DOCSLIB.ORG

Shear Stress Stimulates Phosphorylation of Protein Kinase a Substrate Proteins Including Endothelial Nitric Oxide Synthase in Endothelial Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Shear Stress Stimulates Phosphorylation of Protein Kinase a Substrate Proteins Including Endothelial Nitric Oxide Synthase in Endothelial Cells EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 38, No. 1, 63-71, February 2006 Shear stress stimulates phosphorylation of protein kinase A substrate proteins including endothelial nitric oxide synthase in endothelial cells Yong Chool Boo1,2 sphorylation of target proteins including eNOS, probably by enhancing intracellular site-specific 1Department of Molecular Medicine interactions between protein kinase and substrates. Kyungpook National University School of Medicine Daegu 700-422, Korea Keywords: cyclic AMP responsive element-binding 2Corresponding author: Tel, 82-53-420-4946; protein; endothelial cells; nitric oxide synthase type Fax, 82-53-426-4944; E-mail, [email protected] III; protein kinase A Accepted 19 January 2006 Introduction Abbreviations: BAECs, bovine aortic endothelial cells; CaM, calmodulin; CREB, cAMP responsive element binding protein; eNOS, Endothelial cells are constantly subjected to shear endothelial nitric oxide synthase; L-NAME, nitro-L-arginine methyl stress generated by blood flow. Shear stress re- ester; PI3K, phosphoinositide 3-kinase; PKA, protein kinase A gulates vascular tone and diameter, inflammatory responses, hemostasis, vessel wall remodeling and other vascular functions (Resnick et al., 2003). La- minar shear stress has been proposed to play Abstract anti-atherogenic roles by inhibiting some of the key pro-atherogenic events including apoptosis of endo- Fluid shear stress plays a critical role in vascular thelial cells and binding of monocytes to endothelium health and disease. While protein kinase A (PKA) (Cunningham and Gotlieb, 2005). Various receptors has been implicated in shear-stimulated signaling present on the surface of endothelial cells and other events in endothelial cells, it remains unclear mechanosensing machinery allow vessels to detect whether and how PKA is stimulated in response subtle changes in shear stress (Davies, 2002; Dus- to shear stress. This issue was addressed in the serre et al., 2004; Fleming et al., 2005). The signal present study by monitoring the phosphorylation is transmitted through many intracellular pathways of endogenous substrates of PKA. Shear stress such as mitogen-activated protein kinase cascade, stimulated the phosphorylation of cAMP responsi- via sequential phosphorylations, the activation of ve element binding protein (CREB) in a PKA-de- transcription factors and subsequent gene expre- pendent manner. Western blot analysis using the ssion (Berk et al., 2002). antibody reactive against the consensus motif of There have been indications that protein kinase A (PKA) signaling is involved in critical cellular events PKA substrates detected two proteins, P135 and stimulated by shear stress. For example, PKA activity P50, whose phosphorylation was increased by appears to be essential for shear stress-mediated shear stress. The phosphorylation of P135 was chromatin remodeling which regulates gene expre- blocked by a PKA inhibitor, H89, but not by a ssion in endothelial cells (Illi et al., 2003). However, phosphoinositide 3-kinase inhibitor, wortmannin. it remains controversial whether and how PKA is Expression of a constitutively active PKA subunit stimulated by shear stress. Typically PKA is activated stimulated P135 phosphorylation, supporting the by cAMP-dependent mechanism (Brandon et al., potential of P135 as a PKA substrate. P135 was 1997), but there are conflicting reports with regard identified as endothelial nitric oxide synthase to the effect of fluid shear stress on cellular cAMP (eNOS) by immunoprecipitation study. PKA ap- level. Shear stress has been observed to elevate peared to mediate shear stress-stimulated eNOS cellular cAMP level in osteoblasts (Reich et al., 1990), but not in endothelial cells (Malek et al., 1993). No- activation. Shear stress stimulated intracellular netheless, evolving evidences have suggested that translocation of PKA activity from ‘soluble’ to PKA can also be activated without involving cAMP ‘particulate’ fractions without involving cellular increase, by phosphorylation of Thr197 in the ac- cAMP increase. Taken together, this study suggests tivation loop of PKA catalytic subunit (Cheng et al., that shear stress stimulates PKA-dependent pho - 1998), and interaction with caveolin-1 (Razani et al., 64 Exp. Mol. Med. Vol. 38(1), 63-71, 2006 1999), A-kinase anchoring protein 110 (Niu et al., subunit C which contains double mutations (His87Gln 2001) or I B protein (Dulin et al., 2001). and Trp196Arg) (Orellana and McKnight, 1992). The Unlike most other protein kinases, it has been entire coding sequence of PKA-Cqr was sub-cloned difficult to determine the status of PKA activity in into a bi-cistronic vector, pAdTrackCMV (a kind gift response to certain stimuli in the cells. If the activity from Dr. Bert Vogelstein, Johns Hopkins University) is measured with protein extracts in which cAMP which also expresses green fluorescent protein. is inevitably altered, it cannot represent in situ enzy- BAECs were transfected with plasmid vectors by me activity. Measuring cellular cAMP is not decisive using lipofectamin (Invitrogen). Cells grown to -90% either since PKA can be activated by cAMP-indepen- confluency in 100 mm culture dishes were washed dent mechanisms as well. Accordingly, various efforts with and kept in 5 ml of Opti-MEM (Gibco). Five have been devoted to monitor PKA activity in the g DNA and 10 g lipofectamin were mixed with cells, including a fluorescent indicator protein in which 500 l Opti-MEM and the mixture was kept at room two green fluorescent protein variants are joined by temperature for 30 min. Cells were treated with the the kinase-inducible domain of cAMP responsive mixture for 5 h at 37oC. The transfected cells were element binding protein (CREB) (Nagai et al., 2000). incubated further for 1 d. When BAECs were trans- Phosphorylation of known endogenous substrates fected with pAdTrackCMV vector, the transfected of PKA has also been determined for the same cells were conveniently monitored by fluorescence purpose. For example, phosphorylation of vasodila- microscopy for green fluorescent protein expression, tor-stimulated phosphoprotein (VASP), a substrate revealing typical transfection efficiency ~50% (data for cAMP and cGMP-dependent protein kinases, was not shown). shown to be stimulated in endothelial cells exposed to fluid shear stress (Wei et al., 2003). Adenoviral infection In the present study, in an attempt to determine in situ PKA activation by shear stress in endothelial BAECs were infected at ~90% confluency with a cells, I chose to monitor phosphorylation of known recombinant adenovirus in serum-free DMEM for 1 and unknown endogenous targets of PKA. For the h and then incubated 48 h in a growth medium. detection of unknown targets, I took advantage of The recombinant adenoviral construct, Ad-Akt-Myr, the specific antibody raised against the consensus was used to express a constitutively active Akt mu- sequence of PKA substrates. Results of the current tants generated by fusing a myristoylation signal to study supported PKA stimulation by shear stress. its amino terminus (Fujio and Walsh, 1999; Boo et al., 2002b). Recombinant adenovirus encoding - galactosidase (Ad- -gal) was used as a control. Materials and Methods Cell culture and shear stress treatments Preparation of cell lysates and Western blot Following any treatment, BAECs were washed with Bovine aorta endothelial cells (BAECs) harvested ice-cold PBS and lysed in 0.75 ml of ice-cold lysis from descending thoracic aortas were maintained o buffer A (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, (37 C, 5% CO ) in a growth medium [Dulbecco’s 2 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium pyropho- modified Eagle’s medium (DMEM) containing 1 g/l glucose (Gibco) and 20% fetal bovine serum (FBS, sphate, 1 mM -glycerophosphate, 1 mM sodium Atlanta Biologicals) without antibiotics] (Boo et al., vanadate, 1 g/ml leupeptin, 1 mM PMSF, 1 M microcystin, and 1% Triton X-100). Cell lysates were 2002b). BAECs used in this study were between clarified by spinning at 14,000 rpm for 15 min at passages 5 and 10. 4oC. For the extraction of CREB, cells were lysed A confluent monolayer of BAECs grown in 100 in lysis buffer B (10 mM Tris-HCl, pH 7.6, 1 mM mm culture dish (Falcon) was exposed to laminar sodium vanadate and 1% SDS). The lysates were shear stress in a low serum-containing medium further homogenized by repeated aspiration through (phenol red-free DMEM containing 0.5% FBS and a 25-gauge needle. Protein content of each sample 25 mM Hepes, pH 7.4) by rotating a Teflon cone o was measured by using a Bio-Rad DC assay. (0.5 cone angle) as described previously (Boo et al., 2002a; b). Cells were exposed to an arterial Aliquots of cell lysates (20 g protein each) were 2 resolved on a 10% SDS-PAGE gel and transferred level of shear stress (15 dyn/cm ). to a polyvinylidene difluoride membrane (Millipore). The membrane was incubated with a primary anti- Expression vectors and transfection body overnight at 4oC and then with a secondary PKA-Cqr construct was a kind gift from Dr. G. Stanley antibody conjugated with alkaline phosphatases (1 McKnight, University of Washington. PKA-Cqr is a h at room temperature), which was detected by a constitutively active mutant of mouse PKA catalytic chemiluminescence method, as described previously Shear stress stimulates protein kinase A 65 (Boo et al., 2002a). Blots shown are representatives modulin (CaM) for 40 min at 37oC. Ca2+/CaM- of at least 3 independent studies. independent enzyme activity was measured in repli- cate samples by omitting CaCl2 and CaM from the incubation. All assays were carried out in the absence Immunoprecipitation or presence of eNOS inhibitor nitro-L-arginine methyl For the immunoprecipitation studies, monoclonal en- ester (L-NAME, 1 mM). Incubations were terminated dothelial nitric oxide synthase (eNOS) antibody or by adding 1 ml of ice-cold stop buffer (20 mM HEPES, non-immune IgG was bound to protein G-agarose 5 mM EDTA, pH 5.5). [3H]-L-Arginine was separated o beads by incubating for 1 h at 4 C.
Load more

Recommended publications
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Protein Kinase C As a Paradigm Alexandra C
    Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • GPCR Signaling Inhibits Mtorc1 Via PKA Phosphorylation of Raptor
    RESEARCH ARTICLE GPCR signaling inhibits mTORC1 via PKA phosphorylation of Raptor Jenna L Jewell1,2,3*, Vivian Fu4,5, Audrey W Hong4,5, Fa-Xing Yu6, Delong Meng1,2,3, Chase H Melick1,2,3, Huanyu Wang1,2,3, Wai-Ling Macrina Lam4,5, Hai-Xin Yuan4,5, Susan S Taylor4,7, Kun-Liang Guan4,5* 1Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, United States; 2Harold C Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, United States; 3Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, United States; 4Department of Pharmacology, University of California, San Diego, La Jolla, United States; 5Moores Cancer Center, University of California San Diego, La Jolla, United States; 6Children’s Hospital and Institutes of Biomedical Sciences, Fudan University, Shanghai, China; 7Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, United States Abstract The mammalian target of rapamycin complex 1 (mTORC1) regulates cell growth, metabolism, and autophagy. Extensive research has focused on pathways that activate mTORC1 like growth factors and amino acids; however, much less is known about signaling cues that directly inhibit mTORC1 activity. Here, we report that G-protein coupled receptors (GPCRs) paired to Gas proteins increase cyclic adenosine 3’5’ monophosphate (cAMP) to activate protein kinase A (PKA) and inhibit mTORC1. Mechanistically, PKA phosphorylates the mTORC1 component Raptor on Ser 791, leading to decreased mTORC1 activity. Consistently, in cells where Raptor Ser 791 is mutated to Ala, mTORC1 activity is partially rescued even after PKA activation. Gas-coupled GPCRs *For correspondence: stimulation leads to inhibition of mTORC1 in multiple cell lines and mouse tissues.
    [Show full text]
  • The Control of Phosphorylase Phosphatase by Camp-Dependent Protein Kinase
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Volume 82, number 2 FEBS LETTERS October 1977 THE CONTROL OF PHOSPHORYLASE PHOSPHATASE BY CAMP-DEPENDENT PROTEIN KINASE Pi1 GERGELY and Gyijrgy BOT Institute of Medical Chemistry, University of Medicine, H-4026 Debrecen, Bern t& 18/B, Hungary Received 22 July 1977 1. Introduction tissues which inhibits the phosphatase reaction is heat- stable [ 11 ,121. This heat-stable inhibitor protein is The enzymes of glycogen metabolism are regulated phosphorylated by CAMP-dependent protein kinase by interconversion between phosphorylated and dephos- [ 131. Recently, T&h et al. demonstrated the reversible phorylated forms. Contrary to our well-defined knowl- phosphorylation and dephosphorylation of this heat- edge of the phosphorylation processes of different stable inhibitor protein in vivo [ 143. Huang and Glins- enzymes and their role in glycogen breakdown and mann demonstrated the existence of two heat-stable synthesis, the phosphatases catalyzing the reverse inhibitor proteins for phosphatase [ 15,161. processes are only now being understood. The regula- Enzymic chemical modification of phosphorylase tion of dephosphorylation reactions is still unclear. phosphatase has not been established as a means of Phosphorylase phosphatase converts ‘active’ phos- regulation [ 171. phorylase a (EC 2.4.1.1) into ‘inactive’ phosphorylase In the present communication the effect of CAMP- b by cleavage of the phosphate groups from the serine dependent protein kinase on the phosphatase reaction residues. For the control of phosphorylase phospha- (i.e., on the dephosphorylation of phosphorylase a) tase the following mechanisms are possible: has been investigated.
    [Show full text]
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation
    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
    [Show full text]
  • Activation of Mtorc1 Is Essential for Β-Adrenergic Stimulation of Adipose Browning
    Downloaded from http://www.jci.org on May 2, 2016. http://dx.doi.org/10.1172/JCI83532 The Journal of Clinical Investigation RESEARCH ARTICLE Activation of mTORC1 is essential for β-adrenergic stimulation of adipose browning Dianxin Liu,1 Marica Bordicchia,1 Chaoying Zhang,1 Huafeng Fang,1 Wan Wei,1 Jian-Liang Li,1 Adilson Guilherme,2 Kalyani Guntur,2 Michael P. Czech,2 and Sheila Collins1 1Diabetes and Obesity Research Center, Sanford Burnham Prebys Medical Discovery Institute, Orlando, Florida, USA. 2Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts, USA. A classic metabolic concept posits that insulin promotes energy storage and adipose expansion, while catecholamines stimulate release of adipose energy stores by hydrolysis of triglycerides through β-adrenergic receptor (βARs) and protein kinase A (PKA) signaling. Here, we have shown that a key hub in the insulin signaling pathway, activation of p70 ribosomal S6 kinase (S6K1) through mTORC1, is also triggered by PKA activation in both mouse and human adipocytes. Mice with mTORC1 impairment, either through adipocyte-specific deletion of Raptor or pharmacologic rapamycin treatment, were refractory to the well-known βAR-dependent increase of uncoupling protein UCP1 expression and expansion of beige/brite adipocytes (so-called browning) in white adipose tissue (WAT). Mechanistically, PKA directly phosphorylated mTOR and RAPTOR on unique serine residues, an effect that was independent of insulin/AKT signaling. Abrogation of the PKA site within RAPTOR disrupted βAR/mTORC1 activation of S6K1 without affecting mTORC1 activation by insulin. Conversely, a phosphomimetic RAPTOR augmented S6K1 activity. Together, these studies reveal a signaling pathway from βARs and PKA through mTORC1 that is required for adipose browning by catecholamines and provides potential therapeutic strategies to enhance energy expenditure and combat metabolic disease.
    [Show full text]
  • AMP-Activated Protein Kinase: a Potential Therapeutic Target for Triple
    Cao et al. Breast Cancer Research (2019) 21:29 https://doi.org/10.1186/s13058-019-1107-2 REVIEW Open Access AMP-activated protein kinase: a potential therapeutic target for triple-negative breast cancer Wei Cao1,2, Jieqing Li2,3, Qiongyu Hao2, Jaydutt V Vadgama2* and Yong Wu2* Abstract Triple-negative breast cancer (TNBC) is an aggressive subset of breast carcinomas that lack expression of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER2). Unlike other breast cancer subtypes, targeted therapy is presently unavailable for patients with TNBC. In spite of initial responses to chemotherapy, drug resistance tends to develop rapidly and the prognosis of metastatic TNBC is poor. Hence, there is an urgent need for novel-targeted treatment methods or development of safe and effective alternatives with recognized mechanism(s) of action. AMP-activated protein kinase (AMPK), an energy sensor, can regulate protein and lipid metabolism responding to alterations in energy supply. In the past 10 years, interest in AMPK has increased widely since it appeared as an attractive targeting molecule for cancer therapy. There has been a deep understanding of the possible role of abnormal AMPK signaling pathways in the regulation of growth and survival and the development of drug resistance in TNBC. The increasing popularity of using AMPK regulators for TNBC- targeted therapy is supported by a considerable development in ascertaining the molecular pathways implicated. This review highlights the available evidence for AMPK-targeted anti-TNBC activity of various agents or treatment strategies, with special attention placed on recent preclinical and clinical advances in the manipulation of AMPK in TNBC.
    [Show full text]
  • The Role of GSK-3 in the Regulation of Protein Turnover, Myosin
    International Journal of Molecular Sciences Review The Role of GSK-3β in the Regulation of Protein Turnover, Myosin Phenotype, and Oxidative Capacity in Skeletal Muscle under Disuse Conditions Timur M. Mirzoev * , Kristina A. Sharlo and Boris S. Shenkman Myology Laboratory, Institute of Biomedical Problems RAS, 123007 Moscow, Russia; [email protected] (K.A.S.); [email protected] (B.S.S.) * Correspondence: [email protected] Abstract: Skeletal muscles, being one of the most abundant tissues in the body, are involved in many vital processes, such as locomotion, posture maintenance, respiration, glucose homeostasis, etc. Hence, the maintenance of skeletal muscle mass is crucial for overall health, prevention of various diseases, and contributes to an individual’s quality of life. Prolonged muscle inactivity/disuse (due to limb immobilization, mechanical ventilation, bedrest, spaceflight) represents one of the typical causes, leading to the loss of muscle mass and function. This disuse-induced muscle loss primarily results from repressed protein synthesis and increased proteolysis. Further, prolonged disuse results in slow-to-fast fiber-type transition, mitochondrial dysfunction and reduced oxidative capacity. Glycogen synthase kinase 3β (GSK-3β) is a key enzyme standing at the crossroads of various signaling pathways regulating a wide range of cellular processes. This review discusses various important roles of GSK-3β in the regulation of protein turnover, myosin phenotype, and oxidative capacity in skeletal muscles under disuse/unloading conditions and subsequent recovery. According Citation: Mirzoev, T.M.; Sharlo, K.A.; to its vital functions, GSK-3β may represent a perspective therapeutic target in the treatment of Shenkman, B.S. The Role of GSK-3β muscle wasting induced by chronic disuse, aging, and a number of diseases.
    [Show full text]
  • MTOR Signaling and Metabolism in Early T Cell Development
    G C A T T A C G G C A T genes Review MTOR Signaling and Metabolism in Early T Cell Development Guy Werlen, Ritika Jain and Estela Jacinto * Department of Biochemistry and Molecular Biology, Robert Wood Johnson Medical School, Rutgers University, Piscataway, NJ 08854, USA; [email protected] (G.W.); [email protected] (R.J.) * Correspondence: [email protected]; Tel.: +1-732-235-4476 Abstract: The mechanistic target of rapamycin (mTOR) controls cell fate and responses via its func- tions in regulating metabolism. Its role in controlling immunity was unraveled by early studies on the immunosuppressive properties of rapamycin. Recent studies have provided insights on how metabolic reprogramming and mTOR signaling impact peripheral T cell activation and fate. The contribution of mTOR and metabolism during early T-cell development in the thymus is also emerging and is the subject of this review. Two major T lineages with distinct immune functions and peripheral homing organs diverge during early thymic development; the αβ- and γδ-T cells, which are defined by their respective TCR subunits. Thymic T-regulatory cells, which have immunosup- pressive functions, also develop in the thymus from positively selected αβ-T cells. Here, we review recent findings on how the two mTOR protein complexes, mTORC1 and mTORC2, and the signaling molecules involved in the mTOR pathway are involved in thymocyte differentiation. We discuss emerging views on how metabolic remodeling impacts early T cell development and how this can be mediated via mTOR signaling. Keywords: mTOR; mTORC1; mTORC2; thymocytes; T lymphocytes; early T cell development; T-cell metabolism Citation: Werlen, G.; Jain, R.; Jacinto, E.
    [Show full text]