The Glycogen Phosphorylase

Total Page:16

File Type:pdf, Size:1020Kb

The Glycogen Phosphorylase Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1999 The glycogen phosphorylase/ phosphorylase kinase interaction: effects of mutations in the amino-terminal region of glycogen phosphorylase Alyssa Christine Biorn Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Biochemistry Commons, and the Molecular Biology Commons Recommended Citation Biorn, Alyssa Christine, "The glycogen phosphorylase/ phosphorylase kinase interaction: effects of mutations in the amino-terminal region of glycogen phosphorylase " (1999). Retrospective Theses and Dissertations. 12198. https://lib.dr.iastate.edu/rtd/12198 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book. Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. Belt & Howell Information and Learning 300 North Zeeb Road, Ann Artxsr, Ml 48106-1346 USA 800-521-0600 The glycogen phosphorylase/ phosphorylase kinase interaction: Effects of mutations in the araino-terminal region of glycogen phosphorylase by Alyssa Christine Biom A dissertation submitted to the graduate facility in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Molecular, Cellular and Developmental Biology Major Professor: Donald J. Graves Iowa State University Ames, Iowa 1999 UMI Nxjmber: 9941789 UMI Microform 9941789 Copyriglit 1999, by UMI Company. All rights reserved. This microform edition is protected agaiast unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 ii Graduate College Iowa State University This is to certify that the Doctoral dissertation of Alyssa Christine Biom has met the dissertation requirements of Iowa State University Signature was redacted for privacy. Signature was redacted for privacy. Signature was redacted for privacy. iii TABLE OF CONTENTS GENERAL INTRODUCTION 1 Glycogen Phosphorylase 1 Early history of Glycogen Phosphorylase 1 General GP characteristics 4 Regulation of GP activity 8 Conformation of phosphorylase 9 Phosphorylase Kinase 12 General characteristics 12 The Y catalytic subunit 13 Substrate specificity 15 Interaction of Phosphorylase with Phosphorylase Kinase 17 Experimental Rationale and Dissertation Organization 19 References 20 SITE-DIRECTED MUTANTS OF GLYCOGEN PHOSPHORYLASE ARE ALTERED IN THEIR INTERACTION WITH PHOSPHORYLASE KINASE 26 Abstract 26 Introduction 27 Experimental Procedures 29 Materials 29 Mutagenesis 29 Protein Expression and Purification 30 Phosphorylation Assays 30 Kinetics 31 Results 32 Mutagenesis 32 Interaction of mutants with Y(1-300) 33 Interaction of GP mutants with a mutant of Y(1-300), yEllOK 34 Interaction of GP mutants with Protein ECinase A 35 Discussion 36 References 41 GLYCOGEN PHOSPHORYLASE LIGAND-BINDING PROPERTIES ARE ALTERED BY SINGLE SITE MUTATIONS IN ITS AMINO- TERMINAL REGION 60 Abstract 60 Introduction 61 iv Experimental Procedures 63 Materials 63 Mutagenesis 64 Protein Expression and Purification 64 AMP Activation Assays 65 Phosphorylation Assays 65 Results 66 Activity and AMP-binding characteristics 66 Conformational effects on phosphorylation 68 Phos. a activity of GP mutants 69 Discussion 70 References 76 GENERAL CONCLUSIONS 97 ACKNOWLEDGMENTS 101 1 GENERAL INTRODUCTION Glycogen Phosphorylase Early history of Glycogen Phosphorylase Muscle glycogen phosphorylase (a-l,4-glucan:orthophosphate glucosyltransferase, EC 2.4.1.1) is an important en2yme in carbohydrate metabolism. The homodimeric enzyme utilizes inorganic phosphate in the removal of one glucose unit from the non-reducing end of the storage polysaccharide, glycogen. a-D-Glucose-l-phosphate is produced in this reaction, which is then converted to glucose-6-phosphate, used for the formation of ATP, the cell's energy soxirce. Glycogen phosphorylase (GP) is one of the longest- and most extensively-studied enzymes and has a rich and interesting "history". Glycogen phosphorylase was first discovered as a phosphorylase activity towards glycogen in rabbit skeletal muscle extracts by Carl and Gerty Cori in the mid-1930's (1). This phosphorylase activity required adenosine-5'- monophosphate (AMP) for activity and was shown to release the product glucose-l-phosphate (GIP) (2). The AMP required for activity was thought to be tightly bound to the phosphorylase protein and to be catalytic; in other words, a coenzyme. In time, two forms of phosphorylase were shown to exist: one which had no activity in the absence of AMP, termed phosphorylase ^ and one form which had 60-70% of its maximal activity in the absence of added AMP, termed phosphorylase a (3). Because phos. b required AMP for activity and phos. a did not, it was assumed that AMP was already present in the phos. a form, and therefore did not require its addition (3). During the isolation of phosphorylase, another protein was found in the muscle extracts which converted phos. a to phos. b. The enzyme was named the 2 "PR Enzyme" for "prosthetic removing", as it was assumed to remove the prosthetic group AMP from phos. a (4), even though no free adenylic add could be detected after incubation of phos. a with PR. Keller and Cori, in 1953, proposed a change of the name from "prosthetic-removing" to "phosphorylase- rupttiring" when they foimd that, along with the conversion of phos. a to b, PR caused a halving of the weight of phosphorylase, as determined by sedimentation velocity (5). They could not say how this halving was accomplished, however. At about the same time another group of investigators, Edwin Krebs and Edmond Fischer, found mostly phos. b when they purified muscle phosphorylase, while the Cori group obtained phos. a (6). They determined that this difference was not due to contaminating PR enzyme in the phosphorylase preparations. The only difference between their methods was that Krebs and Fischer did not filter the extracts through paper. Until this time, phos. a was believed to be the GP form found in resting muscle, but this work of BCrebs and Fischer showed that it was phos. b instead. They found that the presence of contaminating divalent metal ions either in tap water used for extraction, or on the filter papers, caused conversion of phos. b to phos. a during the purification process (7). They could also cause a conversion of phos. b to a by adding crude muscle extracts plus divalent metal ioris to purified phosphorylase b. ATP was needed, however, if the extract was not used right away. In addition, this conversion was inhibited by EDTA. Krebs and Fischer believed this conversion process to be enzyme-catalyzed, as a protein fraction of the extract was also required (7). In 1956, this protein fraction was isolated and studied further as the phosphorylase "converting enzyme" (8). Using ^^P, they demonstrated that 2 3 mol were incorporated into 1 mol of phosphorylase b upon incubation with converting enzyme. This was the first demonstration of phosphate incorporation into GP and led Krebs and Fischer to believe that this might be a kinase reaction (8). Kinases had not previously been observed to have protein substrates. Importantly, they also fotmd that 32p was released when 32p-phos- a was converted to phos. b by the PR enzyme (8, 9). The work of all these researchers was extremely significant in that this was the first observation of reversible phosphorylation of an enzyme to regulate its activity. We now know the "converting enzyme" to be phosphorylase kinase (10), and "PR" to be phosphorylase phosphatase (II), or protein phosphatase-1 (12). These two enzjnnes work in concert to modulate the activity of phosphorylase to control the rate of glycogenolysis. This work made up the first twenty years of study on glycogen phosphorylase and its complex system of regulation. It is very interesting to read these older papers and discover how insightful the researchers of the time were about such a new kind of enzymatic regulation. Glycogen
Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • The Effects of Acute Nicotinamide Riboside Supplementation
    THE EFFECTS OF ACUTE NICOTINAMIDE RIBOSIDE SUPPLEMENTATION ON SUBSTRATE UTILISATION AND 5KM TIME-TRIAL PERFORMANCE By ELIZABETH LOUISE GRAY A thesis submitted to The University of Birmingham for the degree of MASTERS BY RESEARCH School of Sport, Exercise and Rehabilitation Sciences College of Life and Environmental Studies University of Birmingham August 2018 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Nicotinamide Riboside (NR) administration has been shown to increase fat oxidation and improve endurance performance in rodents, whilst recent research has proven it is safe for human consumption. The present study aimed to investigate the influence of acute NR supplementation on substrate utilisation and exercise performance in humans. In this counter-balanced, crossover design study, eleven recreationally-active males performed a 60-minute bout of cycling at 55% VO2max, followed by a 5km time-trial. Participants completed this twice during visits separated by at least one week, once following the consumption of 1000mg NR, and the other following placebo consumption. The contribution of fat oxidation to total substrate utilisation was not significantly different between the NR and placebo conditions during steady-state exercise (22.3±9.0% and 19.6±7.3%, respectively; p < 0.05).
    [Show full text]
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides
    catalysts Review α-Glucan Phosphorylase-Catalyzed Enzymatic Reactions Using Analog Substrates to Synthesize Non-Natural Oligo- and Polysaccharides Jun-ichi Kadokawa Department of Chemistry, Biotechnology, and Chemical Engineering, Graduate School of Science and Engineering, Kagoshima University, 1-21-40 Korimoto, Kagoshima 860-0065, Japan; [email protected]; Tel.: +81-99-285-7743 Received: 9 October 2018; Accepted: 16 October 2018; Published: 19 October 2018 Abstract: As natural oligo- and polysaccharides are important biomass resources and exhibit vital biological functions, non-natural oligo- and polysaccharides with a well-defined structure can be expected to act as new functional materials with specific natures and properties. α-Glucan phosphorylase (GP) is one of the enzymes that have been used as catalysts for practical synthesis of oligo- and polysaccharides. By means of weak specificity for the recognition of substrates by GP, non-natural oligo- and polysaccharides has precisely been synthesized. GP-catalyzed enzymatic glycosylations using several analog substrates as glycosyl donors have been carried out to produce oligosaccharides having different monosaccharide residues at the non-reducing end. Glycogen, a highly branched natural polysaccharide, has been used as the polymeric glycosyl acceptor and primer for the GP-catalyzed glycosylation and polymerization to obtain glycogen-based non-natural polysaccharide materials. Under the conditions of removal of inorganic phosphate, thermostable GP-catalyzed enzymatic polymerization of analog monomers occurred to give amylose analog polysaccharides. Keywords: analog substrate; α-glucan phosphorylase; non-natural oligo- and polysaccharides 1. Introduction Oligo- and polysaccharides are widely distributed in nature and enact specific important biological functions in accordance with their chemical structures [1].
    [Show full text]
  • Defective Galactose Oxidation in a Patient with Glycogen Storage Disease and Fanconi Syndrome
    Pediatr. Res. 17: 157-161 (1983) Defective Galactose Oxidation in a Patient with Glycogen Storage Disease and Fanconi Syndrome M. BRIVET,"" N. MOATTI, A. CORRIAT, A. LEMONNIER, AND M. ODIEVRE Laboratoire Central de Biochimie du Centre Hospitalier de Bichre, 94270 Kremlin-Bicetre, France [M. B., A. C.]; Faculte des Sciences Pharmaceutiques et Biologiques de I'Universite Paris-Sud, 92290 Chatenay-Malabry, France [N. M., A. L.]; and Faculte de Midecine de I'Universiti Paris-Sud et Unite de Recherches d'Hepatologie Infantile, INSERM U 56, 94270 Kremlin-Bicetre. France [M. 0.1 Summary The patient's diet was supplemented with 25-OH-cholecalci- ferol, phosphorus, calcium, and bicarbonate. With this treatment, Carbohydrate metabolism was studied in a child with atypical the serum phosphate concentration increased, but remained be- glycogen storage disease and Fanconi syndrome. Massive gluco- tween 0.8 and 1.0 mmole/liter, whereas the plasma carbon dioxide suria, partial resistance to glucagon and abnormal responses to level returned to normal (18-22 mmole/liter). Rickets was only carbohydrate loads, mainly in the form of major impairment of partially controlled. galactose utilization were found, as reported in previous cases. Increased blood lactate to pyruvate ratios, observed in a few cases of idiopathic Fanconi syndrome, were not present. [l-14ClGalac- METHODS tose oxidation was normal in erythrocytes, but reduced in fresh All studies of the patient and of the subjects who served as minced liver tissue, despite normal activities of hepatic galactoki- controls were undertaken after obtaining parental or personal nase, uridyltransferase, and UDP-glucose 4epirnerase in hornog- consent. enates of frozen liver.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Protein Kinase C As a Paradigm Alexandra C
    Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily.
    [Show full text]
  • Chem331 Glycogen Metabolism
    Glycogen metabolism Glycogen review - 1,4 and 1,6 α-glycosidic links ~ every 10 sugars are branched - open helix with many non-reducing ends. Effective storage of glucose Glucose storage Liver glycogen 4.0% 72 g Muscle glycogen 0.7% 245 g Blood Glucose 0.1% 10 g Large amount of water associated with glycogen - 0.5% of total weight Glycogen stored in granules in cytosol w/proteins for synthesis, degradation and control There are very different means of control of glycogen metabolism between liver and muscle Glycogen biosynthetic and degradative cycle Two different pathways - which do not share enzymes like glycolysis and gluconeogenesis glucose -> glycogen glycogenesis - biosynthetic glycogen -> glucose 1-P glycogenolysis - breakdown Evidence for two paths - Patients lacking phosphorylase can still synthesize glycogen - hormonal regulation of both directions Glycogenolysis (glycogen breakdown)- Glycogen Phosphorylase glycogen (n) + Pi -> glucose 1-p + glycogen (n-1) • Enzyme binds and cleaves glycogen into monomers at the end of the polymer (reducing ends of glycogen) • Dimmer interacting at the N-terminus. • rate limiting - controlled step in glycogen breakdown • glycogen phosphorylase - cleavage of 1,4 α glycosidic bond by Pi NOT H2O • Energy of phosphorolysis vs. hydrolysis -low standard state free energy change -transfer potential -driven by Pi concentration -Hydrolysis would require additional step s/ cost of ATP - Think of the difference between adding a phosphate group with hydrolysis • phosphorylation locks glucose in cell (imp. for muscle) • Phosphorylase binds glycogen at storage site and the catalytic site is 4 to 5 glucose residues away from the catalytic site. • Phosphorylase removes 1 residue at a time from glycogen until 4 glucose residues away on either side of 1,6 branch point – stericaly hindered by glycogen storage site • Cleaves without releasing at storage site • general acid/base catalysts • Inorganic phosphate attacks the terminal glucose residue passing through an oxonium ion intermediate.
    [Show full text]
  • The Origins of Protein Phosphorylation
    historical perspective The origins of protein phosphorylation Philip Cohen The reversible phosphorylation of proteins is central to the regulation of most aspects of cell func- tion but, even after the first protein kinase was identified, the general significance of this discovery was slow to be appreciated. Here I review the discovery of protein phosphorylation and give a per- sonal view of the key findings that have helped to shape the field as we know it today. he days when protein phosphorylation was an abstruse backwater, best talked Tabout between consenting adults in private, are over. My colleagues no longer cringe on hearing that “phosphorylase kinase phosphorylates phosphorylase” and their eyes no longer glaze over when a “”kinase kinase kinase” is mentioned. This is because protein phosphorylation has gradu- ally become an integral part of all the sys- tems they are studying themselves. Indeed it would be difficult to find anyone today who would disagree with the statement that “the reversible phosphorylation of proteins regu- lates nearly every aspect of cell life”. Phosphorylation and dephosphorylation, catalysed by protein kinases and protein phosphatases, can modify the function of a protein in almost every conceivable way; for Carl and Gerty Cori, the 1947 Nobel Laureates. Picture: Science Photo Library. example by increasing or decreasing its bio- logical activity, by stabilizing it or marking it for destruction, by facilitating or inhibiting movement between subcellular compart- so long before its general significance liver enzyme that catalysed the phosphory- ments, or by initiating or disrupting pro- was appreciated? lation of casein3. Soon after, Fischer and tein–protein interactions.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • Glycogenosis Due to Liver and Muscle Phosphorylase Kinase Deficiency
    Pediat. Res. 15: 299-303 (198 1) genetics muscle glycogenosis phosphorylase kinase deficiency liver Glycogenosis Due to Liver and Muscle Phosphorylase Kinase Deficiency N. BASHAN. T. C. IANCU. A. LERNER. D. FRASER, R. POTASHNIK. AND S. W. MOSES'"' Pediatric Research Laborarorv. Soroka Medical Center. Iaculr~of Health Sciences. Ben-Gurion Universi!,' of Negev. Beer-Sheva, and Department of Pediatrics. Carmel Hospiral. Huifa. Israel Summary hepatomegaly. The family history disclosed that two sisters were similarly affected, whereas one older brother was apparently A four-year-old Israeli Arab boy was found to have glycogen healthy. accumulation in both liver and muscle without clinical symptoms. Past history was unremarkable. The patient's height was below Liver phosphorylase kinase (PK) activity was 20% of normal, the third percentile for his age in contrast to a normal weight. He resulting in undetectable activity of phosphorylase a. Muscle PK had a doll face and a protuberant abdomen. The liver was palpable activity was about 25% of normal, resulting in a marked decrease 9 cm below the costal margin. Slight muscular hypotonia and of phosphorylase a activity. weakness were noticeable with normal tendon reflexes. He had Two sisters showed a similar pattern, whereas one brother had slightly abnormal liver function tests. a fasting blood sugar of 72 normal PK activity. The patient's liver protein kinase activity was mg %, a normal glucagon test. and no lactic acidemia or uricemia normal. Addition of exogenous protein kinase did not affect PK but slight lipidemia. Electronmicroscopic studies of a liver biopsy activity, whereas exogenous PK restored phosphorylase activity revealed marked deposition of glycogen.
    [Show full text]