DOCSLIB.ORG

REVIEW Specificity and Spatial Dynamics of Protein Kinase A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
REVIEW Specificity and Spatial Dynamics of Protein Kinase A 271 REVIEW Specificity and spatial dynamics of protein kinase A signaling organized by A-kinase-anchoring proteins Guillaume Pidoux and Kjetil Taske´n Biotechnology Centre of Oslo and Centre for Molecular Medicine, Nordic EMBL Partnership, University of Oslo, PO Box 1125, Blindern, N-0317 Oslo, Norway (Correspondence should be addressed to K Taske´n; Email: [email protected]) Abstract Protein phosphorylation is the most common post-translational modification observed in cell signaling and is controlled by the balance between protein kinase and phosphatase activities. The cAMP–protein kinase A (PKA) pathway is one of the most studied and well-known signal pathways. To maintain a high level of specificity, the cAMP–PKA pathway is tightly regulated in space and time. A-kinase-anchoring proteins (AKAPs) target PKA to specific substrates and distinct subcellular compartments providing spatial and temporal specificity in the mediation of biological effects controlled by the cAMP–PKA pathway. AKAPs also serve as scaffolding proteins that assemble PKA together with signal terminators such as phosphoprotein phosphatases and cAMP-specific phosphodiesterases as well as components of other signaling pathways into multiprotein-signaling complexes. Journal of Molecular Endocrinology (2010) 44, 271–284 Introduction spatiotemporal regulation of cellular signaling and constitutes a concept by which a common signaling In multicellular organisms, cell signaling constitutes pathway can perform many different functions. One of communication mechanisms between and inside cells the best-characterized signal transduction pathways is to ensure coordinated behavior of the organism and the cAMP-signaling pathway where ligand binding to G to regulate various biological processes such as cell protein-coupled receptors (GPCRs) via G proteins and proliferation, development, metabolism, gene adenylyl cyclase (AC) leads to an intracellular increase expression, and other more specialized functions of in the levels of the second messenger cAMP. Next, this specific target cells and tissues. Intracellularly, the leads to activation of effector molecules such as cAMP- systems for cellular communication transmit infor- dependent protein kinase A (PKA; Tasken & Aandahl mation based on well-controlled post-translational 2004, Beene & Scott 2007, Taylor et al. 2008; Fig. 1). modifications. Protein phosphorylation is one of the Transmembrane and intracellular signaling pathways most common post-translational modifications and is require a high level of spatial and temporal regulation controlled by the opposing actions of various specific to convey the appropriate inputs. The temporal control protein kinases and phosphatases (PPs). The phos- of the cAMP-signaling pathway is not only due to signal phorylation status of a protein may affect its enzymatic generation by the AC, but also depends on the action activity, cellular localization, and/or association with of cAMP–phosphodiesterases (PDEs), and different other proteins. Kinases and phosphatases have a central cell types may have high or low constitutive turnover role in signal transduction pathways and differ in of cAMP (Baillie et al. 2005, Conti & Beavo 2007). substrate specificity, acting on serine, threonine, or Moreover, spatial control is achieved through associ- tyrosine residues. Since protein phosphorylation affects ation with anchoring proteins that ensure specificity in many cellular processes, its regulation must be specific signal transduction by placing enzymes close to their and act on a defined subset of cellular targets to cognate effectors and substrates. A-kinase-anchoring ensure signal fidelity. Specificity is achieved through proteins (AKAPs) provide the means to achieve both assembly of distinct complexes of enzymes at subcel- spatial control of PKA signaling by regulating proximity lular localizations by anchoring and scaffolding as well as facilitating good temporal control by placing proteins (for review, see Scott & Pawson (2009)). PKA optimally versus small pools of cAMP that are Thus, organization of anchoring provides means for discretely temporally regulated. Indeed, AKAPs target Journal of Molecular Endocrinology (2010) 44, 271–284 DOI: 10.1677/JME-10-0010 0952–5041/10/044–271 q 2010 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/27/2021 09:45:18AM via free access 272 G PIDOUX and K TASKE´ N . Specificity and spatial dynamics of PKA signaling Adenylyl cyclase cAMP-gated ion cAMP signaling and compartmentalization channels Heterotrimeric G proteins are comprised of a, b, and g subunits (Ga,Gb, and Gg). In the resting state, the a Gβy subunit is bound to GDP and is associated with bg Gαs G-protein coupled 4 subunits. The GDP-bound heterotrimer is coupled to receptor GPCRs, which upon binding of an extracellular ligand 2 Epac Local pool of activates the trimeric G protein by increasing the rate of 3 cAMP GDP–GTP exchange on the Ga subunit. The GTP- PDEs bound, active, Ga subunit dissociates from the Gbg CCAnchored PDEs subunits; these subunits then activate their respective Anchored PKA AKAP 1 effectors. The ubiquitously expressed G protein Gas mediate receptor-dependent activation of one of several isoforms of AC resulting in increase in Figure 1 cAMP signal pathways. Ligand binding to various G protein-coupled receptors (GPCRs) activates adenylyl cyclase intracellular cAMP synthesized from ATP. cAMP in their proximity and generates pools of cAMP. The local mediates its effects through several effector molecules concentration and distribution of the cAMP gradient are limited by including PKA (Walsh et al. 1968), exchange proteins phosphodiesterases (PDEs). Particular GPCRs are confined to activated by cAMP (Epac; De Rooij et al. 1998, Kawasaki specific domains of the cell membrane in association with intracellular organelles or cytoskeletal constituents. The sub- et al. 1998), and the cyclic nucleotide-gated ion cellular structures may harbor specific isozymes of PKA that, channels (Nakamura & Gold 1987). For review and through anchoring via AKAPs, are localized in the vicinity of the references, see Tasken & Aandahl (2004), Bos (2006), receptor and the cyclase. PDEs are also anchored and serve to Beene & Scott (2007), Taylor et al. (2008) and Biel limit the extension and duration of cAMP gradients. These mechanisms serve to localize and limit the assembly and (2009) and Fig. 1. triggering of specific pathways to a defined area of the cell close Live-cell imaging and fluorescence resonance energy to the substrate. cAMP (red filled circles) has effects on a range transfer (FRET) have allowed for the visualization of of effector molecules encompassing 1) PKA, 2) PDEs, 3) guanine microdomains with a high concentration cAMP, indi- nucleotide exchange factors (GEFs) known as exchange proteins activated by cAMP (Epacs), and 4) cyclic nucleotide-gated cating that cAMP accumulation is restricted to specific ion channels. locations within the cell (Zaccolo & Pozzan 2002). The compartmentalized pools of cAMP are controlled in space and time by ACs and PDEs inside the cell. PKA to their specific substrates and assemble multi- While a family of nine membrane-bound AC isoforms is protein signal complexes that also include phospho- responsible for the production of cAMP (Hanoune & protein phosphatases and PDEs, which control the Defer 2001, Cooper 2003), the termination of cAMP temporal aspect of the regulation of the cAMP-signaling signaling is conferred by a large superfamily of enzymes pathway (Michel & Scott 2002, Tasken & Aandahl including over 40 different PDE isozyme variants that 2004, Baillie et al. 2005; Fig. 2). The role of AKAPs in the catalyze the degradation of cAMP into AMP (Baillie specificity of cAMP signal transduction is discussed in et al. 2005, Lugnier 2006). The intracellular concen- this review. trations of cAMP are therefore regulated by the AB AKAP amphipathic helix peptide N C PKA holoenzyme N N' CC Helix A' Helix A 1 3 AKAP Antiparallel RII 1–45 dimer 2 Subcellular targeting domains Helix B' Helix B Organelle C' C Figure 2 Illustration of AKAP properties. (A) AKAPs share three common properties: 1) AKAPs bind to the regulatory subunit of PKA through a conserved anchoring domain; 2) a unique subcellular targeting domain directs AKAP-signaling complexes to discrete locations inside a cell; and 3) additional binding sites for other signaling proteins such as kinases, phosphatases, or potential substrates. (B) Ribbon diagram of the NMR structure of RIIa (1–43) dimer (yellow, blue, and red) and the AKAP amphipathic helix peptide (green; Newlon et al. 2001) depicted using Accelrys Discovery Studio 2.5.1 based on the coordinates from PDB (http://www.rcsb.org/pdb/explore/explore.do?structureIdZ2DRN). Journal of Molecular Endocrinology (2010) 44, 271–284 www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/27/2021 09:45:18AM via free access Specificity and spatial dynamics of PKA signaling . G PIDOUX and K TASKE´ N 273 counterbalancing activities of ACs and PDEs that extended, highly disordered linker that contains an establish local pools of cAMP close to the effector autoinhibitory sequence and several putative phos- molecules (Conti & Jin 1999, Houslay & Adams 2003). phorylation sites. All PKA isoforms display high A local pool of cAMP can be generated by a distinct sequence homology in the D/D domain and the ligand and lead the signal to follow a specific route cAMP-binding
Load more

Recommended publications
  • Exome Sequencing in Bipolar Disorder Reveals Shared Risk Gene AKAP11 with Schizophrenia
    medRxiv preprint doi: https://doi.org/10.1101/2021.03.09.21252930; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . Exome sequencing in bipolar disorder reveals shared risk gene AKAP11 with schizophrenia Duncan S Palmer1,2,*, Daniel P Howrigan1,2, Sinéad B Chapman2, Rolf Adolfsson3, Nick Bass4, Douglas Blackwood5, Marco PM Boks6, Chia-Yen Chen7,1,2, Claire Churchhouse1,8,2, Aiden P Corvin9, Nicholas Craddock10, David Curtis11,12, Arianna Di Florio13, Faith Dickerson14, Fernando S Goes15, Xiaoming Jia16, Ian Jones10, Lisa Jones17, Lina Jonsson18,19, Rene S Kahn20, Mikael Landén18,21, Adam Locke22, Andrew McIntosh5, Andrew McQuillin4, Derek W Morris23, Michael C O'Donovan24, Roel A Ophoff 25,26, Michael J Owen24, Nancy Pedersen21, Danielle Posthuma27, Andreas Reif28, Neil Risch29, Catherine Schaefer30, Laura Scott31, Tarjinder Singh1,2, Jordan W Smoller32,33, Matthew Solomonson8, David St. Clair34, Eli A Stahl 35, Annabel Vreeker26, James Walters24, Weiqing Wang35, Nicholas A Watts 8, Robert Yolken36, Peter Zandi15, and Benjamin M Neale1,8,2,*. NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2021.03.09.21252930; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • The Title of the Article
    Mechanism-Anchored Profiling Derived from Epigenetic Networks Predicts Outcome in Acute Lymphoblastic Leukemia Xinan Yang, PhD1, Yong Huang, MD1, James L Chen, MD1, Jianming Xie, MSc2, Xiao Sun, PhD2, Yves A Lussier, MD1,3,4§ 1Center for Biomedical Informatics and Section of Genetic Medicine, Department of Medicine, The University of Chicago, Chicago, IL 60637 USA 2State Key Laboratory of Bioelectronics, Southeast University, 210096 Nanjing, P.R.China 3The University of Chicago Cancer Research Center, and The Ludwig Center for Metastasis Research, The University of Chicago, Chicago, IL 60637 USA 4The Institute for Genomics and Systems Biology, and the Computational Institute, The University of Chicago, Chicago, IL 60637 USA §Corresponding author Email addresses: XY: [email protected] YH: [email protected] JC: [email protected] JX: [email protected] XS: [email protected] YL: [email protected] - 1 - Abstract Background Current outcome predictors based on “molecular profiling” rely on gene lists selected without consideration for their molecular mechanisms. This study was designed to demonstrate that we could learn about genes related to a specific mechanism and further use this knowledge to predict outcome in patients – a paradigm shift towards accurate “mechanism-anchored profiling”. We propose a novel algorithm, PGnet, which predicts a tripartite mechanism-anchored network associated to epigenetic regulation consisting of phenotypes, genes and mechanisms. Genes termed as GEMs in this network meet all of the following criteria: (i) they are co-expressed with genes known to be involved in the biological mechanism of interest, (ii) they are also differentially expressed between distinct phenotypes relevant to the study, and (iii) as a biomodule, genes correlate with both the mechanism and the phenotype.
    [Show full text]
  • Gpr161 Anchoring of PKA Consolidates GPCR and Camp Signaling
    Gpr161 anchoring of PKA consolidates GPCR and cAMP signaling Verena A. Bachmanna,1, Johanna E. Mayrhofera,1, Ronit Ilouzb, Philipp Tschaiknerc, Philipp Raffeinera, Ruth Röcka, Mathieu Courcellesd,e, Federico Apeltf, Tsan-Wen Lub,g, George S. Baillieh, Pierre Thibaultd,i, Pia Aanstadc, Ulrich Stelzlf,j, Susan S. Taylorb,g,2, and Eduard Stefana,2 aInstitute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, 6020 Innsbruck, Austria; bDepartment of Chemistry and Biochemistry, University of California, San Diego, CA 92093; cInstitute of Molecular Biology, University of Innsbruck, 6020 Innsbruck, Austria; dInstitute for Research in Immunology and Cancer, Université de Montréal, Montreal, QC, Canada H3C 3J7; eDépartement de Biochimie, Université de Montréal, Montreal, QC, Canada H3C 3J7; fOtto-Warburg Laboratory, Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany; gDepartment of Pharmacology, University of California, San Diego, CA 92093; hInstitute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, G12 8QQ, United Kingdom; iDepartment of Chemistry, Université de Montréal, Montreal, QC, Canada H3C 3J7; and jInstitute of Pharmaceutical Sciences, Pharmaceutical Chemistry, University of Graz, 8010 Graz, Austria Contributed by Susan S. Taylor, May 24, 2016 (sent for review February 18, 2016; reviewed by John J. G. Tesmer and Mark von Zastrow) Scaffolding proteins organize the information flow from activated G accounts for nanomolar binding affinities to PKA R subunit dimers protein-coupled receptors (GPCRs) to intracellular effector cascades (12, 13). Moreover, additional components of the cAMP signaling both spatially and temporally. By this means, signaling scaffolds, such machinery, such as GPCRs, adenylyl cyclases, and phosphodiester- as A-kinase anchoring proteins (AKAPs), compartmentalize kinase ases, physically interact with AKAPs (1, 5, 11, 14).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Emerging Genetic Alterations Linked to Male Infertility: X-Chromosome Copy Number Variation and Spermatogenesis Regulatory Genes’ Expression
    Central Annals of Reproductive Medicine and Treatment Bringing Excellence in Open Access Research Article *Corresponding author Susana Fernandes, Department of Genetics, Faculty of Medicine of University of Porto, Al. Prof. Hernâni Emerging Genetic Alterations Monteiro, 4200 - 319 Porto, Portugal; Tel: 351 22 551 36 47; Email: Submitted: 12 October 2016 Linked to Male Infertility: Accepted: 10 February 2017 Published: 14 February 2017 X-Chromosome Copy Number Copyright © 2017 Fernandes et al. Variation and Spermatogenesis OPEN ACCESS Keywords Regulatory Genes’ Expression • Male infertility • Spermatogenesis Catarina Costa1, Maria João Pinho1,2, Alberto Barros1,2,3, and • DNA copy number variations • Gene expression Susana Fernandes1,2* 1Department of Genetics, Faculty of Medicine of University of Porto, Portugal 2i3S – Instituto de Investigação e Inovação em Saúde, University of Porto, Portugal 3Centre for Reproductive Genetics A Barros, Portugal Abstract The etiopathogenesis of primary testicular failure remains undefined in 50% of cases. Most of these idiopathic cases probably result from genetic mutations/anomalies. Novel causes, like Copy Number Variation and gene expression profile, are being explored thanks to recent advances in the field of genetics. Our aim was to study Copy Number Variation (CNV) 67, a patient-specific CNV related to spermatogenic anomaly and evaluate the expression of regulatory genes AKAP4, responsible for sperm fibrous sheet assembly, and STAG3, essential for sister chromatid cohesion during meiosis. One hundred infertile men were tested for CNV67 with quantitative PCR (qPCR). Quantitative real-time PCR was performed to evaluate gene expression patterns of the two mentioned genes in testicular biopsies from 22 idiopathic infertile patients. CNV67 deletion was found in 2% of patients, with the same semen phenotype described in previous studies.
    [Show full text]
  • Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1
    BIOLOGY OF REPRODUCTION 78, 184–192 (2008) Published online before print 10 October 2007. DOI 10.1095/biolreprod.107.062943 Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1 Sarah E. Fiedler, Malini Bajpai, and Daniel W. Carr2 Department of Medicine, Oregon Health & Sciences University and Veterans Affairs Medical Center, Portland, Oregon 97239 ABSTRACT Guanine nucleotide exchange factors (GEFs) catalyze the GDP for GTP exchange [2]. Activation is negatively regulated by In somatic cells, RHOA mediates actin dynamics through a both guanine nucleotide dissociation inhibitors (RHO GDIs) GNA13-mediated signaling cascade involving RHO kinase and GTPase-activating proteins (GAPs) [1, 2]. Endogenous (ROCK), LIM kinase (LIMK), and cofilin. RHOA can be RHO can be inactivated via C3 exoenzyme ADP-ribosylation, negatively regulated by protein kinase A (PRKA), and it and studies have demonstrated RHO involvement in actin-based interacts with members of the A-kinase anchoring (AKAP) cytoskeletal response to extracellular signals, including lyso- family via intermediary proteins. In spermatozoa, actin poly- merization precedes the acrosome reaction, which is necessary phosphatidic acid (LPA) [2–4]. LPA is known to signal through for normal fertility. The present study was undertaken to G-protein-coupled receptors (GPCRs) [4, 5]; specifically, LPA- determine whether the GNA13-mediated RHOA signaling activated GNA13 (formerly Ga13) promotes RHO activation pathway may be involved in acrosome reaction in bovine through GEFs [4, 6]. Activated RHO-GTP then signals RHO caudal sperm, and whether AKAPs may be involved in its kinase (ROCK), resulting in the phosphorylation and activation targeting and regulation. GNA13, RHOA, ROCK2, LIMK2, and of LIM-kinase (LIMK), which in turn phosphorylates and cofilin were all detected by Western blot in bovine caudal inactivates cofilin, an actin depolymerizer, the end result being sperm.
    [Show full text]
  • Instability of the Pseudoautosomal Boundary in House Mice
    Genetics: Early Online, published on April 26, 2019 as 10.1534/genetics.119.302232 Article/Investigation Instability of the pseudoautosomal boundary in house mice Andrew P Morgan∗, Timothy A Bell∗, James J Crowley∗; y; z, and Fernando Pardo-Manuel de Villena∗ ∗Department of Genetics and Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC yDepartment of Psychiatry, University of North Carolina, Chapel Hill, NC zDepartment of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden April 26, 2019 Corresponding authors: Andrew P Morgan ([email protected]) Fernando Pardo-Manuel de Villena ([email protected]) 5049C Genetic Medicine Building Department of Genetics University of North Carolina Chapel Hill NC 27599-7264 Keywords: meiosis, recombination, pseudoautosomal region, sex chromosome evolution 1 Copyright 2019. Abstract Faithful segregation of homologous chromosomes at meiosis requires pairing and recombination. In taxa with dimorphic sex chromosomes, pairing between them in the heterogametic sex is limited to a narrow inter- val of residual sequence homology known as the pseudoautosomal region (PAR). Failure to form the obligate crossover in the PAR is associated with male infertility in house mice (Mus musculus) and humans. Yet despite this apparent functional constraint, the boundary and organization of the PAR is highly variable in mammals, and even between subspecies of mice. Here we estimate the genetic map in a previously-documented ex- pansion of the PAR in the Mus musculus castaneus subspecies and show that the local recombination rate is 100-fold higher than the autosomal background. We identify an independent shift in the PAR boundary in the Mus musculus musculus subspecies and show that it involves a complex rearrangement but still recombines in heterozygous males.
    [Show full text]
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • G-Protein-Coupled Receptor Signaling and Polarized Actin Dynamics Drive
    RESEARCH ARTICLE elifesciences.org G-protein-coupled receptor signaling and polarized actin dynamics drive cell-in-cell invasion Vladimir Purvanov, Manuel Holst, Jameel Khan, Christian Baarlink, Robert Grosse* Institute of Pharmacology, University of Marburg, Marburg, Germany Abstract Homotypic or entotic cell-in-cell invasion is an integrin-independent process observed in carcinoma cells exposed during conditions of low adhesion such as in exudates of malignant disease. Although active cell-in-cell invasion depends on RhoA and actin, the precise mechanism as well as the underlying actin structures and assembly factors driving the process are unknown. Furthermore, whether specific cell surface receptors trigger entotic invasion in a signal-dependent fashion has not been investigated. In this study, we identify the G-protein-coupled LPA receptor 2 (LPAR2) as a signal transducer specifically required for the actively invading cell during entosis. We find that 12/13G and PDZ-RhoGEF are required for entotic invasion, which is driven by blebbing and a uropod-like actin structure at the rear of the invading cell. Finally, we provide evidence for an involvement of the RhoA-regulated formin Dia1 for entosis downstream of LPAR2. Thus, we delineate a signaling process that regulates actin dynamics during cell-in-cell invasion. DOI: 10.7554/eLife.02786.001 Introduction Entosis has been described as a specialized form of homotypic cell-in-cell invasion in which one cell actively crawls into another (Overholtzer et al., 2007). Frequently, this occurs between tumor cells such as breast, cervical, or colon carcinoma cells and can be triggered by matrix detachment (Overholtzer et al., 2007), suggesting that loss of integrin-mediated adhesion may promote cell-in-cell invasion.
    [Show full text]
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]