MEK1/2 Dual-Specificity Protein Kinases
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling. -
Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits. -
RAF Protein-Serine/Threonine Kinases: Structure and Regulation
Biochemical and Biophysical Research Communications 399 (2010) 313–317 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc Mini Review RAF protein-serine/threonine kinases: Structure and regulation Robert Roskoski Jr. * Blue Ridge Institute for Medical Research, 3754 Brevard Road, Suite 116, Box 19, Horse Shoe, NC 28742, USA article info abstract Article history: A-RAF, B-RAF, and C-RAF are a family of three protein-serine/threonine kinases that participate in the Received 12 July 2010 RAS-RAF-MEK-ERK signal transduction cascade. This cascade participates in the regulation of a large vari- Available online 30 July 2010 ety of processes including apoptosis, cell cycle progression, differentiation, proliferation, and transforma- tion to the cancerous state. RAS mutations occur in 15–30% of all human cancers, and B-RAF mutations Keywords: occur in 30–60% of melanomas, 30–50% of thyroid cancers, and 5–20% of colorectal cancers. Activation 14-3-3 of the RAF kinases requires their interaction with RAS-GTP along with dephosphorylation and also phos- ERK phorylation by SRC family protein-tyrosine kinases and other protein-serine/threonine kinases. The for- GDC-0879 mation of unique side-to-side RAF dimers is required for full kinase activity. RAF kinase inhibitors are MEK Melanoma effective in blocking MEK1/2 and ERK1/2 activation in cells containing the oncogenic B-RAF Val600Glu PLX4032 activating mutation. RAF kinase inhibitors lead to the paradoxical increase in RAF kinase activity in cells PLX4720 containing wild-type B-RAF and wild-type or activated mutant RAS. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
Mutation-Specific RAS Oncogenicity Explains NRAS Codon 61 Selection in Melanoma
Published OnlineFirst September 24, 2014; DOI: 10.1158/2159-8290.CD-14-0729 reseArch Article Mutation-Specific RAS Oncogenicity Explains NRAS Codon 61 Selection in Melanoma Christin E. Burd1,2, Wenjin Liu3,4, Minh V. Huynh5, Meriam A. Waqas1, James E. Gillahan1,2, Kelly S. Clark3,4, Kailing Fu3,4, Brit L. Martin1, William R. Jeck3,4,. George P Souroullas3,4, David B. Darr3,4, Daniel C. Zedek6, Michael J. Miley7, Bruce C. Baguley8, Sharon L. Campbell4,5, and Norman E. Sharpless3,4 Abstrt Ac NRAS mutation at codons 12, 13, or 61 is associated with transformation; yet, in melanoma, such alterations are nearly exclusive to codon 61. Here, we compared the melanoma susceptibility of an NrasQ61R knock-in allele to similarly designed KrasG12D and NrasG12D alleles. With concomitant p16INK4a inactivation, KrasG12D or NrasQ61R expression efficiently promoted melanoma in vivo, whereas NrasG12D did not. In addition, NrasQ61R mutation potently cooperated with Lkb1/Stk11 loss to induce highly metastatic disease. Functional comparisons of NrasQ61R and NrasG12D revealed little difference in the ability of these proteins to engage PI3K or RAF. Instead, NrasQ61R showed enhanced nucleotide binding, decreased intrinsic GTPase activity, and increased stability when compared with NrasG12D. This work identifies a faithful model of human NRAS-mutant melanoma, and suggests that the increased melanomagenecity of NrasQ61R over NrasG12D is due to heightened abundance of the active, GTP-bound form rather than differences in the engagement of downstream effector pathways. SIGNIFICANCE: This work explains the curious predominance in human melanoma of mutations of codon 61 of NRAS over other oncogenic NRAS mutations. -
Protein Kinase C As a Paradigm Alexandra C
Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily. -
Interaction Between the Protein Kinase B-Raf and the A-Subunit of the IIS Proteasome Regulator1
(CANCER RESEARCH 58. 2986-2990, July 15, I998| Advances in Brief Interaction between the Protein Kinase B-Raf and the a-Subunit of the IIS Proteasome Regulator1 Andreas Kalmes,2 Garsten Hagemann,2 Christoph K. Weber, Ludmilla Wixler, Tillman Schuster, and Ulf R. Kapp* InstituÃfürMedizinische Strahlenkunde und Zettforschung (MSZ). University of Würzburg,97078 Würzburg,Germany ¡C.H.. C. K. W.. L. W.. T. S.. U. K. R.], and Department of Surgery, University of Washington, Seattle. Washington 9SI95 ¡A.KJ Abstract using the yeast two-hybrid system. In addition to the already known B-Raf-binding proteins (MEK and several 14-3-3 isoforms), we iso Protein kinases of the Raf family act as signal-transducing elements lated PA28a, the subunit of the 1IS proteasome regulator (11, 12), as downstream of activated cell surface receptors and are involved in the a novel B-Raf-binding partner. regulation of proliferation, differentiation, and cell survival. Whereas the role of c-Raf-1 as a mitogen-activated protein/extracellular signal-regu The 11S regulator is one of two known activators of the 20S lated kinase activator within the mitogenic cascade is well established, less proteasome (13). Both of these activators seem to possess different is known about the mammalian Raf isoforins A-Raf and B-Raf. Here we functions in vivo. The PA700 activator complex (19S regulator) binds report that B-Raf binds to PA28a, one of two subunits of the 1IS regulator to the 20S proteasome core complex to form the active 26S protea of proteasomes. PA28<* was isolated as a B-Raf-binding protein in a yeast some, which mediates the ATP- and ubiquitination-dependent degra two-hybrid screen of a PC 12 cDNA library. -
AMP-Activated Protein Kinase: the Current Landscape for Drug Development
REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1). -
PV3320 Certificate of Analysis for Lot 1322684A
Certificate of Analysis MAPK8 (JNK1), Inactive , 100 µg Mitogen-activated Protein Kinase 8 (MAP), Inactive, Histidine-tagged Part Number: PV3320 5781 Van Allen Way Lot Number: 1322684A Carlsbad, CA 92008 Immediate Storage: -80°C Phone: 760.603.7200 Shipping Conditions: dry ice www.thermofisher.com Description: Storage and Handling: Recombinant human full-length protein, inactive, Histidine-tagged, Store at -80°C. At first use, aliquot and store at -80°C to avoid multiple expressed in insect cells. freeze-thaws. If properly stored at -80°C, this product is guaranteed for 6 Specific Activity: months from date of purchase. Approximately 2% activity as compared to the active form of the kinase. Storage Buffer: 50 mM Tris (pH 7.5), 150 mM NaCl, 0.5 mM EDTA, 0.05% Triton® X–100, Can be activated by the upstream kinase MAP2K7, mutant. 2 mM DTT and 50% Glycerol. Concentration: 0.87 mg/mL total protein as measured using the Bradford protein assay with BSA as a standard. Calculated 18,300 nM. Aliases: JNK, JNK1, SAPK1 QUALITY ASSURANCE Activation Test: Gel Information for MAPK8 (JNK1), Inactive The coupled MAPK8 activation assay uses active MAP2K7, mutant to Page Description: The SDS- phosphorylate ATF2 substrate. The assay was setup in two states: 1st PAGE and/or Native PAGE MAPK8 phosphorylation by MAP2K7, mutant without 32P-ATP; and 2nd were run on 4-20% Tris-Glycine ATF2 substrate phosphorylation by activated MAPK8 in the presence of Novex® gels (Catalog #: 32P-ATP. The basal activity of MAPK8 was also assayed in the absence of EC6025BOX). MAP2K7, mutant. Lane 1: Invitrogen™ BenchMark™ Protein Ladder (Catalog #: 10747-012). -
LIM and Cysteine-Rich Domains 1 (LMCD1) Regulates Skeletal Muscle Hypertrophy, Calcium Handling, and Force Duarte M
Ferreira et al. Skeletal Muscle (2019) 9:26 https://doi.org/10.1186/s13395-019-0214-1 RESEARCH Open Access LIM and cysteine-rich domains 1 (LMCD1) regulates skeletal muscle hypertrophy, calcium handling, and force Duarte M. S. Ferreira1, Arthur J. Cheng2,3, Leandro Z. Agudelo1,4, Igor Cervenka1, Thomas Chaillou2,5, Jorge C. Correia1, Margareta Porsmyr-Palmertz1, Manizheh Izadi1,6, Alicia Hansson1, Vicente Martínez-Redondo1, Paula Valente-Silva1, Amanda T. Pettersson-Klein1, Jennifer L. Estall7, Matthew M. Robinson8, K. Sreekumaran Nair8, Johanna T. Lanner2 and Jorge L. Ruas1* Abstract Background: Skeletal muscle mass and strength are crucial determinants of health. Muscle mass loss is associated with weakness, fatigue, and insulin resistance. In fact, it is predicted that controlling muscle atrophy can reduce morbidity and mortality associated with diseases such as cancer cachexia and sarcopenia. Methods: We analyzed gene expression data from muscle of mice or human patients with diverse muscle pathologies and identified LMCD1 as a gene strongly associated with skeletal muscle function. We transiently expressed or silenced LMCD1 in mouse gastrocnemius muscle or in mouse primary muscle cells and determined muscle/cell size, targeted gene expression, kinase activity with kinase arrays, protein immunoblotting, and protein synthesis levels. To evaluate force, calcium handling, and fatigue, we transduced the flexor digitorum brevis muscle with a LMCD1-expressing adenovirus and measured specific force and sarcoplasmic reticulum Ca2+ release in individual fibers. Finally, to explore the relationship between LMCD1 and calcineurin, we ectopically expressed Lmcd1 in the gastrocnemius muscle and treated those mice with cyclosporine A (calcineurin inhibitor). In addition, we used a luciferase reporter construct containing the myoregulin gene promoter to confirm the role of a LMCD1- calcineurin-myoregulin axis in skeletal muscle mass control and calcium handling.