DOCSLIB.ORG

Protein Kinase a Type I and Type II Define Distinct Intracellular Signaling Compartments

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein Kinase a Type I and Type II Define Distinct Intracellular Signaling Compartments Protein Kinase A Type I and Type II Define Distinct Intracellular Signaling Compartments Giulietta Di Benedetto, Anna Zoccarato, Valentina Lissandron, Anna Terrin, Xiang Li, Miles D. Houslay, George S. Baillie, Manuela Zaccolo Abstract—Protein kinase A (PKA) is a key regulatory enzyme that, on activation by cAMP, modulates a wide variety of cellular functions. PKA isoforms type I and type II possess different structural features and biochemical characteristics, resulting in nonredundant function. However, how different PKA isoforms expressed in the same cell manage to perform distinct functions on activation by the same soluble intracellular messenger, cAMP, remains to be established. Here, we provide a mechanism for the different function of PKA isoforms subsets in cardiac myocytes and demonstrate that PKA-RI and PKA-RII, by binding to AKAPs (A kinase anchoring proteins), are tethered to different subcellular locales, thus defining distinct intracellular signaling compartments. Within such compartments, PKA-RI and PKA-RII respond to distinct, spatially restricted cAMP signals generated in response to specific G protein–coupled receptor agonists and regulated by unique subsets of the cAMP degrading phosphodiesterases. The selective activation of individual PKA isoforms thus leads to phosphorylation of unique subsets of downstream targets. (Circ Res. 2008;103:836-844.) Key Words: cAMP Ⅲ compartmentalization Ⅲ compartmentation Ⅲ adrenergic stimulation Ⅲ prostaglandin Ⅲ protein kinase A rotein kinase A (PKA) is a key regulatory enzyme in the coupled to specific GPCRs to degrade cAMP selectively in Pheart that is involved in the catecholamine-mediated response to a given stimulus.8 control of excitation–contraction coupling, as well as in a Cardiac myocytes express all four types of PKA isozymes, myriad of other functions including activation of transcrip- PKA-RI␣, PKA-RII␣, PKA-RI␤, and PKA-RII␤.9 PKA iso- tion factors and control of metabolic enzymes. The second forms show different subcellular localization, with PKA-RII messenger cAMP activates PKA by binding to the regula- being mainly associated with the particulate fraction of cell tory (R) subunits, causing release of the activated catalytic lysates whereas PKA-RI has been found preferentially in the (C) subunits. cytosol.10,11 PKA isoforms also show different biochemical The fact that, following cAMP-engagement, PKA mediates properties. PKA-RI is more readily dissociated by cAMP than a plethora of cellular responses has raised the question of how PKA-RII,12,13 and the recent structure solution of holoenzyme specificity is maintained. In recent years, features of this complexes14,15 shows critical isoform-specific features that pathway that contribute to specificity have been uncovered.1 specifically regulate inhibition and cAMP-induced activation A key role is played by AKAPs (A kinase anchoring of PKA-RI and PKA-RII. Given the distinct biochemical proteins), a family of proteins that act as molecular scaffolds properties and the specific subcellular localization of PKA to anchor PKA in the vicinity of specific substrate mole- isozymes, it is not surprising that the biological role of cules,2 thus focusing PKA activity toward relevant substrates. PKA-RI and PKA-RII is nonredundant, as demonstrated by A second mechanism contributing to specificity revolves genetic and biochemical studies (reviewed elsewhere16). around the spatial control of the cAMP signal itself. Restric- However, how individual PKA isoforms serve to deliver a tion of intracellular diffusion of cAMP has been shown by specific response remains unknown. In particular, it remains using a variety of approaches,3–5 including direct imaging of to be established how spatial control of the cAMP signal and gradients of cAMP in response to activation of various G activation of individual PKA isoforms are coordinated to protein–coupled receptors (GPCRs).6 A key role in shaping perform a specific biological function. cAMP intracellular pools is played by phosphodiesterases Here, we set out to answer the question of whether (PDEs), the enzymes that hydrolyze cAMP.7 Indeed, individ- confined pools of cAMP elicited in response of specific ual PDE isoforms have been shown to be functionally extracellular stimuli selectively activate individual PKA iso- Original received February 28, 2008; revision received August 14, 2008; accepted August 19, 2008. From the Dulbecco Telethon Institute (G.D.B., A.Z., V.L., M.Z.), Venetian Institute of Molecular Medicine, Padova, Italy; and Neuroscience and Molecular Pharmacology (A.T., X.L., M.D.H., G.S.B., M.Z.), Faculty of Biomedical & Life Sciences, University of Glasgow, Scotland, United Kingdom. Correspondence to Dr Manuela Zaccolo, Neuroscience and Molecular Pharmacology, Faculty of Biomedical and Life Sciences, University Avenue, G12 8QQ, Glasgow, UK. E-mail [email protected] © 2008 American Heart Association, Inc. Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.108.174813 836 Di Benedetto et al Compartmentalized Signaling by PKA Isoforms 837 forms. By using FRET- and FRAP-based imaging approaches we show that, in cardiomyocytes, PKA-RI and PKA-RII, by anchoring to endogenous AKAPs, define distinct compart- ments within which cAMP is specifically controlled by different subsets of PDEs. In addition, we demonstrate that cAMP levels rise selectively in the PKA-RI and PKA-RII compartments in a stimulus-specific manner, leading to the phosphorylation of unique subsets of downstream PKA tar- gets. The generation of distinct pools of cAMP within cells that allows for the selective activation of individual PKA isoforms is instrumental for the cell to modulate specific physiological functions and points to means for developing strategies for selective pharmacological intervention. Materials and Methods Primary cultures of neonatal cardiac ventriculocytes from 1- to 3-day old rats were prepared as described.6 All the details concerning Figure 1. Targeted FRET-based cAMP sensors. Confocal generation of constructs, cells transfection, Western blotting, immu- images of CHO cells expressing either RI_epac or RII_epac nostaining and confocal imaging, FRAP experiments, FRET imaging alone (left panels) or in combination with ezrin and AKAP 79, and RT-PCR are described in the expanded Materials and Methods respectively (right images). The middle images show the local- section in the online data supplement, available at http://circres. ization of green fluorescent protein (GFP)-tagged ezrin and ahajournals.org. GFP-tagged AKAP79 in CHO cells. Scale barsϭ10 ␮m. Results RII_epac with AKAP79 results in the relocalization of the Generation of cAMP Sensors Selectively Targeted sensor at the plasma membrane, confirming that the modified to the PKA-RI and PKA-RII Compartments sensors localize within the cell where AKAPs are present. We set out to assess whether PKA-RI and PKA-RII are To verify if RI_epac and RII_epac are targeted to different selectively and independently activated by specific extracel- subcellular compartments in neonatal cardiac myocytes, the lular stimuli and generated 2 FRET-based probes that, by localization of the sensors was analyzed by confocal micros- selectively targeting to the same subcellular compartments as copy. As a localization marker, the Z-line protein Zasp fused the endogenous PKA isoforms, monitor the cAMP signals to the red fluorescent protein mRFP (zasp-RFP) was coex- generated at these sites. We took advantage of the unique pressed in combination with either RI_epac or RII_epac. As dimerization/docking domain sequences that have been illustrated in Figure 2A and 2I, RI_epac shows a tight striated shown17 to mediate anchoring of PKA-RI and PKA-RII pattern overlaying with both the Z and the M sarcomeric lines subunits to AKAPs. Thus, by fusing the dimerization/docking (see line intensity profiles at the bottom of Figure 2). In domain from either RI␣ (amino acids 1 to 64) or RII␤ (amino contrast, the distribution of RII_epac shows a very strong acids 1 to 49) to the N terminus of the soluble Epac-1 localization that corresponds to the M line and a much weaker sensor,18 we generated the sensors RI_epac and RII_epac localization overlaying the Z line (Figure 2B and 2L). Such (Figure IA in the online data supplement). For both sensors, localization is identical to the localization of overexpressed it is believed that the binding of cAMP to the cAMP-binding full-length RI and RII subunits and corresponds to the domain will result in a conformational change that causes an localization of endogenous RI and RII subunits (supplemental increase in the distance of the cyan fluorescent protein and Figure II). To assess whether the differences in localization yellow fluorescent protein moieties, with a consequent reduc- were attributable to anchoring of the sensors to endogenous tion of the FRET signal, as shown for the parent sensor.18 The AKAPs, we used the AKAP-competing peptides RIAD21 and modified sensors have been tested with respect to maximal SuperAKAP-IS.22 These peptides have been shown to com- FRET response and to dose-response behavior (supplemen- pete selectively with the binding of PKA-RI and PKA-RII to tary materials and supplemental Figure I). We found that endogenous AKAPs. In particular, the RIAD peptide displays RI_epac and RII_epac are equally sensitive to cAMP more than 1000-fold selectivity for RI over RII,21 whereas the changes. peptide SuperAKAP-IS is 10 000-fold more selective for the RII isoform relative
Load more

Recommended publications
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Protein Kinase C As a Paradigm Alexandra C
    Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • GPCR Signaling Inhibits Mtorc1 Via PKA Phosphorylation of Raptor
    RESEARCH ARTICLE GPCR signaling inhibits mTORC1 via PKA phosphorylation of Raptor Jenna L Jewell1,2,3*, Vivian Fu4,5, Audrey W Hong4,5, Fa-Xing Yu6, Delong Meng1,2,3, Chase H Melick1,2,3, Huanyu Wang1,2,3, Wai-Ling Macrina Lam4,5, Hai-Xin Yuan4,5, Susan S Taylor4,7, Kun-Liang Guan4,5* 1Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, United States; 2Harold C Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, United States; 3Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, United States; 4Department of Pharmacology, University of California, San Diego, La Jolla, United States; 5Moores Cancer Center, University of California San Diego, La Jolla, United States; 6Children’s Hospital and Institutes of Biomedical Sciences, Fudan University, Shanghai, China; 7Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, United States Abstract The mammalian target of rapamycin complex 1 (mTORC1) regulates cell growth, metabolism, and autophagy. Extensive research has focused on pathways that activate mTORC1 like growth factors and amino acids; however, much less is known about signaling cues that directly inhibit mTORC1 activity. Here, we report that G-protein coupled receptors (GPCRs) paired to Gas proteins increase cyclic adenosine 3’5’ monophosphate (cAMP) to activate protein kinase A (PKA) and inhibit mTORC1. Mechanistically, PKA phosphorylates the mTORC1 component Raptor on Ser 791, leading to decreased mTORC1 activity. Consistently, in cells where Raptor Ser 791 is mutated to Ala, mTORC1 activity is partially rescued even after PKA activation. Gas-coupled GPCRs *For correspondence: stimulation leads to inhibition of mTORC1 in multiple cell lines and mouse tissues.
    [Show full text]
  • The Control of Phosphorylase Phosphatase by Camp-Dependent Protein Kinase
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Volume 82, number 2 FEBS LETTERS October 1977 THE CONTROL OF PHOSPHORYLASE PHOSPHATASE BY CAMP-DEPENDENT PROTEIN KINASE Pi1 GERGELY and Gyijrgy BOT Institute of Medical Chemistry, University of Medicine, H-4026 Debrecen, Bern t& 18/B, Hungary Received 22 July 1977 1. Introduction tissues which inhibits the phosphatase reaction is heat- stable [ 11 ,121. This heat-stable inhibitor protein is The enzymes of glycogen metabolism are regulated phosphorylated by CAMP-dependent protein kinase by interconversion between phosphorylated and dephos- [ 131. Recently, T&h et al. demonstrated the reversible phorylated forms. Contrary to our well-defined knowl- phosphorylation and dephosphorylation of this heat- edge of the phosphorylation processes of different stable inhibitor protein in vivo [ 143. Huang and Glins- enzymes and their role in glycogen breakdown and mann demonstrated the existence of two heat-stable synthesis, the phosphatases catalyzing the reverse inhibitor proteins for phosphatase [ 15,161. processes are only now being understood. The regula- Enzymic chemical modification of phosphorylase tion of dephosphorylation reactions is still unclear. phosphatase has not been established as a means of Phosphorylase phosphatase converts ‘active’ phos- regulation [ 171. phorylase a (EC 2.4.1.1) into ‘inactive’ phosphorylase In the present communication the effect of CAMP- b by cleavage of the phosphate groups from the serine dependent protein kinase on the phosphatase reaction residues. For the control of phosphorylase phospha- (i.e., on the dephosphorylation of phosphorylase a) tase the following mechanisms are possible: has been investigated.
    [Show full text]
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation
    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
    [Show full text]
  • Activation of Mtorc1 Is Essential for Β-Adrenergic Stimulation of Adipose Browning
    Downloaded from http://www.jci.org on May 2, 2016. http://dx.doi.org/10.1172/JCI83532 The Journal of Clinical Investigation RESEARCH ARTICLE Activation of mTORC1 is essential for β-adrenergic stimulation of adipose browning Dianxin Liu,1 Marica Bordicchia,1 Chaoying Zhang,1 Huafeng Fang,1 Wan Wei,1 Jian-Liang Li,1 Adilson Guilherme,2 Kalyani Guntur,2 Michael P. Czech,2 and Sheila Collins1 1Diabetes and Obesity Research Center, Sanford Burnham Prebys Medical Discovery Institute, Orlando, Florida, USA. 2Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts, USA. A classic metabolic concept posits that insulin promotes energy storage and adipose expansion, while catecholamines stimulate release of adipose energy stores by hydrolysis of triglycerides through β-adrenergic receptor (βARs) and protein kinase A (PKA) signaling. Here, we have shown that a key hub in the insulin signaling pathway, activation of p70 ribosomal S6 kinase (S6K1) through mTORC1, is also triggered by PKA activation in both mouse and human adipocytes. Mice with mTORC1 impairment, either through adipocyte-specific deletion of Raptor or pharmacologic rapamycin treatment, were refractory to the well-known βAR-dependent increase of uncoupling protein UCP1 expression and expansion of beige/brite adipocytes (so-called browning) in white adipose tissue (WAT). Mechanistically, PKA directly phosphorylated mTOR and RAPTOR on unique serine residues, an effect that was independent of insulin/AKT signaling. Abrogation of the PKA site within RAPTOR disrupted βAR/mTORC1 activation of S6K1 without affecting mTORC1 activation by insulin. Conversely, a phosphomimetic RAPTOR augmented S6K1 activity. Together, these studies reveal a signaling pathway from βARs and PKA through mTORC1 that is required for adipose browning by catecholamines and provides potential therapeutic strategies to enhance energy expenditure and combat metabolic disease.
    [Show full text]
  • AMP-Activated Protein Kinase: a Potential Therapeutic Target for Triple
    Cao et al. Breast Cancer Research (2019) 21:29 https://doi.org/10.1186/s13058-019-1107-2 REVIEW Open Access AMP-activated protein kinase: a potential therapeutic target for triple-negative breast cancer Wei Cao1,2, Jieqing Li2,3, Qiongyu Hao2, Jaydutt V Vadgama2* and Yong Wu2* Abstract Triple-negative breast cancer (TNBC) is an aggressive subset of breast carcinomas that lack expression of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER2). Unlike other breast cancer subtypes, targeted therapy is presently unavailable for patients with TNBC. In spite of initial responses to chemotherapy, drug resistance tends to develop rapidly and the prognosis of metastatic TNBC is poor. Hence, there is an urgent need for novel-targeted treatment methods or development of safe and effective alternatives with recognized mechanism(s) of action. AMP-activated protein kinase (AMPK), an energy sensor, can regulate protein and lipid metabolism responding to alterations in energy supply. In the past 10 years, interest in AMPK has increased widely since it appeared as an attractive targeting molecule for cancer therapy. There has been a deep understanding of the possible role of abnormal AMPK signaling pathways in the regulation of growth and survival and the development of drug resistance in TNBC. The increasing popularity of using AMPK regulators for TNBC- targeted therapy is supported by a considerable development in ascertaining the molecular pathways implicated. This review highlights the available evidence for AMPK-targeted anti-TNBC activity of various agents or treatment strategies, with special attention placed on recent preclinical and clinical advances in the manipulation of AMPK in TNBC.
    [Show full text]
  • The Role of GSK-3 in the Regulation of Protein Turnover, Myosin
    International Journal of Molecular Sciences Review The Role of GSK-3β in the Regulation of Protein Turnover, Myosin Phenotype, and Oxidative Capacity in Skeletal Muscle under Disuse Conditions Timur M. Mirzoev * , Kristina A. Sharlo and Boris S. Shenkman Myology Laboratory, Institute of Biomedical Problems RAS, 123007 Moscow, Russia; [email protected] (K.A.S.); [email protected] (B.S.S.) * Correspondence: [email protected] Abstract: Skeletal muscles, being one of the most abundant tissues in the body, are involved in many vital processes, such as locomotion, posture maintenance, respiration, glucose homeostasis, etc. Hence, the maintenance of skeletal muscle mass is crucial for overall health, prevention of various diseases, and contributes to an individual’s quality of life. Prolonged muscle inactivity/disuse (due to limb immobilization, mechanical ventilation, bedrest, spaceflight) represents one of the typical causes, leading to the loss of muscle mass and function. This disuse-induced muscle loss primarily results from repressed protein synthesis and increased proteolysis. Further, prolonged disuse results in slow-to-fast fiber-type transition, mitochondrial dysfunction and reduced oxidative capacity. Glycogen synthase kinase 3β (GSK-3β) is a key enzyme standing at the crossroads of various signaling pathways regulating a wide range of cellular processes. This review discusses various important roles of GSK-3β in the regulation of protein turnover, myosin phenotype, and oxidative capacity in skeletal muscles under disuse/unloading conditions and subsequent recovery. According Citation: Mirzoev, T.M.; Sharlo, K.A.; to its vital functions, GSK-3β may represent a perspective therapeutic target in the treatment of Shenkman, B.S. The Role of GSK-3β muscle wasting induced by chronic disuse, aging, and a number of diseases.
    [Show full text]
  • MTOR Signaling and Metabolism in Early T Cell Development
    G C A T T A C G G C A T genes Review MTOR Signaling and Metabolism in Early T Cell Development Guy Werlen, Ritika Jain and Estela Jacinto * Department of Biochemistry and Molecular Biology, Robert Wood Johnson Medical School, Rutgers University, Piscataway, NJ 08854, USA; [email protected] (G.W.); [email protected] (R.J.) * Correspondence: [email protected]; Tel.: +1-732-235-4476 Abstract: The mechanistic target of rapamycin (mTOR) controls cell fate and responses via its func- tions in regulating metabolism. Its role in controlling immunity was unraveled by early studies on the immunosuppressive properties of rapamycin. Recent studies have provided insights on how metabolic reprogramming and mTOR signaling impact peripheral T cell activation and fate. The contribution of mTOR and metabolism during early T-cell development in the thymus is also emerging and is the subject of this review. Two major T lineages with distinct immune functions and peripheral homing organs diverge during early thymic development; the αβ- and γδ-T cells, which are defined by their respective TCR subunits. Thymic T-regulatory cells, which have immunosup- pressive functions, also develop in the thymus from positively selected αβ-T cells. Here, we review recent findings on how the two mTOR protein complexes, mTORC1 and mTORC2, and the signaling molecules involved in the mTOR pathway are involved in thymocyte differentiation. We discuss emerging views on how metabolic remodeling impacts early T cell development and how this can be mediated via mTOR signaling. Keywords: mTOR; mTORC1; mTORC2; thymocytes; T lymphocytes; early T cell development; T-cell metabolism Citation: Werlen, G.; Jain, R.; Jacinto, E.
    [Show full text]