global Collaboration for Addressing Global Climate Change

    Global Collaboration for Addressing Global Climate Change

    1/25/2019 Global Collaboration for Addressing Global Climate Change Chittaranjan Kole Raja Ramanna Fellow, Govt. of India ICAR-NRCPB, India 1 1/25/2019 Climate Change • Temp increased by 0.2-0.3°C during 1980 to 2000 • Temp to increase by 4°C by 2100 • Extreme temps, drought, flooding, salinity, input non-bioavailability, biotic stresses, GHG emission ……. • Expected reduction of yield of cereals: 10-15% 2 1/25/2019 Future Research Priorities • Genome designing for Climate Smart Agriculture • Harnessing agriculture for Health & Environment A Sweet Story with Bitter Melon as the Model • Popular vegetable ‘food crop’ • Contains anticancer & antidiabetic ‘bioactives’ • Produces large quantity of ‘biomass’ • Grown under ‘organic’ cultivation • Possesses ‘genome elasticity’ • A new crop for step-wise genome elucidation & improvement “Chitta, …. You should also do some works that will benefit people immediately.” New Crop - New Trait - New Strategy 3 1/25/2019 Phytomedicines in Bitter Melon (32) Alkaloids Galacturonic acids Lauric acid Charantin Gentisic acid Linoleic acid Linolenic β-Carotene Goyaglycosides acid Charine Goyasaponins Lycopene Cryptoxanthin Guanylate MAP-30 Cucurbitins Gyclase inhibitors Momorcharasides Cucurbitacins Gypsogenin Hydroxytryptamines Momorcharins Cycloartenols Karounidiols Momordenol Diosgenin Momordicilin Elaeostearic acids Lanosterol Momordicins Erythrodiol Momordicinin Bitter Melon as a Model Phytomedicines in Bitter Melon (31) Momordicosides Plant Insulin Trypsin inhibitors Momordin Family Cucurbitaceae Proteins
  • (12) Patent Application Publication (10) Pub. No.: US 2007/014818.6 A1 Ketzis (43) Pub

    (12) Patent Application Publication (10) Pub. No.: US 2007/014818.6 A1 Ketzis (43) Pub

    US 200701 481 86A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/014818.6 A1 Ketzis (43) Pub. Date: Jun. 28, 2007 (54) SIMAROUBA AMARA AND/OR (52) U.S. Cl. ........................................................ 424/195.11 MOMORDICA CHARANTIA EXTRACTS FOR THE TREATMENT OF COCCDIOSIS IN (57) ABSTRACT POULTRY Described is the use of a coccidiostatically effective amount (76) Inventor: Jennifer Ketzis, Ballina (IE) of Simarouba amara either alone or in combination with Momordica charantia for the manufacture of a medicament Correspondence Address: for the therapy of coccidiosis in poultry. Further described is NOVARTS a method for controlling coccidiosis in poultry based on the CORPORATE INTELLECTUAL PROPERTY administering of said medicament. Described is also a ONE HEALTH PLAZA 104/3 poultry feed supplement or medicated poultry feed for the EAST HANOVER, NJ 07936-1080 (US) control of coccidiosis in poultry that comprises besides ground dry vegetable- and/or animal-based poultry feed, (21) Appl. No.: 10/586,419 with or without additives such as proteins, vitamins and minerals, and a coccidiostatically effective amount of Sima (22) PCT Filed: Feb. 2, 2005 rouba amara dried bark or an extract thereof either alone or in combination with Momordica charantia fruit extract. Also (86). PCT No.: PCT/EP05/O1041 described is the production of said medicament and to the use of said active ingredients as an additive to dry or wet S 371(c)(1), poultry food or drinking water for the prophylactic or (2), (4) Date: Jul. 19, 2006 curative treatment of coccidial infections in poultry. Another (30) Foreign Application Priority Data described embodiment relates to the management for pre venting the development of resistant Eimeria strains that Feb.
  • Momordica Charantia Linn. (Karela): Nature's Silent Healer

    Momordica Charantia Linn. (Karela): Nature's Silent Healer

    Volume 11, Issue 1, November – December 2011; Article-007 ISSN 0976 – 044X Review Article MOMORDICA CHARANTIA LINN. (KARELA): NATURE’S SILENT HEALER Madhu Gupta, Sushil Sharma, Ajay K. Gautam and Rekha Bhadauria* School of Studies in Botany, Jiwaji University Gwalior (M.P.) 474011, India. Accepted on: 21-07-2011; Finalized on: 20-10-2011. ABSTRACT Momordica charantia Linn. (karela) is an herbal climber grown in tropical and subtropical regions, belonging to the Cucurbitaceae family. Momordica charantia (Karela) have provided many remedies for various diseases from ancient days to now a day. It has been used in various Asian traditional medicines for the treatment of cholera, bronchitis, anemia, blood diseases, ulcer, diarrhea, dysentery, gonorrhea rheumatism, gout, worms, colic, disease of liver and spleen, cancer and diabetes etc. The main constituents of Karela are triterpene, protein, steroid, alkaloid, inorganic, lipid, and phenolic compounds, which are responsible for biological and pharmacological activities including anti-diabetic, anti-cancerous and anti-tumorous, anti-microbial, anti-viral, anti-helmintic, anti- malarial, anti-ulcerative and immunomodulatory. Combination of its Ayuervedic properties i.e. Gunna, Rasa and Virya (Dry, pungent, light, bitter and hot) makes it the real natures wonder. In this article, general description, traditional uses and medicinal properties of Momordica charantia Linn (Karela) have been reviewed. Keywords: Momordica charantia Linn. (karela), general description, medicinal properties. INTRODUCTION Cultivation Momordica charantia Linn. (Karela) commonly known as Karela is an annual or perennial climber found throughout Bitter melon or Bitter gourd is tropical and subtropical India and also cultivated up to an altitude of 1500m. It is climber of the family Cucurbitaceae.
  • Synthesis Calix[4]Resorcinarene from Cassia Oil

    Synthesis Calix[4]Resorcinarene from Cassia Oil

    Prosiding Seminar Kimia Bersama UKM-ITB VIII 9-11 Jun 2009 ANTIHYPERGLICEMIC EFFECT OF FLESHED AND SEEDED EXTRACT OF MOMORDICA CHARANTIA SITI AISYAH1*, HAYAT SHOLIHIN1, IQBAL MUSTHAPA1, ATUN QOWIYAH2 1Department of Chemistry Education, Faculty of Mathematics and Natural Sciences, Indonesia University of Education, Jl. Setiabudi 229 Bandung 2 Faculty of Pharmacy, University of Garut, Jl. Jati 42 Tarogong Garut *email: [email protected] ABSTRACT The research is conducted in order to discover active fraction toward the reduction of blood glucose (antihyperglicemic) from fleshed and seed of Momordica charantia or pare. Extraction is carried out using methanol solvent proceeded with fractionation using organic solvent such as hexane, ethyl acetate, and n-butanol. Entire extracts and fractions are examined to obtain the information of blood glucose intensity reduction activities and the major compound group characteristics with Liebermann- Burchad methods and FT-IR spectroscopy. Based on the glucose tolerance test with in vivo way on Wistar rats it is discovered that hexane fraction of the fleshed is the most active and the fraction insertion causes the mouse with lower blood glucose intensity differs significantly from the positive control. Based on the characteristic test with color method Lieberman-Burchad and spectroscopy IR, active fraction hexane is presumed to contain the major compound such as unglycosides terpenes. Keywords : antihyperglicemic, Momorica charantia, glucose tolerance test. INTRODUCTION Diabetes mellitus is the commonest endocrine disorder attacking more than 4% of people around the world. World Health Organization (WHO) assume that the disease will affect five times more people in th world (Grover, J.K., et al. 2002). The disease is indicated by the increase of blood glucose intensity.
  • New Aliphatic Alcohols from Seeds of Momordica Charantia Linn. and Prediction of Their Biological Activity

    New Aliphatic Alcohols from Seeds of Momordica Charantia Linn. and Prediction of Their Biological Activity

    Available online at www.derpharmachemica.com ISSN 0975-413X Der Pharma Chemica, 2018, 10(10): 1-25 CODEN (USA): PCHHAX (http://www.derpharmachemica.com/archive.html) New Aliphatic Alcohols from Seeds of Momordica charantia Linn. and Prediction of their Biological Activity Deepti Katiyar1*, Vijender Singh2, Mohammed Ali3 1Department of Pharmacognosy, KIET School of Pharmacy, Ghaziabad, UP, India 2School of Pharmacy, Sharda University, Greater Noida, UP, India 3Department of Pharmacognosy and Phytochemistry, Faculty of Pharmacy, Jamia Hamdard, New Delhi, India ABSTRACT Momordica charantia is a very well-known traditional medicinal herb. The current research investigation aimed towards the isolation, characterization and prediction of biological activity spectra of the phytoconstituents from the seeds of Momordica charantia Linn. (Cucurbitaceae). The Ethanolic extract of Momordica charantia seeds led to isolate two new aliphatic alcohols: n-nonatriacontan-19α-ol &n- henetetracontan-19α-ol and four known compounds: n-tetracosane, n-pentacosane, n-pentatriacontane, n-heptatriacontan-15α-ol. These isolated phytomolecules can act as the marker compounds in order to establish the identity, quality and purity of the drug. The observations of the in silico profiling of these compounds shall be very useful for the upcoming reaearchers for establishing them as pharmacologically active moieties. Keywords: n-nonatriacontan-19α-ol, n-henetetracontan-19α-ol, n-tetracosane, n-pentacosane, n-pentatriacontane, n-heptatriacontan-15α-ol. INTRODUCTION Momordica charantia Linn. (Family: Cucurbitaceae) is commonly known as karela in hindi; bitter gourd, bitter cucumber, bitter melon or balsam pear in English and karavella in Sanskrit [1]. It is a monoecious annual climber which grows upto 5 m in height cultivated in East Africa, South America, China, Malaya and India upto an altitude of 1500 m and it also grows wildely in tropical and sub-tropical Africa, Asia, America and Caribbean [2].
  • Research Paper Investigation of Antimicrobial Activity and Chemical

    Research Paper Investigation of Antimicrobial Activity and Chemical

    Academia Journal of Medicinal Plants 6(7): 163-167, July 2018 DOI: 10.15413/ajmp.2018.0134 ISSN 2315-7720 ©2018 Academia Publishing Research Paper Investigation of antimicrobial activity and chemical constituents of Momordica charantia L. var. abbreviata Ser Accepted 17th July, 2018 ABSTRACT The antimicrobial potential of the four extracts of Momordica charantia L. var. abbreviata Ser., including n-hexane, chloroform, ethyl acetate and methanol- water 80:20 (v/v) extracts was screened against four bacterial and four fungal Nguyen PD.1, Vo MD.1, Luong HVT.1, Phan strains, using microbroth dilution assay. The chloroform extract showed the TTH.2 and Nguyen TTT.3* highest growth inhibitory activity with MIC = 200 μg/ml on both Escherichia coli and Bacillus subtillis and MIC = 100 μg/ml on Aspergillus niger. Phytochemical 1Faculty of Education, Can Tho University, Can Tho, Vietnam. study on the bioactive chloroform extract led to the isolation of four known 2Faculty of Science, Mien Tay compounds as octadecan-1-ol (1), (23E)-5β, 19-epoxycucurbita-6, 23, 25-trien- Construction University, Vinh Long, 3β-ol (2), 5α-poriferasta-7,25-dien-3β-ol (3) and 3-O-(6′-O-palmitoyl-β-D- Vietnam. glucopyranosyl)-clerosterol (4). Their structures were elucidated by 3Faculty of Science, Can Tho University of Medicine and Pharmacy, Can Tho, spectroscopic methods including 1D and 2D-NMR, MS and in comparison with Vietnam. literature data. Here, such metabolites were reported for the first time in M. charantia L. var. abbreviata Ser. *Corresponding author. E-mail: [email protected]. Tel: (+84)919886682. Key words: Antibacterial, antifungal, clerosterol, Cucurbitaceae, Momordica charantia.
  • Simarouba Amara And/Or Momordica Charantia Extracts for the Treatment of Coccidiosis in Poultry

    Simarouba Amara And/Or Momordica Charantia Extracts for the Treatment of Coccidiosis in Poultry

    Europäisches Patentamt *EP001563842A1* (19) European Patent Office Office européen des brevets (11) EP 1 563 842 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.7: A61K 35/78, A61P 1/00 17.08.2005 Bulletin 2005/33 (21) Application number: 04002296.4 (22) Date of filing: 03.02.2004 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HU IE IT LI LU MC NL PT RO SE SI SK TR Designated Extension States: (74) Representative: Gros, Florent et al AL LT LV MK Novartis AG, Corporate Intellectual Property (71) Applicant: Novartis AG 4002 Basel (CH) 4056 Basel (CH) (54) Simarouba amara and/or Momordica charantia extracts for the treatment of coccidiosis in poultry (57) Described is the use of natural ingredients Si- ural ingredients or said veterinary compositions to poul- marouba amara dried bark or an extract thereof and low try, and the use of said natural ingredients for the prep- concentrations of Momordica charantia fruit extract ei- aration of these veterinary compositions or for treating ther alone or in combination with each other in the re- coccidial infections in poultry. The invention also com- sistance management and control of coccidiosis in poul- prises the use of said natural ingredients as an additive try. It further relates to veterinary compositions contain- to dry or wet poultry food or drinking water for the pro- ing said natural ingredients, the preparation of these vet- phylactic or curative treatment of coccidial infections in erinary compositions, a method of controlling coccidio- poultry.