Global Collaboration for Addressing Global Climate Change

1/25/2019

Chittaranjan Kole Raja Ramanna Fellow, Govt. of India ICAR-NRCPB, India

1 1/25/2019

Climate Change

• Temp increased by 0.2-0.3°C during 1980 to 2000 • Temp to increase by 4°C by 2100 • Extreme temps, drought, flooding, salinity, input non-bioavailability, biotic stresses, GHG emission ……. • Expected reduction of yield of cereals: 10-15%

2 1/25/2019

Future Research Priorities

• Genome designing for Climate Smart Agriculture • Harnessing agriculture for Health & Environment

A Sweet Story with Bitter Melon as the Model

• Popular vegetable ‘food crop’ • Contains anticancer & antidiabetic ‘bioactives’ • Produces large quantity of ‘biomass’ • Grown under ‘organic’ cultivation • Possesses ‘genome elasticity’ • A new crop for step-wise genome elucidation & improvement

“Chitta, …. You should also do some works that will benefit people immediately.”

New Crop - New Trait - New Strategy

3 1/25/2019

Phytomedicines in Bitter Melon (32)

Alkaloids Galacturonic acids Lauric acid Charantin Gentisic acid Linoleic acid Linolenic β-Carotene Goyaglycosides acid Charine Goyasaponins Lycopene Cryptoxanthin Guanylate MAP-30 Cucurbitins Gyclase inhibitors Momorcharasides Cucurbitacins Gypsogenin Hydroxytryptamines Momorcharins Cycloartenols Karounidiols Momordenol Diosgenin Momordicilin Elaeostearic acids Lanosterol Momordicins

Erythrodiol Momordicinin

Bitter Melon as a Model Phytomedicines in Bitter Melon (31)

Momordicosides Plant Insulin Trypsin inhibitors Momordin Family Cucurbitaceae Proteins Rosmarinic Uracil Sc. Name Momordica charantia Multiflorenol acid Rubixanthin Vacine Myristic acid Nerolidol Spinasterol V-Insulin Synonyms Bitter gourd, Balsam pear, Steroidal glycosides Balsam apple, Snap melon Oleanolic acid Stigmasta-diols Verbascoside 2n 2x=22 Oleic acid Stigmasterol Vicine 1C Value 2.05 pg Oxalic acid Taraxerol Trehalose Zeatin Pentadecans Zeatin riboside Mbp 2009 Peptides Zeaxanthin Petroselinic acid Zeinoxanthin

Some Ethnomedical Uses Research Documentation on Properties Abortions Gout Menstrual • Anticancerous  Hypoglycemic Birth control Hepatitis disorders  Hypocholesteromic Burns & wounds Hydrophobia Pneumonia • Antitumorous Constipation Hyperglycemia Psoriasis • Antileukemic  Antifertility Rheumatism Dermatitis Impotency Leprosy  Immune stimulant Scabies • Antiprotozoal Diabetes Jaundice  Abortive Kidney stones Snakebite Diarrhea • Antibacterial  Contraceptive Tumor Eczema Liver problems • Antiviral Vaginal discharge Fat loss Malaria Worm Flue

4 1/25/2019

Publication number US20120079618 A1 Publication type Application Application number US 13/179,952 Publication date Mar 29, 2012 Filing date Jul 11, 2011 Priority date Jul 16, 2010 Inventors Chittaranjan Kole, Phullara Kole, Bode A. Olukolu, Albert G. Abbott Original Assignee Clemson University Export Citation BiBTeX, EndNote, RefMan Referenced by (1), Classifications (10), Legal Events (2) External Links: USPTO, USPTO Assignment, Espacenet

1.6 Cucurbitacin-B 1.4 Charantin 1.2

0.8

0.6

0.4

0.2

Genotype Origin FRWt (g) CCR-B CHR

Hyb. Beauty Winner China 74.81 0.70 1.10 Hong Kong Green Hong Kong 70.61 0.50 0.90 Hyb. Taiwan White Taiwan 63.6 0.40 0.80 Taiwan White Taiwan 146.33 0.35 0.75 Hyb. White Pearl Taiwan 82.37 0.55 0.95 Hyb. Jumbo Thailand 70.87 0.30 0.70 Hyb. Bangkok Large Thailand 78.50 0.55 0.95 Hyb. India Star India 74.83 0.40 0.70 Hyb. India Baby India 4.28 0.45 0.80 Hyb. India Pearl India 72.26 0.40 0.65 India Long Green India 22.64 0.45 0.75 Hyb. India Green Queen India 25.29 0.45 0.80 Japan Green Spindle Japan 16.1 0.50 0.90 Japan Long Japan 78.69 0.45 0.80 Small Baby Thailand 3.48 0.65 0.95 Hyb. Baby Doll Thailand 5.1 0.35 0.7 CBM10 USA 4.9 1.00 1.35 CBM12 USA 3.84 0.70 1.10 CBM18 USA 5.89 0.750 1.10

5 1/25/2019

Size Color CHR CHR CCR-B E11M47b12 E11M48b9 E11M47b8 E11M50b20 E11M47b1 E11M49b5 E11M48b25 E11M47b14 E11M50b23 E11M49b12 E11M51b25 E11M49b6 E11M47b18 E11M50b36 E11M49b25 E11M51b27 E11M49b14 E11M47b19 E11M50b43 E11M50b43 E12M48b1 E11M49b15 E11M47b25 E11M51b12 E11M51b5 E12M48b28 E11M49b25 E11M48b9 E11M51b29 E12M47b6 E11M50b23 E11M48b14 E12M47b3 E12M49b1 Shape E11M50b43 E11M48b19 E12M47b6 E11M47b12 E12M48b5 E11M48b25 E12M47b10 E11M51b25 E12M49b10 E11M49b1 E12M48b1 E11M51b27 E12M51b1 E11M49b5 E12M48b5 E11M49b6 E12M49b1 Surface Luster E11M49b12 E12M49b20 E11M47b12 E12M49b10 E11M49b15 E12M51b1 E11M49b4 E12M51b1 E11M49b17 E12M51b6 E11M50b6 E11M49b25 E12M51b10 E12M49b16 E11M50b18 E12M51b12

Dual-Purpose Hybrid: CBM12

Performance of the DPV

CCR LYC CAR CHR PLIN FRWT TW 0.13 0.01 0.13 5.99 0.12 146.3 CBM12 0.44 0.05 1.83 7.88 0.26 3.84 CBMH12 0.37 0.02 0.38 7.60 0.30 74.36

6 1/25/2019

Fluidigm SNP Platform Improvement (%) over Inferior Parents

CBMH12 Cucurbitacin-B 180.77 Lycopene 77.27 β-Carotene 192.31 Charantin 27.00 Insulin 160.87 Fruit Weight 1836.00

SNP Development Insulin Gene Cloning

• Genome reduction followed by 454 pyrosequencing AGCCTTTGTGAACCAACACCTTACGGCACGAGCTGACGACAGCCAT GCACCACCTGTGTCCGCGTTCCCGAAGGCACCCCTCTCTTTCAAGA GGATTCGCGGCATGTCAAGCCCTGGTAAGGTTCTTCGCTTTGCATC • 5,190 SNPs GAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTC CTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAA CGCGTTAGCTACAGCACTGCACGGGTCGATACGCACAGCGCCTAGT ATCCATCGTTTACGGCTAGGACTACTGGGGTATCTAATCCCATTCGC • 2,519 contigs TCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTG CTTTCGCCGTTGGTGTTCTTTCCGATCTCTACGCATTTCACCGCTCC ACCGGAAATTCCATCTGCTCCCTCTACCAGC • Coverage: 19.74×

• 785 SSRs

7 1/25/2019

Plant Production Plant Breeding [Productivity, [Nanopesticide, Atomically Modified Plants] Nanofertilizer]

Nanotechnology & Agriculture

Soil Health Smart Monitoring [Biosensor [Hydrogels, Nanozeolites] + e-communication]

Take-Home Messages Publications on Nanoparticles

Wild allied species are Wild genetic Wild genetic wealthy reservoir of backgrounds provide backgrounds provide useful donor genes genome elasticity genomic heterosis

Augmentation of food, Cloning of Association mapping feedstock & phytomedicinal genes could provides genetic therapeutic SMs could facilitate handles for fast-track towards multipurpose biopharming & breeding crop cisgenics

Whole genome sequencing could facilitate precise breeding for designed crop

Performance of the DPV

CCR LYC CAR CHR PLIN FRWT TW 0.13 0.01 0.13 5.99 0.12 146.3 CBM12 0.44 0.05 1.83 7.88 0.26 3.84 CBMH12 0.37 0.02 0.38 7.60 0.30 74.36

8 1/25/2019

Suggestive Preliminary Researches A Treatise with Fullerol

• Fullerol - C60(OH)20 • Concentrations: 0, 0.943, 4.72, 9.43, 10.88, 47.2 nM • Duration: 48 hours

Suggestive Preliminary Researches Accumulation of Fullerol in Leaf

C0 C3 C5

NP/Crop Improvement Accumulation of Fullerol in Flower Al, Cu, CeO2, Germination, Root growth, Stem growth, ZnO, TiO2, Shoot/root ratio, Biomass SWCNT, mRNA expression, Protein level, Transcript MWCNT level Wheat Rubisco activase activity, Rubisco Rape carboxylation, Photosynthetic carbon reaction Soybean Radish rate, Chlorophyll content, Light absorbance, Lettuce Tomato Carbon dioxide assimilation, Onion Ribulosebiphosphate carboxylase/oxygenase Cucumber activity, Photosynthesis, N-fixation, Nitrate Spinach reduction activity, Absorption & utilization of water/fertilizer C0 C3 C5

9 1/25/2019

Accumulation of Fullerols in Fruit

C0 C3 C5

FTIR Data Showing Fullerol Signatures

Changes (%) in Plant Parameters Changes (%) in Content of Phytomedicines

Fruit Fruit Fruit Fruit Biomass Plant Length Weight Number Yield Yield water Cucurbitacin-B Lycopene Charantin Insulin Content C1 -1.65 11.40 59.23 75.60 14.29 4.87 C1 -15.79 -36.36 -20.58 31.82

C2 20.00 69.80 36.165 128.45 11.43 3.10 C2 5.26 0.00 8.22 9.09 C3 -26.32 -9.09 -29.79 63.64 C3 -2.89 11.66 30.77 45.94 54.29 24.35 C4 73.68 9.09 -33.00 90.91 C4 3.09 15.97 23.08 42.66 31.43 0.88 C5 5.26 81.82 -30.64 45.45 C5 11.96 41.44 48.46 112.05 28.57 1.77

10 1/25/2019

Changes (%) in Content of Phytomedicines

Uptake, Translocation and Biotransformation Pathway of Transmission of Fullerols to 2nd Generation Nanoparticles in Plant System

100 m C2- C4- C4- C1- Root Root Leaf Fruit

Nanoparticle-induced Modulation of Cellular Transcriptome and Proteome in Plants Nano-mediated Delivery of Biomolecules

Nanomaterial Type of Plant Delivered molecules References

used for delivery Mesoporous nanoparticles Tobacco DNA and chemicals Torney et al. 2007 system (MSNS) Gold-plated mesoporous Maize CRE-recombinase protein Martin-Ortigosa et al. 2014 nanoparticles system Single-walled carbon Tobacco protoplasts DNA Liu et al. 2009 nanotubes (SWCNTs) Gold nanorodes (NRs) Tobacco protoplasts DNA Silva et al. 2010

Gold functionalized silica Onion epidermis tissue DNA Martin-Ortigosa et al. 2012a nanoparticles (Au-MSN) Gold silica nanoparticle system Onion epidermis tissue DNA, proteins Martin-Ortigosa et al. 2012b (Au-MSN)

Gold nanorodes (NRs) Nanorods with gold cores and Tobacco callus Growth regulator Nima et al. 2014 silver shells (AuNR-Ag) 2,4-D Polymer nanoparticles (CPNs) Tobacco protoplasts siRNA Silva et al. 2010

11 1/25/2019

Nanotechnology towards Crop of the Future

Food Security

Nutrition Energy Security Security

Environment Security

I dedicate my talk to:

Dr. Norman Borlaug & The Farming Community of the World!

12 1/25/2019

Nanotechnology towards Crop of the Future

Food Security

Nutrition Energy Security Security

Environment Security

Acknowledgements to My Colleagues at USA Correlation inter se End Products

• Phullara Kole • Dr. Virendra Rao • Dr. Bode Olukolu • Dr. Anju Bajpai BM CCRB LYC CHR INS WC • Prof. Albert G. Abbott • Dr. Backiyarani Fruit Yield 0.031 0.100 0.351 0.417 -0.096 -0.108 • Prof. Richard K. Marcus Suthanthiram Biomass Yield -0.033 0.146 -0.676 0.784 0.783 • Dr. Pu-Chun Ke • Dr. Jogendra Singh Cucurbit-acin- 0.230 0.205 0.522 -0.540 • Dr. R. Elanchezian • Prof. Apparao M. Rao B • K. Manoj Randunu • Prof. Peter J Maughan of Lycopene -0.370 0.146 -0.279 Brigham Young University • Poonam Choudhary Charantin -0.413 -0.583 • • Ramakrishna Podila And Several UG & Insulin 0.311 Research students • Dr. Samuel D. Forrest

Marker-Trait Association

• # of associated markers: Size: 6, shape: 3, surface: 4, Color: 11, luster: 2, CHR: 34, CCR-B: 7 • 2 markers linked to luster also linked to color • 3 markers linked to shape also linked to size • 5 markers common for CHR and CCR-B • 2 common markers for CCR-B & CHR also linked to color • CHR and color shared another 7 markers

13 1/25/2019

Population Structure Characterization of Fullerol

• 4 Sub-populations with fixation indices of Sample 0.785, 0.663, 0.542 & 0.582 0 C0 C1 C2 C3 C4 C5 -10

-20 • Each sub-population includes both charantia & -30 muricata genotypes -40

-50 Zeta potential (mV) potentialZeta • No correlation between population structure & -60

geographical origin -70

Trait LG SI (cM) LOD R2 (%) A D

Fruit length 2 365-380 3.53 4.84 - 0.85 R2 = 13.4 ± 5.3 % LOD = 6.90 7 190-230 3.02 10.21 -0.47 -

Fruit Diameter R2 = 12.9 ± 6.1 % 1 5-35 4.35 12.88 -0.60 - LOD = 7.73

Fruit Weight R2 = 11.1 ± 4.9 % 1 0-35 3.73 11.11 -0.56 - LOD = 6.88

1 100-140 6.84 4.75 - -0.86

1 555-580 7.52 6.77 0.48 - Fruit Number 2 R = 39.7 ± 6.3 % 2 190-210 6.99 7.51 - -1.39 LOD = 16.05 -0.84 5 30-55 6.47 6.44 -

1 160-185 6.06 7.38 - -1.24

Fruit Yield 1 550-580 4.50 6.47 - 0.76 R2 = 38.1 ± 6.3 % LOD = 15.19 2 190-210 8.12 15.32 - -1.99

3 330-350 3.32 4.42 - 0.87

Characterization of Fullerol Accumulation of Fullerol in Petiole

C0 C3 C5

14 1/25/2019

Clustered regularly FTIR Data Showing Fullerol Signatures interspaced short palindromic repeats (CRISPRs) and CRISPR- associated (Cas) proteins

CRISPR/Cas9 System

To: [email protected] What is it? Subject: Bitter Melon Kristopher & Gina Legge [[email protected]]

Dear Sir,

My 17 year old son is a diabetic but continues to be active in church 4-H Teen CERT as well as other programs thanks to your great works on bitter melon. This week my family  started a Youth Diabetes Wellness group for Beaufort County, SC. I would greatly appreciate advise derived from a natural process found in on where we can obtain seeds for this melon and any additional information you can offer. bacteria to protect themselves from Thank you for your time and service to others. I hope your endeavor to research this topic reaps many benefits. pathogens V/R targets genes for editing and regulating Kris Finally, brethren, whatever things are true, whatever things are noble, whatever things are comparable to Photoshop just, whatever things are pure, whatever things are lovely, whatever things are of good report, if there is any virture and if there is anything praiseworthy--meditate on these things. Phillipians 4:8

Horizon Licenses Harvard University Gene-Editing Technology. (2013). Drug Discovery & 89 Development.

METHODS for GENOME EDITING To initiate gene modification, Finger nucleases RNA interference Transcription activator-like effector nucleases Expensive and time-consuming

A recent and more innovative process.. sgRNA (single guide RNA)

Cas9 Cas9 complex nuclease

87 90

15 1/25/2019

Schematics of Integrated Genomic and Photothermal-based Analysis of Nanoparticle-Plant Interaction Protospacer Adjacent Motif Target (P Sequence AM)

Gene of Interest

Classification of nanoparticles based on dimension

0-D: All dimensions (x, y and z) 1-D: Two dimensions (x and y) are at nanoscale are at nanoscale, third is not (z)

x Non- d ≤ 100 nm Homologous d ≤ 100 nm End Joining (NHEJ) DNA repair pathway 2-D: One dimension (z) is at 3-D: In all of the three nanoscale, other two are not (x dimensions the size is above 100 and y) nm

Stop Codon y z z ≤ 100 nm x x y 92

Summation: crispr/Cas system

sgRNA/Cas9 Cas breaks Induced complex gene (double mutation in binds to strand gene gene breaks) sequence

altered gene sequence  I dedicate my talk to dysfunctional CAD gene Dr. Norman E. Borlaug!

16 1/25/2019