1/25/2019 Plant Genomics & Breeding for Health & Nutrition Security Chittaranjan Kole Raja Ramanna Fellow, Govt. of India ICAR-NRCPB, India 1 1/25/2019 Future Research Priority • Harnessing agriculture for Health & Environment A Sweet Story with Bitter Melon as the Model • Popular vegetable ‘food crop’ • Contains anticancer & antidiabetic ‘bioactives’ • Produces large quantity of ‘biomass’ • Grown under ‘organic’ cultivation • Possesses ‘genome elasticity’ • A new crop for step-wise genome elucidation & improvement 2 1/25/2019 Bitter Melon as a Model Phytomedicines in Bitter Melon (31) Momordicosides Plant Insulin Trypsin inhibitors Momordin Family Cucurbitaceae Proteins Rosmarinic Uracil Sc. Name Momordica charantia Multiflorenol acid Rubixanthin Vacine Myristic acid Nerolidol Spinasterol V-Insulin Synonyms Bitter gourd, Balsam pear, Steroidal glycosides Balsam apple, Snap melon Oleanolic acid Stigmasta-diols Verbascoside 2n 2x=22 Oleic acid Stigmasterol Vicine 1C Value 2.05 pg Oxalic acid Taraxerol Trehalose Zeatin Pentadecans Zeatin riboside Mbp 2009 Peptides Zeaxanthin Petroselinic acid Zeinoxanthin Some Ethnomedical Uses Research Documentation on Properties Abortions Gout Menstrual • Anticancerous Hypoglycemic Birth control Hepatitis disorders Hypocholesteromic Burns & wounds Hydrophobia Pneumonia • Antitumorous Constipation Hyperglycemia Psoriasis • Antileukemic Antifertility Rheumatism Dermatitis Impotency Leprosy Immune stimulant Scabies • Antiprotozoal Diabetes Jaundice Abortive Kidney stones Snakebite Diarrhea • Antibacterial Contraceptive Tumor Eczema Liver problems • Antiviral Vaginal discharge Fat loss Malaria Worm Flue Phytomedicines in Bitter Melon (32) Alkaloids Galacturonic acids Lauric acid Charantin Gentisic acid Linoleic acid Linolenic β-Carotene Goyaglycosides acid Charine Goyasaponins Lycopene Cryptoxanthin Guanylate MAP-30 Cucurbitins Gyclase inhibitors Momorcharasides Cucurbitacins Gypsogenin Hydroxytryptamines Momorcharins Cycloartenols Karounidiols Momordenol Diosgenin Momordicilin Elaeostearic acids Lanosterol Momordicins Erythrodiol Momordicinin 3 1/25/2019 1.6 Cucurbitacin-B 1.4 Charantin 1.2 1 0.8 0.6 0.4 0.2 0 Genotype Origin FRWt (g) CCR-B CHR Size Color CHR CHR CCR-B Hyb. Beauty Winner China 74.81 0.70 1.10 E11M47b12 E11M48b9 E11M47b8 E11M50b20 E11M47b1 Hong Kong Green Hong Kong 70.61 0.50 0.90 E11M49b5 E11M48b25 E11M47b14 E11M50b23 E11M49b12 Hyb. Taiwan White Taiwan 63.6 0.40 0.80 Taiwan White Taiwan 146.33 0.35 0.75 E11M51b25 E11M49b6 E11M47b18 E11M50b36 E11M49b25 Hyb. White Pearl Taiwan 82.37 0.55 0.95 E11M51b27 E11M49b14 E11M47b19 E11M50b43 E11M50b43 Hyb. Jumbo Thailand 70.87 0.30 0.70 E12M48b1 E11M49b15 E11M47b25 E11M51b12 E11M51b5 Hyb. Bangkok Large Thailand 78.50 0.55 0.95 E12M48b28 E11M49b25 E11M48b9 E11M51b29 E12M47b6 Hyb. India Star India 74.83 0.40 0.70 E11M50b23 E11M48b14 E12M47b3 E12M49b1 Hyb. India Baby India 4.28 0.45 0.80 Shape E11M50b43 E11M48b19 E12M47b6 Hyb. India Pearl India 72.26 0.40 0.65 India Long Green India 22.64 0.45 0.75 E11M47b12 E12M48b5 E11M48b25 E12M47b10 Hyb. India Green Queen India 25.29 0.45 0.80 E11M51b25 E12M49b10 E11M49b1 E12M48b1 Japan Green Spindle Japan 16.1 0.50 0.90 E11M51b27 E12M51b1 E11M49b5 E12M48b5 Japan Long Japan 78.69 0.45 0.80 E11M49b6 E12M49b1 Small Baby Thailand 3.48 0.65 0.95 Surface Luster E11M49b12 E12M49b20 Hyb. Baby Doll Thailand 5.1 0.35 0.7 E11M47b12 E12M49b10 E11M49b15 E12M51b1 CBM10 USA 4.9 1.00 1.35 E11M49b4 E12M51b1 E11M49b17 E12M51b6 CBM12 USA 3.84 0.70 1.10 E11M50b6 E11M49b25 E12M51b10 CBM18 USA 5.89 0.750 1.10 E12M49b16 E11M50b18 E12M51b12 Publication number US20120079618 A1 Publication type Application Application number US 13/179,952 Publication date Mar 29, 2012 Filing date Jul 11, 2011 Priority date Jul 16, 2010 Inventors Chittaranjan Kole, Phullara Kole, Bode A. Olukolu, Albert G. Abbott Original Assignee Clemson University Export Citation BiBTeX, EndNote, RefMan Referenced by (1), Classifications (10), Legal Events (2) External Links: USPTO, USPTO Assignment, Espacenet 4 1/25/2019 Improvement (%) over Inferior Parents CBMH12 Cucurbitacin-B 180.77 Lycopene 77.27 β-Carotene 192.31 Charantin 27.00 Insulin 160.87 Fruit Weight 1836.00 Dual-Purpose Hybrid: CBM12 Performance of the DPV SNP Development • Genome reduction followed by 454 pyrosequencing CCR LYC CAR CHR PLIN FRWT TW 0.13 0.01 0.13 5.99 0.12 146.3 • 5,190 SNPs CBM12 0.44 0.05 1.83 7.88 0.26 3.84 CBMH12 0.37 0.02 0.38 7.60 0.30 74.36 • 2,519 contigs • Coverage: 19.74× • 785 SSRs 5 1/25/2019 Fluidigm SNP Platform Take-Home Messages Wild allied species are Wild genetic Wild genetic wealthy reservoir of backgrounds provide backgrounds provide useful donor genes genome elasticity genomic heterosis Augmentation of food, Cloning of Association mapping feedstock & phytomedicinal genes could provides genetic therapeutic SMs could facilitate handles for fast-track towards multipurpose biopharming & breeding crop cisgenics Whole genome sequencing could facilitate precise breeding for designed crop Insulin Gene Cloning Changes (%) in Content of Phytomedicines AGCCTTTGTGAACCAACACCTTACGGCACGAGCTGACGACAGCCAT Cucurbitacin-B Lycopene Charantin Insulin GCACCACCTGTGTCCGCGTTCCCGAAGGCACCCCTCTCTTTCAAGA GGATTCGCGGCATGTCAAGCCCTGGTAAGGTTCTTCGCTTTGCATC GAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTC C1 -15.79 -36.36 -20.58 31.82 CTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAA CGCGTTAGCTACAGCACTGCACGGGTCGATACGCACAGCGCCTAGT C2 5.26 0.00 8.22 9.09 ATCCATCGTTTACGGCTAGGACTACTGGGGTATCTAATCCCATTCGC TCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTG CTTTCGCCGTTGGTGTTCTTTCCGATCTCTACGCATTTCACCGCTCC C3 -26.32 -9.09 -29.79 63.64 ACCGGAAATTCCATCTGCTCCCTCTACCAGC C4 73.68 9.09 -33.00 90.91 C5 5.26 81.82 -30.64 45.45 6 1/25/2019 Nanotechnology towards Crop of the Future Food Security Nutrition Energy Security Security Environment Security I dedicate my talk to: Dr. Norman Borlaug & The Farming Community of the World! 7 1/25/2019 Nanotechnology towards Crop of the Future Food Security Nutrition Energy Security Security Environment Security Acknowledgements to My Colleagues at USA Correlation inter se End Products • Phullara Kole • Dr. Virendra Rao • Dr. Bode Olukolu • Dr. Anju Bajpai BM CCRB LYC CHR INS WC • Prof. Albert G. Abbott • Dr. Backiyarani Fruit Yield 0.031 0.100 0.351 0.417 -0.096 -0.108 • Prof. Richard K. Marcus Suthanthiram Biomass Yield -0.033 0.146 -0.676 0.784 0.783 • Dr. Pu-Chun Ke • Dr. Jogendra Singh Cucurbit-acin- 0.230 0.205 0.522 -0.540 • Dr. R. Elanchezian • Prof. Apparao M. Rao B • K. Manoj Randunu • Prof. Peter J Maughan of Lycopene -0.370 0.146 -0.279 Brigham Young University • Poonam Choudhary Charantin -0.413 -0.583 • • Ramakrishna Podila And Several UG & Insulin 0.311 Research students • Dr. Samuel D. Forrest Marker-Trait Association • # of associated markers: Size: 6, shape: 3, surface: 4, Color: 11, luster: 2, CHR: 34, CCR-B: 7 • 2 markers linked to luster also linked to color • 3 markers linked to shape also linked to size • 5 markers common for CHR and CCR-B • 2 common markers for CCR-B & CHR also linked to color • CHR and color shared another 7 markers 8 1/25/2019 Population Structure Characterization of Fullerol • 4 Sub-populations with fixation indices of Sample 0.785, 0.663, 0.542 & 0.582 0 C0 C1 C2 C3 C4 C5 -10 -20 • Each sub-population includes both charantia & -30 muricata genotypes -40 -50 Zeta potential (mV) potentialZeta • No correlation between population structure & -60 geographical origin -70 Trait LG SI (cM) LOD R2 (%) A D Fruit length 2 365-380 3.53 4.84 - 0.85 R2 = 13.4 ± 5.3 % LOD = 6.90 7 190-230 3.02 10.21 -0.47 - Fruit Diameter R2 = 12.9 ± 6.1 % 1 5-35 4.35 12.88 -0.60 - LOD = 7.73 Fruit Weight R2 = 11.1 ± 4.9 % 1 0-35 3.73 11.11 -0.56 - LOD = 6.88 1 100-140 6.84 4.75 - -0.86 1 555-580 7.52 6.77 0.48 - Fruit Number 2 R = 39.7 ± 6.3 % 2 190-210 6.99 7.51 - -1.39 LOD = 16.05 -0.84 5 30-55 6.47 6.44 - 1 160-185 6.06 7.38 - -1.24 Fruit Yield 1 550-580 4.50 6.47 - 0.76 R2 = 38.1 ± 6.3 % LOD = 15.19 2 190-210 8.12 15.32 - -1.99 3 330-350 3.32 4.42 - 0.87 Characterization of Fullerol Accumulation of Fullerol in Petiole C0 C3 C5 9 1/25/2019 Clustered regularly FTIR Data Showing Fullerol Signatures interspaced short palindromic repeats (CRISPRs) and CRISPR- associated (Cas) proteins CRISPR/Cas9 System 58 To: [email protected] What is it? Subject: Bitter Melon Kristopher & Gina Legge [[email protected]] Dear Sir, My 17 year old son is a diabetic but continues to be active in church 4-H Teen CERT as well as other programs thanks to your great works on bitter melon. This week my family started a Youth Diabetes Wellness group for Beaufort County, SC. I would greatly appreciate advise derived from a natural process found in on where we can obtain seeds for this melon and any additional information you can offer. bacteria to protect themselves from Thank you for your time and service to others. I hope your endeavor to research this topic reaps many benefits. pathogens V/R targets genes for editing and regulating Kris Finally, brethren, whatever things are true, whatever things are noble, whatever things are comparable to Photoshop just, whatever things are pure, whatever things are lovely, whatever things are of good report, if there is any virture and if there is anything praiseworthy--meditate on these things. Phillipians 4:8 Horizon Licenses Harvard University Gene-Editing Technology. (2013). Drug Discovery & 59 Development. METHODS for GENOME EDITING To initiate gene modification, Finger nucleases RNA interference Transcription activator-like effector nucleases