1/25/2019 Global Collaboration for Addressing Global Climate Change Chittaranjan Kole Raja Ramanna Fellow, Govt. of India ICAR-NRCPB, India 1 1/25/2019 Climate Change • Temp increased by 0.2-0.3°C during 1980 to 2000 • Temp to increase by 4°C by 2100 • Extreme temps, drought, flooding, salinity, input non-bioavailability, biotic stresses, GHG emission ……. • Expected reduction of yield of cereals: 10-15% 2 1/25/2019 Future Research Priorities • Genome designing for Climate Smart Agriculture • Harnessing agriculture for Health & Environment A Sweet Story with Bitter Melon as the Model • Popular vegetable ‘food crop’ • Contains anticancer & antidiabetic ‘bioactives’ • Produces large quantity of ‘biomass’ • Grown under ‘organic’ cultivation • Possesses ‘genome elasticity’ • A new crop for step-wise genome elucidation & improvement “Chitta, …. You should also do some works that will benefit people immediately.” New Crop - New Trait - New Strategy 3 1/25/2019 Phytomedicines in Bitter Melon (32) Alkaloids Galacturonic acids Lauric acid Charantin Gentisic acid Linoleic acid Linolenic β-Carotene Goyaglycosides acid Charine Goyasaponins Lycopene Cryptoxanthin Guanylate MAP-30 Cucurbitins Gyclase inhibitors Momorcharasides Cucurbitacins Gypsogenin Hydroxytryptamines Momorcharins Cycloartenols Karounidiols Momordenol Diosgenin Momordicilin Elaeostearic acids Lanosterol Momordicins Erythrodiol Momordicinin Bitter Melon as a Model Phytomedicines in Bitter Melon (31) Momordicosides Plant Insulin Trypsin inhibitors Momordin Family Cucurbitaceae Proteins Rosmarinic Uracil Sc. Name Momordica charantia Multiflorenol acid Rubixanthin Vacine Myristic acid Nerolidol Spinasterol V-Insulin Synonyms Bitter gourd, Balsam pear, Steroidal glycosides Balsam apple, Snap melon Oleanolic acid Stigmasta-diols Verbascoside 2n 2x=22 Oleic acid Stigmasterol Vicine 1C Value 2.05 pg Oxalic acid Taraxerol Trehalose Zeatin Pentadecans Zeatin riboside Mbp 2009 Peptides Zeaxanthin Petroselinic acid Zeinoxanthin Some Ethnomedical Uses Research Documentation on Properties Abortions Gout Menstrual • Anticancerous Hypoglycemic Birth control Hepatitis disorders Hypocholesteromic Burns & wounds Hydrophobia Pneumonia • Antitumorous Constipation Hyperglycemia Psoriasis • Antileukemic Antifertility Rheumatism Dermatitis Impotency Leprosy Immune stimulant Scabies • Antiprotozoal Diabetes Jaundice Abortive Kidney stones Snakebite Diarrhea • Antibacterial Contraceptive Tumor Eczema Liver problems • Antiviral Vaginal discharge Fat loss Malaria Worm Flue 4 1/25/2019 Publication number US20120079618 A1 Publication type Application Application number US 13/179,952 Publication date Mar 29, 2012 Filing date Jul 11, 2011 Priority date Jul 16, 2010 Inventors Chittaranjan Kole, Phullara Kole, Bode A. Olukolu, Albert G. Abbott Original Assignee Clemson University Export Citation BiBTeX, EndNote, RefMan Referenced by (1), Classifications (10), Legal Events (2) External Links: USPTO, USPTO Assignment, Espacenet 1.6 Cucurbitacin-B 1.4 Charantin 1.2 1 0.8 0.6 0.4 0.2 0 Genotype Origin FRWt (g) CCR-B CHR Hyb. Beauty Winner China 74.81 0.70 1.10 Hong Kong Green Hong Kong 70.61 0.50 0.90 Hyb. Taiwan White Taiwan 63.6 0.40 0.80 Taiwan White Taiwan 146.33 0.35 0.75 Hyb. White Pearl Taiwan 82.37 0.55 0.95 Hyb. Jumbo Thailand 70.87 0.30 0.70 Hyb. Bangkok Large Thailand 78.50 0.55 0.95 Hyb. India Star India 74.83 0.40 0.70 Hyb. India Baby India 4.28 0.45 0.80 Hyb. India Pearl India 72.26 0.40 0.65 India Long Green India 22.64 0.45 0.75 Hyb. India Green Queen India 25.29 0.45 0.80 Japan Green Spindle Japan 16.1 0.50 0.90 Japan Long Japan 78.69 0.45 0.80 Small Baby Thailand 3.48 0.65 0.95 Hyb. Baby Doll Thailand 5.1 0.35 0.7 CBM10 USA 4.9 1.00 1.35 CBM12 USA 3.84 0.70 1.10 CBM18 USA 5.89 0.750 1.10 5 1/25/2019 Size Color CHR CHR CCR-B E11M47b12 E11M48b9 E11M47b8 E11M50b20 E11M47b1 E11M49b5 E11M48b25 E11M47b14 E11M50b23 E11M49b12 E11M51b25 E11M49b6 E11M47b18 E11M50b36 E11M49b25 E11M51b27 E11M49b14 E11M47b19 E11M50b43 E11M50b43 E12M48b1 E11M49b15 E11M47b25 E11M51b12 E11M51b5 E12M48b28 E11M49b25 E11M48b9 E11M51b29 E12M47b6 E11M50b23 E11M48b14 E12M47b3 E12M49b1 Shape E11M50b43 E11M48b19 E12M47b6 E11M47b12 E12M48b5 E11M48b25 E12M47b10 E11M51b25 E12M49b10 E11M49b1 E12M48b1 E11M51b27 E12M51b1 E11M49b5 E12M48b5 E11M49b6 E12M49b1 Surface Luster E11M49b12 E12M49b20 E11M47b12 E12M49b10 E11M49b15 E12M51b1 E11M49b4 E12M51b1 E11M49b17 E12M51b6 E11M50b6 E11M49b25 E12M51b10 E12M49b16 E11M50b18 E12M51b12 Dual-Purpose Hybrid: CBM12 Performance of the DPV CCR LYC CAR CHR PLIN FRWT TW 0.13 0.01 0.13 5.99 0.12 146.3 CBM12 0.44 0.05 1.83 7.88 0.26 3.84 CBMH12 0.37 0.02 0.38 7.60 0.30 74.36 6 1/25/2019 Fluidigm SNP Platform Improvement (%) over Inferior Parents CBMH12 Cucurbitacin-B 180.77 Lycopene 77.27 β-Carotene 192.31 Charantin 27.00 Insulin 160.87 Fruit Weight 1836.00 SNP Development Insulin Gene Cloning • Genome reduction followed by 454 pyrosequencing AGCCTTTGTGAACCAACACCTTACGGCACGAGCTGACGACAGCCAT GCACCACCTGTGTCCGCGTTCCCGAAGGCACCCCTCTCTTTCAAGA GGATTCGCGGCATGTCAAGCCCTGGTAAGGTTCTTCGCTTTGCATC • 5,190 SNPs GAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTC CTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAA CGCGTTAGCTACAGCACTGCACGGGTCGATACGCACAGCGCCTAGT ATCCATCGTTTACGGCTAGGACTACTGGGGTATCTAATCCCATTCGC • 2,519 contigs TCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTG CTTTCGCCGTTGGTGTTCTTTCCGATCTCTACGCATTTCACCGCTCC ACCGGAAATTCCATCTGCTCCCTCTACCAGC • Coverage: 19.74× • 785 SSRs 7 1/25/2019 Plant Production Plant Breeding [Productivity, [Nanopesticide, Atomically Modified Plants] Nanofertilizer] Nanotechnology & Agriculture Soil Health Smart Monitoring [Biosensor [Hydrogels, Nanozeolites] + e-communication] Take-Home Messages Publications on Nanoparticles Wild allied species are Wild genetic Wild genetic wealthy reservoir of backgrounds provide backgrounds provide useful donor genes genome elasticity genomic heterosis Augmentation of food, Cloning of Association mapping feedstock & phytomedicinal genes could provides genetic therapeutic SMs could facilitate handles for fast-track towards multipurpose biopharming & breeding crop cisgenics Whole genome sequencing could facilitate precise breeding for designed crop Performance of the DPV CCR LYC CAR CHR PLIN FRWT TW 0.13 0.01 0.13 5.99 0.12 146.3 CBM12 0.44 0.05 1.83 7.88 0.26 3.84 CBMH12 0.37 0.02 0.38 7.60 0.30 74.36 8 1/25/2019 Suggestive Preliminary Researches A Treatise with Fullerol • Fullerol - C60(OH)20 • Concentrations: 0, 0.943, 4.72, 9.43, 10.88, 47.2 nM • Duration: 48 hours Suggestive Preliminary Researches Accumulation of Fullerol in Leaf C0 C3 C5 NP/Crop Improvement Accumulation of Fullerol in Flower Al, Cu, CeO2, Germination, Root growth, Stem growth, ZnO, TiO2, Shoot/root ratio, Biomass SWCNT, mRNA expression, Protein level, Transcript MWCNT level Wheat Rubisco activase activity, Rubisco Rape carboxylation, Photosynthetic carbon reaction Soybean Radish rate, Chlorophyll content, Light absorbance, Lettuce Tomato Carbon dioxide assimilation, Onion Ribulosebiphosphate carboxylase/oxygenase Cucumber activity, Photosynthesis, N-fixation, Nitrate Spinach reduction activity, Absorption & utilization of water/fertilizer C0 C3 C5 9 1/25/2019 Accumulation of Fullerols in Fruit C0 C3 C5 FTIR Data Showing Fullerol Signatures Changes (%) in Plant Parameters Changes (%) in Content of Phytomedicines Fruit Fruit Fruit Fruit Biomass Plant Length Weight Number Yield Yield water Cucurbitacin-B Lycopene Charantin Insulin Content C1 -1.65 11.40 59.23 75.60 14.29 4.87 C1 -15.79 -36.36 -20.58 31.82 C2 20.00 69.80 36.165 128.45 11.43 3.10 C2 5.26 0.00 8.22 9.09 C3 -26.32 -9.09 -29.79 63.64 C3 -2.89 11.66 30.77 45.94 54.29 24.35 C4 73.68 9.09 -33.00 90.91 C4 3.09 15.97 23.08 42.66 31.43 0.88 C5 5.26 81.82 -30.64 45.45 C5 11.96 41.44 48.46 112.05 28.57 1.77 10 1/25/2019 Changes (%) in Content of Phytomedicines Uptake, Translocation and Biotransformation Pathway of Transmission of Fullerols to 2nd Generation Nanoparticles in Plant System 100 m C2- C4- C4- C1- Root Root Leaf Fruit Nanoparticle-induced Modulation of Cellular Transcriptome and Proteome in Plants Nano-mediated Delivery of Biomolecules Nanomaterial Type of Plant Delivered molecules References used for delivery Mesoporous nanoparticles Tobacco DNA and chemicals Torney et al. 2007 system (MSNS) Gold-plated mesoporous Maize CRE-recombinase protein Martin-Ortigosa et al. 2014 nanoparticles system Single-walled carbon Tobacco protoplasts DNA Liu et al. 2009 nanotubes (SWCNTs) Gold nanorodes (NRs) Tobacco protoplasts DNA Silva et al. 2010 Gold functionalized silica Onion epidermis tissue DNA Martin-Ortigosa et al. 2012a nanoparticles (Au-MSN) Gold silica nanoparticle system Onion epidermis tissue DNA, proteins Martin-Ortigosa et al. 2012b (Au-MSN) Gold nanorodes (NRs) Nanorods with gold cores and Tobacco callus Growth regulator Nima et al. 2014 silver shells (AuNR-Ag) 2,4-D Polymer nanoparticles (CPNs) Tobacco protoplasts siRNA Silva et al. 2010 11 1/25/2019 Nanotechnology towards Crop of the Future Food Security Nutrition Energy Security Security Environment Security I dedicate my talk to: Dr. Norman Borlaug & The Farming Community of the World! 12 1/25/2019 Nanotechnology towards Crop of the Future Food Security Nutrition Energy Security Security Environment Security Acknowledgements to My Colleagues at USA Correlation inter se End Products • Phullara Kole • Dr. Virendra Rao • Dr. Bode Olukolu • Dr. Anju Bajpai BM CCRB LYC CHR INS WC • Prof. Albert G. Abbott • Dr. Backiyarani Fruit Yield 0.031 0.100 0.351 0.417 -0.096 -0.108 • Prof.