Sphaerotilus natans, une bactérie filamenteuse et neutrophile avec une relation avec le fer : mecanismes de piégeage d’uranium Marina Seder-Colomina
To cite this version:
Marina Seder-Colomina. Sphaerotilus natans, une bactérie filamenteuse et neutrophile avec une re- lation avec le fer : mecanismes de piégeage d’uranium. Earth Sciences. Université Paris-Est, 2014. English. NNT : 2014PEST1070. tel-01127438
HAL Id: tel-01127438 https://tel.archives-ouvertes.fr/tel-01127438 Submitted on 7 Mar 2015
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Joint PhD degree in Environmental Technology
'RFWHXUGHO¶8QLYHUVLWp3DULV-Est 6SpFLDOLWp 6FLHQFHHW7HFKQLTXHGHO¶(QYLURQQHPHQW
Dottore di Ricerca in Tecnologie Ambientali
Degree of Doctor in Environmental Technology
Thèse ± Tesi di Dottorato ± PhD thesis
Marina SEDER-COLOMINA
Sphaerotilus natans, a neutrophilic iron-related filamentous bacterium: M echanisms of uranium scavenging
To be defended December 1st, 2014
In front of the PhD committee:
Prof. A. KAPPLER Reviewer Prof. P. BAUDA Reviewer Dr. J-J. PERNELLE Examiner Prof. P. LENS Examiner Dr. G. MORIN Promotor Prof. S. ROSSANO Promotor Dr. Hab. G. ESPOSITO Co-Promotor Dr. Hab. E.D. VAN HULLEBUSCH Co-Promotor
Erasmus Joint doctorate programme in Environmental Technology for Contaminated Solids, Soils and Sediments (ETeCoS3)
The first to arrive, the last to leave, and in the meanwhile, a source of inspiration for our own evolution
Acknowledgments
I would like to thank the European Commission for providing financial support through the
Erasmus Mundus Joint Doctorate Programme ETeCoS3 (Environmental Technologies for
Contaminated Solids, Soils and Sediments) under the EU grant agreement FPA n° 2010-0009 and the French Ministry of Foreign Affairs in the framework of MOY Programme under Moy Grant n°2010/038/01.
I would also like to acknowledge the members of the Environmental Technologies for
Contaminated Solids, Soils and Sediments (ETeCoS3) committee: Dr. Hab. Eric VAN
HULLEBUSCH, Université Paris Est, UPE (France); Dr. Hab. Giovanni ESPOSITO, Università degli studi di Cassino e del Lazio Meridionale, UNICLAM (Italy) and Prof. Piet LENS,
UNESCO-IHE (The Netherlands) for giving me the opportunity to participate to this joint
Erasmus Mundus doctorate programme, helping me during PhD mobility and most importantly, for scientific discussions and comments specially during the fantastic summer schools.
I would also like to thank the two main institutes that hosted me during these three years, the
Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – Université Pierre et Marie
Curie, IMPMC – UPMC (France) and the Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture, Irstea (France) for giving me the chance to conduct the experimental part of my PhD research in their laboratories.
I would like to deeply thank Dr. Guillaume MORIN, co-promotor of my PhD thesis in the
IMPMC – UPMC for his help and inspiration during these three years. I would specially like to thank him for showing me that science is always interesting, no matter the subject studied. Indeed, he successfully introduced me into the synchrotron-based sciences even if I did not know about their existence before this PhD. I will be always grateful also to Dr. Jean-Jacques PERNELLE, my advisor in the Irstea, who has mentored me during all this time, giving me valuable advices for the molecular biology section of my PhD thesis and showing me the kindest face of science.
In addition, I would like to thank Dr. Georges ONA-NGUEMA and Dr. Karim BENZERARA
(IMPMC – UPMC) for their fruitful discussions, specially concerning all geomicrobiology aspects of my work. I would specially like to thank Dr. Alex GÉLABERT from the Institut de
Physique du Globe de Paris, IPGP – Université Paris Diderot (France) and also Dr. Luigi
FRUNZO from the Università degli studi di Napoli Federico II, UNINA (Italy) for their nice introduction on modelling.
I would like to express my gratitude to Prof. Stéphanie ROSSANO (UPE) for her kind words, advice and scientific discussions that helped me so much during this PhD. I would also like to thank the external members of the jury: Prof. Andreas KAPPLER, Universität Tübingen
(Germany) and Prof. Pascale BAUDA, Université de Lorraine (France) that took the time to read and evaluate my PhD work.
I would like to extremely thank the scientific staff that has participated in my research. I have a special merci for Jessica BREST and Fériel SKOURI-PANET (IMPMC – UPMC) and Anne
GOUBET (Irstea), the three main pillars of my research. Without these three wonderful women nothing of this could have been possible. In addition, I would like also to thank Céline FÉRARD,
Sylvain LOCATI and Mélanie POINSOT for their help in the experimental setup. Thanks to the
MEB-Team, Imène ESTEVE and Sébastien CHARRON (IMPMC – UPMC) for introducing me in the passionate world of Scanning Electron Microscopy. I also thank Benoît CARON [Institut des Sciences de la Terre de Paris, IsTeP – UPMC], Emmanuel AUBRY [Milieux environnementaux, transferts et interactions dans les hydrosystèmes et les sols, METIS – UPMC] and Mickael THARAUD (IPGP) for their help in ICP-MS/OES and F-AAS analyses. I thank also
Olivier MATHON and Dipanjan BANERJEE for their support during XAS data acquisition at
BM23 and BM26A (DUBBLE) beamlines respectively at the ESRF (France).
I would like to thank now my colleagues and friends from the different places I have been during these three years, starting for those who moved as much as I did, so thanks to all ETeCoS3 students. I would like to specially acknowledge Nang for all the moments we spent together in
Paris, Rohan for his always valuable advice and for the scientific discussions and collaborations that I hope will continue long time and Joana for her kind words under any circumstance. I thank the Italian team, Maria, Borislava, Anish, Flavia, Marta and Nik for all their help during the first days and the good moments spent there. Grazie mile a Fabrizia, Rosalia e Alessia per il loro aiuto e la loro ottima cucina napoletana.
Moltes gràcies a totes les valencianes, Balma, Maite, Ana, Luisa, Inma, Maria, Alex, Ares i
Guifré (valencians del nord) amb qui he compartit tants moments durant estos anys, i qui m’han fet tocar de peus a terra quan la recerca començava a ser massa dura. Gràcies/Merci à Malu de m’avoir appris le français avec beaucoup de patience, pour ses conseils et les soirées sushi. Merci aussi à Yohann, Jérôme et Florent pour les deux années de coloc à Bagnolet, la première maison que j’ai eu en France. Gràcies als biòlegs que van vindre des de Barcelona només per vore a presentació. Gràcies/Merci à Nicolas, pour son soutien, toujours, mais surtout pour celui pendant la préparation de l’oral. A la meua família (ma mare, mon pare, ma germana, Dolça i Roser) que des de la distància sempre m’ha donat suport per continuar endavant. Je tiens à remercier mes collègues de l’Irstea : Ahlem, Julien, Pierre, David, Sylvain et Yoan pour leur convivialité pendant ces trois années, les matchs de volley et les Friday Drinks. Un merci spécial pour Nadège, pour être toujours souriante et de qui j’ai appris tellement de choses.
Je voudrais remercier aussi mes collègues de l’IMPMC pour les bons moments passés à la cantine (surtout la première année), la cafèt (résistance anti-cantine à partir de la deuxième), et les différentes sorties, voyages et bars qu’on a partagés pendant ces trois années. Je voudrais remercier spécialement l’équipe MINENV et toutes ses générations. Merci à ceux qui ont initié le lignage, la toujours souriante Gaby ; le collègue de concerts Guillaume Othmane ; Fabien, toujours omniprésent dans les conversations ; Delphine, qui ne s’arrête jamais pour rien ; Vincent, exemple de bon scientifique et meilleur être humain ; Areej, le courage en personne et que j’admirerai toujours ; Maya, toujours le bon mot à l’instant précis ; Pierre, calme et sage pour les moments importants et spécialement, je remercie Sandy Ardo (a.k.a. Tic) pour tout, absolument tout, les bons moments, les mauvais, l’accueil pre-aéroport chez elle quand je bougeais entre l’Italie et la France, le voyage merveilleux au Liban, et surtout, son amitié et son soutien au cours de ces trois années.
Table of Contents
Table of Contents ...... I!
List of Figures ...... V!
List of Tables ...... X!
List of Abbreviations ...... XII!
Abstract ...... XIV!
Résumé ...... XV!
Sommario ...... XVI!
Samenvatting ...... XVII!
CHAPTER 1 ...... 1!
1.1. Background ...... 2!
1.2. Objectives of the study ...... 3!
1.3. Structure of the thesis ...... 4!
References ...... 7!
CHAPTER 2 ...... 9!
2.1. Introduction ...... 11!
2.2. Physiology of Sphaerotilus natans ...... 12!
2.2.1. Morphology ...... 12!
2.2.2. Ecology ...... 13!
2.2.3. Metabolism ...... 15!
2.2.4. Genetics ...... 16!
2.2.5. Filamentous growth ...... 18!
2.2.6. Sheath formation ...... 19!
2.2.7. Extracellular Polymeric Substances (EPS) ...... 21!
2.3. Sphaerotilus natans relation with iron ...... 22!
2.3.1. Sphaerotilus as an iron-related bacterium ...... 23!
2.3.2. Iron biomineralization ...... 25!
I Table of Contents
2.4. Environmental applications of Sphaerotilus natans ...... 26!
2.4.1. Biosorption onto S. natans ...... 27!
2.4.2. S. natans BIOS sorption ...... 30!
2.5. Conclusions ...... 31!
References ...... 33!
CHAPTER 3 ...... 43!
3.1. Introduction ...... 45!
3.2. Materials and Methods ...... 46!
3.2.1. Bacterial strain and growth conditions ...... 46!
3.2.2. Confocal Laser Scanning Microscopy (CLSM) ...... 47!
3.2.3. Filtration procedure coupled to DNA extraction ...... 48!
3.2.4. Scanning Electron Microscopy (SEM) ...... 49!
3.2.5. Quantitative real-time PCR (qPCR) ...... 49!
3.3. Results ...... 50!
3.3.1. Evolution of pH and oxygen availability in batch cultures ...... 50!
3.3.2. Qualitative evaluation of the dual morphotype in batch cultures ...... 51!
3.3.3. Selective filtration ...... 52!
3.3.4. Filamentous vs. single-cell growth ...... 53!
3.4. Discussion ...... 54!
3.4.1. Differential quantification of single cells and filaments ...... 54!
3.4.2. Oxygen as a factor influencing filamentation ...... 55!
Supporting Information ...... 57!
References ...... 62!
CHAPTER 4 ...... 66!
4.1. Introduction ...... 68!
4.2. Materials and Methods ...... 69!
4.2.1. Bacterial strain and preculture medium ...... 69!
II Table of Contents
4.2.2. Biotic and abiotic Fe, P and U precipitation experiments ...... 70!
4.2.3. Fe and U sorption onto a glass-supported S. natans biofilm ...... 71!
4.2.4. Scanning Electron Microscopy (SEM) ...... 71!
4.2.5. X-ray absorption spectroscopy (XAS) ...... 71!
4.3. Results ...... 73!
4.3.1. Mineralogy of the solid phases in the Fe, P and U precipitation experiments ..... 73!
4.3.2. Uranium removal in the biotic and abiotic Fe, P and U precipitation exp...... 75!
4.3.3. Uranium removal via Fe and U sorption onto S. natans biofilm ...... 76!
4.3.4. U LIII-edge EXAFS analysis of the biotic and abiotic iron phosphate samples ... 77!
4.3.5. U LIII-edge EXAFS analysis of model compounds ...... 78!
4.4. Discussion ...... 82!
4.4.1. Abiotic formation of amorphous iron phosphate precipitates ...... 82!
4.4.2. Biotic formation of amorphous iron phosphate precipitates ...... 83!
4.4.3. Local structure of uranium sorption complexes onto amorphous iron phosphate 84!
4.4.4. Environmental implications ...... 85!
Supporting Information ...... 86!
References ...... 94!
CHAPTER 5 ...... 103!
5.1. Introduction ...... 105!
5.2. Materials and Methods ...... 106!
5.2.1. Bacteria preparation ...... 106!
5.2.2. Uranium adsorption experiments ...... 107!
5.2.3. Characterization of S. natans filaments surface ...... 107!
5.2.4. X-ray absorption spectroscopy (XAS) at U LIII-edge ...... 108!
5.3. Results and discussion ...... 109!
5.3.1. Adsorption isotherms ...... 109!
5.3.2. S. natans filaments surface ...... 110!
III Table of Contents
5.3.3. U LIII-edge EXAFS shell-by-shell fit ...... 113!
5.3.4. Surface complexation modelling ...... 116!
5.4. Conclusions ...... 118!
Supporting Information ...... 120!
CHAPTER 6 ...... 134!
6.1. General overview ...... 135!
6.2. Discussion and conclusions ...... 136!
6.2.1. Fundamental knowledge of S. natans filamentation ...... 136!
6.2.2. S. natans to immobilize iron phosphate particles scavenging U(VI) ...... 137!
6.2.3. Biosorption of U(VI) onto S. natans filaments ...... 138!
6.3. Perspectives ...... 139!
6.3.1. Filamentation of S. natans ...... 139!
6.3.2. Role of iron phosphate-mediated scavenging of inorganic pollutants ...... 140!
6.3.3. Uranium relationship with S. natans ...... 141!
References ...... 143!
Appendix 1: Valorization of the PhD research work ...... 147!
Appendix 2: Activities during the PhD ...... 150!
IV
List of Figures
Chapter 1: Introduction
• Figure 1.1. Mechanisms of uranium removal studied in this PhD. U(VI) scavenging by (a) bacteriogenic iron minerals associated to S. natans filaments, (b) abiotic analogues of such iron minerals and (c) biosorption onto S. natans filaments. • Figure 1.2. Structure of the PhD thesis.
Chapter 2: Literature review
• Figure 2.1. Presumable structures of S. natans (A) and L. cholodnii (B) sheaths, redrawn from Kondo et al. (2011).
Chapter 3: Filamentous growth of S. natans
• Figure 3.1. Filtration method developed for differential amplification by qPCR based on growth morphotypes. • Figure 3.2. Oxygen and pH measurements of actively and passively aerated cultures of Sphaerotilus natans throughout the 48 hours of incubation: (!) pH and (") oxygen of actively aerated culture, (#) pH and ($) oxygen of passively aerated culture. • Figure 3.3. CLSM imaging of (red) Syto61® and (green) PSA and WGA lectins coupled to FITC for (a) initial inoculum of Sphaerotilus natans, (b) actively aerated culture after 48 hours of incubation, and (c) passively aerated culture after 48 hours of incubation. Scale bars represent 10 !m. • Figure 3.4. SEM observations of the 3 !m pore-size filters (a, c and e) and 0.22 !m pore-size filters (b, d and f): (a, b) initial inoculum of Sphaerotilus natans, (c, d) actively aerated culture after 48 hours of incubation, and (e, f) passively aerated culture after 48 hours of incubation. Scale bars represent 5 !m. • Figure 3.5. Sphaerotilus natans differential growth curves, (!) global culture, ($) single cells and (") filaments, under (a) actively aerated and (b) passively aerated culture conditions. Inserted figures display the corresponding distribution of single cells (blue) vs. filaments (red) in (a) and (b), respectively. • Figure 3.S1. Qualitative distribution of single cells and filaments of five different strains of Sphaerotilus, (") ATCC 29329 and 29330, ($) ATCC 15291, (!) ATCC
V List of Figures
13338T, and (%) ATCC 13929. Observations were performed using optical microscopy at !500 after 24 hours of culture in CGY and NB 1% media. • Figure 3.S2-1. Graphical example of the unsuitability of Turbidity/OD for filamentous biomass determination. • Figure 3.S2-2. Photography of S. natans filamentous culture after 24 hours of incubation under passively aerated conditions. • Figure 3.S2-3. Optical density at 600 nm of Sphaerotilus natans grown under ($) passively and (") actively aerated conditions, leading to filamentous and single-cell growth respectively, throughout 48 hours of incubation. • Figure 3.S3. Agarose gel of PCR products amplified using the sthA set of primers. Lane 1: DirectLoad™ PCR Low Ladder, Sigma-Aldrich® (100-1000 bp), 2: Empty well, 3: Sphaerotilus natans ATCC 15291, 4: S. natans ATCC 13338, 5: S. natans ATCC 13929, 6: Sphaerotilus hippei ATCC 29330, 7: Leptothrix cholodnii ATCC 51168, 8: L. cholodnii ATCC 51169, 9: NTC (negative control).
Chapter 4: U(VI) scavenging by iron phosphate encrusting S. natans filaments
• Figure 4.1. SEM images of the mineral precipitates in samples (a) ‘CGY Fe + S. natans’, (c) ‘1/20 CGY Fe + S. natans’, (e) ‘1/20 CGY Fe Abiotic’. The large scale bar is 1 !m and the short one is 10 !m. Representative EDXS spectra of these mineral precipitates are shown in (b, d, f) and indicate a P/Fe mole ratio of 0.36 ± 0.06 for all samples, similar to that obtained on bulk samples incubated with U(VI) (Fig. 4.S1). 3 • Figure 4.2. Linear Combination Least-squares (LC-LS) fits of (a) XANES and (b) k - weighted EXAFS data at the Fe K-edge for samples ‘Fe Abiotic’, ‘Fe + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ after 21 days of incubation. For all samples, III XANES and EXAFS LC-LS fit results (Table 4.S1) indicate 74-87% of amFe PO4, 4- II 11% Fh2L and 10-21% of vivianite taken as proxy for a Fe PO4 compound. Experimental and calculated curves are plotted as black and red solid lines, respectively. Fourier Transforms modulus and imaginary part (FT) of the experimental and calculated EXAFS data are displayed in (c). • Figure 4.3. Evolution of uranium concentrations in solution as a function of time in (a) Fe and U mineralization experiments and (b) in Fe and U sorption on S. natans biofilm experiments. Dissolved U concentration after 0.22 !m filtration in the (")
VI List of Figures
‘U + S. natans’, (&) ‘U + Fe Abiotic’ and ($) ‘U + Fe + S. natans’ mineralization experiments. Dissolved (open symbols) and total uranium (closed symbols) after adition of U + Fe in (#, !) abiotic vial and in (!, ") glass vial supporting a S. natans biofilm.
• Figure 4.4. Linear Combination Least-squares (LC-LS) fits of the U LIII-edge EXAFS data for the solid samples collected from ‘U + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ experiments after 21 days. Experimental and calculated curves are plotted as black and red solid lines respectively, for (a) unfiltered k3-weighted c(k) function and (b) Fourier Transform (FT) modulus and imaginary part. Only two model compound spectra were used as fitting components: U(VI) coprecipitated with III amorphous ferric phosphate (‘amFe PO4-U(VI)cp’) and U(VI) biosorbed onto S. natans (‘Biosorbed-U(VI)’). Proportions of these fitting components are reported in the figure and detailed in Table 4.S3.
• Figure 4.5. U LIII-edge EXAFS spectra of model compounds: U(VI) coprecipitated III III and adsorbed to Fe(III) phosphate (‘amFe PO4-U(VI)cp’ and ‘amFe PO4-U(VI)ad’) and to two-line ferrihydrite (‘Fh2L-U(VI)cp’ and ‘Fh2L-U(VI)ad’) and U(VI) biosorbed to Sphaerotilus natans (‘Biosorbed-U(VI)’). (a) Results of the shell-by-shell fits of unfiltered k3-weighted data and (b) the corresponding Fourier Transforms (FT) magnitude and imaginary part. Experimental data and calculated curves are plotted as black and red solid lines, respectively. All fit parameters are reported in Table 4.S2. • Figure 4.S1. SEM images of bulk solids obtained after 21 days of incubation in experiments (a) ‘U + Fe Abiotic’ and (c) ‘U + Fe + S. natans’. Scale bars represent 100 !m. Representative SEM-EDXS spectra are shown in (b) and (d) respectively. Average of 10 spots indicated similar P/Fe mole ratios of 0.36 ± 0.09 and 0.36 ± 0.04 for ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’, respectively. In addition, uranium M- series peaks were observed at ~3.4 eV. The P/Fe mole of these phases was similar to that measured for the Fe-bearing particles formed in the absence of uranium (Fig. 4.1). • Figure. 4.S2. Alternative linear combination least squares (LC-LS) fit solutions for the (a) XANES and (b) k3-weighted EXAFS spectra at the Fe K-edge, for sample ‘U + Fe Abiotic’. Experimental and calculated curves are displayed as black and red lines respectively. Spectra of the fitting components, namely amorphous ferric phosphate III II (amFe PO4•nH2O), 2 line Ferrihydrite (Fh2L) and vivianite (Fe 3(PO4)2•8H2O) as a proxy for the ferrous phosphate component, are displayed below each fit and are
weighted by their relative proportion in the fit. Addition of a ferrous phosphate
VII List of Figures
component significantly improved the quality of the XANES and EXAFS fits for the five samples analyzed at the Fe K-edge, as confirmed by the decrease in the chi values (Table 4.S2 for this sample, ‘U + Fe Abiotic’). The possible formation of mixed FeII/FeIII phosphates is discussed in the text.
Chapter 5: U(VI) biosorption by S. natans filaments
• Figure 5.1. Uranium adsorption isotherms of S. natans filaments at (a) pH 5.5 and (b) pH 7. Solid lines correspond to the FITEQL model. • Figure 5.2. SEM-EDXS of S. natans filaments exposed to 2 ! 10-5 U at (a) pH 5.5 and (b) pH 7. Scale bars represent 4 !m. Squares represent EDXS analyses spot. • Figure 5.3. FTIR features of S. natans filaments exposed to 2 ! 10-5 U at pH 5.5 and 7, and non-exposed to uranium (control at pH 7). -5 • Figure 5.4. U LIII-edge EXAFS spectra of S. natans filaments exposed to 2 ! 10 M U at pH 5.5 and 7. (a) Results of the shell-by-shell fits of unfiltered k3-weighted data and (b) the corresponding Fourier Transforms (FT), including the magnitude and imaginary part. Experimental data and calculated curves are plotted as black and red solid lines, respectively. All fit parameters are reported in Table 5.3. • Figure 5.S1. Uranium adsorption kinetics onto S. natans filaments at (!) pH 5.5 and (") 7. Uranium concentration 10-6 M. Kinetics of U(VI) sorption onto BIOS at different ratios of groundwater in distilled water. Experimental -6 conditions: initial U(VI) = 10 M; ionic strength (NaClO4) = 0.1 M; -1 adsorbent dosage = 1 gwet.L . • Figure 5.S2. Speciation diagrams for U(VI) concentrations of (a) 1 ! 10-3, (b) 2 ! 10-5 (SEM-EDXS, ATR-FTIR and EXAFS experiments) and (c) 1 ! 10-8 M.
• Figure 5.S3. U LIII-edge EXAFS spectra of S. natans filaments exposed to 2 ! 10-5 M U at (a) pH 5.5 and (b) pH 7. Fourier Transforms (FT) of unfiltered k3-weighted data, including the magnitude and imaginary part. Experimental data and calculated curves are plotted as black and red solid lines, respectively. Calculated curves represent the fit signal corresponding to the U"U path at ~3.8 Å, from the uraninite mineral, as reported by Tsushima et al. (2007). Percentage + of (UO2)3(OH)5 adsorption (% ads) is related to N. If 100% of the adsorbed
VIII List of Figures
+ uranium was under the form of polynuclear (UO2)3(OH)5 , N=1.33 would correspond to the U neighbours at ~3.8 Å.
IX
List of Tables
Chapter 2: Literature review
• Table 2.1. Sphaerotilus natans culture media (concentrations are given in wt % and ppm wt in water). • Table 2.2. Sphaerotilus sequenced genes. • Table 2.3. Some examples of the classification of Sphaerotilus and Leptothrix reported in research papers addressing their relation to iron. • Table 2.4. Some metal scavenging examples by different neutrophilic filamentous iron-related bacteria.
Chapter 4: U(VI) scavenging by iron phosphate encrusting S. natans filaments
• Table 4.1. Fitting results for U LIII-edge EXAFS data of model compounds: U(VI) III coprecipitated and adsorbed to Fe(III)-phosphate (‘amFe PO4-U(VI)cp’ and III ‘amFe PO4-U(VI)ad’) and to 2-line Ferrihydrite (‘Fh2L-U(VI)cp’ and ‘Fh2L- U(VI)ad’) and U(VI) biosorbed to Sphaerotilus natans (‘Biosorbed-U(VI)’). Coordination number (N), interatomic distance (R), Debye–Waller parameter (!) and 2 energy offset (E0). Fit quality was estimated by a reduced #R parameter of the 2 3 3 2 following form: cR = Nind/(Nind – p) $ [k (c(k)exp – k (c(k)calc ] , with Nind =(2%k%R)/p), the number of independent parameters and p the number of free fit parameters. • Table 4.S1. Results of the linear combination least squares (LC-LS) fits for the XANES and k3-weighted EXAFS Fe K-edge spectra of samples ‘Fe Abiotic’, ‘Fe + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ after 21 days of incubation. Corresponding experimental and calculated spectra are displayed in Fig. 4.2. The data are fit by linear combinations of the experimental spectra of the three following model III compounds: amorphous ferric phosphate (amFe PO4•nH2O) (Baumgartner et al.,
2013), 2 line Ferrihydrite (Fh2L) (Maillot et al., 2011) and vivianite (Fe3(PO4)2•8H2O) (Cosmidis et al., 2014) taken as proxy for the ferrous phosphate component. The fit 2 quality was estimated by a R-factor of the following form: Rf = $ [ yexp - ycalc ] / $ 2 3 yexp where y is the normalized absorbance or the k c(k) for XANES and EXAFS fitting respectively.
X List of Tables
• Table 4.S2. Results of the alternative LC-LS fit of the Fe K-edge spectra of sample ‘U + Fe Abiotic’ presented in Fig. 4.S2. The fit quality was estimated by a R-factor of 2 2 2 the following form: Rf = $ [ yexp -ycalc ] / $ yexp where y is the normalized absorbance or the k3c(k) for XANES and EXAFS fitting respectively.
• Table 4.S3. LC-LS fit results for the U LIII-edge EXAFS spectra of the solid samples collected after 21 days in the ‘U + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’. Corresponding experimental and calculated EXAFS spectra are presented in Fig. 4.5. Shell-by-shell analysis of the EXAFS spectra of the model compound spectra used as fitting components is displayed in Fig. 4.4. The fit quality was estimated by a 2 2 3 R-factor of the following form : Rf = $ [ yexp - ycalc ] / $ yexp where y = k c(k). • Table 4.S4-1. U(VI) sorbed in the presence of phosphate. • Table 4.S4-2. U(VI) sorbed onto various bacteria. • Table 4.S4-3. U(VI) sorbed onto ferrihydrite and hematite.
Chapter 5: U(VI) biosorption by S. natans filaments
• Table 5.1. Comparison of uranium binding capacities of various biomass. • Table 5.2. FTIR functional groups and the corresponding structures found for S. natans filaments. Band attributions were made according to (Jiang et al., 2004; Choudhary and Sar, 2011; Shi et al., 2012; Parikh et al., 2014).
• Table 5.3. Fitting results for U LIII-edge EXAFS data of S. natans filaments exposed to 2 ! 10-5 M U at pH 5.5 and 7. Coordination number (N), interatomic distance (R),
Debye–Waller parameter (!) and energy offset (E0). Fit quality was estimated by a 2 reduced #R parameter. • Table 5.4. Distribution of uranium species at 1 ! 10-3, 2 ! 10-5 (SEM-EDXS, ATR-FTIR and EXAFS experiments) and 1 ! 10-8 M for pH 5.5 and pH 7 in 0.1 M
NaClO4 solution. • Table 5.5. Complexation reactions of different uranium species with carboxyl and phosphoryl groups. • Table 5.S1. S. natans biosorption studies from literature.
• Table 5.S2. EXAFS U LIII-edge fitting parameters for U biosorption in literature. • Table 5.S3. Aqueous speciation reactions used for uranium speciation.
XI
List of Abbreviations
2LFh 2 line Ferrihydrite
III amFe PO4 Amorphous Fe(III) phosphate
ATCC American Type Culture Collection
ATR-FTIR Attenuated Total Reflection - Fourier Transform Infra-Red spectroscopy
BIOS Bacteriogenic Iron Oxides
CGY Casitone, Glycerol And Yeast Extract Medium
CLSM Confocal Laser Scanning Microscopy
Cys Cysteine (amino acid)
DNA Deoxyribonucleic Acid
DO Dissolved Oxygen
EDXS Energy X-Ray Dispersive Spectroscopy
EPS Extracellular Polymeric Substances
ESRF European Synchrotron Radiation Facility
EXAFS Extended X-Ray Absorption Fine Structure Spectroscopy
FISH Fluorescence In Situ Hybridization
HFO Hydrous Ferric Oxides
ICP–MS Inductively Coupled Plasma–Mass Spectrometry
ICP–OES Inductively Coupled Plasma–Optical Emission Spectroscopy
LC-LS Linear Combination – Least Squares fitting
OD600 nm Optical Density at 600 nm (for bacterial cell counting)
PCR Polymerase Chain Reaction
qPCR Quantitative Polymerase Chain Reaction
XII List of Abbreviations
RNA Ribonucleic Acid
ROS Reactive Oxygen Species
SEM Scanning Electron Microscope
WWTP Wastewater Treatment Plant
XANES X-Ray Absorption Near Edge Spectroscopy
XAS X-Ray Absorption Spectroscopy
XRD X-Ray Diffraction
XIII
Abstract
Heavy metals and radionuclides are present in some ecosystems worldwide due to natural contaminations or anthropogenic activities. The use of microorganisms to restore those polluted ecosystems, a process known as bioremediation, is of increasing interest, especially under near-neutral pH conditions. Iron minerals encrusting neutrophilic iron-related bacteria, especially Bacteriogenic Iron Oxides (BIOS), have a poorly crystalline structure, which in addition to their large surface area and reactivity make them excellent scavengers for inorganic pollutants. In this PhD work we studied the different mechanisms of uranium scavenging by the neutrophilic bacterium Sphaerotilus natans, chosen as a model bacterium for iron-related sheath-forming filamentous microorganisms. S. natans can grow as single cells and filaments. The latter were used to investigate U(VI) biosorption and U(VI) sorption onto BIOS. In addition, uranium sorption onto the abiotic analogues of such iron minerals was assessed. In order to use S. natans filaments for U(VI) scavenging, it was necessary to identify factors inducing S. natans filamentation. The influence of oxygen was ascertained by using molecular biology techniques and our results revealed that while saturated oxygen conditions -1 resulted in single cell growth, a moderate oxygen depletion to ~ 3 mg O2.L led to the desired filamentous growth of S. natans. BIOS attached to S. natans filaments as well as the abiotic analogues were analysed by XAS at Fe K-edge. Both materials were identified as amorphous iron(III) phosphates with a small component of Fe(II), with a high reactivity towards scavenging of inorganic pollutants.
In addition, EXAFS at the U LIII-edge revealed a common structure for the O shells, while those for P, Fe and C were different for each sorbent. An integrated approach combining experimental techniques and speciation calculations made it possible to describe U(VI) adsorption isotherms by using a surface complexation model. These results suggested the role of phosphoryl and carboxyl groups as the main functional groups involved in the U(VI) biosorption by S. natans. The results of this PhD work will help to better understand the processes governing U(VI) immobilization, either by S. natans biosorption, sorption onto BIOS or sorption onto iron phosphates, an thus the fate of uranium in near-neutral pH environments. Keywords: filamentous bacteria; S. natans; BIOS; iron phosphate; uranium scavenging.
XIV
Résumé
Les métaux lourds et les radionucléides sont présents dans différents écosystèmes du monde à cause de contaminations naturelles ou des activités anthropiques. L’utilisation de micro-organismes pour restaurer ces écosystèmes pollués, processus connu sous le nom de bioremédiation, suscite beaucoup d’intérêt, spécialement aux pH proches de la neutralité. Les minéraux de fer qui encroûtent les bactéries neutrophiles du fer, notamment les Oxydes de Fer Biogéniques (BIOS en anglais), ont une structure très faiblement cristalline, qui en plus de leur grande surface et réactivité font d’eux d’excellents supports pour le piégeage de polluants inorganiques. Dans cette thèse nous avons étudié les différents mécanismes de piégeage de l’uranium uranium par la bactérie neutrophile Sphaerotilus natans, choisie comme modèle bactérien de micro-organismes du fer capables de filamenter en formant des gaines. S. natans peut croître sous forme de cellules individuelles ou formant des filaments. Ces derniers ont été utilisés pour étudier la biosorption d’U(VI) et sa sorption sur les BIOS. De plus, la sorption d’U(VI) sur les analogues abiotiques de ces minéraux de fer a été testée. Afin d’utiliser les filaments de S. natans pour piéger l’U(VI), il était nécessaire d’identifier les facteurs induisant la filamentation de S. natans. L’influence de l’oxygène a été établie en utilisant des techniques de biologie moléculaire et nos résultats ont démontré que tandis qu’en condition d’oxygène saturé elle croît sous forme de cellules individuelles, une diminution -1 modérée d’oxygène à ~ 3 mg O2.L la fait croître sous la forme désirée, des filaments de S. natans. Les BIOS attachés aux filaments de S. natans ainsi que ses analogues abiotiques ont été analysés pas XAS au seuil K du Fe. Les deux matériaux identifiés sont des phosphates de fer(III) amorphes avec une faible proportion de fer(II), qui présentent une réactivité élevée pour le piégeage de polluants inorganiques. L’EXAFS au seuil LIII de l’U a montré la même structure pour les couches O, tandis que celles P, Fe et C étaient différentes en fonction des sorbants. Une étude intégrée qui combine des techniques expérimentales avec des calculs de spéciation a permis de décrire les isothermes d’adsorption de l’U(VI) en utilisant un modèle de complexation de surface. Ces résultats suggèrent que les groupes phosphoryles et carboxyles sont les groupes fonctionnels principaux pour la biosorption d’U(VI) par des filaments de S. natans. Les résultats de cette thèse vont aider à comprendre les processus contrôlant l’immobilisation de l’U(VI), soit par la biosorption sur S. natans, la sorption sur les BIOS ou la sorption sur les phosphates de fer, et en conséquence le devenir de l’U en conditions neutres. Mots clé: bactéries filamenteuses; S. natans; BIOS; phosphate de fer; piégeage d’uranium.
XV
Sommario
I metalli pesanti e i radionuclidi sono presenti in alcuni ecosistemi a causa di contaminazioni naturali o attività antropiche. La biorimediazione, vale a dire l'impiego di processi biologici per ripristinare questi ecosistemi inquinati, è un sistema che sta suscitando interesse crescente, in particolare in condizioni di pH quasi neutro. I minerali di ferro che si accompagnano a batteri neutrofili ferro-correlati, noti anche come Bacteriogenic Iron Oxides (BIOS), hanno una struttura poco cristallina, che unitamente all'elevata superficie e reattività, li rende efficaci nel catturare gli inquinanti inorganici. In questo lavoro sono stati studiati i diversi meccanismi di cattura dell'uranio da parte dei batteri neutrofili Sphaerotilus natans, scelti come modello dei microorganismi ferro-correlati. S. natans può crescere in forma di singole cellule e filamenti. Questi ultimi sono stati utilizzati per valutare l'adsorbimento e il bioadsorbimento di U(VI) nei BIOS. Inoltre, è stato valutato l'adsorbimento di uranio negli analoghi abiotici di tali minerali di ferro. Per utilizzare filamenti di S. natans per la cattura di U(VI) è stato necessario identificare i fattori che inducono la filamentazione. L’influenza dell'ossigeno è stata accertata mediante tecniche di biologia molecolare ed i risultati hanno rivelato che, mentre condizioni di saturazione portano alla crescita di singole cellule, una moderata riduzione dell'ossigeno a ~ 3 -1 mg O2.L porta alla desiderata crescita filamentosa di S. natans. BIOS collegati a filamenti di S. natans ed i loro analoghi abiotici sono stati analizzati mediante XAS alla soglia K del ferro, al fine di chiarire la loro mineralogia. Entrambi i materiali sono stati identificati come fosfati di ferro(III) amorfi con una piccola proporzione di Fe(II), in possesso di una elevata reattività per la cattura di inquinanti inorganici. Inoltre le analisi EXAFS presso la soglia LIII dell'uranio hanno rivelato una struttura comune per il reticolo dell'ossigeno mentre le distanze di P, Fe e C erano differenti per ogni adsorbente. Un approccio integrato che combina tecniche sperimentali e calcoli di speciazione ha permesso di descrivere le isoterme di adsorbimento di U(VI) utilizzando un modello di complessazione superficiale. Questi risultati hanno suggerito il ruolo di gruppi fosfato e carbossilici come i principali gruppi funzionali coinvolti nel bioadsorbimento di U(VI) da S. natans. I risultati di questo lavoro aiuteranno a comprendere meglio i processi che governano l'immobilizzazione di U(VI), sia attraverso il bioadsorbimento da parte di S. natans che l'adsorbimento sul BIOS o sui fosfati di ferro, e quindi il destino dell'uranio in ambienti a pH quasi neutro. Parole chiave: batteri filamentosi; S. natans; BIOS; fosfato di ferro; cattura dell'uranio.
XVI
Samenvatting
Zware metalen en radio-isotopen zijn aanwezig in verscheidene ecosystemen verspreid over de wereld, ofwel door natuurlijke contaminatie, of door menselijk toedoen. Er is een groeiende interesse in het gebruik van microorganismen om deze vervuilde ecosystemen te saneren, ook wel bekend als bioremediatie, met name onder pH-neutrale omstandigheden. Ijzerhoudende mineralen die zich als korst gevormd hebben op neutrofiele ijzer-verwante bacteriën, ook wel bekend als ‘Bacteriogene Ijzer Oxides (BIOS)’, hebben een beperkte kristallijne struktuur, waardoor ze met hun grote specifieke oppervlakte en reactiviteit excellente opruimers van anorganische verontreinigende stoffen zijn. In dit proefschrift bestuderen we de verschillende mechanismen van uranium opname door de neutrofiele bacterie Sphaerotilus natans, hier gekozen als een model voor ijzer-verwante plaatvormende draadvormige microorganismen. S. natans kan als eencellige of als draadvormige cellen groeien. De laatstgenoemden worden gebruikt om U(VI) biosorptie en U(VI) sorptie op BIOS te bestuderen. Daarnaast wordt uranium sorptie op abiotische analogen voor dit soort ijzer mineralen vastgesteld. Om S. natans draden te gebruiken voor U(VI) incorporatie is het noodzakelijk om de factoren die een rol spelen bij de draadvorming van S. natans te identificeren. De invloed van zuurstof wordt onderzocht door het gebruik van moleculaire biologie technieken. Onze resultaten onthullen dat hoewel zuurstof verzadigde omstandigheden resulteren in eencellige -1 groei, een gematigde vermindering van de zuurstof concentratie tot ~ 3 mg O2.L tot een voorkeur voor draadvormige groei van S. natans leidt. BIOS gehecht aan S. natans draden, alsmede de abiotische analogen zijn door X-straal Atomaire Spectroscopie (XAS) op de 'K-edge' van ijzer geanalyseerd om hun mineralogie te identificeren. Beiden materialen zijn geïntentificeerd als amorfe Fe(III) fosfaten, met een klein Fe(II) bestanddeel en met een hoge reactiviteit voor incorporatie van anorganische verontreinigende stoffen. Daarnaast brengen Extended X-ray Absorption Fine Structure
(EXAFS) spectroscopische analyses op de 'LIII-edge’ van uranium een gemeenschappelijke structuur voor de O schillen aan het licht, terwijl de afstanden van de P, Fe and C schillen verschillend waren voor elk gesorbeerd element. Een geïntegreerde aanpak combineert experimentele technieken en speciatie berekeningen, die het mogelijk maken U(VI) adsorptie isotermen te beschrijven door gebruik te maken van een oppervlakte complexatie model. Deze resultaten suggeren een rol voor fosfaat en carboxyl groepen als de functionele hoofdgroepen betrokken bij U(VI) biosorptie door S. natans. De resultaten van dit proefschrift leiden tot een beter begrip van de processen betrokken bij U(VI) immobilisatie, ofwel door S. natans biosorptie op BIOS ofwel door sorptie op ijzer fosfaten, en aldus het lot van uranium in bijna neutrale pH milieus. Trefwoorden: draadvormige bacteriën; Sphaerotilus natans; BIOS; ijzer fosfaat; uranium bioremediatie.
XVII
CHAPTER 1
Introduction
Introduction
1.1. Background
Sphaerotilus natans, a filamentous sheath-forming microorganism characteristic of neutrophilic habitats, has been chosen here as a model bacterium in order to study the mechanisms of uranium scavenging. In neutrophilic environments, filamentous iron-related species such as Leptothrix and Gallionella are usually involved in the scavenging of inorganic pollutants, especially via sorption onto the Bacteriogenic Iron Oxides (BIOS) encrusting them (Fortin and Langley, 2005; Martinez and Ferris, 2005). However, such cells can be tricky to cultivate under laboratory conditions, impairing most investigations regarding their complexation properties. Sphaerotilus, which is related closely enough to be classified as the unique supergroup Leptothrix-Sphaerotilus (Van Veen et al., 1978; Siering and Ghiorse, 1996; Fleming et al., 2011) and also oxidizes iron precipitating Fe minerals (Park et al., 2014) is thus the appropriate organism to perform such laboratory studies. S. natans presents a dual growth morphotype, single cells and those ensheathed forming the filaments, depending on the environmental conditions. Furthermore, S. natans has been previously reported for the scavenging heavy metals by direct biosorption (Esposito et al., 2001; Pagnanelli et al., 2003).
Iron minerals associated to neutrophilic filamentous bacteria are widespread in the environment as they often colonize redox boundaries at water-soils, water-sediments or groundwater-surface water interfaces. Because of their high surface area and surface reactivity, these bacteriogenic iron minerals, whose nature may depend on the environmental or culture conditions (Shopska et al., 2012), have been shown to play a key role in natural attenuation of pollutions, via sorption and coprecipitation of heavy metals, metalloids and radionuclides (Ferris et al., 2000). Although these general properties have been recognized to display great potential for remediation in mining environments (e.g. Ferris, 2005; Morin and Calas, 2006), the importance of such bioremediation processes in near-neutral pH conditions is less documented. Moreover, as S. natans can immobilize these nanocrystalline iron-bearing minerals (Park et al., 2014), they may indeed be less mobile than their chemically synthesized analogues that have to be artificially stabilized against colloidal transport when applied to remediation nanotechnologies (Hua et al., 2012; Xu et al., 2012). As a result, the presence of S. natans may simplify the pollutants’ recovery, therefore enhancing the natural attenuation of heavy metal and radionuclide pollution in impacted environments.
Uranium has been chosen due to the environmental and health consequences of its uncontrolled release in nature (Brugge et al., 2005; WHO, 2005). During the past decades,
2 Chapter 1 aquatic uranium pollution has widespread in the environment, requiring an urgent action to find immobilisation alternatives to limit uranium mobility once it gets to the environment. However, uranium mobility depends on the physicochemical conditions of the environment and on microbial activities. Because such parameters may change frequently, this represents a challenge when searching new immobilization alternatives. In oxic environments, uranium is 2+ mainly under the highly soluble uranyl ion (UO2 ) forming different carbonate and hydroxyl complexes (Langmuir, 1997); in contrast, under reducing conditions, U(IV), originally due to the chemical or biological reduction of U(VI), leads to the formation of insoluble minerals (Guillaumont et al., 2003). However, the long-term instability of these products (i.e. uraninite and non-uraninite minerals) and its reoxidation to the soluble U(VI) (Langmuir, 1997; Murphy and Shock, 1999) suggest further investigations for alternative remediation techniques applicable to oxic-U(VI) conditions.
1.2. Objectives of the study
The thesis presented here is focused on the study of S. natans as a model bacterium of neutrophilic filamentous bacteria for the scavenging of uranium at circumneutral pH. This project aimed at investigating three mechanisms of uranium scavenging under oxic conditions (Fig. 1.1), where U(VI) presents the most challenging immobilization problems due to the elevated solubility of the different uranium species. Indeed, the comparison of uranium removal by biosorption onto S. natans filaments and by sorption onto the iron-bearing minerals associated such filaments was of major interest. For this purpose, investigating the factors favouring the filamentous growth of S. natans was crucial. In additon, uranium scavenging by the abiotic analogues of such iron minerals was also investigated. The specific objectives of the research are listed below:
1. Review the physiology of S. natans, including sheath-formation and iron biomineralization in order to enhance the potential environmental applications of this bacterium. 2. Optimize culture conditions of S. natans to study filamentation and uranium scavenging. 3. Develop a method to quantify the filamentation of S. natans under changing culture conditions. 4. Identify the factors favouring S. natans filamentation from its single cell form. 5. Investigate the nature of the iron precipitates attached to S. natans filaments. 6. Evaluate uranium (VI) scavenging by iron minerals associated to S. natans.
3 Introduction
7. Study uranium (VI) removal by the abiotically synthesized analogues of such iron minerals. 8. Assess uranium (VI) biosorption onto S. natans filaments.
Figure 1.1. Mechanisms of uranium removal studied in this PhD. U(VI) scavenging by (a) bacteriogenic iron minerals associated to S. natans filaments, (b) abiotic analogues of such iron minerals and (c) biosorption onto S. natans filaments.
1.3. Structure of the thesis
The structure of the thesis entitled “Sphaerotilus natans, a neutrophilic iron-related filamentous bacterium: Mechanisms of uranium scavenging” is described in Fig. 1.2.
Figure 1.2. Structure of the PhD thesis.
4 Chapter 1
The thesis manuscript is composed of six chapters:
Chapter 1: Introduction. This first chapter evokes background information about the three main components of this PhD work: Sphaerotilus natans as a model bacterium, bacteriogenic iron minerals associated to neutrophilic filamentous bacteria as biosorbents and uranium as an inorganic pollutant.
Chapter 2: Literature review. In this chapter, Sphaerotilus natans, a neutrophilic iron- related sheath-forming microorganism, is presented. Three main research gaps are identified: 1) the factors favouring S. natans filamentous growth, 2) its relationship with iron and 3) the potential of this bacterium as well as of the iron phases frequently deposited on its sheath to scavenge inorganic pollutants from water systems. This work has been published in the Geomicrobiology Journal.
Chapter 3: Filamentous growth of S. natans. This study reports a new method developed during this PhD to study the filamentation of S. natans by separately quantifying its single cells and filaments. It revealed the importance of oxygen depletion for the filamentous growth of S. natans. Indeed, the same method could be applied in the future to evaluate other factors affecting filamentous growth of this and other bacterial species. This study has been submitted to Journal of Applied Microbiology.
Chapter 4: U(VI) scavenging by iron phosphate encrusting S. natans filaments. In this chapter, both bacteriogenic iron minerals associated to S. natans filaments and the abiotic analogues of such iron phases have been identified as iron phosphates. In addition, such minerals have been used to scavenge U(VI) at circumneutral pH, and results demonstrate that S. natans has a crucial role in the natural immobilization of such Fe and U phases. This work will be submitted to Environmental Science and Technology.
Chapter 5: Uranium biosorption by S. natans filaments. This chapter presents an integrated approach combining experimental techniques and speciation calculations to study U(VI) biosorption onto S. natans filaments by using a surface complexation model. Results indicate that carboxyl and phosphoryl groups drive uranium complexation at pH 5.5 and 7 respectively. Moreover, UO2OH+ has been identified as the principal uranium species sorbed onto S. natans filaments at both pHs. This research paper will be submitted Geochimica et Cosmochimica Acta.
5 Introduction
Chapter 6: General overview and Perspectives. Finally, the last chapter discusses the research that has been done during the PhD thesis and highlights the main key points. In addition, the future perspectives are mentioned for the three axes of research.
In addition, this thesis manuscript contains two Appendix:
Appendix 1. Valorization of the PhD research work. All the papers published or submitted, conferences, summerschool presentations and seminars during this PhD are included here.
Appendix 2. Activities during the PhD. Academic and scientific communications, laboratory courses as well as the scientific divulgation activities during the three years of doctorate are listed here.
6 Chapter 1
References
Brugge, D., de Lemos, J.L., and Oldmixon, B. (2005) Exposure pathways and health effects associated with chemical and radiological toxicity of natural uranium: a review. Rev. Environ. Health 20: 177–193.
Esposito, A., Pagnanelli, F., Lodi, A., Solisio, C., and Vegliò, F. (2001) Biosorption of heavy metals by Sphaerotilus natans: an equilibrium study at different pH and biomass concentrations. Hydrometallurgy 60: 129–141.
Ferris, F. (2005) Biogeochemical properties of bacteriogenic iron oxides. Geomicrobiol. J. 22: 79–85.
Ferris, F., Hallberg, R., Lyvén, B., and Pedersen, K. (2000) Retention of strontium, cesium, lead and uranium by bacterial iron oxides from a subterranean environment. Appl. Geochemistry 15: 1035–1042.
Fleming, E.J., Langdon, A.E., Martinez-Garcia, M., Stepanauskas, R., Poulton, N.J., Masland, E.D.P., and Emerson, D. (2011) What’s new is old: resolving the identity of Leptothrix ochracea using single cell genomics, pyrosequencing and FISH. PLoS One 6: e17769.
Fortin, D. and Langley, S. (2005) Formation and occurrence of biogenic iron-rich minerals. Earth-Science Rev. 72: 1–19.
Guillaumont, R., Fanghänel, T., Neck, V., Fuger, J., Palmer, D.A., Grenthe, I., and Rand, M.H. (2003) Chemical thermodynamics 5: Update on the chemical thermodynamics of uranium, neptunium, plutonium, americium and technetium. OECD Nuclear Energy Agency. Elsevier Science Ltd, Amsterdam.
Hua, M., Zhang, S., Pan, B., Zhang, W., Lv, L., and Zhang, Q. (2012) Heavy metal removal from water/wastewater by nanosized metal oxides: A review. J. Hazard. Mater. 211- 212: 317–331.
Langmuir, D. (1997) Aqueous Environmental Geochemistry. Prentice Hall. Upper Saddle River, New Jersey.
7 Introduction
Martinez, R.E. and Ferris, F.G. (2005) Review of the surface chemical heterogeneity of bacteriogenic iron oxides: proton and cadmium sorption. Am. J. Sci. 305: 854–871.
Morin, G. and Calas, G. (2006) Arsenic in soils, mine tailings, and former industrial sites. Elements 2: 97–101.
Murphy, W.M. and Shock, E.L. (1999) Environmental aqueous geochemistry of actinides. In, Burns, P.C.A. and Finch, R. (eds), Uranium: Mineralogy, Geochemistry and the Environment. Mineralogical Society of America, Washington DC.
Pagnanelli, F., Esposito, A., Toro, L., and Vegliò, F. (2003) Metal speciation and pH effect on Pb, Cu, Zn and Cd biosorption onto Sphaerotilus natans: Langmuir-type empirical model. Water Res. 37: 627–633.
Park, S., Kim, D.-H., Lee, J.-H., and Hur, H.-G. (2014) Sphaerotilus natans encrusted with nanoball-shaped Fe(III) oxide minerals formed by nitrate-reducing mixotrophic Fe(II) oxidation. FEMS Microbiol. Ecol. 90: 1–10.
Shopska, M., Cherkezova-Zheleva, Z.P., Paneva, D.G., Iliev, M., Kadinov, G.B., Mitov, I.G., and Groudeva, V.I. (2012) Biogenic iron compounds: XRD, Mossbauer and FTIR study. Cent. Eur. J. Chem. 11: 215–227.
Siering, P.L. and Ghiorse, W.C. (1996) Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses. Int. J. Syst. Bacteriol. 46: 173–182.
Van Veen, W.L., Mulder, E.G., and Deinema, M.H. (1978) The Sphaerotilus-Leptothrix group of bacteria. Microbiol. Rev. 42: 329–356.
WHO (2005) Uranium in drinking-water World Health Organization.
Xu, P., Zeng, G.M., Huang, D.L., Feng, C.L., Hu, S., Zhao, M.H., et al. (2012) Use of iron oxide nanomaterials in wastewater treatment: a review. Sci. Total Environ. 424: 1–10.
8
CHAPTER 2
Literature review
This chapter has been published as:
Seder-Colomina, M., Morin, G., Benzerara, K., Ona-Nguema, G., Pernelle, J-J., Esposito, G. and Van Hullebusch, E.D. (2014) Sphaerotilus natans, a neutrophilic iron-related sheath- forming bacterium: perspectives for metal remediation strategies. Geomicrobiol. J. 31: 64-75. DOI: 10.1080/01490451.2013.806611
Literature review
2. Sphaerotilus natans, a neutrophilic iron-related sheath-forming bacterium: perspectives for metal remediation strategies
Sphaerotilus natans is a neutrophilic sheath-forming microorganism from the Sphaerotilus-Leptothrix group of iron-related bacteria, known to form bacteriogenic iron oxides (BIOS) frequently deposited on cell surfaces as well as on sheaths and extracellular polymeric substances. S. natans has been reported to be an excellent sorbent for inorganic pollutants, either due to direct sorption onto biological surfaces or due to sorption onto BIOS. However, its filaments can cause bulking problems in wastewater treatment plants. This paper promotes the potential applications of Sphaerotilus natans in bioremediation by reviewing its physiology and the fundamental understanding of sheath-forming mechanisms as well as iron biomineralization processes.
Keywords
Iron-related bacteria; biomineralization; bacteriogenic iron oxides; bioremediation; heavy metals; radionuclides.
10 Chapter 2
2.1. Introduction
Sphaerotilus natans was first isolated from polluted waters by Kützing in 1833 (Kützing, 1833) and several authors continued to investigate the physiology until Stokes (1953) set up the basis for modern research on this microorganism. S. natans has become increasingly relevant because its filamentous proliferation has been identified in many studies of diverse wastewater treatment problems and environmental issues such as food industry wastewater treatment plants (WWTP) (Phaup 1968; Contreras et al. 2000). It has also been identified as being responsible for slime formation in paper mill factories causing damage of industrial machines (Pellegrin et al., 1999), slime formation in polluted rivers (Demoll and Liebmann 1952; Dondero 1961) and problems in fishing areas (Gaudy and Wolfe, 1961; Phaup, 1968). In addition, S. natans is occasionally involved in the blockage of trickling filters and bulking of activated sludge in wastewater treatment plants (Mulder and van Veen 1963; Dondero 1975; Eikelboom 1975).
Sphaerotilus has always been classified in the Sphaerotilus-Leptothrix group (Mulder and van Veen 1963; Dondero 1975; van Veen et al. 1978; Siering and Ghiorse 1996; Spring 2006). However, Sphaerotilus has been much less studied and reviewed than Leptothrix (Spring 2006; Emerson et al. 2010; Hedrich et al. 2011; Szewzyk et al. 2011). Leptothrix species together with Gallionella ferruginea (a neutrophilic iron-oxidizing bacterium) have been extensively studied as iron-related microorganisms. Bacteriogenic iron oxides (BIOS) formed in the environment due to the interaction between Leptothrix or Gallionella with iron present in the environment (James and Ferris, 2004; Gault et al., 2012) have been reported to be efficient sorbents for heavy metals or radionuclides (Ferris et al., 2000; Katsoyiannis and Zouboulis, 2002; Katsoyiannis, 2007). Despite the knowledge-base that exists for those genera, less information is available regarding iron biomineralization by S. natans and the potential importance of S. natans BIOS in the scavenging of inorganic pollutants. Additionally, direct sorption of pollutants onto the bacterial surface, sheath and extracellular polymeric substances (EPS) of S. natans has been recently identified as having potential applications in the removal of heavy metals (Esposito et al. 2001; Pagnanelli et al. 2003).
In this paper, the physiology of Sphaerotilus natans and its potential importance in elucidating iron biomineralization processes are reviewed. In this context, special attention is focused on the filamentation and sheath-forming mechanisms. Furthermore, this article
11 Literature review reviews the potential applications of Sphaerotilus in bioremediation processes in both natural and anthropogenic ecosystems. For this purpose, we examine the relationship between S. natans, iron and the sorption of inorganic pollutants, either by direct biosorption or by uptake onto BIOS.
2.2. Physiology of Sphaerotilus natans
Sphaerotilus natans has been episodically described over the last decades. Pringsheim (1949) carefully reviewed the available knowledge derived from the first identification of the species in 1833 until the late 1940s. This first period of investigation consisted in microscopy observations and isolation of strains. Afterwards, Stokes (1953), Mulder and van Veen (1963), Doetsch (1966), Phaup (1968), Dondero (1975) and van Veen et al. (1978) were involved in a second research period in which new chemical methodologies and microscopy tools were developed. Finally, molecular biology and modern analytical techniques were utilized in a third phase of studies by Siering and Ghiorse (1996), Kämpfer (1998) and Gridneva et al. (2011). Indeed, in the latter publication, the description of the Sphaerotilus genus description was amended in order to reclassify some strains of S. natans as new species and subspecies (e.g. S. hippei, S. montanus, S. natans subsp. natans and S. natans subsp. sulfidivorans).
2.2.1. Morphology
S. natans is a rod-shaped Gram-negative neutrophilic &-Proteobacterium with non- sporulating cells measuring 1 - 2 µm in width and 1 - 10 µm in length. These cells can be found forming chains enclosed in sheaths; these sheaths can get encrusted with iron oxides under particular conditions. In addition, the sheaths are covered by a thin layer of EPS. Sometimes, cells develop one small subpolar flagellum consisting of several strands, giving rise to bacterial motility. This bacterium is also characterized by the presence of holdfasts (as attaching mechanism) and presents false branching of filaments depending on the growth medium. According to Stokes (1953), the space between the cell wall and the sheath is very small, making it very difficult to discern both structures, unless shrinking methods such as ethanol or nigrosin are applied. Nevertheless, there is still enough space for cells to develop flagella while ensheathed.
12 Chapter 2
2.2.2. Ecology
Species from the Sphaerotilus-Leptothrix group can be easily found at mesophilic temperatures and circumneutral pH from aerobic to microaerophilic habitats; the latter case is typical of Fe-rich environments (James and Ferris, 2004; Rentz et al., 2007; Duckworth et al., 2009; Gault et al., 2011).
S. natans has been specifically reported in slowly running freshwater streams (Stokes, 1953) and is associated with elevated concentration of organic nutrients (Spring, 2006), but not necessarily high iron concentrations. This bacterium is capable of growing under oxic and microaerophilic conditions; it is mesophilic and neutrophilic as it grows at optimal temperatures ranging from 25 to 32ºC and pH ranging between 6.5 and 7.5 respectively (Gridneva et al., 2011). Previous reviews suggested similar values for the optimal growth parameters for S. natans (Stokes 1953; Phaup 1968; van Veen et al. 1978).
S. natans is typically cultivated in the laboratory at pH 7, at the optimum temperature of 30°C and with oxygen concentrations ranging from 0.1 to 7.5 mg.L-1. Its generation time [doubling time] ranges between 1 to 6.9 h depending on the isolate (Pellegrin et al. 1999;
Gridneva et al. 2009). S. natans growth depends on vitamin B12 (cyanocobalamin). This substance, or methionine (from which B12 is synthesized), are the sole growth factor (Mulder and van Veen 1963; Okrend and Dondero 1964). Since it grows easily in artificial media, S. natans can more easily be used as a model organism than many other neutrophilic iron-related bacteria and sheath-forming microorganisms, which are often more difficult to culture. S. natans cultures have also been scaled-up using chemostat bioreactors under various culture conditions (Contreras et al. 2000; Caravelli et al. 2008). Most commonly, two different culture media have been used in order to simulate two types of environments: one with high nutrient content –as in polluted rivers or wastewaters- and another one with low nutrient content –as in freshwater (Table 2.1).
13 Literature review
Table 2.1. Sphaerotilus natans culture media (concentrations are given in wt % and ppm wt in water).
Nutrients content Concentration References
High (CGY media) Casitone 0.5 % Dondero et al. (1961); Glycerol 1 % Okrend and Dondero (1964); Dias et al. (1968); Phaup (1968); Venosa (1975); Siering and Ghiorse (1996); Contreras et al. (2000) Yeast extract 0.1 %
Low (Adapted from Stokes medium)
Casamino acids/Peptone/(NH4)2SO4 0.01 - 0.2 % Stokes (1953); Mulder
MgSO4 ' 7 H2O 0.0075 - 0.04 % and van Veen (1963);
CaCl2' 2 H2O 0.005 % Doetsch (1966); Phaup
Na2HPO ' 12 H2O/K2HPO4 0.008 - 0.2 % (1968); Dondero (1975);
KH2PO4 0.003 - 0.05% van Veen et al. (1978);
Cyanocobalamin (Vitamine B12) 0.5 - 10 ppm Contreras et al. (2000); Caravelli et al. (2008); Gridneva et al. (2011) Glucose and other compounds (section 0.1 - 0.25 % 2.4.)
FeCl3 ' 6 H2O/FeSO4 ' 7 H2O 0.0015 - 0.001 %
CoCl2 ' 6 H2O 15 ppm
CuSO4 ' 5 H2O 75 - 100 ppm
ZnSO4 ' 7 H2O 10 - 500 ppm
MnSO4 ' H2O 0.0003 - 0.01 %
BO3H3 10 ppm KI 10 ppm
Na2MoO4/(NH4)Mo7O24 ' 4 H2O 5 - 50 ppm
14 Chapter 2
2.2.3. Metabolism
S. natans has been traditionally classified as a chimioorganoheterotrophic bacterium (van Veen et al. 1978) that can use a wide variety of carbon compounds as electron donor and carbon source (Mulder and van Veen 1963; van Veen et al. 1978; Kämpfer 1998; Gridneva et al. 2011). In contrast to Leptothrix, S. natans has an effect response to an increasing concentration of organic nutrients in the media. However, Gridneva et al. (2009; 2011) have recently identified several S. natans sulfur-oxidizing strains that use sulfur compounds as electron donor. These strains isolated from sulfide springs exhibit organotrophic, lithoheterotrophic and mixotrophic growth under oxic conditions and microaerophilic conditions where low concentrations of available organic substrates prevail. Some of these strains accumulate inclusions of elemental sulfur resulting from the oxidation of hydrogen sulfide (Gridneva et al. 2009).
Fermentation has never been observed for S. natans (Stokes, 1953; Spring, 2006). Little controversy exists regarding its respiratory chain as oxygen is the only electron acceptor that has been confirmed (Stokes, 1953; Dondero, 1975; Spring, 2006). Nevertheless, it has been suggested that some S. natans strains can grow anaerobically, potentially by metabolising some nitrogen compounds (Ankrah and Søgaard, 2009). Although nitrates have been shown to provide a source of nitrogen in aerobic growth, both Stokes (1953) and Gridneva et al. (2011) reported that S. natans is unable to use nitrate as electron acceptor under anoxic conditions. Therefore, anaerobic metabolism for S. natans has not yet been demonstrated.
Nitrogen requirements for S. natans can be satisfied by ammonia, amino acids or nitrate (Stokes, 1953; Dias and Heukelekian, 1967; Yoshikawa and Takiguchi, 1979; Gridneva et al., 2011). In addition, S. natans might be able to reduce nitrate to nitrite (Dias and Heukelekian, 1967; Gridneva et al., 2011), which is an intermediate in the nitrogen assimilation pathway. The reduction of nitrate is supported by the identification of nitrate reductase enzymes in both culture collection and isolated strains by Pellegrini et al. (1999). Under certain restrictive conditions such as when nitrogen and/or oxygen become scarce, S. natans has been reported to produce glycogen and poly-&-hydroxybutyrate as reserve materials (Mulder and van Veen 1963; van Veen et al. 1978; Takeda et al. 1995).
Enzymatic oxidation of iron by this bacterium to provide energy for growth and/or CO2 fixation has not been demonstrated yet. However, iron oxides are commonly found covering
15 Literature review
S. natans sheaths. Therefore, the relationship between the growth and metabolic activity of S. natans and the mechanisms of iron oxidation and deposition are of crucial interest for its potential applications, as discussed in Section 3 and 4 of this review.
2.2.4. Genetics
The S. natans genome is not yet available at the International Nucleotide Sequence Database Collaboration. In contrast, the complete genome of the Sphaerotilus-related species Leptothrix cholodnii SP-6 is available (GenBank accession number CP001013). Partial sequences of several Sphaerotilus strains genes are available in the GenBank database (Table 2.2). The phylogeny of type strain Sphaerotilus natans subsp. natans DSM 6575T (equivalent to ATCC 13338T or LMG 7172T) has been determined by the 16S ribosomal RNA gene sequence submitted by Gridneva et al. (2011) (GenBank accession number EU642571). More details on the different species (S. hippei and S. montanus) and subspecies can be found in the List of Prokaryotic names with Standing in Nomenclature (formerly List of Bacterial names with Standing in Nomenclature) (LBSN).
16 Chapter 2
Table 2.2. Sphaerotilus sequenced genes.
Gene sequenced Accession numbers References DNA gyrase subunit B FJ032203, FJ161075, Gridneva et al. (2011) (gyrB) GU734704, GU591797, GU591798, GU734705, GU734706 60 kDa chaperonin FJ167404, FJ167405, Gridneva et al. (2011) (cpn60/hsp60) FJ871056, Dumonceaux T.J. (Agriculture GU734707, and Agri-Food Canada, 107 FJ871057, Science Place, Saskatoon, GU591796, Saskatchewan S7T 0A1, GU591797, Canada) JF745940, JF745941 SnaBI restricted E41314-E41324 New England Biolabs, Inc. endonuclease Patents: EP0985730A1, EP0985730B1, US6025179 SspI restriction- JX649948, New England Biolabs, Inc. modification system gene AY461517, cluster JF432055 sulfate thioesterase/sulfate HQ696789, Chernousova E. (All-Russian thiohydrolase (soxB) JN570727 Collection of Microorganisms, Institute of Physiology and Biochemistry of Microorganisms, pr. Nauki 5, Pushchino 142290, Russian Federation) adenosine-5'- JF510498 Chernousova E. (idem) phosphosulfate reductase alpha subunit (aprA) putative AB050638, Suzuki et al. (2002) glycosyltransferase AB050640 putative rpoD gene AB062133 Suyama T. (National Institute of Advanced Industrial Science and Technology, Research Institute of Biological Resources; Central 6, 1-1-1, Higashi, Tsukuba, Ibaraki 305- 8566, Japan) putative RNA polymerase AB050639 Suzuki et al. (2002) associated protein
17 Literature review
2.2.5. Filamentous growth
S. natans can present a filamentous and planktonic growth (Gaudy and Wolfe, 1961; Pellegrin et al., 1999; Spring, 2006). Under typical culture conditions, this microorganism grows as single-cells that can be arranged inside a sheath, forming a filament. Depending on the culture conditions S. natans filaments form cotton-wool-like flocs that cover wide surfaces at the water-air interface (Pringsheim, 1949; Dondero, 1961). This proliferation pattern has several consequences when studying this microorganism, such as quantification or identification problems. Until the late 1970s, quantification of cell growth was very tedious for Sphaerotilus cultures and the common measures of total dry weight method or optical density were not reliable techniques due to the filamentous and flocculent growth mentioned above. van Veen et al. (1978) suggested to use cell protein, cell nitrogen or DNA quantification but it was not until Pellegrin et al. (1999) that the protein quantification method was optimally applied to the study of this bacterium. Sphaerotilus presents high morphological similarities with Leptothrix (especially when appearing as the filamentous form encrusted with iron oxides) and as a result traditional methods are not good enough to distinguish new strains. Thus, molecular techniques such as PCR or Fluorescence in situ hybridization (FISH) combined with Confocal laser scanning microscopy (CLSM) are considered promising tools to identify specifically Leptothrix. and therefore to differentiate it from S. natans and other species (Spring et al., 1996; Fleming et al., 2011).
Gaudy and Wolfe (1961) studied the effects of the nature and concentration of the carbon source and of the concentration of phosphate buffer and peptone on cell growth modes. By using the total dry weight quantification method, they found that only the concentration of peptone affects the growth pattern; high content of peptone (>0.2%) has a negative effect in the proliferation of filaments. However, it does not affect total growth of the bacterium so it does not affect cell growth and division but it might affect the filamentation pathways. Dias et al. (1968) identified calcium ion as a crucial factor for filamentous growth. A concentration of dissolved Ca2+ of 0.1 mM lead to the development of single cells in cultures while higher Ca2+ concentrations induce the formation of sheaths and therefore filamentous proliferation. Later on, Gaval and Pernelle (2003) reported that dissolved oxygen in the medium affects the filamentation process, as controlled O2 deficiency periods led to different filamentation responses.
18 Chapter 2
The study of filamentous growth, sheath formation and sheath composition is of general interest because it could help to design strategies to limit the filamentous blooms of S. natans in the bulking processes mentioned in Section 1. Moreover, since S. natans is easily grown under laboratory conditions, it could be used as model for some microorganisms that cause bulking problems but which cannot be cultivated under laboratory conditions (Rossetti et al., 2005).
2.2.6. Sheath formation
Sheath formation implies an expense of cell energy for all sheath-forming organisms. Thus, sheath formation is considered to occur because at some point during the evolution history it represented an advantageous character for those organisms. For this reason it is thought that sheath formation, especially regarding the Sphaerotilus-Leptothrix group, could be a competitive adaptation when nutrients or oxygen become scarce (Gaval and Pernelle, 2003). According to Spring (2006), a linear arrangement of single cells within a tubular sheath enables bacteria to form filaments, without actual enlargement of cell size. It has been shown that filamentous growth is an effective strategy for bacteria to exceed the size limit of particles edible by protozoa, thereby allowing them to escape from grazing (Sommaruga and Psenner, 1995). In addition, sheaths provide cells with physical protection from infection by bacteriophages (Winston and Thompson, 1979) and bacterial predators (Venosa, 1975). Obviously when sheaths are impregnated with ferric oxides the difficulties for such predators increase and therefore bacterial survival rises. Furthermore, the sheath localizes the metal precipitation at its surface and prevents cells from being in direct contact with iron oxides. Moreover, sheaths together with EPS can initiate biofilm formation, which is considered advantageous for many bacterial species (Spring, 2006; Madigan et al., 2012).
Sheath formation was first studied by Romano and Geason (1964) and Phaup (1968). More recently, Takeda et al. (2012) studied the special relationship between sheath elongation and cell proliferation by using a selective fluorescent-labelling of the sheath. Similar results to those of previous papers were obtained, confirming that S. natans sheaths elongate from their terminal regions, while cell division takes place within the whole length of the sheath. Hence, cell proliferation appears to be independent of the sheath elongation process.
Although no complete genome sequence of S. natans is available yet, there exist a few integrated genetic and physiology studies on the relationship between gene expression and
19 Literature review sheath formation. For example, Suzuki et al. (2002) reported a knock-out of a putative glycosyltransferase gene that blocked the formation of new sheath. This gene, designated as sthA, consisted of 1407 bp encoding a protein formed by 469 amino acids (accession number AB050638). Comparing the amino acid sequence with three different bacterial species, they found a similarity (in amino acid identity) in between 31 and 37% to a similar enzyme catalyzing the glycosyl transfer essential for the sheath formation. Interestingly, sthA seems to be related also to the EPS synthesis in both single-cell and filamentous growth forms. Suzuki et al. (2002) suggested that once the genes involved in sheath formation are identified, a mechanism directed to inhibit their expression could be effectively used to prevent S. natans filamentous blooms in WWTP.
GalNAc GalN GalN GlcA Glc CH2OH CH2OH CH2OH OH O O O COOH CH2OH O O O O O OH OH O A OH O O
NH NH NH2 O O OH (0.5) OH Gly O CH3 NH O
CH3 O NH CH3 N -Ac-Cys SH n
COOH 3-HP GalNAc (0.5) GalN GalA GlcN O CH OH O CH OH 2 GalNA 2 OH O O O COOH CH2OH O O O O O OH OH O B OH OH NH O NH NH2 O O OH NH 2 CH NH NH2 3 HS Cys O Gly
n
Figure 2.1. Presumable structures of S. natans (A) and L. cholodnii (B) sheaths, redrawn from Kondo et al. (2011).
The chemical structure of the S. natans sheath differs in several ways from the sheaths produced by the closely related L. cholodnii (Fig. 2.1). Both glycoconjugates consist of amphoteric straight pentasaccharide repeating units that are grafted with dipeptide containing
L-Cys. The thiol group of the cysteine in the Sphaerotilus and Leptothrix glycoconjugates is oriented outward and inward, respectively. It has been suggested by Kondo et al. (2011) that the thiol group of the O-acetylated repeating unit may serve as a ligand for extracellular protein immobilization. Furthermore, the presence of thiol groups on the outer side of the sheath could potentially play a direct role in the complexation of metals as they do in other
20 Chapter 2 systems. For instance, it has been suggested that the cysteine-like and glutathione-like ligands identified in the exudates of several marine algae may influence the extracellular adsorption and intracellular uptake of Cu, Pb, Cd, Zn, Fe, Mn, Ni and Co in phytoplankton species (Vasconcelos et al. 2002).
As a consequence of this particular composition, the sheath of S. natans is particularly resistant to conventional degradation techniques such as those using proteases. For example, it has been suggested that the proteins contributing to the sheath structure, in combination with other components, could protect the sheath from protease attack (Takeda et al., 1998). It is of general interest to search alternative methods to break down the sheath formed by S. natans to prevent its occasional filamentous blooms in wastewaters treatment plants, since there is no bulking problem when the bacterium is in its single-cell form. Alternatively, bacteriophages have been reported to attack Sphaerotilus and other bulking-related species. Such viruses could be used to control the composition and genetic diversity of WWTP bacterial communities and their transductional gene exchange processes and therefore contribute to solve the problem of the treatment plants (Jensen et al., 1998).
Takeda et al. (2000) isolated a bacterium belonging to the genus Paenibacillus that can actively degrade the sheath of S. natans due to its enzymatic activity. Cultures of Paenibacillus koleovorans have been grown using the purified S. natans sheath as a sole carbon source. Furthermore, Takeda et al. (2003) had cloned and expressed dssA, the gene encoding for this enzyme (DssA), in Escherichia coli, allowing the characterization of the enzyme. In addition, Kondo et al. (2011) elucidated the action mechanisms of this enzyme and designated it as a thiopeptidoglycan lyase.
2.2.7. Extracellular Polymeric Substances (EPS)
In the physiology of S. natans, the EPS that forms the slime layer has been occasionally studied. Indeed, EPS synthesis and secretion occur frequently in S. natans. However, those processes have never been correlated to a particular stage of filament formation. In addition, the distribution of the EPS associated with the filament structure is not clear. EPS might be located between the cell wall and the sheath or outside the sheath, and in each case the biological functions could be different.
21 Literature review
Takeda et al. (2002) described the EPS composition as glucose, rhamnose and aldobiouronic acid using thin-layer chromatography (TLC). Aldobiouronic acid was then analyzed by gas-liquid chromatography and TLC and as a result rhamnose and glucuronic acid were identified, so that total molar ratios of glucose, glucuronic acid and rhamnose are 1:1:2. Finally, the structure of the EPS produced by S. natans has been identified as a gellan- like polysaccharide formed by a tetrasaccharide repeating unit (4)-)-D-Glcp-(1(2)-&-D-
GlcAp-(1(2)-)-L-Rhap-(1(3)-&-L-Rhap-(1(. More recently, Kondo et al. (2012) studied the conformation of the EPS by using NMR analysis and H-H distances in the molecule. The results show that the polysaccharide forms a (12/1) helix of pitch 42.5 Å, which includes the triangle substructure caused by consecutive (1(2) linkages that is reinforced by the hydrogen bond between )-Glc and )-Rha. As a result of this particular structure and properties, authors suggested the term “sphaeran” to refer the EPS polysaccharide produced by S. natans.
Takeda et al. (2005) identified a new strain of Paenibacillus (P. hodogayensis) that is able to degrade the EPS of Sphaerotilus. No enzyme characterization has been performed in this study but EPS degradation has been demonstrated by cultivating the bacteria in a mineral medium with purified EPS as the only source of carbon. In addition, it seems that EPS do not play a role against sheath-degrading bacteria (Takeda et al. 2002).
Although it is known that some of the enzymes and proteins produced by S. natans are secreted outside the cell and incorporated to the pool of EPS that surround the sheath (Spring, 2006), the role of EPS has not been yet elucidated in the case of S. natans. As it has been suggested for other iron-related bacterial species (Miot et al. 2009), EPS could play an important role in iron oxidation and deposition.
2.3. Sphaerotilus natans relation with iron
Iron is the fourth most abundant element in the Earth’s crust and is involved in numerous biogeochemical processes. The importance of Fe is not only based on its geological relevance but also on its role as an element necessary to living organisms (Fortin and Langley, 2005). Bacteria participate in geochemical reactions that involve redox and phase transformations of iron species. As has been summarized in several publications, microorganisms play a key role in iron oxidation and deposition (Konhauser, 1998; Gadd, 2004; James and Ferris, 2004; Duckworth et al., 2009; Gault et al., 2011).
22 Chapter 2
Investigations into iron oxidation and autotrophy of the neutrophilic iron-related bacteria started at the end of the XIXth century, when Winogradsky (1888) suggested that iron could be used as an energy source for growth by some filamentous bacteria. Since then, several neutrophilic filamentous iron-related microorganisms living under microaerophilic conditions have been identified within the beta-proteobacteria, such as Sphaerotilus natans, Leptothrix ochracea or Gallionella ferruginea (Hedrich et al. 2011). However, only the latter species has been effectively proven to live autotrophically on iron (Hallbeck and Pedersen, 1991).
2.3.1. Sphaerotilus as an iron-related bacterium
The Sphaerotilus-Leptothrix group has been frequently related to microaerophilic iron oxidation as it will be detailed in the following sections. However, no agreement has been yet achieved in the literature about their exact implication on the iron cycle. S. natans has been -1 found under microaerophilic conditions, with O2 concentrations around 0.1 - 0.5 mg.L (Gridneva et al. 2011). However, deciphering whether iron oxidation can be considered as biotic or abiotic in such microaerophilic conditions is challenging.
Druschel et al. (2008) stated that metabolic reactions that lead to an oxidation of Fe(II) by living bacteria are often difficult to distinguish from autocatalysis by bacteriogenic iron oxides (BIOS), so they might be considered as a passive oxidation process. In other words, Rentz et al. (2007) discussed if the passive catalysis of Fe oxidation by cell surfaces, EPS and the released by-products should be considered a biotic or an abiotic oxidation because there is no direct implication of cell metabolism, even if cells are contributing in some way. In addition, de Vet et al. (2011) have also questioned whether the bacterial release of enzymes that oxidize Fe(II) should be classified as biotic or abiotic when microorganisms do not use this energy for bacterial growth. To date, such key questions regarding iron oxidation mechanisms have not been definitely answered.
In this review iron oxidation is divided in two different categories: if direct enzymatic activity is involved in Fe oxidation, it is classified as enzymatic iron oxidation, whereas if the oxidation is due to passive autocatalysis by BIOS or catalysis by EPS, cell surface or by the released by-products it is considered as biological-related iron oxidation. For instance, some nitrate-reducing iron-oxidizing bacteria oxidize iron through the nitrites produced as by- product of nitrate reduction and not as a result of a direct enzymatic activity (Miot et al. 2009; Klueglein and Kappler 2013).
23 Literature review
Despite all the investigations, the classification of Sphaerotilus and its relationship with iron is yet unclear (Table 2.3). Phauph (1968) noted that, even if Sphaerotilus is often called an iron-bacterium, it has never been definitely established that the organism either requires iron or receives any energy from its oxidation. Since biological-related oxidation has been often misinterpreted as enzymatic iron oxidation through literature, the ability of Sphaerotilus species to oxidize Fe is still confusing and unresolved.
Table 2.3. Some examples of the classification of Sphaerotilus and Leptothrix reported in research papers addressing their relation to iron.
Bacteria studied Classification References
S. natans Iron bacterium Stokes (1953)
Sphaerotilus Sheathed bacterium Dondero et al. (1961)
S. natans ATCC 29329 Iron-oxidizing bacteria Corstjens et al. (1992)
L. discophora SS-1 Mn and Fe-oxidizing bacteria
Leptothrix-like Secondary iron-oxidizing Dimitriakos Michalakos et al. bacterium (1997)
S. natans Heterotrophic iron bacterium Gridneva et al. (2011)
Enzymatic iron oxidation by S. natans was suggested by Corstjens et al. (1992) based on enzymatic experiments. In this study Sphaerotilus and Leptothrix discophora are described as iron oxidizing heterotrophic bacteria. For L. discophora, an iron-oxidizing protein was identified. However, for Sphaerotilus natans, the reported evidence for iron oxidation ability is only based on bacterial lysates activity, which does not allow to differentiate enzymatic oxidation from other processes as catalysis by EPS or cell materials. Beyond this study discussing the hypothesis of enzymatic iron oxidation by S. natans, little is known about the genetics and proteomics of iron metabolism in this bacterium. As mentioned previously, the genome of S. natans has not been sequenced yet. Consequently, no bioinformatics analysis has been done to identify parts of the genome that could be involved in iron metabolic reactions. Accordingly, no work has been published yet with the aim of identifying the
24 Chapter 2 proteins involved on iron oxidation as in the case of Leptothrix discophora (de Vrind-de Jong et al. 1990; Corstjens et al. 1992).
Biological-related iron oxidation by S. natans has been more widely reported in literature. For instance, van Veen et al. (1978) suggested iron deposition as consequence of biological- related oxidation, but not as a result of enzymatic iron oxidation. Similarly, Spring (2006) reported that the capability of this species to oxidize Fe(II) could be a side effect of a biological reaction not involving enzymatic iron oxidation. The same author recalls that possible autotrophic or mixotrophic growth of Sphaerotilus and Leptothrix with ferrous iron as electron donor has not been demonstrated yet. Accordingly, in the case of the closely related Leptothrix cholodnii, Vollrath et al. (2012) reported that the competitive advantage of microbial iron oxidation in low oxygen environments may be limited by the autocatalytic nature of abiotic Fe(III) oxide precipitation, unless the accumulation of Fe(III) oxides is prevented, for example, through a close coupling of Fe(II) oxidation and Fe(III) reduction.
2.3.2. Iron biomineralization
Once the iron is oxidized -either abiotically or by enzymatic or biological-related iron oxidation processes- ferrous iron leads to oversaturation of Fe3+ with respect to ferric oxyhydroxides that precipitate near the cells in the form of hydrous ferric oxides (HFO). The deposition of Fe(III) forms BIOS, which mostly consist of a mixture of poorly ordered HFO and biological material (Ferris, 2005). In the case of the Sphaerotilus-Leptothrix group, iron deposition onto the filaments (sheath encrustation) is classified as biologically-induced biomineralization, as the process is not directly driven by metabolic activity. Indeed, it is rather attributed to interactions of cell metabolism (biological-related iron oxidation) with the surrounding media (Konhauser, 2007). The nature of the mineral phases forming can thus be influenced by the release of by-products, changes in pH, redox potential, organic and inorganic nutrients and free metabolites (Gadd, 2004).
The consequences of sheath encrustation on cell metabolism are still debated, with possible beneficial or detrimental effects. When the whole sheath is encrusted by Fe oxides some dissolved compounds and enzymes that might pass across it could be blocked. Cell metabolism could thus be affected by possible decrease in nutrient availability and in respiration exchange processes. Hedrich et al. (2011) stated that the deposition of iron oxides “could be serendipitous, and derives from the breakdown of organic iron complexes by these
25 Literature review bacteria, with the sheath acting as a focal point for the hydrolysis and precipitation of the ferric iron released”. In contrast, various possible evolutionary advantages of sheath and EPS mineralization have been proposed in the literature. The most widely accepted hypothesis is that it may prevent cells from becoming totally encrusted with iron oxyhydroxides (Emerson and Moyer 1997; Sobolev and Roden 2001; Straub et al. 2001; Hallberg and Ferris 2004; Chan et al. 2011). Chan (2011) recently proposed that it may be a strategy to place waste products far from the cell to prevent entombment. It could also be possible that cells gain energetic benefit from localized release of protons during mineral formation (Emerson and Moyer, 1997; Chan et al., 2004). Additionally, James and Ferris (2004) suggested that the precipitation of ferric hydroxides might increase the free energy available, while Hallbeck et al. (1993) stated that it may protect cells from reactive oxygen species (ROS) generated during iron oxidation.
2.4. Environmental applications of Sphaerotilus natans
Anthropogenic activities have released potentially toxic inorganic compounds in natural environments during the last several decades, causing increasing pollution in many countries. Several treatments have been used to reduce contamination levels from wastewaters, such as chemical precipitation, membrane separation, coagulation, reverse osmosis, ion exchange and electrochemical treatments (Sharma et al. 2005; Hashim et al. 2011; Chaturvedi and Dave 2012). Most of these processes have an elevated economical cost or present technical difficulties and therefore new methods are now under investigation.
Compared to the techniques mentioned above, biosorption of heavy metals and radionuclides potentially offer several advantages, such as lower economical cost, high performance in pollutants removal and technical simplicity (Vijayaraghavan and Yun, 2008). In this context, two main types of biological scavenging can be distinguished for filamentous bacteria, which have not yet been reviewed for Sphaerotilus natans: i) biosorption that comprises direct sorption onto biological material as bacterial surface, sheath and EPS and ii) sorption onto BIOS produced by the cell. According to Gadd (2004), biosorption can be defined as the microbial uptake of organic and inorganic metal species, both soluble and insoluble, by physicochemical mechanisms, such as adsorption. On the other hand, sorption onto BIOS, which are deposited on the bacterial or sheath surfaces, is a combined effect of metal sorption reactions at the mineral-solution interface together with interactions of minerals with cell wall, sheath, EPS and by-products released by the microorganism.
26 Chapter 2
2.4.1. Biosorption onto S. natans
Metal ion sorption onto S. natans surface has been extensively reported, especially in the field of process engineering. S. natans biosorbent capabilities depend on the isoelectric point (IP) of its sheath, which is at pH 3.8. It can electrostatically bind negative ions at pH lower than ~ 4 and positive ions at higher pH (Zhao et al. 2007). This wide range of pH broadens the potential of S. natans as industrial biosorbent (Table 2.4). However, the relationship between sorption mechanisms and the sorption efficiency of S. natans has been barely investigated.
Table 2.4. Some metal scavenging examples by different neutrophilic filamentous iron-related bacteria.
Sample origin Microorganism Metal Sorbent References Culture S. natans Bacteria collection NCIMB 11196 Mg Converti et al. =ATCC 15291 (1992) Cd, Zn, Cu, Lodi et al. (1998) Ag, Cr(III) Cd, Cu Esposito et al. (2001)
Pb, Cu, Zn, Pagnanelli et al. Cd (2003) Cu -Cd, Cu- Pagnanelli et al. Pb (2004) Cu Beolc hini et al. (2003; 2006) ATCC 29329 Cr(III) Caravelli et al. (2008) Isolated from Iron -related Fe Bacteria Dimitrakos the bacteria Michalakos et al. environment (putative (1997) Leptothrix, Sphaerotilus, Crenothrix) Isolated from Sphaerotilus Fe Bacteria Zhang et al. the natans (2012)
27 Literature review environment Leptothrix ATCC 43182 discophora Isolated from Sphaerotilus Fe Bacteria Shopska et al. the and Leptothrix (2013) environment Isolated from Leptothrix and Fe Bacteria Katsoyiannis and the Gallionea Zouboulis (2004) environment Pacini et al. (2005) Qin et al. (2009) Isolated from Sphaerotilus Pb, Cr Bacteria Z hao et al. (2007) the natans coated environment with magnetite Isolated from Leptothrix BIOS the and/or environment Gallionea As Katsoyiannis (2002) Keim (2011) U Katsoyiannis et al. (2006) Katsoyiannis (2007) I Kennedy et al. (2011) Sr Ferris et al. (2000) Langley et al. (2009) Sr, Cs, Pb, Ferris et al. (2000) U
Converti et al. (1992) investigated the accumulation of magnesium by S. natans cells and their results suggested that it was not only a biological mechanism but also physical, providing the first clues about the sorption capabilities of S. natans. Lodi et al. (1998) reported for the first time the use of S. natans as biosorbent for the potential treatment of acidic industrial wastewaters. Cadmium, zinc, copper, silver and chromium (III) were
28 Chapter 2 separately added to batch cultures in order to calculate sorption isotherms and hence metal uptake and kinetics of metal removal. The authors hypothesized that sorption mechanisms could be based on the interaction between the negative charges of S. natans cell surface and the positive cations.
Later on, biosorption of copper onto S. natans surface has been carried out by immobilising S. natans lyophilised biomass in a polysulfone matrix (Beolchini et al., 2003) and by using membrane reactors experiments to calibrate dynamic modelling of the biosorption process (Beolchini et al., 2006). In addition, the dynamics of binary systems (Cu- Cd, Cu-Pb) in biosorbent membrane reactors have been also modelled (Pagnanelli et al., 2004). The influence of pH, biomass concentration, matrix parameters and ionic strength on biosorption rates has been investigated. However, as the biomass used in these experiments was lyophilised, the possible influence of bacterial metabolism in those sorption processes could not be evaluated. In addition to these dynamic studies, empirical modelling has also been conducted in single metal systems to study Pb (Pagnanelli et al., 2003), Cu (Esposito et al., 2001; Pagnanelli et al., 2003), Zn (Pagnanelli et al., 2003) and Cd (Esposito et al., 2001; Pagnanelli et al., 2003) biosorption onto S. natans surface. An adaptation of the classical Langmuir isotherm model was used to describe biosorption at various equilibrium pH values. For further information about single and binary models for biosorption experiments, references (Esposito et al. 2002; Pagnanelli et al. 2002) can be consulted.
Beyond sorption experiments, chromium reduction at pH 7 has been tested by Caravelli et al. (2008) and results showed that S. natans is able to reduce Cr(VI) to Cr(III) and adsorb it on its surface. In this case, contrary to previously mentioned studies, Cr reduction is influenced by the metabolic activity of the microorganism and therefore the mechanisms of Cr tolerance and reduction are promising features for the wastewater treatment processes.
In parallel, iron sorption onto bacteria has been used as an alternative to classical physicochemical treatments designed for iron removal in water systems (Ankrah and Søgaard, 2009; Hashim et al., 2011). Dimitrakos Michalakos et al. (1997) used iron-related bacteria to remove iron from potable water and compared it with physicochemical traditional methods such as aeration and solid-liquid separation (filtration and sedimentation mainly). In this work, unknown inoculum from a WWTP was used as biosorbent. After 10 days of culture, “cylindrical-shaped filaments, which could be Leptothrix, Sphaerotilus or even Crenothrix” were observed. Results showed that biological iron oxidation and subsequent precipitation of
29 Literature review
BIOS removed two times more iron than physicochemical oxidation alone. Accordingly, several authors also concluded that microorganisms of the Sphaerotilus-Leptothrix group and Gallionella ferruginea are efficient iron biosorbents, having fast first-order kinetics for iron removal (Katsoyiannis and Zouboulis 2004; Pacini et al. 2005; Qin et al. 2009). As it can be inferred from those examples, biological-mediated treatment for iron removal offers advantageous future perspectives because it is environmental friendly (less chemical reagents are used) and has a low economic cost (Katsoyiannis and Zouboulis, 2004). In addition, BIOS formed upon these reactions are potential sorbents for pollutants as it is discussed hereafter.
2.4.2. S. natans BIOS sorption
The formation of BIOS has been discussed through literature for Leptothrix and Gallionella species (the closest neutrophilic bacteria related to Sphaerotilus) (James and Ferris, 2004; Gault et al., 2011). Interestingly, it has been reported that such BIOS, due to the reactive properties of their surfaces, are efficient substrates for the sorption of various metals. Despite knowledge about bacterial BIOS and their favourable properties, S. natans BIOS and their potential use for the scavenging of inorganic pollutants has been rarely documented (Table 2.4).
In addition, BIOS formation has been of interest also in the material sciences. In this context, Zhang et al. (2012) used S. natans and L. discophora to prepare fiber-shaped ferrite and manganese ferrite, respectively, after heat treatment of a biogenic lepidocrocite precursor. Such results open new perspectives for the preparation of special shaped materials. In addition, Shopska et al. (2013) studied the biogenic iron compounds formed by Sphaerotilus and Leptothrix isolated from the environment and reported different iron oxides depending on the culture media.
BIOS, presumably from Leptothrix and Gallionella, have been reported to scavenge arsenic (Keim, 2011), strontium (Ferris et al., 2000; Langley et al., 2009), cesium (Ferris et al., 2000), lead (Ferris et al., 2000), iodide (Kennedy et al. 2011), cadmium - only Gallionella - (Martinez et al. 2004; Martinez and Ferris 2005) and uranium (Ferris et al., 2000; Katsoyiannis et al., 2006; Katsoyiannis, 2007). Other bacterial species have been artificially coated with iron oxides such as Shewanella alga, which has been used in strontium sorption (Small et al. 2001), Bacillus thuringiensis, used to scavenge copper and chromium (Zhu et al.,
30 Chapter 2
2012) or the fungus Aspergilus niger, used to scavenge arsenic (Pokhrel and Viraraghavan, 2006).
In the case of Sphaerotilus, Zhao et al. (2007) presented a composite formed artificially by S. natans and magnetite (chemically precipitated), which was tentatively tested to scavenge lead and chromium from polluted waters. Results showed that this combination increases the removal rate of Pb, suggesting that sorption onto BIOS could be more efficient than biosorption in this case. Furthermore, the mineralogy and characteristics of the BIOS could facilitate the separation method; for instance, in the same study a magnetic field is used at the end to separate the composite magnetite-Sphaerotilus (which scavenges the Pb) from the depolluted medium. This last example suggests that combinations of S. natans with biogenic or non-biogenic iron oxides are promising for the improvement of inorganic pollutant scavenging pathways.
2.5. Conclusions
Sphaerotilus natans has often been at the edge of scientific attention due to the prominence of its closest related species Leptothrix spp. A detailed review of the physiology of S. natans, its relationship with iron and its environmental applications has been presented in this paper. Some knowledge gaps are identified, which represent major challenges for future research studies and experimental investigations. First of all, S. natans has not been proven to oxidize iron and hence its classification as iron-related bacterium is yet unclear. In addition, the filamentation mechanisms and the factors that affect such processes are still poorly constrained. The mechanisms of direct sorption of inorganic pollutants onto S. natans surface, EPS or sheath, are still unknown. Thus, we believe that the potential of S. natans as biosorbent is currently underestimated. As a result, the application of this microorganism to bioremediation processes is not yet optimized.
Moreover, interactions between iron and S. natans that lead to the precipitation of iron oxides are not understood. Bacteriogenic iron oxides produced by S. natans might be potentially used as scavenger substrate for metals and metalloids and may thus be considered in addition to classical biosorption processes. Indeed, reactive surface of BIOS increases available sites to bind the heavy metals or radionuclides and iron oxides are known to exhibit high affinities for such solutes. Additionally, coprecipitation of iron with such pollutants could also facilitate their removal from the polluted medium. Hence, improving our
31 Literature review knowledge of the physiology of S. natans, especially concerning the mechanisms of filamentation and sheath formation and composition and their effect on iron biomineralization would likely facilitate implementation of Sphaerotilus natans and its BIOS in bioremediation technologies to remove heavy metals and radionuclides from water systems.
32 Chapter 2
References
Ankrah, D.A. and Søgaard, E.G. (2009) A review of biological iron removal. Thirteen. Int. Water Technol. Conf. IWTC 13 1: 999–1005.
Beolchini, F., Pagnanelli, F., Toro, L., and Vegliò, F. (2003) Biosorption of copper by Sphaerotilus natans immobilised in polysulfone matrix: equilibrium and kinetic analysis. Hydrometallurgy 70: 101–112.
Beolchini, F., Pagnanelli, F., Toro, L., and Vegliò, F. (2006) Ionic strength effect on copper biosorption by Sphaerotilus natans: equilibrium study and dynamic modelling in membrane reactor. Water Res. 40: 144–152.
Caravelli, A.H., Giannuzzi, L., and Zaritzky, E. (2008) Reduction of hexavalent chromium by Sphaerotilus natans a filamentous micro-organism present in activated sludges. J. Hazard. Mater. 156: 214–222.
Chan, C.S., Fakra, S.C., Emerson, D., Fleming, E.J., and Edwards, K.J. (2011) Lithotrophic iron-oxidizing bacteria produce organic stalks to control mineral growth: implications for biosignature formation. ISME J. 5: 717–727.
Chan, C.S., De Stasio, G., Welch, S.A., Girasole, M., Frazer, B.H., Nesterova, M. V, et al. (2004) Microbial polysaccharides template assembly of nanocrystal fibers. Science 303: 1656–1658.
Chaturvedi, S. and Dave, P.N. (2012) Removal of iron for safe drinking water. Desalination 303: 1–11.
Contreras, E.M., Giannuzzi, L., and Zaritzky, N.E. (2000) Growth kinetics of the microorganism Sphaerotilus natans in a model system of a food industry wastewater. Water Res. 34: 4455–4463.
Corstjens, P. and Muyzer, G. (1993) Phylogenetic analysis of the metal-oxidizing bacteria Leptothrix discophora and Sphaerotilus natans using 16S rDNA sequencing data. Syst. Appl. Microbiol. 16: 219–223.
33 Literature review
Corstjens, P.L., de Vrind, J.P., Westbroek, P., and de Vrind-de Jong, E.W. (1992) Enzymatic iron oxidation by Leptothrix discophora: identification of an iron-oxidizing protein. Appl. Environ. Microbiol. 58: 450–454.
Demoll, R. and Liebmann, H. (1952) Über die verteilung von Sphaerotilus natans in fluss. Schweizerische zeitschrift fur Hydrol. - Swiss J. Hydrol. 17: 112–125.
Dias, F.F. and Heukelekian, H. (1967) Utilization of inorganic nitrogen compounds by Sphaerotilus natans growing in a continuous-flow apparatus. Appl. Microbiol. 15: 1083– 1086.
Dias, F.F., Okrend, H., and Dondero, N.C. (1968) Calcium nutrition of Sphaerotilus growing in a continuos-flow apparatus. Appl. Environ. Microbiol. 16: 1364–1369.
Doetsch, R.N. (1966) Notes on some structural features of Sphaerotilus natans. Arch. Mikrobiol. 54: 46–55.
Dondero, N.C. (1961) Sphaerotilus, its nature and economic significance. Adv. Appl. Microbiol. 3: 77–107.
Dondero, N.C. (1975) The Sphaerotilus-Leptothrix group. Annu. Rev. Microbiol. 29: 407– 428.
Duckworth, O.W., Holmström, S.J.M., Peña, J., and Sposito, G. (2009) Biogeochemistry of iron oxidation in a circumneutral freshwater habitat. Chem. Geol. 260: 149–158.
Eikelboom, D.H. (1975) Filamentous organisms observed in activated sludge. Water Res. 9: 365–388.
Emerson, D., Fleming, E.J., and McBeth, J.M. (2010) Iron-oxidizing bacteria: an environmental and genomic perspective. Annu. Rev. Microbiol. 64: 561–583.
Emerson, D. and Moyer, C. (1997) Isolation and characterization of novel iron-oxidizing bacteria that grow at circumneutral pH. Appl. Environ. Microbiol. 63: 4784–4792.
Emerson, D. and Weiss, J. V. (2004) Bacterial iron oxidation in circumneutral freshwater habitats: findings from the field and the laboratory. Geomicrobiol. J. 21: 405–414.
34 Chapter 2
Esposito, A., Pagnanelli, F., Lodi, A., Solisio, C., and Vegliò, F. (2001) Biosorption of heavy metals by Sphaerotilus natans: an equilibrium study at different pH and biomass concentrations. Hydrometallurgy 60: 129–141.
Esposito, A., Pagnanelli, F., and Vegliò, F. (2002) pH-related equilibria models for biosorption in single metal systems. Chem. Eng. Sci. 57: 307–313.
Ferris, F. (2005) Biogeochemical properties of bacteriogenic iron oxides. Geomicrobiol. J. 22: 79–85.
Ferris, F.., Hallberg, R.., Lyvén, B., and Pedersen, K. (2000) Retention of strontium, cesium, lead and uranium by bacterial iron oxides from a subterranean environment. Appl. Geochemistry 15: 1035–1042.
Fleming, E.J., Langdon, A.E., Martinez-Garcia, M., Stepanauskas, R., Poulton, N.J., Masland, E.D.P., and Emerson, D. (2011) What’s new is old: resolving the identity of Leptothrix ochracea using single cell genomics, pyrosequencing and FISH. PLoS One 6: e17769.
Fortin, D. and Langley, S. (2005) Formation and occurrence of biogenic iron-rich minerals. Earth-Science Rev. 72: 1–19.
Gadd, G.M. (2004) Microbial influence on metal mobility and application for bioremediation. Geoderma 122: 109–119.
Gaudy, E. and Wolfe, R.S. (1961) Factors affecting filamentous growth of Sphaerotilus natans. Appl. Microbiol. 9: 580–584.
Gault, A.G., Ibrahim, A., Langley, S., Renaud, R., Takahashi, Y., Boothman, C., et al. (2011) Microbial and geochemical features suggest iron redox cycling within bacteriogenic iron oxide-rich sediments. Chem. Geol. 281: 41–51.
Gault, A.G., Langley, S., Ibrahim, A., Renaud, R., Takahashi, Y., Boothman, C., et al. (2012) Seasonal changes in mineralogy, geochemistry and microbial community of bacteriogenic iron oxides (BIOS) deposited in a circumneutral wetland. Geomicrobiol. J. 29: 161–172.
35 Literature review
Gaval, G. and Pernelle, J.-J. (2003) Impact of the repetition of oxygen deficiencies on the filamentous bacteria proliferation in activated sludge. Water Res. 37: 1991–2000.
Gridneva, E., Chernousova, E., Dubinina, G., Akimov, V., Kuever, J., Detkova, E., and Grabovich, M. (2011) Taxonomic investigation of representatives of the genus Sphaerotilus: descriptions of Sphaerotilus montanus sp. nov., Sphaerotilus hippei sp. nov., Sphaerotilus natans subsp. natans subsp. nov. and Sphaerotilus natans subsp. sulfidivorans subsp. nov., and an emended description of the genus Sphaerotilus. Int. J. Syst. Evol. Microbiol. 61: 916– 925.
Gridneva, E. V., Grabovich, M.Y., Dubinina, G.A., Chernousova, E.Y., and Akimov, V.N. (2009) Ecophysiology of lithotrophic sulfur-oxidizing Sphaerotilus species from sulfide springs in the Northern Caucasus. Microbiology 78: 76–83.
Hallbeck, L. and Pedersen, K. (1991) Autotrophic and mixotrophic growth of Gallionella ferruginea. J. Gen. Microbiol. 137: 2657–2661.
Hallbeck, L., Ståhl, F., and Pedersen, K. (1993) Phylogeny and phenotypic characterization of the stalk-forming and iron-oxidizing bacterium Gallionella ferruginea. J. Gen. Microbiol. 139: 1531–1535.
Hallberg, R. and Ferris, F.G. (2004) Biomineralization by Gallionella. Geomicrobiol. J. 21: 325–330.
Hashim, M. a, Mukhopadhyay, S., Sahu, J.N., and Sengupta, B. (2011) Remediation technologies for heavy metal contaminated groundwater. J. Environ. Manage. 92: 2355–88.
Hedrich, S., Schlömann, M., and Johnson, D.B. (2011) The iron-oxidizing proteobacteria. Microbiology 157: 1551–64.
James, R. and Ferris, F. (2004) Evidence for microbial-mediated iron oxidation at a neutrophilic groundwater spring. Chem. Geol. 212: 301–311.
Jensen, E.C., Schrader, H.S., Rieland, B., Thompson, T.L., Lee, K.I.T.W., Nickerson, K.W., and Kokjohn, T.A. (1998) Prevalence of broad-host-range lytic bacteriophages of Sphaerotilus natans, Escherichia coli, and Pseudomonas aeruginosa. Appl. Environ. Microbiol. 64: 575–580.
36 Chapter 2
Kämpfer, P. (1998) Some chemotaxonomic and physiological properties of the genus Sphaerotilus. Syst. Appl. Microbiol. 21: 245–250.
Katsoyiannis, I.A. (2007) Carbonate effects and pH-dependence of uranium sorption onto bacteriogenic iron oxides: kinetic and equilibrium studies. J. Hazard. Mater. 139: 31–37.
Katsoyiannis, I.A., Werner, H., Bartel, H., and Jekel, M. (2006) The effect of groundwater composition on uranium (VI) sorption onto bacteriogenic iron oxides. Water Res. 40: 3646– 3652.
Katsoyiannis, I.A. and Zouboulis, A.I. (2004) Biological treatment of Mn (II) and Fe (II) containing groundwater: kinetic considerations and product characterization. Water Res. 38: 1922–1932.
Katsoyiannis, I.A. and Zouboulis, A.I. (2002) Removal of arsenic from contaminated water sources by sorption onto iron-oxide-coated polymeric materials. Water Res. 36: 5141–5155.
Keim, C.N. (2011) Arsenic in biogenic iron minerals from a contaminated environment. Geomicrobiol. J. 28: 242–251.
Kondo, K., Takeda, M., Mashima, T., Katahira, M., Koizumi, J., and Ueda, K. (2012) Conformational analysis of an extracellular polysaccharide produced by Sphaerotilus natans. Carbohydr. Res. 360: 102–108.
Konhauser, K. (2007) Introduction to geomicrobiology John Wiley & Sons, Padstow.
Konhauser, K.O. (1998) Diversity of bacterial iron mineralization. Earth-Science Rev. 43: 91–121.
Kützing, F.T. (1833) Sphaerotilus natans, eine neue Süsswasseralge. Linnaea 8: 385–387.
Langley, S., Gault, A.G., Ibrahim, A., Takahashi, Y., Renaud, R., Fortin, D., et al. (2009) Sorption of strontium onto bacteriogenic iron oxides. Environ. Sci. Technol. 43: 1008–1014.
Madigan, M.T., Martinko, J.M., Stahl, D., and Clark, D.P. (2012) Brock Biology of Microorganisms 13th Editi. Pearson Education, Inc., San Francisco.
37 Literature review
Martinez, R.E. and Ferris, F.G. (2005) Review of the surface chemical heterogeneity of bacteriogenic iron oxides: proton and cadmium sorption. Am. J. Sci. 305: 854–871.
Martinez, R.E., Pedersen, K., and Ferris, F.G. (2004) Cadmium complexation by bacteriogenic iron oxides from a subterranean environment. J. Colloid Interface Sci. 275: 82– 89.
McAllister, S.M., Davis, R.E., McBeth, J.M., Tebo, B.M., Emerson, D., and Moyer, C.L. (2011) Biodiversity and emerging biogeography of the neutrophilic iron-oxidizing Zetaproteobacteria. Appl. Environ. Microbiol. 77: 5445–5457.
Michalakos, G.D., Martínez Nieva, J., Vayenas, D. V, and G, L. (1997) Removal of iron from potable water using a trickling filter. Water Res. 31: 991–996.
Mulder, E.G. and van Veen, W.L. (1963) Investigations on the Sphaerotilus-Leptothrix Group. Antoine van Leeuwenhoek 29: 121–153.
Okrend, H. and Dondero, N.C. (1964) Requirement of Sphaerotilus for cyanocobalamin. J. Bacteriol. 87: 286–292.
Pacini, V.A., María Ingallinella, A., and Sanguinetti, G. (2005) Removal of iron and manganese using biological roughing up flow filtration technology. Water Res. 39: 4463– 4475.
Pagnanelli, F., Beolchini, F., Di Biase, A., and Vegliò, F. (2004) Biosorption of binary heavy metal systems onto Sphaerotilus natans cells confined in an UF/MF membrane reactor: dynamic simulations by different Langmuir-type competitive models. Water Res. 38: 1055– 1061.
Pagnanelli, F., Esposito, A., Toro, L., and Vegliò, F. (2003) Metal speciation and pH effect on Pb, Cu, Zn and Cd biosorption onto Sphaerotilus natans: Langmuir-type empirical model. Water Res. 37: 627–633.
Pagnanelli, F., Esposito, A., and Vegliò, F. (2002) Multi-metallic modelling for biosorption of binary systems. Water Res. 36: 4095–4105.
38 Chapter 2
Pellegrin, V., Juretschko, S., Wagner, M., Cottenceau, G., Pellegrin, R., and Ge, L. De (1999) Morphological and biochemical properties of a Sphaerotilus sp. isolated from paper mill slimes. Appl. Environ. Microbiol. 65: 156–162.
Phaup, J.D. (1968) The biology of Sphaerotilus species. Water Res. 2: 597–614.
Pokhrel, D. and Viraraghavan, T. (2006) Arsenic removal from aqueous solution by iron oxide-coated fungal biomass: a factorial design analysis. Water. Air. Soil Pollut. 173: 195– 208.
Pringsheim, E.G. (1949) The filamentous bacteria Sphaerotilus, Leptothrix, Cladothrix, and their relation to iron and manganese. Philos. Trans. R. Soc. B Biol. Sci. 233: 453–482.
Qin, S., Ma, F., Huang, P., and Yang, J. (2009) Fe (II) and Mn (II) removal from drilled well water: a case study from a biological treatment unit in Harbin. Desalination 245: 183– 193.
Rentz, J.A., Kraiya, C., Luther III, G.W., and Emerson, D. (2007) Control of ferrous iron oxidation within circumneutral microbial iron mats by cellular activity and autocatalysis. Environ. Sci. Technol. 41: 6084–6089.
Romano, A.H. and Geason, D.J. (1964) Pattern of sheath synthesis in Sphaerotilus natans. J. Bacteriol. 88: 1145–1150.
Rossetti, S., Tomei, M.C., Nielsen, P.H., and Tandoi, V. (2005) “Microthrix parvicella”, a filamentous bacterium causing bulking and foaming in activated sludge systems: a review of current knowledge. FEMS Microbiol. Rev. 29: 49–64.
Sharma, S.K., Petrusevski, B., and Schippers, J.C. (2005) Biological iron removal from groundwater: a review. J. Water Supply Res. Technol. 54: 239–247.
Siering, P.L. and Ghiorse, W.C. (1996) Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analyses. Int. J. Syst. Bacteriol. 46: 173–182.
39 Literature review
Small, T.D., Warren, L.A., and Ferris, F.G.G. (2001) Influence of ionic strength on strontium sorption to bacteria, Fe(III) oxide, and composite bacteria-Fe(III) oxide surfaces. Appl. Geochemistry 16: 939–946.
Sobolev, D. and Roden, E.E. (2001) Suboxic deposition of ferric iron by bacteria in opposing gradients of Fe (II) and oxygen at circumneutral pH. Appl. Environ. Microbiol. 67: 1328–1334.
Sommaruga, R. and Psenner, R. (1995) Permanent presence of grazing-resistant bacteria in a hypertrophic lake. Appl. Environ. Microbiol. 61: 3457–3459.
Spring, S. (2006) The genera Leptothrix and Sphaerotilus. In, Dworkin,M., Falkow,S., Rosenberg,E., Schleifer,K.-H., and Stackebrandt,E. (eds), Prokaryotes. Springer New York, pp. 758–777.
Spring, S., Kampfer, P., Ludwig, W., and Schleifer, K.-H. (1996) Polyphasic characterization of the genus Leptothrix: new descriptions of Leptothrix mobilis sp. nov. and Leptothrix discophora sp. nov. nom. rev. and emended description of Leptothrix cholodnii emend. Syst. Appl. Microbiol. 19: 634–643.
Stokes, J.L. (1953) Studies on the filamentous sheathed iron bacterium Sphaerotilus natans. J. Bacteriol. 67: 278–291.
Straub, K., Benz, M., and Schink, B. (2001) Iron metabolism in anoxic environments at near neutral pH. FEMS Microbiol. Ecol. 34: 181–186.
Suzuki, T., Kanagawa, T., and Kamagata, Y. (2002) Identification of a gene essential for sheathed structure formation in Sphaerotilus natans, a filamentous sheathed bacterium. Appl. Environ. Microbiol. 68: 365–371.
Szewzyk, U., Szewzyk, R., Schmidt, B., and Braun, B. (2011) Neutrophilic iron-depositing microorganisms. In, Flemming, H.-C., Wingender, J., and Szewzyk, U. (eds), Biofilm Highlights, Springer Series on Biofilms. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 63–79.
40 Chapter 2
Takeda, M., Iohara, K., Shinmaru, S., Suzuki, I., and Koizumi, J.-I. (2000) Purification and properties of an enzyme capable of degrading the sheath of Sphaerotilus natans. Appl. Environ. Microbiol. 66: 4998–5004.
Takeda, M., Matsuoka, H., Hamana, H., and Hikuma, M. (1995) Biosynthesis of poly-3- hydroxybutyrate by Sphaerotilus natans. Appl. Microbiol. Biotecnol. 43: 31–34.
Takeda, M., Miyanoiri, Y., Nogami, T., Oda, K., Saito, T., Kato, K., et al. (2007) Structural analysis of the fundamental polymer of the sheath constructed by Sphaerotilus natans. Biosci. Biotechnol. Biochem. 71: 2992–2998.
Takeda, M., Nakano, F., Nagase, T., Iohara, K., and Koizumi, J. (1998) Isolation and chemical composition of the sheath of Sphaerotilus natans. Biosci. Biotechnol. Biochem. 62: 1138–1143.
Takeda, M., Nomoto, S., and Koizumi, J. (2002) Structural analysis of the extracellular polysaccharide produced by Sphaerotilus natans. Biosci. Biotechnol. Biochem. 66: 1546– 1551.
Takeda, M., Suzuki, I., and Koizumi, J. (2005) Paenibacillus hodogayensis sp. nov., capable of degrading the polysaccharide produced by Sphaerotilus natans. Int. J. Syst. Evol. Microbiol. 55: 737–741.
Takeda, M., Umezu, T., Kawasaki, Y., Shimura, S., Kondo, K., and Koizumi, J. (2012) A spatial relationship between sheath elongation and cell proliferation in Sphaerotilus natans. Biosci. Biotechnol. Biochem. 76: 2357–2359.
Van Veen, W.L., Mulder, E.G., and Deinema, M.H. (1978) The Sphaerotilus-Leptothrix group of bacteria. Microbiol. Rev. 42: 329–356.
Venosa, a D. (1975) Lysis of Sphaerotilus natans swarm cells by Bdellovibrio bacteriovorus. Appl. Microbiol. 29: 702–705.
De Vet, W.W.J.M., Dinkla, I.J.T., Rietveld, L.C., and van Loosdrecht, M.C.M. (2011) Biological iron oxidation by Gallionella spp. in drinking water production under fully aerated conditions. Water Res. 45: 5389–5398.
41 Literature review
Vijayaraghavan, K. and Yun, Y.-S. (2008) Bacterial biosorbents and biosorption. Biotechnol. Adv. 26: 266–291.
De Vrind-de Jong, E.W., Corstjens, P.L., Kempers, E.S., Westbroek, P., and de Vrind, J.P. (1990) Oxidation of manganese and iron by Leptothrix discophora: use of N,N,N’,N'- Tetramethyl-p-Phenylenediamine as an indicator of metal oxidation. Appl. Environ. Microbiol. 56: 3458–62.
Winston, V. and Thompson, T.L. (1979) Isolation and characterization of a bacteriophage specific for Sphaerotilus natans which contain an unusual base in its deoxyribonucleic acid. Appl. Environ. Microbiol. 37: 1025–30.
Yoshikawa, H. and Takiguchi, Y. (1979) Attached growth of Sphaerotilus natans in continuous-flow apparatus and its growth inhibition by 9-b-D- Arabinofuranosyladenine. Appl. Environ. Microbiol. 38: 200–204.
Zhang, W., Cai, J., and Zhang, D. (2012) Preparation and properties of ferrite derived from iron oxidizing bacteria. Chinese Sci. Bull. 57: 2470–2474.
Zhao, J., Guan, X., and Unuma, H. (2007) Preparation of Fe3O4 nanoparticles and their application to composite biosorbent. J. Ceram. Soc. Japan 115: 475–478.
Zhu, J., Huang, Q., Pigna, M., and Violante, A. (2012) Competitive sorption of Cu and Cr on goethite and goethite–bacteria complex. Chem. Eng. J. 179: 26–32.
42
CHAPTER 3
Filamentous growth of Sphaerotilus natans
This chapter has been submitted as:
Seder-Colomina, M., Goubet, A., Lacroix, S., Morin, G., Ona-Nguema, G., Esposito, G., Van Hullebusch, E.D. and Pernelle, J-J. (2014) Moderate oxygen depletion as a factor favouring the filamentous growth of Sphaerotilus natans. Journal of Applied Microbiology, Submitted.
Filamentous growth of Sphaerotilus natans
3. Moderate oxygen depletion as a factor favouring the filamentous growth of Sphaerotilus natans
The present study evaluates the effect of dissolved oxygen (DO) concentration on the filamentous growth of Sphaerotilus natans from single cells, by separately quantifying filamentous and single-cell morphotypes. Differential filtration coupled with quantitative PCR was used to quantify S. natans. Scanning Electron Microscopy (SEM) was used to validate the filtration step. Under actively aerated conditions (DO maintained at 7.6 ± 0.1 mg l-1), S. natans grew mainly as single cells throughout the experiment, with 83.3 ± 5.9% and 16.7 ± 5.9% of single cells and filaments, respectively. Under passively aerated conditions, for which DO decreased to 2.9 ± 0.4 mg l-1, the proportion of single cells decreased regularly down to 14.3 ± 3.4%, while the proportion of filaments increased to 85.7 ± 3.4%. The identification of moderate oxygen depletion as a factor favouring Sphaerotilus natans filamentation from single cells contributes to better understand its filamentous proliferation. The proposed method will be helpful to evaluate other factors favouring filamentous growth.
Keywords
Filamentous bacteria; dissolved oxygen; Sphaerotilus natans; qPCR.
44 Chapter 3
3.1. Introduction
Activated sludge process is a widespread biological technology in wastewater treatment plants (WWTP) and it is known that its efficiency depends on the settling ability of the biomass in the clarifier (Silverstein et al. 1990; Patziger et al. 2012). In such process, the invasive proliferation of filamentous bacteria can drastically reduce the settling ability and produce bulking issues (Jenkins 1992; Martins et al. 2004). Despite their negative implications in WWTP, some filamentous bacteria can also potentially be used as biosorbents (e.g. Cd, Zn, Cu, Ag, Cr(III), Cr(VI), Pb, etc.) (Lodi et al., 1998; Pagnanelli et al., 2003; Seder-Colomina et al., 2014). Hence, identifying factors that affect filamentation could help to better understand the filamentous proliferation of these bacteria as well as to improve their application in the field of bioremediation.
The identification of filamentous bacteria is often based only on their filamentous morphotype and can lead to ambiguous species assignment (Eikelboom 1975; Martins et al. 2004). Furthermore, some of the filamentous bacteria present in wastewater can also grow as single cells depending on the environmental conditions and cannot be identified by their morphotype as filaments do (Rossetti et al. 1997; Jenkins et al. 2004). In fact, little is known about the factors that govern the induction of filamentous proliferation from such single cells. Moreover, the hypothesis of filament formation by fast chaining of single cells leading to bulking episodes remains to be demonstrated. Elucidating the factors that may favour filamentous over single-cell growth of such bacterial species thus requires to quantify both morphotypes separately and to determine the proportion of single cells versus filaments under varying conditions. However, filamentous bacteria involved in bulking episodes and presenting this dual morphotype are not easily grown as axenic cultures (Tomei et al. 1998; Blackall et al. 2000). Hence, the fundamental understanding of the factors inducing filamentous growth from single cells under laboratory conditions is still poorly documented.
Sphaerotilus natans is chosen here as a model of filamentous sheath-forming bacteria to investigate the triggering factors governing filamentous growth from single cells since it is able to grow either as single cells –measuring around 1 – 2 µm in diameter and 1 – 10 µm in length (Spring 2006, Gridneva et al. 2011)– or as ensheathed cells forming filaments, and it can be easily cultivated under laboratory conditions. Furthermore, S. natans has been occasionally identified in nutrient-rich industrial wastewaters (Van Veen et al. 1978; Pellegrin et al. 1999; Contreras et al. 2000). Few studies have yet been dedicated to the factors affecting
45 Filamentous growth of Sphaerotilus natans
S. natans sheath formation and filamentous growth. For instance, it has been demonstrated that at high concentrations of peptone (>0.2%) the filamentation pathway is perturbed (Gaudy and Wolfe 1961). In addition, it has been shown that Ca2+ concentrations higher than 0.1 mM induce the formation of sheaths and therefore filamentous proliferation (Dias et al. 1968a). The effect of substrate concentration has also been tested and low nutrient-content plates (0.1% NB agar) result in S. natans filamentous growth while rich medium (1% NB) leads to single-cell development (Suzuki et al. 2002). Oxygen influence on S. natans filamentation has been suggested after observation of bulking in WWTP (Strom and Jenkins 1984; Richard et al. 1985) and in lab-scale activated sludge units (Palm and Parker 1980), as well as in pure and mixed culture experiments (Dias et al. 1968b). However, uncertainties remain on the relative proportions of filaments versus single cells in these and other studies when quantifying filamentous bacteria. The suitability of the procedures used to separate and quantify the two morphotypes in pure or mixed cultures had not been investigated in detail (Gaudy and Wolfe 1961; Dias et al. 1968b; Gino et al. 2010). Furthermore, analysis of microscopy images may be unable to distinguish ensheathed cells inside the filaments from single cells or single cells from different bacterial species (Gaval and Pernelle 2003; Contreras et al. 2004; Jassby et al. 2014). Combining separation techniques with modern strain-specific techniques for bacterial counting may thus help to overcome these difficulties.
In the present study we have evaluated the effect of a moderate oxygen depletion as a factor favouring the filamentous or single-cell growth of S. natans through an accurate counting of the two morphotypes in axenic cultures, using a differential filtration procedure coupled with quantitative PCR.
3.2. Materials and Methods
3.2.1. Bacterial strain and growth conditions
Various strains of Sphaerotilus were found to present different responses to oxygen upon preliminary tests, as filamentation from single cells was induced at different oxygen availabilities for each strain tested (Fig. S1). The strain presenting the largest dependence of the morphotype on oxygen concentration was chosen for the present study. The selected strain Sphaerotilus natans ATCC 15291 was initially grown in solid CGYA media (0.5% casitone, 1% glycerol, 0.1% yeast extract and 1.2% agar) for ~24 hours until it reached the exponential growth phase. Bacteria were then recovered from the plates, resuspended in CGY broth (0.5% casitone, 1% glycerol and 0.1% yeast extract) and filtered through a 3 !m pore-size
46 Chapter 3 polycarbonate membrane filter (IsoporeTM, Millipore®) in order to obtain an inoculum for the batch cultures that mostly contained single cells.
Batch experiments were designed to study the role of dissolved oxygen (DO) concentration in influencing S. natans filamentation and sheath-formation from single cells. Two types of batch culture conditions were used in triplicate experiments in order to measure the proportion of filaments versus single cells, under oxygen saturated conditions or under depleted oxygen conditions. The first condition, referred to as ‘actively aerated’, corresponds to oxygen-saturated conditions obtained by continuously aerating the growth medium in glass bottles with an active air bubbling system. The second condition referred to as ‘passively aerated’, lead to progressive deoxygenation of the medium upon cell respiration and was obtained by passively aerating the medium by air diffusion through a cotton plug. For both culture conditions, 250 ml CGY broth (0.5% casitone, 1% glycerol and 0.1% yeast extract) were inoculated at an absorbance of 0.03 (at 600 nm) using the previously 3 !m-filtered inoculum of S. natans. Bottles were agitated at 100 rpm for 48 hours of incubation. The temperature of 30ºC and pH 7 were kept constant and were measured using a SevenGo™ SG2 (Mettler Toledo). In both cases a YSI Model 57 Dissolved Oxygen Meter (YSI Incorporated) was also used to monitor oxygen as a function of time. Optical density was measured throughout the 48 hours of incubation, but it was found to be inaccurate when quantifying filamentous biomass (Fig. S2).
3.2.2. Confocal Laser Scanning Microscopy (CLSM)
In order to initially evaluate the dual morphotype growth of S. natans and to distinguish extracellular polymeric substances (EPS) and sheath formation, samples were double-stained with the non-specific bacteria dye Syto®61 Red Fluorescent Nucleic Acid Stain (LifeTechnologies™) targeting DNA and with two different lectins coupled with green fluorescent FITC. These Pisum sativum agglutinin (PSA) and Wheat germ agglutinin (WGA) lectins (Sigma-Aldrich®) bind sugar residues from the EPS (terminal )-D-mannosyl-like) and sheath (proteins containing &(1(4)-N-acetyl-D-glucosamine-like residues), respectively. Samples were incubated for 15 minutes with Syto®61, PSA and WGA and then washed to remove the unbound Syto®61 and lectins. In parallel, Fluorescence in situ hybridization (FISH) was used to verify S. natans purity in the process of the culture. The specific 16S rRNA-targeting probe SNA –labeled in 5' with Cy3– used in this study (Wagner et al. 1994) was purchased at Eurofins MWG Operon (Ebersberg, Germany). Samples were prepared
47 Filamentous growth of Sphaerotilus natans according to a 3-step protocol (Amann et al. 1990; Manz et al. 1992): 1) cells were dehydrated with ethanol to permeabilize the cell membrane to SNA probe; 2) they were then incubated with the probe for 90 minutes at 46ºC to hybridize the probe and the targeted 16S rRNA; 3) cells were finally washed to remove the unbound probe. All samples were observed under a CLSM Zeiss Axiovert 200M LSM 510 META.
3.2.3. Filtration procedure coupled to DNA extraction
A specific filtration procedure was developed in the present study in order to quantify separately the total biomass, the filaments and the single cells, in axenic cultures of S. natans containing both morphotypes (Fig. 3.1). This filtration procedure provides three different samples: the total biomass (referred to as ‘global culture’), the fraction of bacteria retained on a 3 !m pore-size filter (referred to as ‘filaments’) and those who passed through the 3 !m pore-size filter (referred to as ‘single cells’).
Figure 3.1. Filtration method developed for differential amplification by qPCR based on growth morphotypes.
To avoid filter clogging in exponential and stationary growth phases, different dilutions of the culture were performed in the experiment prior to the filtration step to a final volume of 5 ml. An aliquot of 1.35 ml of the diluted sample was then transferred to a 2 ml tube containing 135 !l of SDS 25% and 0.4 g of zirconium beads to disrupt cells to extract DNA (bead- beating tubes). The remaining 3.65 ml were filtered through a 3 !m pore-size polycarbonate membrane filter (IsoporeTM, Millipore®). The filtration membrane was then recovered and placed in a bead-beating tube with 1.35 ml fresh CGY medium; 1.35 ml of the 3 !m-filtered culture were also transferred to a bead-beating tube. Samples were vortexed for 10 minutes in
48 Chapter 3 a MO BIO bead-beating adapter for Vortex-Genie2® at a maximum speed. Phenol- chloroform-isoamyl (PCI) was added to samples (vol:vol 1:1) and centrifuged in Phase-Lock Gel™ tubes (5PRIME), to ensure DNA quality extraction by removing proteins and PCI residues. The DNA was recovered after precipitation in 2-propanol (vol:vol 1:1) at -20ºC overnight. Sampling, filtration and DNA extraction were done in triplicate for each sampling time.
3.2.4. Scanning Electron Microscopy (SEM)
SEM was used to validate the efficiency of the above filtration step at various times and dilutions. Two types of samples were observed: 1) samples filtered using 3 !m filters and 2) samples double-filtered, first at 3 !m and subsequently at 0.22 !m. Filters were deposited on carbon tape and coated with a thin carbon film. SEM observations were performed with a Field Emission Gun Scanning Electron Microscope (GEMINI ZEISS Ultra55) operating at 2 to 5 kV.
3.2.5. Quantitative real-time PCR (qPCR)
At successive sampling times throughout the batch cultures, DNA was extracted from the three samples separated by our filtration procedure, i.e. global culture, filaments, and single cells. The integrity and quality of extracted DNA were systematically checked on 1% agarose gel electrophoresis (data not shown) prior to the quantification by qPCR analysis. For this purpose we used primers targeting the sthA gene of S. natans, which is involved in both sheath and EPS synthesis (Suzuki et al. 2002). The choice of sthA gene and the design of sthA primers are detailed in the Supporting Information (Fig. S3).
Samples were analyzed using Multiplate® PCR Plates™ Low-Profile 96-well plates (Bio Rad) in a CFX 96™ Real-Time PCR Detection System (Bio Rad). The qPCR reaction mixture (23 !l) was added to global culture, filaments and single cells extracted DNA (2 !l) to give the following final concentrations of components: sthA RP and sthA FP 300 nM and iQ™ SYBR® Green Supermix (Bio Rad) Q.S. to 1U of iTaq DNA polymerase. qPCR was performed with the following cycling program: 3 min at 95°C; 40 cycles consisting of 15 sec at 95°C, 30 sec at 60°C, and 30 sec at 72°C followed by a melt curve from 60°C to 95°C (with increasing steps of 0.5°C) at intervals of 10 sec. NTC controls (2 !l of molecular biology grade DNA-free water) were also run. Tests were conducted in triplicate.
49 Filamentous growth of Sphaerotilus natans
The standard curves for each assay were generated by the ampli*cation of serial 10-fold dilutions of a linearized plasmid pEX-A containing a sequence of 243 bp encompassing the amplicon. The original plasmid was synthesized by Eurofins MWG Operon (Ebersberg, Germany). It was then linearized with the restriction enzyme HindIII in order to perform an accurate quantitative PCR (Hou et al. 2010). Its concentration was fixed at 33 ng !l-1 (1.12 ! 1010 copies !l-1). This value was determined using the Biowave II spectrophotometer (Biochrom). After that, the 10-fold dilution series from 108 to 102 copies sthA !l-1 was prepared in molecular biology grade DNA-free water. The quanti*cation limit is de*ned as the lowest concentration of standard in the linear range that differed at least from 1 log unit (equivalent to 3.3 threshold cycles) from the NTC (Smith et al. 2006); in this case, 102 copies of sthA per qPCR reaction. Each standard was tested in triplicate.
Data analysis was carried out with CFX Manager™ V1.0 software (Bio-Rad). The level of contamination –given by negative controls and NTC– and the qPCR efficiency were checked for each assay. The qPCR efficiency (E) was calculated from standard curves using the following formula
! ! !!! ! !" !! !"#$% !!!"" (eq. 1)
where the slope was obtained by the regression analysis between the threshold cycles (Ct) and the logarithm number of sthA copies. The qPCR efficiency of all plates run was between 90% and 98% with a regression coefficient value (R2) systematically above 0.98. Results were validated only when NTC controls were detected after 33 Ct. qPCR results were converted to sthA copies ml-1 culture depending on the dilution factors applied during the sampling process. Arithmetic means and standard deviation were calculated from qPCR and sample triplicates.
3.3. Results
3.3.1. Evolution of pH and oxygen availability in batch cultures
Under actively aerated conditions, the medium was saturated in oxygen with -1 [O2]aq = 7.6 ± 0.1 mg l throughout the 48 hours of incubation. In contrast, in the passively aerated culture, the DO concentration decreased from 6.4 mg l-1 to values below 4 mg l-1 after 4 hours of incubation due to bacterial activity, and remained at 2.9 ± 0.4 mg l-1 after 8 hours (Fig. 3.2). Under both batch culture conditions, pH remained constant throughout the
50 Chapter 3 experiments, at 7.1 ± 0.1, indicating that potential changes in filamentation could not be attributed to a pH-related stress but rather to the significant difference in DO.
Figure 3.2. Oxygen and pH measurements of actively and passively aerated cultures of Sphaerotilus natans throughout the 48 hours of incubation: (!) pH and (") oxygen of actively aerated culture, (#) pH and ($) oxygen of passively aerated culture.
3.3.2. Qualitative evaluation of the dual morphotype in batch cultures
Depending on the culture conditions, CLSM analyses displayed different contrasted fluorescence for S. natans morphotypes, sheath and EPS (Fig. 3.3), which suggested that oxygen availability influenced single-cell vs filamentous growth, EPS synthesis and sheath formation by S. natans.
Figure 3.3. CLSM imaging of (red) Syto61® and (green) PSA and WGA lectins coupled to FITC for (a) initial inoculum of Sphaerotilus natans, (b) actively aerated culture after 48 hours of incubation, and (c) passively aerated culture after 48 hours of incubation. Scale bars represent 10 !m.
51 Filamentous growth of Sphaerotilus natans
The inoculum (Fig. 3.3a) was composed mostly of single cells, which did not have any sheath or EPS and therefore did not present lectin staining. After 48 hours of incubation, in the actively aerated culture (Fig. 3.3b) single cells were the predominant morphotype. No sheath was observed, whereas lectins were slightly bound on the periphery and deeply at the poles of the single cells, suggesting an EPS production concentrated in these parts of the cells. Under passively aerated conditions (Fig. 3.3c) S. natans was present mainly as filaments and the fluorescence of the lectins revealed the sheath formation and EPS synthesis. In all cases, the use of S. natans-specific FISH (data not shown) made it possible to successfully discard any contamination problems that could have affected growth patterns.
3.3.3. Selective filtration
SEM images (Fig. 3.4) show that the inoculum contained almost exclusively single cells that passed through the 3 !m pore-size filter (Fig. 3.4a), and that were further retained on the 0.22 !m filter (Fig. 3.4b).
Figure 3.4. SEM observations of the 3 !m pore-size filters (a, c and e) and 0.22 !m pore-size filters (b, d and f): (a, b) initial inoculum of Sphaerotilus natans, (c, d) actively aerated culture after 48 hours of incubation, and (e, f) passively aerated culture after 48 hours of incubation. Scale bars represent 5 !m.
However, a few cells forming aggregates were occasionally observed on the surface of the 3 !m filter (Fig. 3.4a, Insert). After 48 hours of incubation, the actively aerated culture was predominantly composed of single cells that passed through the 3 !m filter and that were retained on the 0.22 !m filter (Fig. 3.4d). Occasionally, a few aggregates of single cells were observed after 48 hours of incubation on the 3 !m filter surface (Fig. 3.4c, Insert). In contrast, after 48 hours of incubation, the passively aerated culture contained mostly filaments retained
52 Chapter 3 by the 3 !m filter (Fig. 3.4e). The remaining single cells and some rare filaments were observed on the 0.22 !m filter (Fig. 3.4f). No significant clogging of the filter was observed in any case. Altogether, these SEM observations validate the filtration procedure, showing that most filaments were retained on the 3 !m filter, whereas the corresponding filtrate consisted almost exclusively of single cells that could be further retained by the 0.22 !m filtration.
3.3.4. Filamentous vs. single-cell growth
Growth curves of global culture as well as filaments and single cells of S. natans obtained from qPCR data after differential filtration are displayed in Fig. 3.5. They demonstrate significant differences in the proportions of the two morphotypes as a function of oxygen availability in the batch cultures.
Figure 3.5. Sphaerotilus natans differential growth curves, (!) global culture, ($) single cells and (") filaments, under (a) actively aerated and (b) passively aerated culture conditions. Inserted figures display the corresponding distribution of single cells (blue) vs. filaments (red) in (a) and (b), respectively.
Under actively aerated conditions (Fig. 3.5a), a lag phase of at least 8 hours was observed. The global culture then yielded a rapid growth phase, parallel to the single cells growth curve, and reached a maximum value of 6.4 ! 106 copies of sthA. Filaments in this case represented a low proportion of the culture. Indeed, the fractions of single cells and filaments in the culture (Fig. 3.5a, Insert) remain rather constant throughout the incubation (83.3 ± 5.9% and 16.7 ± 5.9% on average, respectively). The increase in the number of copies of sthA
53 Filamentous growth of Sphaerotilus natans corresponding to filaments after 24 hours of incubation could be explained by the presence of small aggregates of single cells on the filter (Fig. 3.4c, Insert).
In contrast, under passively aerated conditions (Fig. 3.5b), the global culture as well as the filaments presented a classical bacterial growth curve, with a lag phase that lasted for approximately 4 hours. The proportion of sthA copies from single cells dramatically decreased with time and became much lower than that of filaments especially after 16 hours of incubation. Indeed, in the stationary phase, i.e. after 24 hours of incubation, the proportion of single cells was 14.3 ± 3.4% while filaments accounted for up to 85.7 ± 3.4% of the total biomass (Fig. 3.5b, Insert). Finally, under passively aerated conditions the maximum total number of sthA copies was 1.9 ! 108 that is 30 times higher than under actively aerated conditions, suggesting that saturated oxygen conditions are not the most favourable conditions for S. natans growth.
3.4. Discussion
3.4.1. Differential quantification of single cells and filaments
The selective filtration procedure coupled to DNA extraction and amplification, as developed in the present study, is shown to be an effective and accurate method to evaluate factors favouring the filamentous growth of S. natans. This differential quantification methodology is faster than imaging methods and overcome most of their limitations. For instance, manual counting under the microscope and the sludge volume index (SVI) have been used to highlight correlations between both total filament length and total number of filaments per mg TSS (Palm and Parker 1980). In the same way, a filament index (FI) varying from 0 (no filament) to 5 (sludge population extremely dominated by filaments) has been often used for characterizing activated sludge, but it is rather qualitative and influenced by the subjectivity of the experimenter (Eikelboom and Van Buijsen 1981).
More recently, image processing methods have been focused on the quantification of filamentous bacteria. FISH imaging was used for filament counting but this method was found to be time consuming since a ten-fold manual counting on a whole microscope slide was necessary to obtain reliable data for each sample (Gaval and Pernelle 2003). Automatic image analyses to quantify filamentous bacteria from activated sludge have significantly improved the method (Contreras et al. 2004; Jassby et al. 2014). In these latter studies, phase contrast microscopy was used and 9 to 15 microscope field images were processed using
54 Chapter 3
Global Lab Image 2.10 (Data Translation, Inc.) or ImageJ V1.37 (National Institutes of Health) image analyses software. Filament quantification was related to the number of pixels corresponding to filaments using a correction factor. While Gaval and Pernelle (2003) and Jassby et al. (2014) did not take into account the single-cell microorganisms present in the samples, Contreras et al. (2004) developed a model to discern a single-cell small cocci (strain E932) from S. natans ensheathed cells found inside the filaments. Unfortunately, this method by itself could not be applied to quantify separately both morphotypes of S. natans, as the single cells have the exact same shape as the ensheathed ones forming the filaments.
In the present study, quantitative PCR was successfully used to quantify the two morphotypes after they were separated by a suitable filtration procedure. The optimal size of the generated amplicons recommended by qPCR commercial kits (e.g. SYBR® Green or Taqman®) is between 50 and 150 bp as too long amplicons may lead to poor amplification efficiency. The amplification products of the sthA primers developed here have a length of 143 bp, which is optimal for qPCR results. The qPCR reaction values obtained for the average slope, E, R2 and NTC controls also assure the effectiveness of the amplification reaction and therefore the accuracy of the quantification.
3.4.2. Oxygen as a factor influencing filamentation
The present results clearly demonstrate that dissolved oxygen concentration plays a crucial role in S. natans filamentation from single cells. Indeed, under saturated oxygen conditions (7.6 ± 0.1 mg l-1), S. natans grew under its single-cell form, while a moderate oxygen depletion (2.9 ± 0.4 mg l-1) triggered filamentous growth from the inoculum of single cells. Few studies have similarly reported that low oxygen concentrations could induce the proliferation of S. natans filaments. For instance, Palm and Parker (1980) reported S. natans bulking due to its filamentous proliferation (measured as SVI), in laboratory activated sludge at DO concentrations + 5.5 mg l-1. In the same way, Gino et al. (2010) found that S. natans grown predominantly as filaments forming biofilms in a groundwater well with DO values of 6.4 – 3.6 mg l-1. Dias et al. (1968b) reported filamentous growth of S. natans at DO concentrations of 6.9 – 7.8 mg l-1 (~ oxygen saturated conditions), which seems in contradiction with our and previously mentioned studies. However, Dias et al. results were based on the measurements of dry weight of total biomass, which cannot discriminate between single cells and filaments. In addition, oxygen was not supplied during the first 24 hours of batch culture in their experiments. As shown in the present study, after 24 hours of
55 Filamentous growth of Sphaerotilus natans incubation without any active supply of air the dissolved oxygen concentration is depleted due to bacterial activity, and hence the filamentation of S. natans is induced.
Finally, our study is in agreement with previous observations indicating that the DO threshold below which filamentation and sheath-formation of S. natans are induced is higher or close to ~ 3 mg l-1. This is an elevated value compared to the low dissolved oxygen values found in WWTP. Indeed, low DO concentrations, known as inducing poor sludge settling due to excessive growth of filamentous bacteria in activated sludge, range from 0.5 to 2.0 mg l-1, while high DO values are comprised between 2.0 to 5.0 mg l-1 (Wilen and Balmer 1999). These threshold values for filamentous proliferation slightly vary depending on the microorganisms present in the activated sludge and the level of competition with floc-forming bacteria.
In addition, here we showed that oxygen affected not only the growth morphotype but also the quantity of total cells. Indeed, saturated oxygen conditions negatively impacted total bacterial growth (30 times less growth in the actively aerated culture). This fact suggests that elevated DO stresses S. natans. Hence, single-cell growth would be a response to stress and filaments would be the predominant morphotype under favourable culture conditions. This hypothesis is supported by a recent publication (Park et al. 2014) in which S. natans changed from filaments to single cells in response to the stress produced by full anoxic culture conditions.
The method developed here makes it possible to accurately quantify S. natans under its two growth morphotypes, which may help in identifying other factors favouring filamentous growth for this and other microorganisms of socio-economical and ecological interest. Furthermore, future investigations of a hypothetical reversibility of the filamentous growth may also help to better understand the mechanisms of recurrent filamentous proliferation in WWTP.
56 Chapter 3
Supporting Information
I. Oxygen response of different Sphaerotilus strains
Figure 3.S1. Qualitative distribution of single cells and filaments of five different strains of Sphaerotilus, (") ATCC 29329 and 29330, ($) ATCC 15291, (!) ATCC 13338T, and (%) ATCC 13929. Observations were performed using optical microscopy at !500 after 24 hours of culture in CGY and NB 1% media.
Different strains of Sphaerotilus were grown in non-shaked broth, shaked broth and agar plates, in order to test their responses to an increasing oxygen availability. Qualitative changes in the ratio of single cells to filaments (the two morphotypes) under these three culture conditions were observed under the microscope.
Results of this initial test showed that when cultured in agar plates, 4 of the 5 Sphaerotilus strains tested grew under the form of single cells. In addition, cultures in non-agitated broth resulted in mainly filaments. On the basis of these results, the hypothesis that a moderate oxygen depletion would favour the filamentous growth of S. natans was assumed. In order to verify this hypothesis, strain ATCC 15291 was selected for further experiments as it presented the widest dependence of the morphotype to oxygen concentration.
II. Unsuitability of Turbidity/OD when studying S. natans dual morphotype
Turbidity is estimated by optical density (OD), which measures light scattering (at 600 nm) by the microorganisms present in the suspension. However, OD is proportional to the number
57 Filamentous growth of Sphaerotilus natans of cells only in homogeneous suspensions. For filamentous bacteria, these techniques may underestimate the quantity of cells, because filaments and single cells form aggregates spread in a non-turbid solution. Therefore, if the light beam does not cross any bacterial aggregate, the light is not scattered and the measured OD value is very low, underestimating the actual quantity of microorganisms.
Figure 3.S2-1. Graphical example of the unsuitability of Turbidity/OD for filamentous biomass determination.
Optical density was measured for all cultures reported in our study. However, as is the case of filamentous microorganisms that form flocs (Fig. 3.S2-2), such measurements were not reliable (see error bars, Fig. 3.S2-3).
Figure 3.S2-2. Photography of S. natans filamentous culture after 24 hours of incubation under passively aerated conditions.
58 Chapter 3
Figure 3.S2-3. Optical density at 600 nm of Sphaerotilus natans grown under ($) passively and (") actively aerated conditions, leading to filamentous and single-cell growth respectively, throughout 48 hours of incubation.
III. Design of qPCR primers sthA
New primers were designed here in order to ensure the validity of our results despite the dual morphotype of S. natans and to avoid the potential miscounting problems of total bacteria quantification. For instance, as S. natans single cells are optically indistinguishable from other rod-shaped bacteria, if any other microorganism would colonized the growth media it would not be detectable by traditional microscopy and the counting would be inaccurate. In addition, 16S universal primers for qPCR of total bacteria would amplify all DNA present in the sample, existing hence the same potential inaccuracy problems as for microscopy. Therefore, specific set of primers amplifying S. natans was required to ensure the validity of the results.
The set of primers targeting the sthA gene of S. natans 15291 was designed using Primer 3 software (http://bioinfo.ut.ee/primer3-0.4.0/) (Koressaar & Remm 2007; Untergasser et al. 2012). This sthA gene was previously identified by Suzuki et al. (Suzuki et al. 2002), and the sequence of sthA is deposited in GenBank (http://www.ncbi.nlm.nih.gov/genbank/index.html) under the accession numbers AB050638 and AB050640. The role of sthA in S. natans has been investigated by the disruption of the gene and the cultivation in a substrate-controlled media where filamentous growth was supposed to be induced. Microscopy images showed the
59 Filamentous growth of Sphaerotilus natans absence of filamentation under such conditions which indicated that the sthA gene is involved in both sheath and EPS synthesis (Suzuki et al. 2002).
The region amplified by the novel sthA set of primers was defined within the coding sequence, at a proximal location, near the start codon. The imposed parameters were: an amplicon size ranging between 140 and 200 nucleotides, a primer length of 20 nucleotides, Tm = 60 ± 1.5°C, a maximum self-complementarity of 4.00 and a maximum 3’ self- complementarity of 2.00. Each primer was tested using BLAST facilities (http://www.ncbi.nlm.nih.gov/BLAST/). The sequence of forward primer sthA-F is CGCTGCTCTATTCCTTCGTC and the one of reverse primer sthA-R is GGCGTAACCGTCATAGCTGA, generating an amplicon of 143 bp. The primers were synthesized by Eurofins MWG Operon (Ebersberg, Germany).
To confirm the specificity of the designed primers, conventional PCR was run using DNA from different bacterial species of the Sphaerotilus-Leptothrix supergroup: S. natans (ATCC 15291, 13338 and 13929), Sphaerotilus hippei (ATCC 29330) (Gridneva et al. 2011) and Leptothrix cholodnii ATCC 5168 and 51169. The reaction mixture contained 2 !L of genomic DNA used as a template in 25 !L of PCR cocktail containing in final concentrations: sthA RP and sthA FP 900 nM, MgCl2 1.5 mM, dNTP 250 !M each and Therm start DNA polymerase (ABgene AB-0908) 0.625 U. Amplification was performed with the following cycling program: 15 min at 95°C; 40 cycles consisting of 30 sec at 94°C, 30 sec at 60°C, and 30 sec at 72°C; and elongation for 5 min at 72°C. No template controls (NTC) (2 !L of molecular biology grade water DNA-free) were also run. Tests were made in triplicate. The amplification products (of 143 bp expected) were separated in a 1.5% agarose gel electrophoresis and stained with ethidium bromide.
60 Chapter 3
Figure 3.S3. Agarose gel of PCR products amplified using the sthA set of primers. Lane 1: DirectLoad™ PCR Low Ladder, Sigma-Aldrich® (100-1000 bp), 2: Empty well, 3: Sphaerotilus natans ATCC 15291, 4: S. natans ATCC 13338, 5: S. natans ATCC 13929, 6: Sphaerotilus hippei ATCC 29330, 7: Leptothrix cholodnii ATCC 51168, 8: L. cholodnii ATCC 51169, 9: NTC (negative control).
Results show that amplification was successful for all tested S. natans species (ATCC 15291, 13338 and 13929) for which a single band containing around 140 bp fragments was observed. In contrast, no amplification was observed either for other species of the same genus (S. hippei ATCC 29330) or the same supergroup (L. cholodnii ATCC 5168 and 51169). These results indicate that the sthA set of primers is able to amplify a specific region of S. natans DNA. Indeed, it is enough sensitive to distinguish between species from the Sphaerotilus genus.
61 Filamentous growth of Sphaerotilus natans
References
Amann, R., Binder, B., Olson, R., Chisholm, S., Devereux, R., and Stahl, D. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56: 1919–1925.
Blackall, L.L., Seviour, E.M., Bradford, D., Rossetti, S., Tandoi, V., and Seviour, R.J. (2000) “Candidatus Nostocoida limicola”, a filamentous bacterium from activated sludge. Int. J. Syst. Evol. Microbiol. 50: 703–709.
Contreras, E.M., Giannuzzi, L., and Zaritzky, N.E. (2000) Growth kinetics of the microorganism Sphaerotilus natans in a model system of a food industry wastewater. Water Res. 34: 4455–4463.
Contreras, E.M., Giannuzzi, L., and Zaritzky, N.E. (2004) Use of image analysis in the study of competition between filamentous and non-filamentous bacteria. Water Res. 38: 2621–2630.
Dias, F.F., Dondero, N.C., and Finstein, M.S. (1968b) Attached growth of Sphaerotilus and mixed populations in a continuous-flow apparatus. Appl. Microbiol. 16: 1191–1199.
Dias, F.F., Okrend, H., and Dondero, N.C. (1968a) Calcium nutrition of Sphaerotilus growing in a continuos-flow apparatus. Appl. Environ. Microbiol. 16: 1364–1369.
Eikelboom, D. and Van Buijsen, H. (1981) Microscopic sludge investigation manual. TNO – Research Institute for Environmental Hygiene. TNO Report A 94a.
Eikelboom, D.H. (1975) Filamentous organisms observed in activated sludge. Water Res. 9: 365–388.
Gaudy, E. and Wolfe, R.S. (1961) Factors affecting filamentous growth of Sphaerotilus natans. Appl. Microbiol. 9: 580–584.
Gaval, G. and Pernelle, J.-J. (2003) Impact of the repetition of oxygen deficiencies on the filamentous bacteria proliferation in activated sludge. Water Res. 37: 1991–2000.
Gino, E., Starosvetsky, J., Kurzbaum, E., and Armon, R. (2010) Combined chemical- biological treatment for prevention/rehabilitation of clogged wells by an iron-oxidizing bacterium. Environ. Sci. Technol. 44: 3123–3129.
62 Chapter 3
Gridneva, E., Chernousova, E., Dubinina, G., Akimov, V., Kuever, J., Detkova, E., Grabovich, M. (2011) Taxonomic investigation of representatives of the genus Sphaerotilus: descriptions of Sphaerotilus montanus sp. nov., Sphaerotilus hippei sp. nov., Sphaerotilus natans subsp. natans subsp. nov. and Sphaerotilus natans subsp. sulfidivorans subsp. nov., and an emended description of the genus Sphaerotilus. Inter. J System. Evolution. Microbiol. 61:916–925.
Hou, Y., Zhang, H., Miranda, L., and Lin, S. (2010) Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene. PLoS One 5: e9545.
Jassby, D., Xiao, Y., and Schuler, A.J. (2014) Biomass density and filament length synergistically affect activated sludge settling: systematic quantification and modeling. Water Res. 48: 457–465.
Jenkins, D. (1992) Towards a comprehensive model of activated sludge bulking and foaming. Water Sci. Technol. 25: 215–230.
Jenkins, D., Richard, M., and Daigger, G. (2004) Manual of the causes and control of activated sludge bulking, foaming, and other solids separation problems 3rd Edition. Lewis Publishers.
Koressaar, T. and Remm, M. (2007) Enhancements and modifications of primer design program Primer3. Bioinformatics 23: 1289–1291.
Lodi, A., Solisio, C., Converti, A., and Borghi, M. Del (1998) Cadmium, zinc, copper, silver and chromium (III) removal from wastewaters by Sphaerotilus natans. Bioprocess Eng. 19: 197–203.
Manz, W., Amann, R., Ludwig, W., Wagner, M., and Schleifer, K. (1992) Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: Problems and solutions. Syst. Appl. Microbiol. 15: 593–600.
Martins, A.M.P., Pagilla, K., Heijnen, J.J., and van Loosdrecht, M.C.M. (2004) Filamentous bulking sludge – a critical review. Water Res. 38: 793–817.
63 Filamentous growth of Sphaerotilus natans
Pagnanelli, F., Esposito, A., Toro, L., and Vegliò, F. (2003) Metal speciation and pH effect on Pb, Cu, Zn and Cd biosorption onto Sphaerotilus natans: Langmuir-type empirical model. Water Res. 37: 627–633.
Palm, J. and Parker, D. (1980) Relationship between organic loading, dissolved oxygen concentration and sludge settleability in the completely-mixed activated sludge process. J. Water Pollut. Control Fed. 52: 2484–2506.
Park, S., Kim, D.-H., Lee, J.-H. and Hur, H.-G. (2014), Sphaerotilus natans encrusted with nanoball-shaped Fe(III) oxide minerals formed by nitrate-reducing mixotrophic Fe(II) oxidation. FEMS Microbiol. Ecol. doi: 10.1111/1574-6941.12372
Patziger, M., Kainz, H., Hunze, M., and Józsa, J. (2012) Influence of secondary settling tank performance on suspended solids mass balance in activated sludge systems. Water Res. 46: 2415–2424.
Pellegrin, V., Juretschko, S., Wagner, M., and Cottenceau, G. (1999) Morphological and biochemical properties of a Sphaerotilus sp. isolated from paper mill slimes. Appl. Environ. Microbiol. 65: 156–162.
Richard, M., Hao, O., and Jenkins, D. (1985) Growth kinetics of Sphaerotilus species and their significance in activated sludge bulking. J. Water Pollut. Control Fed. 57: 68–81.
Rossetti, S., Hildisch, D., Christensson, C., Del Dot, T., Blackall, L.L., Tandoi, V. (1997) Isolation and identification of an Eikelboom Type 1863 strain as Acinetobacter johnsonii. Water Res. 31: 657-660.
Seder-Colomina, M., Morin, G., Benzerara, K., Ona-Nguema, G., Pernelle, J.-J., Esposito, G., and van Hullebusch, E.D. (2014) Sphaerotilus natans, a neutrophilic iron-related sheath- forming bacterium: perspectives for metal remediation strategies. Geomicrobiol. J. 31: 64–75.
Silverstein, J., Mines, R., Sherrard, J., Weber, A., and Aitken, M. (1990) Activated sludge. Res. J. Water Pollut. Control Fed. 62: 398–406.
Smith, C.J., Nedwell, D.B., Dong, L.F., and Osborn, a M. (2006) Evaluation of quantitative polymerase chain reaction-based approaches for determining gene copy and gene transcript numbers in environmental samples. Environ. Microbiol. 8: 804–815.
64 Chapter 3
Spring, S. (2006) The genera Leptothrix and Sphaerotilus. In: Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K-H., Stackebrandt, E., Editors. The Prokaryotes, vol 5. New York: Springer. p758–777.
Strom, P.F. and Jenkins, D. (1984) Identification and significance of filamentous microorganisms in activated sludge. J. Water Pollut. Control Fed. 56: 449–459.
Suzuki, T., Kanagawa, T., and Kamagata, Y. (2002) Identification of a gene essential for sheathed structure formation in Sphaerotilus natans, a filamentous sheathed bacterium. Appl. Environ. Microbiol. 68: 365–371.
Tomei, M.C., Levantesi, C., Rossetti, S., Tandoi, V. (1999) Microbiological characterisation of pure cultures and its relevance to modelling and control of bulking phenomena. Water Sci. Technol. 39: 21-29.
Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rozen, S.G. (2012) Primer3 – new capabilities and interfaces. Nucleic Acids Res. 40: e115.
Van Veen, W.L., Mulder, E.G., and Deinema, M.H. (1978) The Sphaerotilus-Leptothrix group of bacteria. Microbiol. Rev. 42: 329–356.
Wagner, M., Amann, R., Kämpfer, P., Assmus, B., Hartmann, A., Hutzler, P., et al. (1994) Identification and in situ detection of Gram-negative filamentous bacteria in activated sludge. Syst. Appl. Microbiol. 17: 405–417.
Wilen, B-M. and Balmer, P. (1999) The effect of dissolved oxygen concentration on the structure, size and size distribution of activated sludge flocs. Water Res. 33: 391–400.
65
CHAPTER 4
U(VI) scavenging by iron phosphate encrusting S. natans filaments
This chapter will be submitted for publication as:
Seder-Colomina, M., Morin, G., Brest, J., Ona-Nguema, G., Gordien, N., Pernelle, J-J., Van Hullebusch, E.D. and Mathon, O. (2014) Uranium (VI) scavenging by amorphous iron phosphate encrusting Sphaerotilus natans filaments. Environmental Science and Technology, To be submitted.
Chapter 4
4. Uranium (VI) scavenging by amorphous iron phosphate encrusting Sphaerotilus natans filaments
U(VI) sorption to iron oxyhydroxides, precipitation of uranium phosphate minerals, as well as biosorption on bacterial biomass are among the most efficient processes limiting U(VI) mobility under oxidizing conditions. Although phosphates significantly influence bacterially mediated as well as iron oxyhydroxide mediated scavenging of uranium, the sorption or coprecipitation of U(VI) with poorly-crystalline nanosized iron phosphates has been yet scarcely documented, especially in the presence of microorganisms. Here we show that dissolved U(VI) can be efficiently bound to amorphous ferric-ferrous phosphate hydroxides during their deposition on Sphaerotilus natans filamentous bacteria, via Fe(II) oxidation in the presence of phosphate. Uranium LIII-edge EXAFS analysis reveals that uranyl ions share equatorial atoms with phosphate tetrahedron from the amorphous ferric-ferrous phosphate hydroxide, with a characteristic U-P distance of 3.6 Å. In addition, a fraction of the uranyl ions are bound to phosphoryl and carboxyl moeities of the S. natans biomass, the proportion of this biosorbed fraction decreasing when increasing the initial iron concentration. Furthermore, based on these sorption reactions, we demonstrate the ability of an attached Sphaerotilus natans biofilm to remove uranium from solution without any filtration step.
Keywords
Iron phosphate; S. natans; biofilm; uranium sorption; EXAFS.
67 U(VI) scavenging by iron phosphate encrusting S. natans filaments
4.1. Introduction
Among inorganic pollutants, uranium is a major environmental concern due to its chemical and radiological toxicity for humans (Brugge et al., 2005). During the past decades, uranium release from natural sources and via anthropogenic activities such as mining, ore processing and disposal, combustion of coal and the use of phosphates fertilizers that contain uranium (WHO, 2005) has increased the need for developing cost effective uranium remediation strategies for contaminated aquatic systems (Gavrilescu et al., 2009). The search for alternative remediation processes often relies on improving our knowledge of the mechanisms governing uranium transport and bioavailability. Indeed, uranium mobility in soils and aquifers largely depends on the physicochemical conditions, especially redox and pH and on microbial activities that can catalyze redox reactions as well as participate to sorption reactions. In oxic environments uranium is mainly under the highly soluble uranyl ions, e.g. 2+ + UO2 and UO2(OH) in dilute solutions. Uranyl complexation by carbonate ions at pH > 5 significantly increases U(VI) solubility with respect to sorbed or precipitated phases (Langmuir, 1997). Under reducing conditions, U(IV) generally resulting from biological reduction of U(VI), can forms of insoluble minerals as uraninite (McCleskey et al., 2001; Guillaumont et al., 2003; Bargar et al., 2008) or low solubility complexes (Bernier-Latmani et al., 2010). However, the long-term instability of these products (i.e. uraninite and non- uraninite minerals) and their reoxidation to the soluble U(VI) (Langmuir, 1997; Murphy and Shock, 1999) suggest further investigations for alternative remediation techniques applicable to oxic-U(VI) conditions.
Adsorption to metal oxides (e.g. poorly-crystalline iron hydroxides) or precipitation reactions (e.g. formation of uranium phosphate minerals) are among the most efficient processes limiting U(VI) mobility (Salome et al., 2013). Under neutral to slightly alkaline pH conditions, crystalline as well as poorly-ordered ferric oxides are the most important U(VI) sorbents in soils due to their high specific surface area and sorption ability. For instance, U(VI) sorption has been reported for goethite (Moyes et al., 2000; Missana et al., 2003; Singh et al., 2010), hematite (Bargar et al., 2000; Zeng and Singh, 2009) or ferrihydrite (Waite et al., 1994; Reich et al., 1998; Ulrich et al., 2006; Rossberg et al., 2009; Foerstendorf et al., 2012). U(VI) also may be incorporated in the structure of hematite at temperatures higher than 60°C (Marshall et al., 2014), or of goethite at room temperature (Nico et al., 2009). However, iron oxyhydroxides minerals having the highest sorption capacities have nanometer sizes and thus
68 Chapter 4 need to be efficiently separated from the liquid phase in order to be used for pollutant removal (Yavuz et al., 2006; Fu and Wang, 2011). In this context, neutrophilic filamentous sheath- and stalk-forming iron-related bacteria such as the Leptothrix-Sphaerotilus group and Gallionella act as natural agents immobilizing heavy metals and radionuclides in the environment, by sorption to or coprecipitation with the bacteriogenic iron oxides (BIOS) formed in their presence (Katsoyiannis et al., 2006; Sean Langley et al., 2009; Keim, 2011; Kennedy et al., 2011; Marina Seder-Colomina et al., 2014). In addition bacterial biomass has been also successfully used as biosorbent for radionuclides as uranium (Cologgi et al., 2014). Since the biomass may also need to be separated after the biosorption process (Vijayaraghavan and Yun, 2008; Fu and Wang, 2011), bacteria able to form attached biofilms may potentially help in designing cost effective water treatment strategies. Finally, although phosphates significantly influence bacterially mediated (Beazley et al., 2007; Mondani et al., 2011) as well as iron- mediated (Karabulut et al., 2000; Cheng et al., 2004; Singh et al., 2012) scavenging of uranium, the sorption or coprecipitation of U(VI) with poorly-crystalline nanosized iron phosphates has been yet scarcely documented, especially in the presence of microorganisms.
Here we investigated uranium scavenging by amorphous iron phosphate minerals formed in the presence or absence of Sphaerotilus natans, a filamentous bacteria that has potentialities for metal biosorption and sorption onto BIOS (Marina Seder-Colomina et al.,
2014). X-ray absorption spectroscopy at the Fe K-edge and U LIII-edge are used to determine the nature of the iron phosphate minerals formed and to identify the modes of uranium binding to the mineral and bacteria at the molecular level. Furthermore, based on these sorption reactions, we investigated the ability of an attached Sphaerotilus natans biofilm to remove uranium from solution.
4.2. Materials and Methods
4.2.1. Bacterial strain and preculture medium
The sheath-forming microorganism Sphaerotilus natans strain ATCC 15291 belongs to the Spherotilus-Leptothrix group of iron-related bacteria. It can form bacteriogenic iron oxides (Park et al., 2014) and it is known as a biosorbent for inorganic pollutants (Seder- Colomina et al., 2014). S. natans is easily grown in the laboratory at an optimum temperature at 30°C under oxic to microaerophilic conditions, the latter prevailing in its natural habitat. The tolerance of S. natans to uranium was previously tested for 4 log units up to 10 !M (data not shown). The S. natans was precultured in CGY (0.5% casitone, 1% glycerol and 0.1%
69 U(VI) scavenging by iron phosphate encrusting S. natans filaments yeast extract) under passively aerated conditions to produce S. natans filamentous biomass (Seder-Colomina et al., submitted paper). Once it reached exponential phase, the culture was centrifuged, washed three times with anoxic CGY media diluted 20 times and resuspended for further inoculation. This medium contains 200 !M total P and 1.8 !M Fe as determined by Inductively Coupled Plasma–Optical Emission Spectroscopy (ICP–OES; Jobin-Yvon® JY2000 HORIBA Scientific) after 0.22 !m filtration and acidification to pH ~1 with HCl.
4.2.2. Biotic and abiotic Fe, P and U precipitation experiments
A biotic precipitation experiment referred to as ‘CGY Fe + S. natans’ was first carried out to investigate the formation of iron containing precipitates via ferrous iron oxidation in microaerophilic S. natans culture. An anoxic CGY broth doped with 500 !M of aqueous Fe2+ added as FeCl2 under anoxic conditions was inoculated with an appropriated volume of S. natans culture (DO600nm ~ 0.05) and incubated for 21 days at 30°C under 100 rpm agitation under microaerophilic conditions, i.e. bubbling a 99:1 N2:O2 gaz mixture for 15 minutes every -1 2 days, which thus maintained the O2 saturation level of the solution below 5% (+ 0.5 mg.L ). The initial dissolved P/Fe mole ratio was 0.4 in this experiment, i.e., 200 !M of total dissolved P and 500 !M of aqueous Fe2+.
Similar biotic and abiotic precipitation experiments referred to as ‘1/20 CGY Fe + S. natans’ and ‘1/20 CGY Fe Abiotic’ were then conducted with and without S. natans, but in diluted 1/20 CGY broth, thus having an initial dissolved P/Fe mole ratio of 0.02, i.e. 10 !M total dissolved P and 500 !M aqueous Fe2+.
Finally, biotic and abiotic Fe, P and U precipitation experiments were conducted following the same setup, in the diluted 1/20 CGY broth, but in the presence of 3 !M of aqueous U(VI) added from a 0.2 M uranyl nitrate stock solution to the initial culture medium, which ensured undersaturation with respect to uranyl phosphate minerals. Four conditions were investigated and comprised ‘U + Fe + S. natans’, ‘U + Fe Abiotic’, ‘U +S. natans’, ‘U Abiotic’. Aliquots of the culture suspension were sampled at 0, 3, 7 and 21 days, filtrated through a 0.22 !m pore-size syringe filter, acidified to pH ~1 with ultrapure HNO3, stored at 4°C in polyethylene tubes, and analyzed for aqueous U concentration using Inductively Coupled Plasma–Mass Spectrometry (ICP"MS) on a Thermo Fisher Scientific™ XSeries II spectrometer. After 21 days of incubation, suspensions were centrifuged in an anoxic glovebox for 30 minutes at 10034 g. The harvested solids were then washed three times with Milli-Q water before vacuum drying within the glove box. Dry solids were stored in O2-free sealed containers until
70 Chapter 4 mineralogical and spectroscopic analyses.
4.2.3. Fe and U sorption onto a glass-supported S. natans biofilm
In order to evaluate the ability of S. natans biofilm to scavenge iron- and uranium-bearing nanoparticles, a glass-supported S. natans biofilm was exposed to ferrous iron and uranium solutions under oxidizing conditions. A control experiment was also conducted without biofilm. Accordingly, two glass vials were filled with 250 mL oxic CGY broth and one of them was inoculated with S. natans (DO600nm ~ 0.5). Both vials were incubated at 30°C and 100 rpm in contact with air through a cotton plug, until the internal surface of the inoculated vials was completely recovered by S. natans biofilm, i.e. for 24h. The liquid medium was then removed from both vials and they were refilled with a 1/20 CGY solution containing 500 !M of Fe2+ and 3 !M U(VI). Both vials were then incubated for 7 days at 30°C and 100 rpm in contact with air. Dissolved uranium (filtered at 0.22 !m) and total aqueous uranium (non filtered) concentrations were measured at 0, 3 and 7 days.
All solutions (reagent grade >99.9% purity level) and experiments were prepared in a
JACOMEX® glove-box under N2 atmosphere (<50 ppm O2) with O2-free Milli-Q water, unless specified. Amber glass vials or bottles covered with aluminium foil were used to avoid uranium(VI) photoreduction throughout the experiments (McCleskey et al., 2001). For all experiments, initial pH was set to 7 and final pH values were measured at 6.5 ± 0.6.
4.2.4. Scanning Electron Microscopy (SEM)
Suspension samples were diluted in O2-free Milli-Q water and filtered using 0.22 !m filter. The filters were then deposited on a carbon tape, dried at ambient temperature inside the anoxic glove-box and carbon coated. SEM data were obtained with a GEMINI ZEISS Ultra55 Field Emission Gun microscope operating at 2 kV for imaging and at 15kV for energy dispersive X-ray (EDXS) spectroscopy. The P/Fe mole ratios were determined from EDXS spectra using the ESPRIT software (Bruker®), averaging data on 15 spots per sample.
4.2.5. X-ray absorption spectroscopy (XAS)
Fe K-edge (7112 eV) XAS data of the incubation samples were collected at 80 K in fluorescence detection mode using a 9 elements Ge array detector on the BM26A beamline at the European Synchrotron Radiation Facility, France (ESRF) with a Si(111) double-crystal monochromator. Energy was calibrated by setting to 7112 eV the first inflection point of Fe foil recorded in double transmission setup. X-ray Absorption Near Edge Structure (XANES)
71 U(VI) scavenging by iron phosphate encrusting S. natans filaments spectra as well as Extended X-ray Absorption Fine Structure (EXAFS) spectra were were averaged, normalized, background subtracted from a minimum of 12 scans then extracted using ATHENA (Ravel and Newville, 2005). XANES and EXAFS data were then least- squares fit by linear combination (LC-LS fit) of the spectra of amorphous ferric phosphate III (amFe PO4•nH2O with P/Fe ~1) (Baumgartner et al., 2013; Cosmidis et al., 2014), 2-line ferrihydrite (Fh2L) (Maillot et al., 2011), and vivianite Fe3(PO4)2•8H2O (Cosmidis et al., 2014). Other model compounds data for a large variety of ferric (oxyhydr)oxides (Hohmann et al., 2011; Maillot et al., 2011) and Fe(II) hydr(oxides) (Ona-Nguema et al., 2010) were also available for this study. LC-LS fit quality was estimated by a classical R-factor (Tables 4.S1 and 4.S2).
Uranium LIII-edge XAS data were also collected at the ESRF. Data for the incubation samples and for the model compounds were collected on bending magnet beamlines BM23 and BM26A, using a 13 or 9 elements Ge array fluorescence detector, respectively. The energy of the beam delivered by the Si(111) double-crystal monochromator was calibrated by setting to 17173.4 eV the first inflection point in the U LIII-edge of uranyl nitrate recorded in double transmission setup, i.e. similar to Zr and Y foils data calibrated to 17998 and 17038 eV, respectively. Data were collected at 15K and 80K on BM23 and BM26A, respectively, in order to avoid photoreduction of U(VI) under the X-ray beam in our organic samples (Mercier-Bion et al., 2011). A minimum of 12 scans was collected for each sample. Data were averaged, normalized and background subtracted using ATHENA (Ravel and Newville,
2005) to extract Extended X-ray Absorption Fine Structure Data. U LIII-EXAFS data of the incubation samples were analyzed by LC-LS fit procedure using relevant model compounds including: U(VI) adsorbed to - or coprecipitated with - amorphous ferric phosphate (samples III III ‘amFe PO4-U(VI)ad’ and ‘amFe PO4-U(VI)cp’) or two-line ferrihydrite (samples ‘Fh2L- U(VI)ad’ and ‘Fh2L-U(VI)cp’), as well as U(VI) biosorbed to S. natans ‘Biosorbed-U(VI)’. All these compounds were prepared at uranium concentration of 2% wt. Detailed synthesis procedures are given in Supporting Information. U LIII-EXAFS data of the model compounds were analyzed using a classical shell-by-shell fit procedure based on the plane-wave EXAFS formalism (Teo, 1986) and using a Levenberg–Marquardt least-squares minimization algorithm. Theoretical phase and amplitude functions employed in this fitting procedure were calculated according to the curved-wave scattering theory, thanks to the ab initio FEFF8 code (Ankudinov et al., 1998), and using the crystal structures of torbernite (Locock and Burns, 2003) for the U–O and U–P paths, of brannerite (Szymanski and Scott, 1982) for the U–Fe
72 Chapter 4 paths and of uranyl acetate dihydrate (Howatson and Grev, 1975) for U–C path. Both EXAFS LC and shell-by-shell fits were performed in k-space. The quality of the LC-LS and shell-by- shell fits was estimated by a R-factor (Table 4.S3) and a reduced chi2 parameter (Table 4.1), respectively.
4.3. Results
4.3.1. Mineralogy of the solid phases in the Fe, P and U precipitation experiments
In all biotic and abiotic precipitation experiments, the solids that had formed after 21 days of incubation in the presence or absence of S. natans essentially consisted of iron phosphate with a P/Fe mole ratio of 0.36 ± 0.09, as determined by SEM-EDXS analyses (Fig. 4.1 and Fig. 4.S1).
Figure 4.1. SEM images of the mineral precipitates in samples (a) ‘CGY Fe + S. natans’, (c) ‘1/20 CGY Fe + S. natans’, (e) ‘1/20 CGY Fe Abiotic’. The large scale bar is 1 !m and the short one is 10 !m. Representative EDXS spectra of these mineral precipitates are shown in (b, d, f) and indicate a P/Fe mole ratio of 0.36 ± 0.06 for all samples, similar to that obtained on bulk samples incubated with U(VI) (Fig. 4.S1).
73 U(VI) scavenging by iron phosphate encrusting S. natans filaments
In the ‘CGY Fe + S. natans’ experiment, filaments were encrusted with spherical particles of 55 ± 10 nm in diameter consisting of such iron phosphate material (Fig. 4.1a,b). In the ‘1/20 CGY Fe + S. natans’ experiment conducted in diluted culture medium, similar but much less abundant particles were observed on S. natans filaments (Fig. 4.1c,d). Aggregates of such iron phosphate were also observed in the corresponding abiotic experiment (Fig. 4.1e,f). Finally, the precipitates formed in the presence of uranium in experiments ‘1/20 CGY Fe + U Abiotic’ and ‘1/20 CGY Fe + U + S. natans’ had similar P/Fe ratio of 0.36(9) (Fig. 4.S1). Powder X-Ray Diffraction (XRD) analyses did not show any Bragg peaks, thus suggesting amorphous or nanocrystalline materials (data not shown).
Consistently, LC-LS fit of the Fe K-edge XANES and EXAFS data of bulk samples obtained after 21 days of biotic and abiotic incubation in the dilute 1/20 CGY medium indicated that iron is predominantly under the form of amorphous ferric phosphate (74-87% III of amFe PO4•nH2O) (Fig. 4.2 and Table 4.S1).
(a) (b) (c) Fe Abiotic 1 10 Fe + S. natans 10
U + Fe Abiotic
U + Fe + S. natans
amFeIIIPO .nH O 4 2 ) k FT ( !
3
Ferrihydrite 2L k
Vivianite [FeII (PO ) .8H O] Normalized absorbance Normalized absorbance 3 4 2 2
7100 7120 7140 7160 7180 7200 4 6 8 10 12 0 1 2 3 4 5 6 Energy (eV) k (Å-1) R + !R (Å)
3 Figure 4.2. Linear Combination Least-squares (LC-LS) fits of (a) XANES and (b) k -weighted EXAFS data at the Fe K-edge for samples ‘Fe Abiotic’, ‘Fe + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ after 21 days of incubation. For all samples, XANES and EXAFS LC-LS fit results (Table 4.S1) indicate 74-87% of III II amFe PO4, 4-11% Fh2L and 10-21% of vivianite taken as proxy for a Fe PO4 compound. Experimental and calculated curves are plotted as black and red solid lines, respectively. Fourier Transforms modulus and imaginary part (FT) of the experimental and calculated EXAFS data are displayed in (c).
In addition, XANES and EXAFS data LC-LS fitting indicates the presence of a minor ferrous phosphate component in all samples (10-21%; Table 4.S1). Indeed, including a
74 Chapter 4
II vivianite [Fe PO4•8H2O] component in the LC-LS significantly improved the fit quality, decreasing the normalized square residue by a factor of two (Table 4.S2). As shown in Fig. 4.S2, this additional component corrects both the energy shift in the Fe K-edge in the XANES spectra and the phase shift in the EXAFS spectra, this latter feature being due to the contribution of Fe(II)-O interatomic distances that are classically longer than Fe(III)-O distances in oxide minerals, i.e.
4.3.2. Uranium removal in the biotic and abiotic Fe, P and U precipitation experiments
Figure 4.3a shows uranium removal from the dissolved phase in the precipitation experiments with initial dissolved concentration of U(VI) of 3!M. After 21 days, biosorption by S. natans removed only 7.7% of the initial dissolved uranium quantity in the (‘U + S. natans’) experiment, and was thus found to be ineffective at such low concentrations bacteria (filamentous growth under microaerophilic conditions is slow down, so biomass is not highly abundant). In contrast, 67% of the initial dissolved uranium quantity was scavenged by the amorphous iron phosphate solid phase in the ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ experiments (Fig. 4.3a), as confirmed by the detection of U M-series emission lines in bulk SEM-EDXS spectra of these solids (Fig. 4.S1). Both abiotic and biotic experiments yielded similar U removal, the kinetic of removal being however slightly faster during the first 7 days for the biotic experiment.
75 U(VI) scavenging by iron phosphate encrusting S. natans filaments
(a) (b)
3 3 M) M) ! !
2 2
Uranium Uranium in solution ( 1 Uranium Uranium in solution ( 1
0 0 0 7 14 21 0 1 2 3 4 5 6 7 Time (days) Time (days)
Figure 4.3. Evolution of uranium concentrations in solution as a function of time in (a) Fe and U mineralization experiments and (b) in Fe and U sorption on S. natans biofilm experiments. Dissolved U concentration after 0.22 !m filtration in the (") ‘U + S. natans’, (&) ‘U + Fe Abiotic’ and ($) ‘U + Fe + S. natans’ mineralization experiments. Dissolved (open symbols) and total uranium (closed symbols) after adition of U + Fe in (#, !) abiotic vial and in (!, ") glass vial supporting a S. natans biofilm.
4.3.3. Uranium removal via Fe and U sorption onto S. natans biofilm
Figure 4.3b displays the result of uranium sorption onto a glass-supported S. natans biofilm in the presence of ferrous iron under oxidizing conditions, compared with an abiotic control experiment conducted without biofilm. In both experiments, i.e. with or without biofilm, 50% of the initial dissolved uranium quantity was removed from the dissolved phase after 7 days, as indicated by the significant decrease in uranium concentration in the 0.22 !m filtrate (Fig. 4.3b). Dissolved uranium was likely scavenged by iron phosphate precipitates that formed via oxidation of dissolved ferrous iron since the present sorption experiments were conducted in the same medium as the precipitation experiments reported above, i.e. 1/20 CGY medium doped with 500 !M Fe and 3 !M U. Removal of dissolved uranium in these sorption experiments was close, although slightly lower, than that in the biotic and abiotic precipitation experiments within the same period of 7 days (60 %, Fig. 4.3a). Importantly, in the sorption experiments (Fig. 4.3b), the total concentration of uranium in the unfiltered suspension significantly differed in the presence or absence of S. natans biofilm. Indeed, in the presence of S. natans biofilm, the total residual uranium concentration was as low as that in the 0.22 !m filtrate (1.5 !M = 50% of the initial U concentration after 7 days; Fig. 4.3b), indicating that the particulate fraction of Fe and U was scavenged by the biofilm covering the internal surface of the vial. This interpretation is confirmed by the higher total residual
76 Chapter 4 uranium concentration measured in the absence of biofilm (2.6 !M = 87% of the initial U concentration after 7 days), the particulate fraction of Fe and U being then only removed after 0.22 !m filtration (Fig. 4.3b).
4.3.4. U LIII-edge EXAFS analysis of the biotic and abiotic iron phosphate samples
The mode of association of U with the amorphous iron phosphate solid formed in the biotic and abiotic Fe, P, and U precipitation experiments was determined at the molecular level using EXAFS spectroscopy analysis at the U LIII-edge. The corresponding EXAFS data for the solid samples collected after 21 days are displayed in Figure 4.4, together with their best LC-LS fits including only the two same model compounds spectra as fitting components, namely, U(VI) biosorbed onto S. natans (‘Biosorbed-U(VI)’) and U(VI) coprecipitated with III III amorphous Fe phosphate (‘amFe PO4-U(VI)cp’). Fitting results are reported in Figure 4.4 and are detailed in Table 4.S3.
(a) (b) 5 U + S. natans 37% amFeIIIPO -U(VI)cp + 66% Biosorbed-U(VI) 4 5
U + Fe Abiotic
) III k
( 95% amFe PO -U(VI)cp 4 !
3 k FT
U + Fe + S.natans 52% amFeIIIPO -U(VI)cp + 45% Biosorbed-U(VI) 4
4 6 8 10 12 0 1 2 3 4 5 6 -1 k (Å ) R + !R(Å)
Figure 4.4. Linear Combination Least-squares (LC-LS) fits of the U LIII-edge EXAFS data for the solid samples collected from ‘U + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ experiments after 21 days. Experimental and calculated curves are plotted as black and red solid lines respectively, for (a) unfiltered k3- weighted !(k) function and (b) Fourier Transform (FT) modulus and imaginary part. Only two model compound III spectra were used as fitting components: U(VI) coprecipitated with amorphous ferric phosphate (‘amFe PO4- U(VI)cp’) and U(VI) biosorbed onto S. natans (‘Biosorbed-U(VI)’). Proportions of these fitting components are reported in the figure and detailed in Table 4.S3.
77 U(VI) scavenging by iron phosphate encrusting S. natans filaments
III They indicate that ‘amFe PO4-U(VI)cp’ was the sole uranium species in the ‘U + Fe Abiotic’ experiment, and accounted for 95% of U in this sample. In contrast, a significant fraction of ‘Biosorbed-U(VI)’ is observed in the ‘U + Fe + S. natans’ experiment (45%). This III proportion increases to the extent of the ‘amFe PO4-U(VI)cp’ species in the ‘U + S. natans’ experiment, carried out without doping the culture medium with iron. Although the iron concentration was too low to record Fe K-edge XAS data in our transmission setup for this latter sample, amorphous iron phosphate could however precipitate from the initial concentrations of Fe and P in this experiment (0.09 and 10 !M respectively). Further analysis III of the local structure around U atoms in the ‘amFe PO4-U(VI)cp’ and ‘Biosorbed-U(VI)’ model compounds is detailed in the following subsection.
4.3.5. U LIII-edge EXAFS analysis of model compounds
Visual inspection of our model compounds EXAFS data (Fig. 4.5) indicates that similar uranium species were obtained via sorption and coprecipitation experiments on/with a similar substrate, i.e amorphous ferric phosphate hydroxide or ferrihydrite. However, uranium speciation significantly differed when U(VI) was reacted with a different substrate, i.e., either with amorphous iron phosphate or with ferrihydrite, as indicated by significant differences in the spectra of these various species in the 7 – 13 Å-1 k-range. Uranium speciation obtained after biosorption on S. natans cells also differed from that obtained with the mineral sorbents studied (Fig. 4.5).
78 Chapter 4
(a) (b) III Oax amFe PO -U(VI)cp Oeq 10 4 5 C MS PFe
amFeIIIPO -U(VI)ad 4 PFe ) k
( Fh2L-U(VI)cp !
3 Fe k FT
Fh2L-U(VI)ad Fe
Biosorbed-U(VI) P
4 6 8 10 12 0 1 2 3 4 5 6 -1 k (Å ) R + !R (Å)
Figure 4.5. U LIII-edge EXAFS spectra of model compounds: U(VI) coprecipitated and adsorbed to Fe(III) III III phosphate (‘amFe PO4-U(VI)cp’ and ‘amFe PO4-U(VI)ad’) and to two-line ferrihydrite (‘Fh2L-U(VI)cp’ and ‘Fh2L-U(VI)ad’) and U(VI) biosorbed to Sphaerotilus natans (‘Biosorbed-U(VI)’). (a) Results of the shell-by- shell fits of unfiltered k3-weighted data and (b) the corresponding Fourier Transforms (FT) magnitude and imaginary part. Experimental data and calculated curves are plotted as black and red solid lines, respectively. All fit parameters are reported in Table 4.S2.
These observations are fully confirmed by the results of the shell-by-shell fit of the unfiltered k3-weighted EXAFS spectra of our series of sorption and coprecipitation model compounds (Fig. 4.5, Table 4.1). For all samples, the first-neighbour contribution to the EXAFS was fit with 2.4 ± 0.5 oxygen atoms at 1.80 ± 0.02 Å corresponding to the two axial oxygen atoms (Oax) of the uranyl ion. The contribution from the two corresponding
U"Oax"U"Oax multiple scattering paths at 3.58 ± 0.05 Å was added in all fits. The second- neighbour contribution to the EXAFS was fit with 2.1 ± 0.3 and 1.2 ± 0.2 O atoms at a distance of 2.34 ± 0.03 and 2.5 ± 0.04 Å respectively, corresponding to equatorial oxygen atoms (Oeq) of the uranyl ion. The next shell was fitted with 1.7± 0.4 C atoms at a distance of 2.90 ± 0.04 interpreted as carbonate ion complexing sorbed uranyl ions, as generally observed in uranyl sorption experiments conducted in solutions equilibrated with air (Bargar et al., 1999, 2000; Walter et al., 2003; Rossberg et al., 2009). For both the sorption and coprecipitation ferrihydrite samples, an U"Fe scattering path was observed with 0.5 ± 0.1 Fe atoms at a distance of 3.47 ± 0.05 Å. In contrast, for both the sorption and coprecipitation iron
79 U(VI) scavenging by iron phosphate encrusting S. natans filaments phosphate samples, the U"Fe path was found to have a longer distance (0.9 ± 0.2 Fe atoms at 3.75 ± 0.05 Å) and it is accompanied by an U"P path with 0.5 ± 0.04 P atoms at a distance of 3.68± 0.05 Å. Finally, for U(VI) sorbed to S. natans cells, the number of C atoms at 2.9 ± 0.02 Å increased to N = 2.4 ± 0.5 and a minor contribution from 0.4 ± 0.1 P atoms was observed at 3.63 ± 0.05 Å. Adding a U–O–P multiple scattering path with a distance of 3.92 ± 0.05 Å significantly improved the fit quality, as reported in previous EXAFS studies of uranyl sorption onto bacterial cells (Kelly et al., 2002; Dunham-Cheatham et al., 2011; Llorens et al., 2012).
80 Chapter 4
Table 4.1. Fitting results for U LIII-edge EXAFS data of model compounds: U(VI) coprecipitated and III III adsorbed to Fe(III)-phosphate (‘amFe PO4-U(VI)cp’ and ‘amFe PO4-U(VI)ad’) and to 2-line Ferrihydrite (‘Fh2L-U(VI)cp’ and ‘Fh2L-U(VI)ad’) and U(VI) biosorbed to Sphaerotilus natans (‘Biosorbed-U(VI)’).
Coordination number (N), interatomic distance (R), Debye–Waller parameter (!) and energy offset (E0). Fit 2 2 3 quality was estimated by a reduced #R parameter of the following form: cR = Nind/(Nind – p) $ [k (c(k)exp – 3 2 k (c(k)calc ] , with Nind =(2%k%R)/p), the number of independent parameters and p the number of free fit parameters.
2 Model compound Path R (Å) N ! (Å) "E0 (eV) #R (± 1.5%) (± 20%) (± 0.01) (±3) III amFe PO4-U(VI)cp U-Oax 1.79 2.5 0.06 2.1 32 U-Oeq 2.33 2.6 - U-Oeq 2.52 1.1 - U-C 2.91 2.6 0.10 U-P 3.65 1.1 0.04 U-Fe 3.72 1.4 0.08
III amFe PO4-U(VI)ad U-Oax 1.79 2.5 0.06 1.8 29 U-Oeq 2.32 2.4 - U-Oeq 2.50 0.8 - U-C 2.93 2.3 0.07 U-P 3.61 1.1 0.08 U-Fe 3.69 1.5 0.11
Fh2L-U(VI)cp U-Oax 1.81 2.4 0.06 4.4 37 U-Oeq 2.36 2.0 - - U-Oeq 2.52 1.1 - - U-C 2.89 1.5 0.06 - U-Fe 3.47 0.5 0.09 -
Fh2L-U(VI)ad U-Oax 1.82 2.5 0.06 5.1 27 U-Oeq 2.36 2.0 - - U-Oeq 2.53 1.4 - - U-C 2.90 2.8 0.09 - U-Fe 3.47 0.4 0.08 -
* Biosorbed-U(VI) U-Oax 1.80 2.5 0.06 2.6 17 U-Oeq 2.35 2.0 - - U-Oeq 2.51 1.7 - - U-C 2.88 3.1 0.10 - U-P 3.64 0.5 0.04 -
Notes: (-) Kept equal to the free parameter placed above in the table / The multiple
scattering path U-Oax-U-Oax (R=3.58 Å and N=2) was added in all fits / * The multiple
scattering path U-Oax-P (R=3.90 Å and N=2) was added.
81 U(VI) scavenging by iron phosphate encrusting S. natans filaments
4.4. Discussion
4.4.1. Abiotic formation of amorphous iron phosphate precipitates
In the present study, iron phosphate precipitates that were observed attached to the surface of Sphaerotilus natans filaments had similar chemical composition and local structure than those that formed in suspension in the abiotic experiments, as indicated by SEM-EDXS and Fe K-edge EXAFS results. Apart from the presence of a fraction of a ferrous component (10- 20%), these iron phosphate precipitates mainly exhibit the characteristic Fe K-edge EXAFS III spectrum of amorphous ferric phosphate hydroxide, referred to as amFe PO4•nH2O in the present study. The local atomic arrangement in this phase, when having a solid P/Fe mole ratio of 1:1, has been recently demonstrated by Mikutta et al. (2014) to be close to that in the crystalline mineral strengite FePO4•2H2O, in which single FeO6 octahedra share corners with
PO4 tetrahedra, with a characteristic Fe–P distance of 3.25 Å.
Amorphous ferric phosphate hydroxide has been reported to form in the presence of high concentration of dissolved phosphate, via abiotic (Voegelin et al., 2010, 2013) and biotic (J Miot et al., 2009; Jennyfer Miot et al., 2009; Cosmidis et al., 2014) oxidation of Fe(II). It has been also recognized using XAS analysis as being consistent with the mineral component of prokaryotic ferritin (Baumgartner et al., 2013). In the present study the initial dissolved P/Fe mole ratio in the culture medium (0.02 and 0.4 in the CGY and CGY 1/20 experiments) are significantly lower than the minimum threshold value leading to the precipitation of pure III amFe PO4•nH2O, i.e. P/Fe ~ 0.55 as observed by Voegelin et al. (2013) in Fe(II) oxidation experiments. This difference can be explained by the lower Fe(II) oxidation rate in our experiments conducted under microaerophilic conditions than in the experiments of Voegelin et al. (2013) in which the solutions were hourly mixed with air. Consequently, the production of Fe(III) in our experiment was slow, as supported by the presence of a ferrous phosphate component in our samples after 7 days of incubation (Table 4.S1). Consequently, the dissolved P/Fe(III) mole ratio remained likely much higher than the initial P/Fe(II) ratio (0.02 III in CGY 1/20 experiments), which favoured the formation of amFe PO4•nH2O, instead of ferrihydrite and lepidocrocite that are forming at lower P/Fe(III) ratio. Nevertheless, the presence of a minor ferrihydrite component in the mineral precipitates obtained in our experiments (Table 4.S1), suggests that their local structure could slightly differ from that of III am-Fe PO4•nH2O (P/Fe ~1), which may be explained by their lower solid P/Fe mole ratio (P/Fe = 0.36 ± 0.09).
82 Chapter 4
4.4.2. Biotic formation of amorphous iron phosphate precipitates
In natural environments, bacteriogenic iron oxides (BIOS) produced by microaerophilic iron oxidizing bacteria as Gallionella and Leptohtrix, often consist of ferrihydrite, as identified by XRD (Ferris et al., 2000; S Langley et al., 2009) and XAS analyses (Mitsunobu et al.; Gault et al., 2012). However, amorphous iron phosphate hydroxides have been recently identified in association with microbial cells in the water column of a stratified lake (Cosmidis et al., 2014) and such phases were previously detected as major phosphate host in freshwater and estuarine sediments (Hyacinthe and Van Cappellen, 2004). In these latter studies, amorphous iron phosphate hydroxides were found to form via oxidation of ferrous iron at redox boundaries, such as lake chemocline (Cosmidis et al., 2014) or in upper sediments layers (Hyacinthe and Van Cappellen, 2004). Although dominantly ferric, this phases were found to contain also ferrous iron and have been interpreted as amorphous Fe(III)-Fe(II) phosphates (Cosmidis et al., 2014). Similar minerals have been shown to encrust the anaerobic nitrate-reducing mixotrophic iron-oxidizing bacterium Acidovorax sp. related strain BoFeN1 in laboratory biomineralization experiments conducted in a phosphate rich medium (J Miot et al., 2009; Jennyfer Miot et al., 2009). Secondary oxidation of Fe(II) by nitrite produced by enzymatic nitrate reduction explains the formation of amorphous Fe(III)-Fe(II) phosphate within the periplasm and its growth on the BoFeN1 cells, as well as at distance from the cells, as shown for the biomineralization of ferric oxyhydroxides by the same strain in phosphate poor medium (Klueglein and Kappler, 2013; Klueglein et al., 2014). By contrast, S. natans has not been recognized to actively oxidize iron (Marina Seder- Colomina et al., 2014) although a recent study by Park et al. (2014) suggests that this bacterium could couple nitrate reduction with iron oxidation. Nevertheless, various iron oxyhydroxides including ferrihydrite (Zhang et al., 2012) have been shown to be deposited on S. natans sheats in laboratory experiments, the nature of which depends on the culture conditions (Shopska et al., 2012). More generally, iron biosorption by S. natans has been also reported for samples from water treatment systems and water streams (Michalakos et al., 1997; Gino et al., 2010; Shopska et al., 2012; Zhang et al., 2012). In the present study we demonstrated that amorphous ferric phosphate hydroxide can be deposited on S. natans sheats, upon oxidation of dissolved Fe(II) in a phosphate rich medium, either in a cell culture suspension or via sorption on a supported biofilm. In addition, as detailed in the next section, we show that this amorphous mineral phase has a strong ability to bind uranyl species that are known to be among the most mobile uranium species under oxidizing conditions.
83 U(VI) scavenging by iron phosphate encrusting S. natans filaments
4.4.3. Local structure of uranium sorption complexes onto amorphous iron phosphate
Our U LIII-edge EXAFS results show that the coprecipitation or adsorption experiments we conducted with uranyl ions and ferrihydrite or amorphous ferric phosphate, all lead to uranyl surface complexation, referred to as sorption in the following text. Accordingly, uranyl sorption to amorphous phosphate hydroxides was found to mainly rely on the binding of uranyl ions to phosphoryl groups via single corner sharing complexes, in which an equatorial oxygen atom of the uranyl ion is shared with a phosphate tetrahedron. This geometry is common in the structure of crystalline uranyl phosphate minerals as autunite and torbernite (Locock and Burns, 2003) and it is characterized by an U–P distance of 3.6(5) Å (Table 4.1), that has also been reported for uranyl–phosphate ternary complexes forming at the surface of goethite upon uranyl sorption in the presence of phosphate (Singh et al. 2012) (Table 4.S4-1). We observed a similar U–P distance for uranyl sorbed to filamentous S. natans biomass (Table 4.1), as commonly reported for uranyl biosorption experiments on bacterial cells (Kelly et al., 2002; Merroun et al., 2005; Dunham-Cheatham et al., 2011; Llorens et al., 2012) (Table 4.S4-2). However, our results for uranyl sorption to amorphous ferric phosphate hydroxide did not unambiguously indicate the binding of uranyl ions to FeO6 octahedra. Indeed, including a Fe shell at a U–Fe distance of 3.7 Å improved the fit but such a distance could not be related to an expected geometry for uranyl binding to FeO6 octahedra. Indeed, the bidentate edge-sharing complex commonly observed for uranyl adsorbed to iron (oxyhydr)oxides surfaces (Waite et al., 1994; Reich et al., 1998; Bargar et al., 2000; Dodge et al., 2002; Ulrich et al., 2006; Rossberg et al., 2009)) (Table 4.S4-3), in which two adjacent
Oeq atoms of the uranyl ion are shared with the edges of a FeO6 octahedron, is characterized by the U–Fe distance of 3.4 ± 0.05) Å that we observed here for uranyl sorption to ferrihydrite III but not for uranyl sorption to amFe PO4•nH2O (Table 4.1). Furthermore, bidentate corner- sharing complexes in which two adjacent Oeq atom are shared with the vertex of two distinct
FeO6 octahedra are characterized by a long Fe–O distance of 4.3 ± 0.1 Å (Locock and Burns, III 2003; Singh et al., 2012) that we did not observed for uranyl sorption onto amFe PO4•nH2O.
Monodentate U–Oeq–Fe corner-sharing complexes or bidentate corner sharing complexes involving an FeO6 octahedron and a phosphate tetrahedron would also exhibit such a long U– Fe distance and were thus not present in our samples. Finally, for all samples, our EXAFS results indicated the presence of light atoms at a distance at 2.9 Å from the U absorbing atom. For our model compounds samples, we interpret this signal as being due to complexation of the sorbed uranyl ion with carbonate ligands in a bidentate edge sharing geometry, as
84 Chapter 4 previously reported for uranyl sorption experiments conducted in equilibrium with atmospheric CO2 (Reich et al., 1998; Bargar et al., 1999, 2000; Catalano and Brown, 2004; Rossberg et al., 2009; Foerstendorf et al., 2012) (Table 4.S4-3). In our biotic experiments, a significant fraction of uranium was found to be sorbed to the bacterial biomass as in our biosorption model compound. In these latter samples, this C shell is interpreted as being due to uranyl complexation to carboxyl moeities, as previously observed in EXAFS studies of uranyl biosorption on microbial biomass (Kelly et al., 2002; Merroun et al., 2005; Dunham- Cheatham et al., 2011; Llorens et al., 2012) (Table 4.S4-2).
4.4.4. Environmental implications
In the present study, we showed that dissolved uranyl can be efficiently scavenged upon co-sorption with iron and phosphate on a glass supported biofilm of the filamentous S. natans bacterium. The results we obtained on parallel U, Fe and P coprecipitation experiments in the presence of S. natans indicated that the uranyl ion is likely bound to phosphoryl groups belonging to amorphous ferric phosphate hydroxide nanoparticles attached to S. natans sheats. These findings offer potential perspectives for designing passive water treatment strategies based on metal sorption onto a fixed biomass. Indeed, although metal biosorption onto S. natans has been previously reported for different elements, e.g. Mg, Cd, Zn, Cu, Ag, Cr, Pb (Converti et al., 1992; Lodi et al., 1998; Pagnanelli et al., 2003), recovery of planktonic biomass requires either artificial immobilization before the process or centrifugation or filtration steps after metal scavenging. Zhao et al. (2007) showed that these separation steps may be overcome by magnetically recovering S. natans cells when coated with ferrimagnetic magnetite (Fe3O4) nanoparticles. This solution, though cheaper than traditional filtration, also implied an additional step in the process. Since S. natans can grow as single cells or as ensheathed cells forming filaments (Marina Seder-Colomina et al., 2014), controlling culture conditions to select the desired morphotype may help optimize theses separation steps (M Seder-Colomina et al., 2014). S natans filaments can form planktonic flocs (Phaup, 1968) or biofilms attached to surfaces that can cause well clogging (Gino et al., 2010). The biofilm results presented here show the potential of using S. natans biofilm grown under depleted oxygen conditions as biomass attached to a reactor, making it possible to save the separation step and reducing costs and time. Interestingly, filamentous bacterial biofilms that have been seen as a clogging problem for decades could offer effective sorbent with high potential for metal recovery in water systems.
85 U(VI) scavenging by iron phosphate encrusting S. natans filaments
Supporting Information
I. Model compounds preparation
U(VI) sorbed to - and coprecipitated with - ferrihydrite (Fh)
The reference sample for U(VI) sorbed onto ferrihydrite ‘Fh2L-Uad’ was prepared by first neutralizing a 0.2 M ferric nitrate solution with 1 M KOH to a pH of 7-8 to obtain pure 2-Line Fh (Schwertmann and Cornell, 2000). Fh was washed three times and resuspended in water at fixed ionic strength of 0.1 M NaNO3 and pH was dropped to 4 using 1 M HNO3. Uranium nitrate was then added to a concentration of 2 wt% and pH was adjusted to 6.5 using 1 M KOH and was then stirred for 60 hours. For ferrihydrite coprecipitated with U(VI), ‘Fh2L- Ucp’, a solution of 0.2 M ferric nitrate and uranium nitrate (2% wt) was prepared at pH 2. Afterwards, this solution was neutralized with 1 M KOH to a pH 7 to obtain the uranium coprecipitated Fh. At the end of both procedures, solid samples were centrifuged, washed three times and air-dried immediately. X-Ray Diffraction (XRD) was performed in all cases to ensure the purity of the compounds.
U(VI) sorbed to – coprecipitated with - amorphous iron(III) phosphate
III The amFe PO4 references were synthesized adapting the protocole of Eynard et al. (1992). III U(VI) sorbed onto amorphous iron(III) phosphate ‘amFe PO4-Uad’ was prepared by first mixing 150 mL iron chloride 0.2 M with 150 mL of phosphoric acid 0.3 M and adjusting pH III to 3 using 0.1 M KOH, to obtain amFe PO4 with a solid P/Fe mole ratio of ~1 (Baumgartner III et al., 2013; Cosmidis et al., 2014). The amFe PO4 precipitate was washed three times and resuspended in 500 mL of milli-Q water at fixed ionic strength of 0.1 M NaNO3 and pH was dropped to 4 using 1 M HNO3. Uranium nitrate was then added to a concentration of 2% wt and pH was adjusted to 6.5 using 1 M KOH. Solution was agitated for 60 hours to obtain the uranium adsorbed amFeIIIPO4. For U(VI) coprecipitated with amorphous iron(III) phosphate III ‘amFe PO4-Ucp’, solutions of iron chloride 0.2 M, phosphoric acid 0.3 M and uranium nitrate (2% wt) were mixed. Afterwards, pH was rised to 3 by adding appropriate amounts of III 1 M KOH solution to obtain the uranium coprecipitated with amFe PO4. The samples were centrifuged, washed three times and air-dried immediately. XRD was performed in all cases to ensure the purity of the compounds.
86 Chapter 4
Biosorbed U(VI)
Sphaerotilus natans was grown in CGY broth (casitone 0.5%, glycerol 1% and yeast extract 0.1%) at 30°C and depleted oxygen conditions to enhance filamentous growth (Seder- Colomina et al., submitted paper). Filaments were recovered by centrifugation at the end of the exponential phase (~24h of incubation). Pellet was washed three times with ultrapure water at fixed ionic strength of 0.1 M NaClO4 and filaments were resuspended at a -1 concentration of 1 g bacteria.L (wet weight) in same 0.1 M NaClO4 ultrapure water. Uranium was added to a final concentration of 2% wt to obtain U(VI) biosorbed onto S. natans, ‘Biosorbed-U’. After 8 hours of stabilization, the sample was centrifuged, washed three times and dried immediately.
II. Sample preparation and transfer for XAS analyses
For XAS analyses, incubation samples and model compounds were ground in an agate mortar during 20 minutes then pelleted for synchrotron pures. The pellets were sealed between two layers of Kapton tape, mounted on the sampleholders, resealed with Kapton and stored within aluminized foil sealed bags (Protpack®) in order to maintain anoxic conditions during the transfer to the synchrotron. Bags were opened at the beamline and samples were directly plunged into liquid N2 to their transfer inside the cryostat, where they were placed under He atmosphere. This procedure preserved anoxic conditions during sample transfer and analysis (Miot et al., 2009).
87 U(VI) scavenging by iron phosphate encrusting S. natans filaments
III. SEM-EDXS of Fe-bearing particles formed in the presence of U
Figure 4.S1. SEM images of bulk solids obtained after 21 days of incubation in experiments (a) ‘U + Fe Abiotic’ and (c) ‘U + Fe + S. natans’. Scale bars represent 100 !m. Representative SEM-EDXS spectra are shown in (b) and (d) respectively. Average of 10 spots indicated similar P/Fe mole ratios of 0.36 ± 0.09 and 0.36 ± 0.04 for ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’, respectively. In addition, uranium M-series peaks were observed at ~3.4 eV. The P/Fe mole of these phases was similar to that measured for the Fe-bearing particles formed in the absence of uranium (Fig. 4.1).
88 Chapter 4
IV. XAS fitting results at the Fe K-edge
Table 4.S1. Results of the linear combination least squares (LC-LS) fits for the XANES and k3-weighted EXAFS Fe K-edge spectra of samples ‘Fe Abiotic’, ‘Fe + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’ after 21 days of incubation. Corresponding experimental and calculated spectra are displayed in Fig. 4.2. The data are fit by linear combinations of the experimental spectra of the three following model compounds: III amorphous ferric phosphate (amFe PO4•nH2O) (Baumgartner et al., 2013), 2 line Ferrihydrite (Fh2L) (Maillot et al., 2011) and vivianite (Fe3(PO4)2•8H2O) (Cosmidis et al., 2014) taken as proxy for the ferrous phosphate 2 2 component. The fit quality was estimated by a R-factor of the following form: Rf = $ [ yexp - ycalc ] / $ yexp where y is the normalized absorbance or the k3c(k) for XANES and EXAFS fitting respectively.
Model compound (%) Sum of Rf Sample XAS 2 III II components (x 10 ) amFe PO4•nH2O Fh2L Fe 3(PO4)2•8H2O
XANES 86 4 11 101 0.009 Fe Abiotic EXAFS 80 10 13 104 2.1
XANES 87 4 10 101 0.009 Fe + S. natans EXAFS 80 10 17 107 2.8
XANES 79 9 12 100 0.011 U + Fe Abiotic EXAFS 76 11 19 106 2.5
XANES 78 7 14 100 0.010 U + Fe + S.natans EXAFS 74 10 21 106 3.1
89 U(VI) scavenging by iron phosphate encrusting S. natans filaments
(a) (b) 0.5
III 10 amFe PO .nH O III 4 2 amFe PO .nH O 4 2
Fh 2L Ferrihydrite 2L )
III k amFe PO .nH O (
4 2 ! III amFe PO .nH O 3 4 2 k
FeII (PO ) .8H O 3 4 2 2 FeII (PO ) .8H O 3 4 2 2 Normalized Normalized absorbance
III amFe PO .nH O III 4 2 amFe PO .nH O 4 2
Ferrihydrite 2L FeII (PO ) .8H O 3 4 2 2 FeII (PO ) .8H O Fh 2L 3 4 2 2
7110 7120 7130 7140 7150 4 6 8 10 12 k (Å-1) Energy (eV) !
Figure 4.S2. Alternative linear combination least squares (LC-LS) fit solutions for the (a) XANES and (b) k3-weighted EXAFS spectra at the Fe K-edge, for sample ‘U + Fe Abiotic’. Experimental and calculated curves are displayed as black and red lines respectively. Spectra of the fitting components, namely amorphous ferric III II phosphate (amFe PO4•nH2O), 2 line Ferrihydrite (Fh2L) and vivianite (Fe 3(PO4)2•8H2O) as a proxy for the ferrous phosphate component, are displayed below each fit and are weighted by their relative proportion in the fit. Addition of a ferrous phosphate component significantly improved the quality of the XANES and EXAFS fits for the five samples analyzed at the Fe K-edge, as confirmed by the decrease in the chi values (Table 4.S2 for this sample, ‘U + Fe Abiotic’). The possible formation of mixed FeII/FeIII phosphates is discussed in the text.
90 Chapter 4
Table 4.S2. Results of the alternative LC-LS fit of the Fe K-edge spectra of sample ‘U + Fe Abiotic’ 2 2 presented in Fig. 4.S2. The fit quality was estimated by a R-factor of the following form: Rf = $ [ yexp -ycalc ] / 2 3 $ yexp where y is the normalized absorbance or the k c(k) for XANES and EXAFS fitting respectively.
Model compound (%) Sum of Rf Sample XAS III II components (x 102) amFe PO4•nH2O Fh2L Fe 3(PO4)2•8H2O
U + Fe XANES 56 42 n.i. 100 0.049 Abioti c EXAFS 72 19 n.i. 91 4.7
U + Fe XANES 85 n.i. 14 99 0.012 Abioti c EXAFS 83 n.i. 20 103 2.8
U + Fe XANES 79 9 12 100 0.011 Abioti c EXAFS 76 11 19 106 2.5
V. EXAFS LCF results at the U LIII-edge
Table 4.S3. LC-LS fit results for the U LIII-edge EXAFS spectra of the solid samples collected after 21 days in the ‘U + S. natans’, ‘U + Fe Abiotic’ and ‘U + Fe + S. natans’. Corresponding experimental and calculated EXAFS spectra are presented in Fig. 4.5. Shell-by-shell analysis of the EXAFS spectra of the model compound spectra used as fitting components is displayed in Fig. 4.4. The fit quality was estimated by a R-factor of the 2 2 3 following form: Rf = $ [ yexp - ycalc ] / $ yexp where y = k c(k).
Model compound (%) Sum of Rf Sample components 2 III (x 10 ) amFe PO4-U(VI)cp Biosorbed-U(VI)
U + S. natans 37 66 103 3.9
U + Fe Abiotic 95 - 95 4.4
U + Fe + 52 45 97 2.0 S. natans
91 U(VI) scavenging by iron phosphate encrusting S. natans filaments
VI. U LIII-edge EXAFS shell-by-shell fitting in literature
Selected literature data for U(VI) molecular environment in sorption experiments as determined by shell-by-shell fitting of U LIII-edge EXAFS spectra.
Table 4.S4-1. U(VI) sorbed in the presence of phosphate.
This study Singh (2012) III Path U/amFe PO4 U/(Gt – PO4) N R N R
UOax 2.4 1.8 2 1.8
UOeq 2.5 2.3 3.0 2.3
UOeq 1.0 2.5 1.7 2.5
UC 1.4 2.9 - -
UP 0.5 3.6 0.4-1* 3.6
UFe 0.8 3.7 0.2-1* 4.2
* Different for each sample in the study
Table 4.S4-2. U(VI) sorbed onto various bacteria.
Kelly Dunham- Llorens Merroun This studya (2002)c Cheatham (2012)d (2005)b Path (2011)
R N R N R N R N R N
UOax 1.79 2.4 1.76 2 1.76 1 1.75 2 1.79 2
UOeq 2.34 1.8 2.30 3.7 2.33 1 2.28 3.7 2.34 4.2
UOeq 2.49 1.6 2.45 2.7 2.45 1 2.13 2.5 2.49 2.3 UC 2.88 1.5 2.88 1.4 2.85 3 2.54 2.6 2.93 2.6 UP 3.65 0.9 3.62 1.9 3.60 4 3.58 1.5 3.59 0.3
* Additional paths for (a): UOUO, UOP; (b): UOP, UO; (c): UOP, UOC and (d): UOP, UC, UOUO, UOO, UCC, UCCC
92 Chapter 4
Table 4.S4-3. U(VI) sorbed onto ferrihydrite and hematite.
This Waite Reich Dodge Ulrich Rossberg Bargar study (1994) (1998) (2002) (2006)a (2009) (2000)c Path N R N R N R N R N R N R N R
b UOax 2.4 1.8 2.0 1.8 2.0 1.8 2.4 1.8 3.11 1.9 2 1.8 2.1 1.8
UOeq 1.9 2.3 3.0 2.3 1.0 2.3 3.0 2.3 1.91 2.1 4.8 2.4 2.5 2.3
UOeq 1.2 2.5 2.0 2.5 Variable 2.9 2.0 2.5 - - - - 2.1 2.5
UC 1.5 2.9 ------3b 2.9 0.8 2.9
UFe 0.5 3.4 0.4 3.3 1.0 3.4 1.0 3.4 1.5 3.4 1.1 3.4 0.7 3.4
Notes: (a): Additional paths UFe @2.9 (N=0.5), @3.0 (N=1.1) and @4.0 (N=0.3); (b): fixed parameter; (c): U/Hematite, not Fh.
93 U(VI) scavenging by iron phosphate encrusting S. natans filaments
References
Ankudinov, A.L., Ravel, B., Rehr, J.J., and Conradson, S.D. (1998) Real-space multiple- scattering calculation and interpretation of x-ray-absorption near-edge structure. Phys. Rev. B 58: 7565–7576.
Bargar, J., Retmeyer, R., Lenhart, J.J., and Davis, J.A. (2000) Characterization of U(VI)- carbonato ternary complexes on hematite: EXAFS and electrophoretic mobility measurements. Geochim. Cosmochim. Acta 64: 2737–2749.
Bargar, J.R., Bernier-Latmani, R., Giammar, D.E., and Tebo, B.M. (2008) Biogenic uraninite nanoparticles and their importance for uranium remediation. Elements 4: 407–412.
Bargar, J.R., Reitmeyer, R., and Davis, J.A. (1999) Spectroscopic confirmation of Uranium(VI)-carbonato adsorption complexes on hematite. Environ. Sci. Technol. 33: 2481– 2484.
Baumgartner, J., Morin, G., Menguy, N., Perez Gonzalez, T., Widdrat, M., Cosmidis, J., and Faivre, D. (2013) Magnetotactic bacteria form magnetite from a phosphate-rich ferric hydroxide via nanometric ferric (oxyhydr)oxide intermediates. Proc. Natl. Acad. Sci. U. S. A. 110: 14883–14888.
Beazley, M.J., Martinez, R.J., Sobecky, P. a, Webb, S.M., and Taillefert, M. (2007) Uranium biomineralization as a result of bacterial phosphatase activity: insights from bacterial isolates from a contaminated subsurface. Environ. Sci. Technol. 41: 5701–5707.
Bernier-Latmani, R., Veeramani, H., Vecchia, E.D., Junier, P., Lezama-Pacheco, J.S., Suvorova, E.I., et al. (2010) Non-uraninite products of microbial U(VI) reduction. Environ. Sci. Technol. 44: 9456–9462.
Brugge, D., de Lemos, J.L., and Oldmixon, B. (2005) Exposure pathways and health effects associated with chemical and radiological toxicity of natural uranium: a review. Rev. Environ. Health 20: 177–193.
Catalano, J.G. and Brown, G.E. (2004) Analysis of uranyl-bearing phases by EXAFS spectroscopy: interferences, multiple scattering, accuracy of structural parameters, and spectral differences. Am. Mineral. 89: 1004–1021.
94 Chapter 4
Cheng, T., Barnett, M.O., Roden, E.E., and Zhuang, J. (2004) Effects of phosphate on uranium(VI) adsorption to goethite-coated sand. Environ. Sci. Technol. 38: 6059–6065.
Cologgi, D.L., Speers, A.M., Bullard, B. a, Kelly, S.D., and Reguera, G. (2014) Enhanced uranium immobilization and reduction by Geobacter sulfurreducens biofilms. Appl. Environ. Microbiol.
Converti, A., Fiorito, G., Zilli, M., Lodi, A., Borgld, M. Del, and Ferraiolo, G. (1992) Magnesium uptake by Sphaerotilus natans. Bioprocess Eng. 7: 325–330.
Cosmidis, J., Benzerara, K., Morin, G., Busigny, V., Lebeau, O., Jézéquel, D., et al. (2014) Biomineralization of iron-phosphates in the water column of Lake Pavin (Massif Central, France). Geochim. Cosmochim. Acta 126: 78–96.
Dodge, C.J., Francis, a J., Gillow, J.B., Halada, G.P., Eng, C., and Clayton, C.R. (2002) Association of uranium with iron oxides typically formed on corroding steel surfaces. Environ. Sci. Technol. 36: 3504–3511.
Dunham-Cheatham, S., Rui, X., Bunker, B., Menguy, N., Hellmann, R., and Fein, J. (2011) The effects of non-metabolizing bacterial cells on the precipitation of U, Pb and Ca phosphates. Geochim. Cosmochim. Acta 75: 2828–2847.
Eynard, A., Campillo, M.C., and Torrent, J. (1992) Use of vivianite (Fe3(PO4)2.8H20) to prevent iron chlorosis in calcareous soils. Fertil. Res. 31: 61–67.
Ferris, F.., Hallberg, R.., Lyvén, B., and Pedersen, K. (2000) Retention of strontium, cesium, lead and uranium by bacterial iron oxides from a subterranean environment. Appl. Geochemistry 15: 1035–1042.
Foerstendorf, H., Heim, K., and Rossberg, A. (2012) The complexation of uranium(VI) and atmospherically derived CO2 at the ferrihydrite-water interface probed by time-resolved vibrational spectroscopy. J. Colloid Interface Sci. 377: 299–306.
Fu, F. and Wang, Q. (2011) Removal of heavy metal ions from wastewaters: a review. J. Environ. Manage. 92: 407–18.
Gault, A.G., Langley, S., Ibrahim, A., Renaud, R., Takahashi, Y., Boothman, C., et al. (2012) Seasonal changes in mineralogy, geochemistry and microbial community of
95 U(VI) scavenging by iron phosphate encrusting S. natans filaments bacteriogenic iron oxides (BIOS) deposited in a circumneutral wetland. Geomicrobiol. J. 29: 161–172.
Gavrilescu, M., Pavel, L.V., and Cretescu, I. (2009) Characterization and remediation of soils contaminated with uranium. J. Hazard. Mater. 163: 475–510.
Gino, E., Starosvetsky, J., Kurzbaum, E., and Armon, R. (2010) Combined chemical- biological treatment for prevention/rehabilitation of clogged wells by an iron-oxidizing bacterium. Environ. Sci. Technol. 44: 3123–3129.
Guillaumont, R., Fanghänel, T., Neck, V., Fuger, J., Palmer, D.A., Grenthe, I., and Rand, M.H. (2003) Update on the chemical thermodynamics of uranium, neptunium, plutonium, americium and technetium OECD Nucle. Elsevier Science Ltd, Amsterdam.
Hohmann, C., Morin, G., Ona-Nguema, G., Guigner, J.-M., Brown, G.E., and Kappler, A. (2011) Molecular-level modes of As binding to Fe(III) (oxyhydr)oxides precipitated by the anaerobic nitrate-reducing Fe(II)-oxidizing Acidovorax sp. strain BoFeN1. Geochim. Cosmochim. Acta 75: 4699–4712.
Howatson, J. and Grev, D.M. (1975) Crystal and molecular structure of uranyl acetate dihydrate. J. Inorg. Nucl. Chem. 37: 1933–1935.
Hyacinthe, C. and Van Cappellen, P. (2004) An authigenic iron phosphate phase in estuarine sediments: composition, formation and chemical reactivity. Mar. Chem. 91: 227– 251.
Karabulut, M., Marasinghe, G.K., Ray, C.S., Waddill, G.D., Day, D.E., Badyal, Y.S., et al. (2000) A high energy x-ray and neutron scattering study of iron phosphate glasses containing uranium. J. Appl. Phys. 87: 2185.
Katsoyiannis, I.A., Werner, H., Bartel, H., and Jekel, M. (2006) The effect of groundwater composition on uranium (VI) sorption onto bacteriogenic iron oxides. Water Res. 40: 3646– 3652.
Keim, C.N. (2011) Arsenic in biogenic iron minerals from a contaminated environment. Geomicrobiol. J. 28: 242–251.
96 Chapter 4
Kelly, S.D., Kemner, K.M., Fein, J.B., Fowle, D.A., Byanov, M.I., Bunker, B.A., and Yee, N. (2002) X-ray absorption fine structure determination of pH-dependent U-bacterial cell wall interactions. Geochim. Cosmochim. Acta 66: 3855–3871.
Kennedy, C.B., Gault, a. G., Fortin, D., Clark, I.D., and Ferris, F.G. (2011) Retention of iodide by bacteriogenic iron oxides. Geomicrobiol. J. 28: 387–395.
Klueglein, N. and Kappler, A. (2013) Abiotic oxidation of Fe(II) by reactive nitrogen species in cultures of the nitrate-reducing Fe(II) oxidizer Acidovorax sp. BoFeN1 - questioning the existence of enzymatic Fe(II) oxidation. Geobiology 11: 180–190.
Klueglein, N., Zeitvogel, F., Stierhof, Y.-D., Floetenmeyer, M., Konhauser, K.O., Kappler, A., and Obst, M. (2014) Potential role of nitrite for abiotic Fe(II) oxidation and cell encrustation during nitrate reduction by denitrifying bacteria. Appl. Environ. Microbiol. 80: 1051–1061.
Langley, S., Gault, A.G., Ibrahim, A., Takahashi, Y., Renaud, R., Fortin, D., et al. (2009) Sorption of strontium onto bacteriogenic iron oxides. Environ. Sci. Technol. 43: 1008–1014.
Langley, S., Igric, P., Takahashi, Y., Sakai, Y., Fortin, D., Hannington, M.D., and Schwarz-Schampera, U. (2009) Preliminary characterization and biological reduction of putative biogenic iron oxides (BIOS) from the Tonga-Kermadec Arc, southwest Pacific Ocean. Geobiology 7: 35–49.
Langmuir, D. (1997) Aqueous Environmental Geochemistry Prentice H. Upper Saddle River, New Jersey.
Llorens, I., Untereiner, G., Jaillard, D., Gouget, B., Chapon, V., and Carriere, M. (2012) Uranium interaction with two multi-resistant environmental bacteria: Cupriavidus metallidurans CH34 and Rhodopseudomonas palustris. PLoS One 7: e51783.
Locock, A.J. and Burns, P.C. (2003) The crystal structure of synthetic autunite,
Ca[(UO2)(PO4)]2(H2O)11. Am. Mineral. 88: 240–244.
Lodi, A., Solisio, C., Converti, A., and Borghi, M. Del (1998) Cadmium, zinc, copper, silver and chromium (III) removal from wastewaters by Sphaerotilus natans. Bioprocess Eng. 19: 197–203.
97 U(VI) scavenging by iron phosphate encrusting S. natans filaments
Maillot, F., Morin, G., Wang, Y., Bonnin, D., Ildefonse, P., Chaneac, C., and Calas, G. (2011) New insight into the structure of nanocrystalline ferrihydrite: EXAFS evidence for tetrahedrally coordinated iron(III). Geochim. Cosmochim. Acta 75: 2708–2720.
Marshall, T.A., Morris, K., Law, G.T.W., Livens, F.R., Mosselmans, J.F.W., Bots, P., and Shaw, S. (2014) Incorporation of uranium into hematite during crystallization from ferrihydrite. Environ. Sci. Technol. 48: 3724–3731.
McCleskey, T.M., Foreman, T.M., Hallman, E.E., Burns, C.J., and Sauer, N.N. (2001) Approaching zero discharge in uranium reprocessing: photochemical reduction of uranyl. Environ. Sci. Technol. 35: 547–551.
Mercier-Bion, F., Drot, R., Ehrhardt, J.J., Lambert, J., Roques, J., and Simoni, E. (2011) X-ray photoreduction of U(VI)-bearing compounds. Surf. Interface Anal. 43: 777–783.
Merroun, M.L., Raff, J., Rossberg, A., Hennig, C., Reich, T., and Selenska-Pobell, S. (2005) Complexation of uranium by cells and S-layer sheets of Bacillus sphaericus JG-A12. Appl. Environ. Microbiol. 71: 5532–5543.
Michalakos, G.D., Martínez Nieva, J., Vayenas, D. V, and G, L. (1997) Removal of iron from potable water using a trickling filter. Water Res. 31: 991–996.
Mikutta, C., Schröder, C., and Marc Michel, F. (2014) Total X-ray scattering, EXAFS, and Mössbauer spectroscopy analyses of amorphous ferric arsenate and amorphous ferric phosphate. Geochim. Cosmochim. Acta 140: 708–719.
Miot, J., Benzerara, K., Morin, G., Bernard, S., Beyssac, O., Larquet, E., et al. (2009) Transformation of vivianite by anaerobic nitrate-reducing iron-oxidizing bacteria. Geobiology 7: 373–384.
Miot, J., Benzerara, K., Morin, G., Kappler, A., Bernard, S., Obst, M., et al. (2009) Iron biomineralization by anaerobic neutrophilic iron-oxidizing bacteria. Geochim. Cosmochim. Acta 73: 696–711.
Missana, T., Garcı!a-Gutiérrez, M., and Maffiotte, C. (2003) Experimental and modeling study of the uranium (VI) sorption on goethite. J. Colloid Interface Sci. 260: 291–301.
Mitsunobu, S., Shiraishi, F., Makita, H., Orcutt, B.N., Kikuchi, S., Jørgensen, B.B., and Takahashi, Y. (2012) Bacteriogenic Fe(III) (oxyhydr)oxides characterized by synchrotron
98 Chapter 4 microprobe coupled with spatially-resolved phylogenetic analysis. Environ. Sci. Technol 46: 3304–3311.
Mondani, L., Benzerara, K., Carrière, M., Christen, R., Mamindy-Pajany, Y., Février, L., et al. (2011) Influence of uranium on bacterial communities: a comparison of natural uranium-rich soils with controls. PLoS One 6: e25771.
Moyes, L.N., Parkman, R.H., Charnock, J.M., Vaughan, D.J., Livens, F.R., Hughes, C.R., and Braithwaite, A. (2000) Uranium uptake from aqueous solution by interaction with goethite, lepidocrocite, muscovite, and mackinawite: An X-ray Absorption Spectroscopy study. Environ. Sci. Technol. 34: 1062–1068.
Murphy, W.M. and Shock, E.L. (1999) Environmental aqueous geochemistry of actinides. In, Burns, P.C.A. and Finch, R. (eds), Uranium: Mineralogy, Geochemistry and the Environment. Mineralogical Society of America, Washington DC.
Nico, P.S., Stewart, B.D., and Fendorf, S. (2009) Incorporation of oxidized uranium into Fe (hydr)oxides during Fe(II) catalyzed remineralization. Environ. Sci. Technol. 43: 7391– 7396.
Ona-Nguema, G., Morin, G., Wang, Y., Foster, A.L., Juillot, F., Calas, G., and Brown, G.E. (2010) XANES evidence for rapid arsenic(III) oxidation at magnetite and ferrihydrite surfaces 2+ by dissolved O2 via Fe -mediated reactions. Environ. Sci. Technol. 44: 5416–5422.
Pagnanelli, F., Esposito, A., Toro, L., and Vegliò, F. (2003) Metal speciation and pH effect on Pb, Cu, Zn and Cd biosorption onto Sphaerotilus natans: Langmuir-type empirical model. Water Res. 37: 627–633.
Park, S., Kim, D.-H., Lee, J.-H., and Hur, H.-G. (2014) Sphaerotilus natans encrusted with nanoball-shaped Fe(III) oxide minerals formed by nitrate-reducing mixotrophic Fe(II) oxidation. FEMS Microbiol. Ecol. 90: 1–10.
Phaup, J.D. (1968) The biology of Sphaerotilus species. Water Res. 2: 597–614.
Ravel, B. and Newville, M. (2005) ATHENA, ARTEMIS, HEPHAESTUS: data analysis for X-ray absorption spectroscopy using IFEFFIT. J. Synchrotron Radiat. 12: 537–541.
99 U(VI) scavenging by iron phosphate encrusting S. natans filaments
Reich, T., Moll, H., Arnold, T., Denecke, M., Hennig, C., Geipel, G., et al. (1998) An EXAFS study of uranium(VI) sorption onto silica gel and ferrihydrite. J. Electron Spectros. Relat. Phenomena 96: 237–243.
Rossberg, A., Ulrich, K.-U., Weiss, S., Tsushima, S., Hiemstra, T., and Scheinostt, A.C. (2009) Identification of uranyl surface complexes on ferrihydrite: Advanced EXAFS data analysis and CD-MUSIC modeling. Environ. Sci. Technol. 43: 1400–1406.
Salome, K.R., Green, S.J., Beazley, M.J., Webb, S.M., Kostka, J.E., and Taillefert, M. (2013) The role of anaerobic respiration in the immobilization of uranium through biomineralization of phosphate minerals. Geochim. Cosmochim. Acta 106: 344–363.
Schwertmann, U. and Cornell, R.M. (2000) Iron oxides in the laboratory. Wiley-VCH. Weinheim.
Seder-Colomina, M., Goubet, A., Lacroix, S., Morin, G., Ona-Nguema, G., Esposito, G., et al. (2014, submitted paper) Moderate oxygen depletion as a factor favouring the filamentous growth of Sphaerotilus natans.
Seder-Colomina, M., Morin, G., Benzerara, K., Ona-Nguema, G., Pernelle, J.-J., Esposito, G., and van Hullebusch, E.D. (2014) Sphaerotilus natans, a neutrophilic iron-related sheath- forming bacterium: perspectives for metal remediation strategies. Geomicrobiol. J. 31: 64–75.
Shannon, R.D. and Prewitt, C.T. (1969) Effective ionic radii in oxides and fluorides. Acta Crystallogr. B 25: 925–946.
Shopska, M., Cherkezova-Zheleva, Z.P., Paneva, D.G., Iliev, M., Kadinov, G.B., Mitov, I.G., and Groudeva, V.I. (2012) Biogenic iron compounds: XRD, Mossbauer and FTIR study. Cent. Eur. J. Chem. 11: 215–227.
Singh, A., Catalano, J.G., Ulrich, K.-U., and Giammar, D.E. (2012) Molecular-scale structure of uranium(VI) immobilized with goethite and phosphate. Environ. Sci. Technol. 46: 6594–6603.
Singh, A., Ulrich, K.-U., and Giammar, D.E. (2010) Impact of phosphate on U(VI) immobilization in the presence of goethite. Geochim. Cosmochim. Acta 74: 6324–6343.
100 Chapter 4
Szymanski, J.T. and Scott, J.D. (1982) A crystal-structure refinement of synthetic brannerite, UTi2O6, and its bearing on rate of alkaline-carbonate leaching of brannerite in ore. Can. Mineral. 20: 271–279.
Teo, B.K. (1986) EXAFS: Basic principles and data analysis. Inorganic Chemistry Concepts 9. Springer Berlin Heidelberg, Berlin.
Ulrich, K.-U., Rossberg, A., Foerstendorf, H., Zänker, H., and Scheinost, A.C. (2006) Molecular characterization of uranium(VI) sorption complexes on iron(III)-rich acid mine water colloids. Geochim. Cosmochim. Acta 70: 5469–5487.
Vijayaraghavan, K. and Yun, Y.-S. (2008) Bacterial biosorbents and biosorption. Biotechnol. Adv. 26: 266–291.
Voegelin, A., Kaegi, R., Frommer, J., Vantelon, D., and Hug, S.J. (2010) Effect of phosphate, silicate, and Ca on Fe(III)-precipitates formed in aerated Fe(II)- and As(III)- containing water studied by X-ray absorption spectroscopy. Geochim. Cosmochim. Acta 74: 164–186.
Voegelin, A., Senn, A.-C., Kaegi, R., Hug, S.J., and Mangold, S. (2013) Dynamic Fe- precipitate formation induced by Fe(II) oxidation in aerated phosphate-containing water. Geochim. Cosmochim. Acta 117: 216–231.
Waite, T.D., Davis, J.A, Payne, T.E., Waychunas, G.A., and Xu, N. (1994) Uranium(VI) adsorption to ferrihydrite: Application of a surface complexation model. Geochim. Cosmochim. Acta 58: 5465–5478.
Walter, M., Arnold, T., Reich, T., and Bernhard, G. (2003) Sorption of uranium(VI) onto ferric oxides in sulfate-rich acid waters. Environ. Sci. Technol. 37: 2898–2904.
WHO (2005) Uranium in drinking-water. World Health Organization.
Yavuz, C.T., Mayo, J.T., Yu, W.W., Prakash, A., Falkner, J.C., Yean, S., et al. (2006)
Low-field magnetic separation of monodisperse Fe3O4 nanocrystals. Science (80). 314: 964– 967.
Zeng, H., Singh, A., Basak, S., Ulrich, K-U., Sahu, M., Biswas, P., Catalano, J.G., Giammar, D.E. (2009) Nanoscale size effects on uranium(VI) adsorption to hematite. Environ. Sci. Technol. 43: 1373–1378.
101 U(VI) scavenging by iron phosphate encrusting S. natans filaments
Zhang, W., Cai, J., and Zhang, D. (2012) Preparation and properties of ferrite derived from iron oxidizing bacteria. Chinese Sci. Bull. 57: 2470–2474.
Zhao, J., Guan, X., and Unuma, H. (2007) Preparation of Fe3O4 nanoparticles and their application to composite biosorbent. J. Ceram. Soc. Japan 115: 475–478.
102
CHAPTER 5
Uranium biosorption by S. natans filaments
This chapter will be submitted for publication as:
Seder-Colomina, M., Morin, G., Gélabert, A., Ardo, S., Ona-Nguema, G., Pernelle, J-J.,
Van Hullebusch, E.D. (2014) Uranium (VI) biosorption by Sphaerotilus natans filaments: An integrated approach. Geochimica et Cosmochimica Acta, To be submitted.
Uranium biosorption by S. natans filaments
5. U(VI) biosorption onto Sphaerotilus natans filaments
U(VI) adsorption onto the neutrophilic filamentous sheath-forming bacterium Sphaerotilus natans was studied using Scanning Electron Microscope - Energy Dispersive X-ray Spectroscopy (SEM-EDXS), Attenuated Total Reflection - Fourier Transform Infra-Red (ATR-FTIR) spectroscopy and Extended X-ray Absorption Fine Structure (EXAFS) spectroscopy at the U LIII-edge. Constant-pH adsorption isotherms were performed over a uranium concentration range of 5 log units (10-8 to 10-3 M). This integrated approach made it possible to identify mainly the carboxyl and phosphoryl functional groups of S. natans filaments as responsible for U(VI) biosorption at pH 5.5 and 7, respectively. Moreover, a surface complexation model for uranium biosorption was developed here, incorporating uranium speciation into the equations. Affinity constants for all reactions were adjusted using + FITEQL software. Uranium mononuclear species UO2OH was found to be the predominant -8 -4 + species adsorbed at both pH for 10 to 10 M, while polynuclear species (UO2)3(OH)5 and + -3 (UO2)4(OH)7 were biosorbed only when uranium concentration raised the order of 10 M.
Keywords
Uranium biosorption, ATR-FTIR, EXAFS, S. natans, surface complexation modelling.
104 Chapter 5
5.1. Introduction
Uranium pollution is a major concern worldwide as it has severe implications on public health as well as on the natural environment (Brugge et al., 2005). Indeed, uranium has been accumulating during the past decades in terrestrial and aquatic ecosystems due to the release from natural sources and anthropogenic activities (WHO, 2005). Uranium mobility is strongly controlled by environmental physicochemical conditions: under reducing conditions, it is usually present as U(IV), due to the chemical or biological reduction of U(VI), and forms insoluble minerals (McCleskey et al., 2001; Guillaumont et al., 2003; Bargar et al., 2008; Bernier-Latmani et al., 2010). In contrast, U(VI) is usually found under the highly soluble 2+ uranyl ion form (UO2 ). In acidic environments it is present as free ion while at higher pH (> 4) it usually forms hydroxyl and carbonate complexes that are also positively charged (Langmuir, 1997). Due to the long-term instability of U(IV) reservoirs by re-oxidation to soluble U(VI), further investigations for alternative immobilization techniques applicable to oxic-U(VI) conditions are of crucial interest.
In this context, bioremediation with microorganisms is proposed as one of the best cost- effective alternative (Barkay and Schaefer, 2001; Lloyd and Renshaw, 2005). Indeed, bacteria play a major role in the scavenging, redox transformation and cycling of metals and radionuclides in soils and aqueous environments (Gadd, 2004). In the case of uranium, microorganisms have been suggested as bioremediators for two different reasons: (i) bacteria can reduce U(VI) to U(IV) and therefore contribute to the immobilization of this radionuclide by metabolic processes and the subsequent U(IV) precipitation (Sheng et al., 2011; Cologgi et al., 2014), and (ii) they can retain U(VI) onto their cell walls and extracellular material by biosorption (Xie et al., 2008; Carvajal et al., 2012) and/or biomineralization (Beazley, 2009; Salome et al., 2013) thus strongly modifying uranium transport in environmental systems. In case of U(VI) biosorption at circumneutral pH, representing most natural waters, filamentous sheath- and stalk-forming microorganisms are of special interest due to their particular physiology and their potential to form biofilms, a natural way of attachment. For instance, bacteria such as the Leptothrix-Sphaerotilus group and Gallionella act as natural agents immobilizing heavy metals and radionuclides (e.g. Anderson and Pedersen, 2003; Florea et al., 2011). However, despite their potential applications, such filamentous bacteria can be tricky to grow in a laboratory, impairing most investigations regarding their complexation properties.
105 Uranium biosorption by S. natans filaments
Sphaerotilus natans, a Gram-negative neutrophilic filamentous sheath-forming microorganism (Seder-Colomina et al., 2014), has been chosen here as a model bacterium for filamentous sheath-forming bacteria as it is easily grown in a wide range of culture conditions. Indeed, depending on various parameters such as peptone (Gaudy and Wolfe, 1961), calcium (Dias et al., 1968), nutrient content (Suzuki et al., 2002) or oxygen (Seder-Colomina et al., submitted article), S. natans growth morphotype can be easily switched from single cells to filaments. Moreover, both single cells and filaments can be covered by a layer of extracellular polymeric substances (EPS), often associated to the scavenging of inorganic pollutants (Li and Yu, 2014). S. natans biosorption potential for the removal of heavy metals has been occasionally reported (Converti et al., 1992; Lodi et al., 1998; Pagnanelli et al., 2003) and several mathematical models, mainly Langmuir-type with different adaptations, have been developed to describe its sorption capacities (e.g. Esposito et al., 2001; Pagnanelli et al., 2002; Beolchini et al., 2003). However, although such models tried to understand the interactions of different metals with S. natans, they would not be accurate enough when describing uranium complexation, as this element present multiple species as stated above. Thus, information about functional groups sorbing U(VI) as well as urarium speciation are needed to develop a reliable model describing uranium complexation onto S. natans.
The integrated approach presented here to study U(VI) biosorption onto S. natans filaments is based on three main axes: (i) characterization of the changes in S. natans filaments surfaces when exposed to U(VI) , (ii) determination of the uranium local environment when bound to S. natans filaments using Extended X-ray Absorption Fine
Structure (EXAFS) spectroscopy at the U LIII-edge, and (iii) description of U biosorption mechanisms by using surface complexation modelling based on U(VI) adsorption isotherms.
5.2. Materials and Methods
5.2.1. Bacteria preparation
The Sphaerotilus natans ATCC 15291 was purchased from the American Type Culture Collection, and was originally isolated from a paper-mill slime. It was cultivated in CGY broth (0.5% casitone, 1% glycerol and 0.1% yeast extract) at pH 7 and 30°C. Air diffused freely through the porous cotton plug so that S. natans could grow under its filamentous form (Seder-Colomina et al., submitted article). Cultures were shaked at 100 rpm until the late exponential growth phase was reached (~20 h). Filaments were then centrifuged at 10034 g and washed three times with 0.1 M NaClO4 electrolyte solution in order to remove excess
106 Chapter 5 ions from the cells and CGY solution prior to the experiments. After the final wash, the wet bacterial pellet was weighed and immediately used for the experiments.
5.2.2. Uranium adsorption experiments
Adsorption as a function of uranium concentration in solution was tested at fixed pH 5.50 and 7.00. All experiments and stock solutions were prepared in a JACOMEX® anoxic glove- box (pO2 < 50 ppm) using O2-free Milli-Q water purged by bubbling Ar Alphagaz™ in order to avoid the formation of carbonate complexes (Bargar et al., 1999; Rossberg et al., 2009; Foerstendorf et al., 2012). Uranium stock solution was prepared from reagent grade -1 UO2(NO3)2. All tests were conducted at 25°C for a S. natans concentration of 1 gwet.L continuously stirred in 0.1 M NaClO4 electrolyte solution in Teflon® vessels. After preliminary kinetic tests (Fig. 5.S1), exposure time in all experiments was fixed to 8 h.
Uranium-loading concentration in solution varied from 10-8 to 10-3 M. pH was adjusted using either NaOH or HNO3 Normatom (Prolabo®) grade reagents. The equilibrium pH was readjusted when necessary within ± 0.05 pH units over the 8 h of reaction time. At the end of the experiment, the suspension was filtered through a 0.22 !m pore-size syringe filter, acidified with ultrapure nitric acid and stored at 4°C until analysis. The concentration of uranium adsorbed to S. natans was calculated by subtracting the concentration of uranium in the supernatant from the original amount added in the suspension.
Uranium in solution was determined using High Resolution-Inductively Coupled Plasma– Mass Spectrometry (HR-ICP"MS) on a ThermoScientific Element II.
5.2.3. Characterization of S. natans filaments surface
Scanning Electron Microscope - Energy Dispersive X-ray Spectroscopy (SEM-EDXS) was used to investigate uranium biosorption onto S. natans. Filaments were exposed to 2 ! 10-5 M of uranium, taken as an average concentration inside the adsorption isotherms range detailed -1 above. S. natans filaments (1 gwet.L ) were incubated in 0.1 M NaClO4 electrolyte solution at pH 7 and pH 5.5. After 8 hours of incubation, 100 !L of S. natans suspension were diluted in
O2-free Milli-Q water and filtered using 0.22 !m filter. Then filters were deposited on a carbon tape, dried at ambient temperature inside the anoxic glove-box and finally coated with a thin carbon film. SEM-EDXS analyses were performed with a GEMINI ZEISS Ultra55 Field Emission Gun microscope operating at 15 kV.
Attenuated Total Reflection - Fourier Transform Infra-Red spectroscopy (ATR-FTIR) was
107 Uranium biosorption by S. natans filaments used here to investigate the functional groups present in the surface of S. natans filaments, either non-exposed or exposed to 2 ! 10-5 M of uranium (pH 7 and 5.5). After the 8 hours of incubation, suspensions were centrifuged and wet pastes of S. natans were deposited on a ZnSe ATR crystal and dried for 24 hours under vacuum. The Nicolet™ 6700 FTIR Spectrometer (Thermo Scientific™) was equipped with a deuterated triglycine sulfate (DTGS) detector and a horizontal attenuated total reflectance attachment (ZnSe crystal). The spectrometer was purged with CO2-free dry air using a Balston® filter (Whatman, Inc.) at room temperature. The ATR-FTIR spectra were recorded at an incidence angle of 45° and a total of 3000 scans at a resolution of 2 cm"1 were averaged for each sample, in the 4000–500 cm-1 region. All spectra were background subtracted and normalized to the 3190 cm"1 peak.
5.2.4. X-ray absorption spectroscopy (XAS) at U LIII-edge
Samples from adsorption experiments exposed to uranium concentration of 2 ! 10-5 M at pH 7 and 5.5 were harvested by centrifugation and the wet biomass was dried under vacuum for 24 hours. Samples were ground in an agate mortar for 20 minutes and pelleted for synchrotron analyses. The pellets were sealed between two layers of Kapton tape, mounted on the sampleholders, resealed with Kapton and stored within aluminized foil sealed bags (Protpack®) during the transfer to the synchrotron. Bags were opened at the beamline and samples were directly plunged into liquid N2 prior to their transfer inside the cryostat, where they were placed under N2 atmosphere.
Uranium LIII-edge XAS data of S. natans filaments at pH 7 and 5.5 were collected at the European Synchrotron Radiation Facility, France (ESRF), on bending magnet beamline BM26A using a 9 elements Ge array fluorescence detector. The energy of the beam delivered by the Si(111) double-crystal monochromator was calibrated by setting to 17173.4 eV the first inflection point in the U LIII-edge of uranyl nitrate recorded in double transmission setup, i.e. similar to Zr and Y foils data calibrated to 17998 and 17038 eV, respectively. Data were collected at 80K in order to avoid photoreduction of U(VI) under the X-ray beam in our organic samples (Mercier-Bion et al., 2011). A minimum of 12 scans was collected for each sample. ATHENA (Ravel and Newville, 2005) was used to average, normalize and background-subtract EXAFS data. Spectra were analyzed by the classical shell-by-shell fit procedure based on the plane-wave formalism (Teo, 1986) and using a Levenberg–Marquardt least-squares minimization algorithm. Theoretical phase and amplitude functions employed in this fitting procedure were calculated using the curved-wave scattering theory thanks to the ab
108 Chapter 5 initio FEFF8 code (Ankudinov et al., 1998), and using the crystal structures of torbernite (Locock and Burns, 2003) for the U–O and U–P paths and of uranyl acetate dehydrate (Howatson and Grev, 1975) for U–C paths. Shell-by-shell fits were performed in k-space. Fit 2 2 quality was estimated by a reduced #R parameter of the following form: cR = Nind/(Nind – p) 3 3 2 $ [k (c(k)exp – k (c(k)calc ] , with Nind =(2%k%R)/p), the number of independent parameters and p the number of free fit parameters.
5.3. Results and discussion
5.3.1. Adsorption isotherms
Results of U adsorption isotherms performed at constant pH are illustrated in Fig. 5.1. The overall adsorption on S. natans filaments at pH 5.5 was higher than at pH 7 (Fig. 5.1a and b, respectively).
-3 -3 (a) (b)
-4 -4
-5 -5
-6 -6 Log q (mol U/g bacteria) Log q (mol U/g bacteria)
-7 -7
-8 -8 -9 -8 -7 -6 -5 -4 -3 -9 -8 -7 -6 -5 -4 -3 Log Cf (mol U/L) Log Cf (mol U/L)
Figure 5.1. Uranium adsorption isotherms of S. natans filaments at (a) pH 5.5 and (b) pH 7. Solid lines correspond to the FITEQL model.
The maximal absorption of S. natans filaments was calculated and values of 370 !mol U.g-1 bacteria and 75 !mol U.g-1 bacteria were found for pH 5.5 and 7 respectively. These values are in agreement with uranium biosorption reported for other microorganisms (Table 5.1), slightly varying depending on pH, exposure time and bacterial physiology. It has been demonstrated that for S. natans, culture conditions modify its physiology, from single cell morphotype to filaments (Seder-Colomina et al., submitted article). In previous biosorption
109 Uranium biosorption by S. natans filaments studies little attention was paid to the growth morphotype of S. natans (Table 5.S1 for a comparative study) and hence, data to compare S. natans biosorption ability for different inorganic pollutants is insufficient.
Table 5.1. Comparison of uranium binding capacities of various biomass.
Time q Bacteria Gram pH max Reference (h) (!mol.g-1) Nakajima and Tsuruta Micrococcus luteus Positive 3.5 1 611.0 (2004) Arthrobacter sp. Positive 7.3 24 323.1 Carvajal et al. (2012) G975 Microcystis Negative 8 3 187.9 Li et al. (2004) aeruginosa Synechococcus Negative 8 1 224.8 Acharya et al. (2009) elongatus Sphaerotilus natans Negative 7 8 75 This study Sphaerotilus natans Negative 5.5 8 370 This study
5.3.2. S. natans filaments surface
Figure 5.2 displays SEM-EDXS analyses of S. natans filaments at (a) pH 5.5 and (b) pH 7 after 8 hours of exposition to 2 ! 10-5 M of uranium. Results showed the characteristic X-ray lines corresponding to the M-series of uranium at 3.16 and 3.33 keV. P and S peaks were also observed and are inherent to bacterial cell and sheath composition. Na and Cl peaks observed correspond to electrolyte salt precipitation. Moreover, EDXS analyses of the filters (data not shown) discard any unspecific uranium precipitation. These results confirmed that S. natans filaments were responsible for uranium removal by a biosorption process. This is in agreement with previous studies that reported the scavenging of heavy metals such as Pb, Cu, Zn, Cd, Ag, Cr(III) and Mg by S. natans (Converti et al., 1992; Lodi et al., 1998; Pagnanelli et al., 2003). However, as discussed above, in non of these publications the morphotype of S. natans is specified.
110 Chapter 5
Figure 5.2. SEM-EDXS of S. natans filaments exposed to 2 ! 10-5 U at (a) pH 5.5 and (b) pH 7. Scale bars represent 4 !m. Squares represent EDXS analyses spot.
FTIR-ATR (Figure 5.3) contributed in elucidating the functional groups present in S. natans filaments surface. Infrared spectra made it possible to detect the following organic groups: aliphatic, amides I and II, carboxylic, phosphate, polysaccharide, sulfonic and uranyl (Table 5.2), in accordance with previous IR measurements (Jiang et al., 2004; Choudhary and Sar, 2011; Shi et al., 2012; Parikh et al., 2014). In some of these cases, while bands were attributed to the same functional group, small shifts were observed in the wave number. Phosphate-attributed band at 1202 shifted to 1241 cm-1 when S. natans was exposed to uranium. This variation was attributed to phosphoryl groups because as Jiang et al. (2004) reported, the alternative would be carboxyl groups, but the signal is too low in this case. Although the carboxyl-attributed band had a large signal, shifts were not detected. As the non-exposed control used here was at pH 7, the carboxyl signal when exposed to U at pH 5. 5 (when these groups are more active towards uranium) is not clearly comparable. The band between 1056 and 1088 cm-1 corresponding to phosphoryl and EPS groups was slightly shifted depending on pH. Moreover, several bands were exclusive from one of the conditions, -1 2+ i.e. band at 918 cm that corresponds to the U–O asymmetric stretching vibration of UO2
111 Uranium biosorption by S. natans filaments
and stretching vibrations of weekly bonded oxygen ligands with uranium (U–Oligand) (Cejka, 1999).
Figure 5.3. FTIR features of S. natans filaments exposed to 2 ! 10-5 U at pH 5.5 and 7, and non-exposed to uranium (control at pH 7).
The overall IR spectroscopic analysis suggests that carboxyl and phosphoryl groups present in the surface of S. natans filaments and cells are the dominant functional groups involved in bacteria-uranium interaction, as has been reported for other microorganisms (Merroun et al., 2003; Acharya et al., 2009; Kazy et al., 2009). In addition, EPS may also contribute to the uranium biosorption as it does for other metals (Merroun et al., 2003; Li and Yu, 2014). These results are in agreement with the composition of S. natans sheath reported by Takeda et al. (1998): 54.1% carbohydrates, 12.2% protein and 1-3% lipid. Indeed, as the functional groups playing a role in the scavenging on inorganic pollutants may differ between both single cells and ensheathed filaments of S. natans, authors would suggest further investigations to compare both morphotypes.
112 Chapter 5
Table 5.2. FTIR functional groups and the corresponding structures found for S. natans filaments. Band attributions were made according to (Jiang et al., 2004; Choudhary and Sar, 2011; Shi et al., 2012; Parikh et al., 2014).
Functional group Wave numbera (cm-1) Corresponding structure
Aliphatic 1452 C–H bending in CH2
1383 C–H bending in CH2 Amide I 1642 C=O stretching N–H bending, Amide II 1532 C–N stretching Carboxylic 1735 C=O stretching Phosphate 1202 - 1241 P–O asymmetric stretching 970 PO2- symmetric stretching 1056 - 1088 P–O symmetric stretching Stretching modes of Polysaccharide 1056 - 1088 polysaccharides
Sulfonic 1303 S–O asymmetric stretching
1147 S–O symmetric stretching Uranyl 918 U–O stretching
a: Several of the bands identified are broad, and the band position in the table represents the center of the band maximum.
5.3.3. U LIII-edge EXAFS shell-by-shell fit
To characterize U molecular structure when bound to S. natans filaments at pH 5.5 and 7 -5 after 8 hours of exposition to 2 ! 10 M of uranium, U LIII-edge EXAFS spectroscopy was used. Results of the shell-by-shell fit of unfiltered k3-weighted EXAFS spectra are displayed in Figure 5.4, and corresponding fitting parameters are given in Table 5.3.
113 Uranium biosorption by S. natans filaments
3 (a) (b) Oax Oeq P 3 C MS1 MS2 ) k (
! S. natans - U / pH 5.5
3 k FT
S. natans - U / pH 7
4 6 8 10 12 0 1 2 3 4 5 6 k (Å-1) R + !R(Å)
-5 Figure 5.4. U LIII-edge EXAFS spectra of S. natans filaments exposed to 2 ! 10 M U at pH 5.5 and 7. (a) Results of the shell-by-shell fits of unfiltered k3-weighted data and (b) the corresponding Fourier Transforms (FT), including the magnitude and imaginary part. Experimental data and calculated curves are plotted as black and red solid lines, respectively. All fit parameters are reported in Table 5.3.
-5 Table 5.3. Fitting results for U LIII-edge EXAFS data of S. natans filaments exposed to 2 ! 10 M U at pH 5.5 and 7. Coordination number (N), interatomic distance (R), Debye–Waller parameter (!) and energy offset 2 (E0). Fit quality was estimated by a reduced #R parameter.
2 Sample Path R (Å) N ! (Å) "E0 (eV) #R (± 1.5%) (± 20%) (± 0.01) (± 3)
S. natans – U / pH 5.5 UOax 1.79 2.43 0.06 14.6 28
UOeq 2.34 1.80 -
UOeq 2.49 1.56 - UC 2.88 1.80 0.07 UP 3.65 0.87 0.07
S. natans – U / pH 7 UOax 1.80 2.70 0.06 16.3 40
UOeq 2.35 1.77 -
UOeq 2.50 1.52 - UC 2.88 1.94 0.08 UP 3.66 0.76 0.06
* Notes: (-) Kept equal to the free parameter placed above in the table. Path UOUO (MS1) at N=2 and R=3.58 and UOP (MS2) at N=2 and R=3.92 added in all samples as multiple scattering.
114 Chapter 5
The first-neighbour contribution to the EXAFS was fit with 2.43 ± 0.48 and 2.70 ± 0.54 oxygen atoms (pH 5.5 and 7 respectively) at 1.80 ± 0.02 Å, in agreement with the geometry of the uranyl two axial oxygen atoms. The second-neighbour contributions to the EXAFS were fit for both samples with 1.78 ± 0.36 and 1.54 ± 0.31 O atoms at a distance of 2.35 ± 0.03 and 2.50 ± 0.04 Å respectively, corresponding to the uranyl equatorial oxygen atoms. Previous studies of U adsorption on bacteria (Kelly et al., 2002; Merroun et al., 2005) and minerals such as ferrihydrite (Waite et al., 1994; Dodge et al., 2002), hematite (Bargar et al., 2000) or goethite (Singh et al., 2012) found the same structure for these two shells of the uranyl complex. The next shell was fitted with 1.80 ± 0.36 and 1.94 ± 0.39 C atoms (pH 5.5 and 7 respectively) at a distance of 2.88 ± 0.04. As the experiments were performed in anoxic glove-box, no carbonate complexes were expected (Bargar et al., 1999; Rossberg et al., 2009; Foerstendorf et al., 2012). This U"C distance observed here is in agreement with previous studies of Gram-positive (Kelly et al., 2002; Merroun et al., 2005) and Gram-negative bacteria (Llorens et al., 2012) and corresponds to the complexation of uranium by carboxyl groups. U"P distance was found at 3.65 ± 0.05 Å, with a contribution of 0.87 ± 0.17 and 0.76 ± 0.15 P atoms (pH 5.5 and 7 respectively). Phosphorus participation in uranium scavenging by bacteria has been reported in several occasions (Beazley et al., 2007; Dunham- Cheatham et al., 2011; Merroun et al., 2011). Furthermore, phosphoryl groups have been reported to bind uranyl ions via its oxygen atoms in the case of sugar phosphates such as glucose and fructose 6-phosphate (Koban et al., 2004), which are similar to those found in S. natans EPS and sheath (Takeda et al., 2003, 2007; Kondo et al., 2012). Moreover, as a Gram- negative bacteria, S. natans lipopolysaccharide (LPS)-rich outer membrane has an abundance of phosphoryl groups (Masoud et al., 1991) on which U(VI) may bind (Barkleit et al., 2011). U"P distance of ~3.6 Å has also been reported for uranium immobilized in goethite in the presence of phosphates (Singh et al., 2012). In addition, a scattering contributions corresponding to U"O"U"O path (R= 3.58 Å and N=2) and U"O"P path (R= 3.92 Å and N=2) were added in both fits, in agreement with literature (Table 5.S3). U"O distance at ~2.5 Å together with the U"C at ~2.9 Å correspond to the coordination distances of a bidentate carboxylate or carbonate binding (Bargar et al., 1999; Llorens et al., 2012) while U"O at ~2.3 Å and U"P at ~3.6 Å are in agreement with a monodentate phosphate binding (Merroun et al., 2005; Singh et al., 2012).
The overall EXAFS results together with the ATR-FTIR data suggest a major role of phosphoryl and carboxyl groups in the complexation of uranium by S. natans for both pHs.
115 Uranium biosorption by S. natans filaments
Since the two pHs are very similar, no major differences were expected for the EXAFS signal, and therefore a modelling approach was necessary to elucidate the specific role of each functional group in the scavenging of uranium at pH 5.5 and 7.
5.3.4. Surface complexation modelling
Results exposed above demonstrate the complementary role of ATR-FTIR and EXAFS spectroscopy for determining the uranium distribution and scavenging by S. natans filaments and hence for improving the mathematical model as described hereafter. A thermodynamic surface complexation approach was used to model the adsorption of U(VI) onto S. natans filaments as the interactions between a range of different aqueous uranyl species (Table 5.4) and specific sites on the bacteria, previously identified as carboxyl and phosphoryl groups by using ATR-FTIR and EXAFS techniques.
Table 5.4. Distribution of uranium species at 1 ! 10-3, 2 ! 10-5 (SEM-EDXS, ATR-FTIR and EXAFS -8 experiments) and 1 ! 10 M for pH 5.5 and pH 7 in 0.1 M NaClO4 solution.
pH 5.5 pH 7 1 ! 10-3 2 ! 10-5 1 ! 10-8 1 ! 10-3 2 ! 10-5 1 ! 10-8 Chemical species (%) Chemical species (%) + 67.3 46.6 - 50.0 73.3 - (UO2)3(OH)5 + 23.3 3.9 - 49.5 22.4 - (UO2)4(OH)7 + - 15.9 45.1 - - 47.6 UO2(OH) 2+ - 18.9 53.5 - - - UO2 2+ - 12.6 - - - - (UO2)2(OH)2
- - - - - 45.5 UO2(OH)2 (aq) 9.4 2.1 1.4 0.5 4.3 6.9 Other
A 2-site model was adapted from Gorman-Lewis et al. (2005) and Sheng and Fein (2013) to characterize the proton-active binding sites on S. natans filaments. The carboxyl (pKa ~ -4 -5 4.0) and phosphoryl sites (pKa ~ 6.8) were set to densities of 3.7 ! 10 and 7.8 ! 10 per g of wet weight respectively, based on Mishra et al. (2009). Both pHs data sets of U(VI) adsorption were modelled using FITEQL computer codes (Herbelin and Westall, 1996). This 2+ + + + model included optimization of UO2 , UO2OH , (UO2)3(OH)5 and (UO2)4(OH)7 complexation constants with carboxyl and phosphoryl groups and the EDL capacitance value. Parameters related to intrinsic properties of S. natans surface (pKa of COOH and POH and their total concentrations) were allowed to slightly vary, always following previous studies
116 Chapter 5
(Mishra et al., 2010). Therefore, eight adjustable K parameters for reactions (1) to (8) (Table 5.5) were used to describe the adsorption experiments.
Table 5.5. Complexation reactions of different uranium species with carboxyl and phosphoryl groups.
Reaction log K
2+ + + 1 R-COOH + UO2 = R-COOUO2 + H K COOUO2+ = - 0.5
2+ 0 + 2 R-COOH + UO2 = R-COOUO2OH + 2 H K COOUO2OH0 = - 5.1
2+ 0 + 3 R-COOH + 3 UO2 = R-COO(UO2)3(OH)5 + 6 H K COO(UO2)3(OH)50 = - 19.0
2+ 0 + 4 R-COOH + 4 UO2 = R-COO(UO2)4(OH)7 + 8 H K COO(UO2)4(OH)70 = - 26.9
2+ + + 5 R-POH + UO2 = R-POUO2 + H K POUO2+ = - 3.8
2+ 0 + 6 R-POH + UO2 = R-POUO2OH + 2 H K POUO2OH0 = - 8.6
2+ 0 + 7 R-POH + 3 UO2 = R-PO(UO2)3(OH)5 + 6 H K PO(UO2)3(OH)50 = - 24.9
2+ 0 + 8 R-POH + 4 UO2 = R-PO(UO2)4(OH)7 + 8 H K PO(UO2)4(OH)70 = - 32.5
* Note: Site density of COOH = 3.4 ! 10-4 and POH = 7.8 ! 10-5. / pKa COOH ~ 4.0 and pKa POH ~6.8.
Results of surface complexation modelling are presented in Fig. 5.1 as solid lines. Each adsorption experiment was fitted individually to provide simultaneously the best fit of the experimental adsorption isotherm. The model considered the uranium speciation depending on pH (Table 5.4 and Figure 5.S2) as well as different funtional groups. Indeed, the model was based on the assumption that carboxyl groups dominated uranium adsorption at pH 5.5 while phosphoryl groups were more relevant in the scavenging of uranium at pH 7. This choice was motivated by the dissociation constant of each group and the affinity constants for uranium species and supported by EXAFS evidences. Phosphoryl groups have higher affinity for U species than carboxyl groups. Hence, when both ionized species are present in the media (pH 7), phosphoryl groups drive uranium surface complexation. In contrast, at pH 5.5 only the carboxyl groups are negatively charged (pKa of phosphoryl groups ~ 6.8) and therefore uranium complexation at such pH is mainly controlled by the carboxyl sites.
+ For instance, at pH 7 UO2OH was the main uranium species sorbed for almost 4 log units
117 Uranium biosorption by S. natans filaments
(10-8 to 10-5 M initial uranium load), and only for the highest uranium concentration (1 ! 10-4 + M) (UO2)4(OH)7 was the dominant species sorbed (with a small contribution of + 2+ (UO2)3(OH)5 ). As at pH 7 UO2 is not present anymore, it is not involved in surface + complexation (Table 5.4). Accordingly, at pH 5.5 UO2OH also dominated uranium -4 2+ complexation until 1 ! 10 M U. In this case, even if UO2 was present in the lowest + concentrations tested (Table 5.4), it changed rapidly to UO2OH . Highest concentrations of -4 -3 + uranium tested (5 ! 10 to 1 ! 10 M) resulted in (UO2)3(OH)5 complexation, which + predominated compared to (UO2)4(OH)7 .
It is very interesting to notice that while uranium-loading concentration was increasing along the isotherms experiments and uranium speciation was theoretically changing towards + + the predominance of polynuclear U species (UO2)4(OH)7 and (UO2)3(OH)5 ) (Table 5.4 and + Fig. 5.S2), the mononuclear species UO2OH dominated the surface complexation in both pHs experiment. These evidences could be supported by our EXAFS data (Fig. 5.4). Indeed, if polynuclear species were bound to S. natans filaments, neighbouring uranium atoms would be detected by EXAFS analysis. As adsorption experiments (Fig. 5.1) showed that ~ 95% of + total uranium was adsorbed in samples analyzed by EXAFS, if (UO2)3(OH)5 and + (UO2)4(OH)7 were the sorbed species, U"U pair correlations at a distance of ~3.8 Å (Tsushima et al., 2007) should appear, with expected number of neighbours of N = 1.3 and 1.5 + + U atoms for (UO2)3(OH)5 and (UO2)4(OH)7 respectively. EXAFS fit including such U-U paths with these numbers of neighbours did not match the experimental signal (Fig. 5.S3), indicating that uranium complexes were mostly mononuclear. Indeed, EXAFS modelling revealed that a maximum of 25% of the total bound uranium could correspond to polynuclear species (Fig. 5.S3). Moreover, such contribution only matches for pH 5.5 (Fig. 5.S3a), while at pH 7 this U-U contribution is absent and would appear to be out of phase with the + experimental data (Fig. 5.S3b). Although UO2OH does not dominate in solution at pH 5.5 and 7 for dissolved U-loading concentrations higher than 10-5 and 10-7 M respectively, our results indicate a higher affinity of the U mononuclear species than of polynuclear species for + the microbial ligands. Polynuclear species can compete with UO2OH and be complexed by the carboxyl and phosphoryl groups at pH 5.5 and 7 respectively only when U-loading concentrations are in the order of 10-4 to 10-3 M.
5.4. Conclusions
This study provides evidences for U(VI) biosorption by Sphaerotilus natans as a model
118 Chapter 5 bacterium for neutrophilic filamentous microorganisms. FTIR-ATR and EXAFS contributed in elucidating the functional groups present in S. natans filaments surface and in identifying those involved in uranium biosorption. Results indicate that carboxyl and phosphoryl groups are the main functional groups interacting with uranium, under its different species, depending on pH and concentration. Moreover, the surface complexation model developed here confirmed this results. Indeed, such approach indicates that mononuclear uranium + species, and in particular UO2OH controlled the uranium complexation onto S. natans in permanent equilibrium with the other U species. U adsorption at pH 5.5 was found to be driven by carboxyl functional groups while uranium binding by phosphoryl groups predominated at pH 7. Sphaerotilus natans filaments have been reported to form dense biofilms (Gino et al., 2010) with great potential for uranium water treatment (as shown for other bacterial species, Cologgi et al. 2014)). Hence, the adsorption results presented here together with the ability of this bacterium for attached biofilm growth suggest the potential of S. natans for the scavenging of uranium.
119 Uranium biosorption by S. natans filaments
Supporting Information
I. Kinetics of U(VI) biosorption experiments
100
95
90
85 U U adsorbed (%)
80
75 0 8 16 24 Time (hours)
Figure 5.S1. Uranium adsorption kinetics onto S. natans filaments at (!) pH 5.5 and (") 7. Uranium concentration 10-6 M. Kinetics of U(VI) sorption onto BIOS at different ratios of groundwater in distilled water. Experimental conditions: initial U(VI) = 10-6 M; ionic strength -1 (NaClO4) = 0.1 M; adsorbent dosage = 1 gwet.L .
120 Chapter 5
II. S. natans biosorption studies
Table 5.S1. S. natans biosorption studies from literature.
Guessed Production Morphotype Biomass Metal Models Reference conditions *
48 h, 28°C, Filaments Fresh Mg - Converti shaken, peptone et al. & yeast extract (1992)
36-48 h, 30°C, Filaments Not detailed Cd, Zn, - Lodi et al. 150 rpm, Cu, Ag, (1998) peptone & yeast Cr(III) extract
36-48 h, 28°C, Filaments Fresh Cr(III) - Solisio et shaken, dry meat al. (2000) extract
Air flux rate of Single cells Lyophilised Cd, Cu Langmuir Esposito 0.5 L.min-1, Freundlich et al. 25°C, meat Redlich–Peterson (2001) peptone & yeast extract
36-48 h, 28°C, Filaments Lyophilised Cu–Cd Langmuir Pagnanelli shaken, dry meat Cu–Pb competitive model (2002) extract Cu–Zn
36-48 h, 28°C, Filaments Lyophilised Pb, Cu, Langmuir Pagnanelli shaken, dry meat Zn, Cd empirical model et al. extract (2003)
Air flux rate of Single cells Lyophilised Cu–Cd, Langmuir Pagnanelli 0.5 L.min-1, Cu–Pb competitive model et al. 25°C, meat (2004) peptone & yeast extract
Air flux rate of Single cells Lyophilised Cu - Beolchini 0.5 L.min-1, et al. 25°C, meat (2003; peptone & yeast 2006) extract * The morphotype was not detailed in any publication, so it has been deduced from biomass culture conditions.
121 Uranium biosorption by S. natans filaments
III. EXAFS U LIII-edge fitting parameters for U biosorption in literature
Table 5.S2. EXAFS U LIII-edge fitting parameters for U biosorption in literature.
EXAFS fitting Bacteria Gram pH Additiona Reference Path R N l paths
Sphaerotilus natans - 5.5 UOax 1.79 2.4 UOUO This study UOeq 2.34 1.8 UOP UOeq 2.49 1.6 UC 2.88 1.5 UP 3.65 0.9 Sphaerotilus natans - 7 UOax 1.80 2.7 UOUO This study UOeq 2.35 1.8 UOP UOeq 2.51 1.6 UC 2.88 2.3 UP 3.66 0.8 Bacillus sphaericus + 4.5 UOax 1.76 2 UOP Merroun et al. UOeq 2.30 3.7 UO (2005) UOeq 2.45 2.7 UC 2.88 1.4 UP 3.62 1.9 Bacillus subtilis + < 4.8 UOax 1.76 1 UOP Kelly et al. UOeq 2.33 1 UOC (2002) UOeq 2.45 1 UC 2.85 3 UP 3.60 4 Bacillus subtilis + 4.5 UOax 1.75 2 - Dunham- UOeq 2.28 3.7 Cheatham et al. (2011) UOeq 2.13 2.5 UC 2.54 2.6 UP 3.58 1.5 Cupriavidus - 7 UOax 1.79 2 UOP, UC Llorens et al.
metallidurans UOeq 2.34 4.2 UOUO (2012) UOeq 2.49 2.3 UOO UC 2.93 2.6 UCC UP 3.59 0.3 UCCC Sphingomonas sp. - 4.5 UOax 1.77 2 UU Merroun et al. UOeq 2.27 4/0 UOP (2011) UOeq 2.86 0.8 UP 3.59 1.8 Rahnella sp. - 5.5 UOax 1.79 2 UOP Beazley et al. UOeq 2.28 2.7 OPOU (2007) UP 3.59 2.3 Rahnella sp. - 7 UOax 1.78 2 UOP Beazley et al. UOeq 2.28 3.1 OPOU (2007) UP 3.54 0.75
122 Chapter 5
IV. U(VI) aqueous speciation
Table 5.S3. Aqueous speciation reactions used for uranium speciation.
Reaction Log K*
2+ + + UO2 + H2O = UO2OH + H -5.25
2+ + UO2 + 2H2O = UO2(OH)2(aq) + 2H -12.15
2+ - + UO2 + 3H2O = UO2(OH)3 + 3H -20.25
2+ 2- + UO2 + 4H2O = UO2(OH)4 + 4H -32.4
2+ 3+ + 2UO2 + H2O = (UO2)2OH + H -2.7
2+ 2+ + 2UO2 + 2H2O = (UO2)2(OH)2 + 2H -5.62
2+ + + 3UO2 + 5H2O = (UO2)3(OH)5 + 5H -15.55
2+ - + 3UO2 + 7H2O = (UO2)3(OH)7 + 7H -32.2
2+ + + 4UO2 + 7H2O = (UO2)4(OH)7 + 7H -21.9
*Note: values from NEA (Guillaumont et al., 2003).
123 Uranium biosorption by S. natans filaments
1 10-3 (a)
8 10-4
6 10-4
4 10-4 Uranium Uranium (mol/L)
2 10-4
0 2 4 6 8 10 12 14 pH
2 10-5 (b)
1.5 10-5
1 10-5 Uranium Uranium (mol/L) 5 10-6
0 2 4 6 8 10 12 14 pH
1 10-8 (c)
8 10-9
6 10-9
4 10-9 Uranium Uranium (mol/L)
2 10-9
0 2 4 6 8 10 12 14 pH
UO2+2 UO2(OH)2+2 UO2(OH)2(aq) UO2OH+ (UO2)3(OH)5+ (UO2)3(OH)7- UO2(OH)3- (UO2)4(OH)7+ UO2(OH)4-2
Figure 5.S2. Speciation diagrams for U(VI) concentrations of (a) 1 ! 10-3, (b) 2 ! 10-5 (SEM- EDXS, ATR-FTIR and EXAFS experiments) and (c) 1 ! 10-8 M.
124 Chapter 5
IV. Preliminar study of U(VI) polynuclear species sorption by EXAFS
(a) (b) U @ 3.80 U @ 3.80 4 4 100% ads 100% ads N=1.33 N=1.33
U @ 3.80 U @ 3.80 50% ads 50% ads N=0.66 N=0.66 FT FT
U @ 3.80 U @ 3.80 25% ads 25% ads N=0.33 N=0.33
0 1 2 3 4 5 6 0 1 2 3 4 5 6 R + !R(Å) R + !R(Å)
-5 Figure 5.S3. U LIII-edge EXAFS spectra of S. natans filaments exposed to 2 ! 10 M U at (a) pH 5.5 and (b) pH 7. Fourier Transforms (FT) of unfiltered k3-weighted data, including the magnitude and imaginary part. Experimental data and calculated curves are plotted as black and red solid lines, respectively. Calculated curves represent the fit signal corresponding to the U"U path at ~3.8 Å, from the uraninite mineral, as reported by + Tsushima et al. (2007). Percentage of (UO2)3(OH)5 adsorption (% ads) is related to N. If 100% of the adsorbed + uranium was under the form of polynuclear (UO2)3(OH)5 , N=1.33 would correspond to the U neighbours at ~3.8 Å.
125 Uranium biosorption by S. natans filaments
References
Acharya, C., Joseph, D., and Apte, S.K. (2009) Uranium sequestration by a marine cyanobacterium, Synechococcus elongatus strain BDU/75042. Bioresour. Technol. 100: 2176–2181.
Anderson, C.R. and Pedersen, K. (2003) In situ growth of Gallionella biofilms and partitioning of lanthanides and actinides between biological material and ferric oxyhydroxides. Geobiology 1: 169–178.
Ankudinov, A.L., Ravel, B., Rehr, J.J., and Conradson, S.D. (1998) Real-space multiple- scattering calculation and interpretation of x-ray-absorption near-edge structure. Phys. Rev. B 58: 7565–7576.
Bargar, J., Retmeyer, R., Lenhart, J.J., and Davis, J.A. (2000) Characterization of U(VI)- carbonato ternary complexes on hematite: EXAFS and electrophoretic mobility measurements. Geochim. Cosmochim. Acta 64: 2737–2749.
Bargar, J.R., Bernier-Latmani, R., Giammar, D.E., and Tebo, B.M. (2008) Biogenic uraninite nanoparticles and their importance for uranium remediation. Elements 4: 407–412.
Bargar, J.R., Reitmeyer, R., and Davis, J.A. (1999) Spectroscopic confirmation of Uranium(VI)-carbonato adsorption complexes on hematite. Environ. Sci. Technol. 33: 2481– 2484.
Barkay, T. and Schaefer, J. (2001) Metal and radionuclide bioremediation: issues, considerations and potentials. Curr. Opin. Microbiol. 4: 318–323.
Barkleit, A., Foerstendorf, H., Li, B., Rossberg, A., Moll, H., and Bernhard, G. (2011) Coordination of uranium(VI) with functional groups of bacterial lipopolysaccharide studied by EXAFS and FT-IR spectroscopy. Dalton Trans. 40: 9868–9876.
Beazley, M.J. (2009) Non reductive biomineralization of uranium (VI) as a result of microbial phosphatase activity. PhD thesis. Georgia Institute of Technology, USA.
126 Chapter 5
Beazley, M.J., Martinez, R.J., Sobecky, P. a, Webb, S.M., and Taillefert, M. (2007) Uranium biomineralization as a result of bacterial phosphatase activity: insights from bacterial isolates from a contaminated subsurface. Environ. Sci. Technol. 41: 5701–5707.
Beolchini, F., Pagnanelli, F., Toro, L., and Vegliò, F. (2003) Biosorption of copper by Sphaerotilus natans immobilised in polysulfone matrix: equilibrium and kinetic analysis. Hydrometallurgy 70: 101–112.
Bernier-Latmani, R., Veeramani, H., Vecchia, E.D., Junier, P., Lezama-Pacheco, J.S., Suvorova, E.I., et al. (2010) Non-uraninite products of microbial U(VI) reduction. Environ. Sci. Technol. 44: 9456–9462.
Brugge, D., de Lemos, J.L., and Oldmixon, B. (2005) Exposure pathways and health effects associated with chemical and radiological toxicity of natural uranium: a review. Rev. Environ. Health 177–193.
Carvajal, D. a., Katsenovich, Y.P., and Lagos, L.E. (2012) The effects of aqueous bicarbonate and calcium ions on uranium biosorption by Arthrobacter G975 strain. Chem. Geol. 330-331: 51–59.
Cejka, J. (1999) Infrared spectroscopy and thermal analysis of the uranyl minerals. Rev. Mineral. Geochemistry 38: 521–622.
Choudhary, S. and Sar, P. (2011) Uranium biomineralization by a metal resistant Pseudomonas aeruginosa strain isolated from contaminated mine waste. J. Hazard. Mater. 186: 336–343.
Cologgi, D.L., Speers, A.M., Bullard, B. a, Kelly, S.D., and Reguera, G. (2014) Enhanced uranium immobilization and reduction by Geobacter sulfurreducens biofilms. Appl. Environ. Microbiol.
Converti, A., Fiorito, G., Zilli, M., Lodi, A., Borgld, M. Del, and Ferraiolo, G. (1992) Magnesium uptake by Sphaerotilus natans. Bioprocess Eng. 7: 325–330.
Dias, F.F., Okrend, H., and Dondero, N.C. (1968) Calcium nutrition of Sphaerotilus growing in a continuos-flow apparatus. Appl. Environ. Microbiol. 16: 1364–1369.
127 Uranium biosorption by S. natans filaments
Dodge, C.J., Francis, a J., Gillow, J.B., Halada, G.P., Eng, C., and Clayton, C.R. (2002) Association of uranium with iron oxides typically formed on corroding steel surfaces. Environ. Sci. Technol. 36: 3504–3511.
Dunham-Cheatham, S., Rui, X., Bunker, B., Menguy, N., Hellmann, R., and Fein, J. (2011) The effects of non-metabolizing bacterial cells on the precipitation of U, Pb and Ca phosphates. Geochim. Cosmochim. Acta 75: 2828–2847.
Esposito, A., Pagnanelli, F., Lodi, A., Solisio, C., and Vegliò, F. (2001) Biosorption of heavy metals by Sphaerotilus natans: an equilibrium study at different pH and biomass concentrations. Hydrometallurgy 60: 129–141.
Florea, L., Noe-Stinson, C., Brewer, J., Fowler, R., Kearns, B.J., and Greco, A. (2011) Iron oxide and calcite associated with Leptothrix sp. biofilms within an estavelle in the upper Floridan aquifer. Int. J. Speleol. 40: 205–219.
Foerstendorf, H., Heim, K., and Rossberg, A. (2012) The complexation of uranium(VI) and atmospherically derived CO2 at the ferrihydrite-water interface probed by time-resolved vibrational spectroscopy. J. Colloid Interface Sci. 377: 299–306.
Gadd, G.M. (2004) Microbial influence on metal mobility and application for bioremediation. Geoderma 122: 109–119.
Gaudy, E. and Wolfe, R.S. (1961) Factors affecting filamentous growth of Sphaerotilus natans. Appl. Microbiol. 9: 580–584.
Gino, E., Starosvetsky, J., Kurzbaum, E., and Armon, R. (2010) Combined chemical- biological treatment for prevention/rehabilitation of clogged wells by an iron-oxidizing bacterium. Environ. Sci. Technol. 44: 3123–3129.
Gorman-Lewis, D., Elias, P.E., and Fein, J.B. (2005) Adsorption of aqueous uranyl complexes onto Bacillus subtilis cells. Environ. Sci. Technol. 39: 4906–4912.
Guillaumont, R., Fanghänel, T., Neck, V., Fuger, J., Palmer, D.A., Grenthe, I., and Rand, M.H. (2003) Update on the chemical thermodynamics of uranium, neptunium, plutonium, americium and technetium OECD Nucle. Elsevier Science Ltd, Amsterdam.
128 Chapter 5
Herbelin, A.L. and Westall, J.C. (1996) FITEQL version 3.2, a computer program for determination of chemical equilibrium constants from experimental data. Department of Chemistry, Oregon State University. Corvallis, OR 97331.
Howatson, J. and Grev, D.M. (1975) Crystal and molecular structure of uranyl acetate dihydrate. J. Inorg. Nucl. Chem. 37: 1933–1935.
Jiang, W., Saxena, A., Song, B., Ward, B.B., Beveridge, T.J., and Myneni, S.C.B. (2004) Elucidation of functional groups on gram-positive and gram-negative bacterial surfaces using infrared spectroscopy. Langmuir 20: 11433–11442.
Kazy, S.K., D’Souza, S.F., and Sar, P. (2009) Uranium and thorium sequestration by a Pseudomonas sp.: mechanism and chemical characterization. J. Hazard. Mater. 163: 65–72.
Kelly, S.D., Kemner, K.M., Fein, J.B., Fowle, D.A., Byanov, M.I., Bunker, B.A., and Yee, N. (2002) X-ray absorption fine structure determination of pH-dependent U-bacterial cell wall interactions. Geochim. Cosmochim. Acta 66: 3855–3871.
Koban, A, Geipel, G., Roßberg, A., and Bernhard, G. (2004) Uranium(VI) complexes with sugar phosphates in aqueous solution. Radiochim. Acta 92: 903–908.
Kondo, K., Takeda, M., Mashima, T., Katahira, M., Koizumi, J., and Ueda, K. (2012) Conformational analysis of an extracellular polysaccharide produced by Sphaerotilus natans. Carbohydr. Res. 360: 102–108.
Langmuir, D. (1997) Aqueous Environmental Geochemistry Prentice H. Upper Saddle River, New Jersey.
Li, P.-F., Mao, Z.-Y., Rao, X.-J., Wang, X.-M., Min, M.-Z., Qiu, L.-W., and Liu, Z.-L. (2004) Biosorption of uranium by lake-harvested biomass from a cyanobacterium bloom. Bioresour. Technol. 94: 193–195.
Li, W.-W. and Yu, H.-Q. (2014) Insight into the roles of microbial extracellular polymer substances in metal biosorption. Bioresour. Technol. 160: 15–23.
129 Uranium biosorption by S. natans filaments
Llorens, I., Untereiner, G., Jaillard, D., Gouget, B., Chapon, V., and Carriere, M. (2012) Uranium interaction with two multi-resistant environmental bacteria: Cupriavidus metallidurans CH34 and Rhodopseudomonas palustris. PLoS One 7: e51783.
Lloyd, J.R. and Renshaw, J.C. (2005) Bioremediation of radioactive waste: radionuclide- microbe interactions in laboratory and field-scale studies. Curr. Opin. Biotechnol. 16: 254– 260.
Locock, A.J. and Burns, P.C. (2003) The crystal structure of synthetic autunite,
Ca[(UO2)(PO4)]2(H2O)11. Am. Mineral. 88: 240–244.
Lodi, A., Solisio, C., Converti, A., and Borghi, M. Del (1998) Cadmium, zinc, copper, silver and chromium (III) removal from wastewaters by Sphaerotilus natans. Bioprocess Eng. 19: 197–203.
Masoud, H., Urbanik-Sypniewska, T., Lindner, B., Weckesser, J., and Mayer, H. (1991) The structure of the lipid A component of Sphaerotilus natans. Arch. Microbiol. 156: 167– 175.
McCleskey, T.M., Foreman, T.M., Hallman, E.E., Burns, C.J., and Sauer, N.N. (2001) Approaching zero discharge in uranium reprocessing: photochemical reduction of uranyl. Environ. Sci. Technol. 35: 547–551.
Mercier-Bion, F., Drot, R., Ehrhardt, J.J., Lambert, J., Roques, J., and Simoni, E. (2011) X-ray photoreduction of U(VI)-bearing compounds. Surf. Interface Anal. 43: 777–783.
Merroun, M.L., Geipel, G., Nicolai, R., Heise, K.-H., and Selenska-Pobell, S. (2003) Complexation of uranium (VI) by three eco-types of Acidithiobacillus ferrooxidans studied using time-resolved laser-induced fluorescence spectroscopy and infrared spectroscopy. Biometals 16: 331–339.
Merroun, M.L., Nedelkova, M., Ojeda, J.J., Reitz, T., Fernández, M.L., Arias, J.M., et al. (2011) Bio-precipitation of uranium by two bacterial isolates recovered from extreme environments as estimated by potentiometric titration, TEM and X-ray absorption spectroscopic analyses. J. Hazard. Mater. 197: 1–10.
130 Chapter 5
Merroun, M.L., Raff, J., Rossberg, A., Hennig, C., Reich, T., and Selenska-Pobell, S. (2005) Complexation of uranium by cells and S-layer sheets of Bacillus sphaericus JG-A12. Appl. Environ. Microbiol. 71: 5532–5543.
Mishra, B., Boyanov, M., Bunker, B. a., Kelly, S.D., Kemner, K.M., and Fein, J.B. (2010) High- and low-affinity binding sites for Cd on the bacterial cell walls of Bacillus subtilis and Shewanella oneidensis. Geochim. Cosmochim. Acta 74: 4219–4233.
Mishra, B., Boyanov, M.I., Bunker, B. a., Kelly, S.D., Kemner, K.M., Nerenberg, R., et al. (2009) An X-ray absorption spectroscopy study of Cd binding onto bacterial consortia. Geochim. Cosmochim. Acta 73: 4311–4325.
Nakajima, A. and Tsuruta, T. (2004) Competitive biosorption of thorium and uranium by Micrococcus luteus. J. Radioanal. Nucl. Chem. 260: 13–18.
Pagnanelli, F., Esposito, A., Toro, L., and Vegliò, F. (2003) Metal speciation and pH effect on Pb, Cu, Zn and Cd biosorption onto Sphaerotilus natans: Langmuir-type empirical model. Water Res. 37: 627–633.
Pagnanelli, F., Esposito, A., and Vegliò, F. (2002) Multi-metallic modelling for biosorption of binary systems. Water Res. 36: 4095–105.
Parikh, S.J., Mukome, F.N.D., and Zhang, X. (2014) ATR-FTIR spectroscopic evidence for biomolecular phosphorus and carboxyl groups facilitating bacterial adhesion to iron oxides. Colloids Surf. B. Biointerfaces 119: 38–46.
Ravel, B. and Newville, M. (2005) ATHENA, ARTEMIS, HEPHAESTUS: data analysis for X-ray absorption spectroscopy using IFEFFIT. J. Synchrotron Radiat. 12: 537–541.
Rossberg, A., Ulrich, K.-U., Weiss, S., Tsushima, S., Hiemstra, T., and Scheinostt, A.C. (2009) Identification of uranyl surface complexes on ferrihydrite: Advanced EXAFS data analysis and CD-MUSIC modeling. Environ. Sci. Technol. 43: 1400–1406.
Salome, K.R., Green, S.J., Beazley, M.J., Webb, S.M., Kostka, J.E., and Taillefert, M. (2013) The role of anaerobic respiration in the immobilization of uranium through biomineralization of phosphate minerals. Geochim. Cosmochim. Acta 106: 344–363.
131 Uranium biosorption by S. natans filaments
Seder-Colomina, M., Goubet, A., Lacroix, S., Morin, G., Ona-Nguema, G., Esposito, G., et al. (submitted article) Moderate oxygen depletion as a factor favouring the filamentous growth of Sphaerotilus natans.
Seder-Colomina, M., Morin, G., Benzerara, K., Ona-Nguema, G., Pernelle, J.-J., Esposito, G., and van Hullebusch, E.D. (2014) Sphaerotilus natans, a neutrophilic iron-related sheath- forming bacterium: perspectives for metal remediation strategies. Geomicrobiol. J. 31: 64–75.
Sheng, L. and Fein, J.B. (2013) Uranium adsorption by Shewanella oneidensis MR-1 as a function of dissolved inorganic carbon concentration. Chem. Geol. 358: 15–22.
Sheng, L., Szymanowski, J., and Fein, J.B. (2011) The effects of uranium speciation on the rate of U(VI) reduction by Shewanella oneidensis MR-1. Geochim. Cosmochim. Acta 75: 3558–3567.
Shi, W., Zhou, Y., Zhang, Y., Li, L., and Yang, Q. (2012) Synthesization, characterization and adsorption properties of sulfonic cellulose. Water Sci. Technol. 66: 2638–2646.
Singh, A., Catalano, J.G., Ulrich, K.-U., and Giammar, D.E. (2012) Molecular-scale structure of uranium(VI) immobilized with goethite and phosphate. Environ. Sci. Technol. 46: 6594–6603.
Suzuki, T., Kanagawa, T., and Kamagata, Y. (2002) Identification of a gene essential for sheathed structure formation in Sphaerotilus natans, a filamentous sheathed bacterium. Appl. Environ. Microbiol. 68: 365–371.
Takeda, M., Miyanoiri, Y., Nogami, T., Oda, K., Saito, T., Kato, K., et al. (2007) Structural analysis of the fundamental polymer of the sheath constructed by Sphaerotilus natans. Biosci. Biotechnol. Biochem. 71: 2992–2998.
Takeda, M., Nakamori, T., Hatta, M., Yamada, H., and Koizumi, J.-I. (2003) Structure of the polysaccharide isolated from the sheath of Sphaerotilus natans. Int. J. Biol. Macromol. 33: 245–250.
132 Chapter 5
Takeda, M., Nakano, F., Nagase, T., Iohara, K., and Koizumi, J. (1998) Isolation and chemical composition of the sheath of Sphaerotilus natans. Biosci. Biotechnol. Biochem. 62: 1138–1143.
Teo, B.K. (1986) EXAFS: Basic principles and data analysis. Inorganic Chemistry Concepts 9. Springer Berlin Heidelberg, Berlin.
Tsushima, S., Ikeda, A., Mu, K., and Scheinost, A.C. (2007) Stoichiometry and Structure of Uranyl (VI) hydroxo dimer and trimer complexes in aqueous solution. 46: 10819–10826.
Waite, T.D., Davis, J. a., Payne, T.E., Waychunas, G. a., and Xu, N. (1994) Uranium(VI) adsorption to ferrihydrite: Application of a surface complexation model. Geochim. Cosmochim. Acta 58: 5465–5478.
WHO (2005) Uranium in drinking-water World Health Organization.
Xie, S., Yang, J., Chen, C., Zhang, X., Wang, Q., and Zhang, C. (2008) Study on biosorption kinetics and thermodynamics of uranium by Citrobacter freudii. J. Environ. Radioact. 99: 126–133.
133
CHAPTER 6
General overview and Perspectives
General overview and Perspectives
6.1. General overview
Bioremediation techniques are based on the use of microorganisms for the restoration and attenuation of polluted ecosystems. However, field application of such methods relies on the fundamental knowledge of the processes governing the bioavailability, speciation and scavenging of such pollutants. In this context, two choices have to be made when starting a new investigation: 1) the pollutant and 2) the microorganism.
The present PhD thesis was focused on uranium scavenging at near-neutral pH, as this radionuclide presents harmful effects to human beings and natural ecosystems (Brugge et al., 2005). Furthermore, this study focused specifically on the scavenging of U(VI) as this oxydation state is very problematic in the environment due to its particularly elevated solubility (Langmuir, 1997). In addition, the choice of Sphaerotilus natans was based on the particularities of this strain: dual morphotype growth (single cells vs filaments), ability to grow easily at lab scale, close relationship with iron (Park et al., 2014) and previous use as biosorbent for heavy metals (Seder-Colomina et al., 2014). These positive preliminarily information made it a good candidate to perform laboratory studies that would shed light on the processes of uranium scavenging under circumneutral pH by filamentous sheath-forming bacteria.
Microorganisms have great potential for bioremediation; however, different growth forms exist and they have different consequences when hypothetically applied to field situations. Basically, three different growth forms are known: 1) planktonic single cells, 2) planktonic filaments and 3) attached biofilms (formed either by single cells or filaments, depending on the bacterial species). Planktonic forms live free in their environment; in contrast, biofilms are a natural way of attachment to any kind of surfaces. For instance, there are dental biofilm (Martinhon et al., 2006), Pseudomonas aeruginosa biofilm (Wei and Ma, 2013), Gallionella biofilm (Anderson and Pedersen, 2003), Leptothrix biofilm (Florea et al., 2011), S. natans biofilm (Gino et al., 2010). In the case of planktonic cells, they need to be immobilized in gelly-like matrixes when applied for bioremediation purposes, which requires an extra economic cost to the process. In contrast, as bacteria forming biofilms grow naturally attached to the different carriers, such economic cost is reduced. In this PhD work, sheath-forming filamentous bacterium S. natans was in the focus of interest not only due to the potential
135 Chapter 6 advantages provided by their physiology (sheath formation, surface area, functional groups, mechanisms of attachment, EPS distribution...) but also to the ability to form biofilm.
6.2. Discussion and conclusions
The integrated approach developed here was based on three different axes:
1. Fundamental knowledge of S. natans filamentation 2. S. natans to immobilize iron phosphate particles scavenging U(VI) 3. Biosorption of U(VI) onto S. natans filaments
6.2.1. Fundamental knowledge of S. natans filamentation
In order to study the use of S. natans filaments for U(VI) removal, it was necessary to master the culture conditions to produce the desired biomass. In this context, studying the physiology of S. natans to elucidate factors affecting its filamentous growth was crucial. However, a reliable technique was needed to quantify independently the two growth morphologies of S. natans (single cells and filaments). In this PhD work a new method based on the physical separation of both morphologies coupled with the qPCR-based quantification was developed. In addition, specific set of qPCR primers (sthA) was designed in order to corroborate the results, discarding any possible confusion due to morphotype similarities of bacteria that could happen if using only microscopy analyses (specially for the single cell form). In addition, to confirm the suitability of this new method, the strain-specificity of qPCR primers sthA was tested against different species of the same and closely related genera.
Results indicated that sthA primers amplify specifically S. natans DNA, making it possible to quantify S. natans biomass by means of the sthA number of copies without any doubt of bacterial identity. The first factor assessed for S. natans filamentation was oxygen, i.e. dissolved oxygen concentration in the culture media. It was chosen after the observation in wastewater treatment plants of bulking episodes associated to oxygenation problems and attributed to S. natans filamentous growth. The experiments in this PhD thesis showed that when S. natans is cultivated under fully saturated oxygen conditions, it grows under the single cell form. In contrast, when oxygen availability is not controlled, a decrease to concentrations -1 of ~3 mg O2.L lead to sheath formation and thus filamentous growth of S. natans.
136 General overview and Perspectives
In this first part of the PhD thesis:
• A method to quantify independently both growth forms of S. natans was developed. • The effect of oxygen on S. natans filamentation from single cells was demonstrated. • The culture conditions to produce S. natans filamentous biomass were mastered, which was an essential requirement to proceed with experiments of U(VI) scavenging by S. natans.
6.2.2. S. natans to immobilize iron phosphate particles scavenging U(VI)
Iron minerals are widely reported to be good scavengers of heavy metals and radionuclides, either when abiotically precipitated (e.g. Moyes et al. 2000) or in association with microorganisms. Neutrophilic sheath- and stalk-forming filamentous microorganisms such as Leptothrix or Gallionella forming natural biofilms recovered in BIOS have been reported for scavenging inorganic pollutants such as I, Sr, As, Cd, etc. (Katsoyiannis and Zouboulis, 2002; Martinez et al., 2004; Langley et al., 2009; Kennedy et al., 2011). Unfortunately, these microorganisms can hardly grow under laboratory conditions. S. natans (phylogenetically related to Leptothrix (Mulder and van Veen, 1963) has also a close relationship with iron (Park et al., 2014) and same sheath-structured filaments as Leptothrix; therefore, it was highly suitable as a model bacterium to study the scavenging of uranium by BIOS under laboratory conditions. Several authors have suggested that iron minerals formed in the presence of bacteria under laboratory conditions as well as in natural environments may depend on the chemical composition of the media (Shopska et al., 2012). In this study, the complex media recommended to grow S. natans (containing yeast extract and casitone) was of unknown chemical composition. It was therefore difficult to predict in advance the chemical nature of BIOS, which determines the reactivity and efficiency of the uranium scavenging process.
Therefore, it was crucial to identify the chemical nature of the iron minerals formed in the presence of S. natans filaments. In addition, an abiotic synthesis of such precipitates was performed to elucidate the role and implication of S. natans in the process. XAS analyses at the Fe K-edge showed that such BIOS were indeed not iron oxides but iron phosphates. This has important implications regarding the reactivity and potential of such material in the
137 Chapter 6 scavenging of inorganic pollutants. In addition, chemical analogues presented the same mineralogy, evidencing that the presence of S. natans filaments did not influence the nature of the mineral but its mobility. EXAFS at the U LIII-edge revealed that the molecular environment of U(VI) when trapped by both materials was very similar. However, abiotic iron phosphate particles trapping uranium remained in suspension and media need to be filtered at the end of the process. In contrast, when those particles were attached to S. natans biofilm, uranium was directly removed from solution, saving the filtration step and therefore reducing the costs of U(VI) removal.
In this second part of the PhD:
• The nature of BIOS and abiotic analogues was identified as amorphous iron phosphates, which present high reactivity for the scavenging of inorganic pollutants. • The coordination chemistry of U(VI) when coprecipitated with abiotic and biotic samples was determined. • S. natans filaments and biofilm mediated the immobilization of U(VI) scavenging iron phosphate particles, avoiding extra costs of artificial immobilization and suggesting the potential of using S. natans biofilms for bioremediation purposes.
6.2.3. Biosorption of U(VI) onto S. natans filaments
Uranium biosorption has been reported for different bacteria (e.g. Fowle et al., 2000; Kelly et al., 2001; Sheng and Fein, 2013) but in all cases the microorganisms studied grew under planktonic single cell form. For this reason, studying U(VI) biosorption onto S. natans filaments was of major interest. Moreover, complex uranium speciation as a function of pH (especially challenging at near-neutral pH conditions) and its implications in the biosorption processes has been in the edge of attention during the past years (Gorman-Lewis et al., 2005; Beazley et al., 2011; Sheng et al., 2011). In addition, although several studies have focused on the potential of S. natans in the scavenging of heavy metals (e.g. Esposito et al., 2001; Pagnanelli et al., 2004), none of those investigations considered the dual morphotype of S. natans. After the results achieved in the first part of this PhD work demonstrating that S. natans growth morphotype depends on environmental factors, the information available nowadays about S. natans biosorption might be revised.
138 General overview and Perspectives
The multidisciplinary approach developed here, using different experimental techniques combined with mathematical modelling of surface complexation and uranium speciation, shed light into the mechanisms governing U(VI) biosorption by filamentous bacteria. Indeed, U(VI) scavenging by S. natans filaments was confirmed by using SEM-EDXS microscopy. Furthermore, functional groups involved in the scavenging of U(VI) were investigated by using ATR-FTIR and EXAFS at U LIII-edge. These techniques revealed that in the surface of S. natans filaments the functional groups participating in the scavenging of uranium were principally carboxyl and phosphoryl groups. Uranium adsorption isotherms performed over a range of 5 log units of U concentration data was analyzed using Visual MINTEQ for uranium speciation as a function of pH and FITEQL for surface complexation modelling. The model revealed that carboxyl groups drive uranium complexation at pH 5.5 while phosphoryl groups controlled uranium sorption at pH 7. Moreover, UO2OH+ has been identified as the principal uranium species sorbed onto S. natans filaments at both pHs.
In this third part of the PhD:
• Phosphoryl and carboxyl groups were identified as the main functional groups involved in the scavenging of U(VI) by S. natans filaments. • U(VI) coordination to such functional groups from the surface of S. natans filaments was determined. • Surface complexation model developed described U(VI) biosorption onto S. natans as a function of pH.
6.3. Perspectives
6.3.1. Filamentation of S. natans
The method developed in this PhD work is highly suitable for the evaluation of factors affecting the filamentous growth of S. natans. Studying sheath formation and filamentation is crucial to better understand mechanisms of biomineralization as sheath may provide a nucleation surface for mineral precipitation (Fortin and Langley, 2005). In addition, EPS synthesis may vary depending on the filamentation conditions. Since it has been shown to play a key role in the scavenging of inorganic pollutants (Li and Yu, 2014), mastering culture conditions that affect EPS production is also very interesting. In addition to changes in the physiology of the bacterium, gene expression can be also modified depending on the growth
139 Chapter 6 conditions (Suzuki et al., 2002). In this context, four different sets of experiments are currently under study to:
1. Complete the evaluation of oxygen as a factor affecting filamentation
Bioreactor studies at laboratory scale (volume 2 to 5 L) are being used to determine the oxygen threshold inducing the filamentous growth of S. natans and to study the reversibility of this phenomenon.
2. Investigate the effect of iron on filamentous growth
The qPCR-based method developed during this PhD has been used to study filamentous growth from single cells in the presence of iron. Preliminary results indicate that iron may induce S. natans filamentation even under oxygen-saturated conditions. This study is motivated by the recent observations of S. natans bulking episodes on a river polluted by a fish farm effluent increasing slightly the iron concentration.
3. Explore the effect of uranium on filamentous growth
Since the filamentous growth form of S. natans is potentially the most interesting morphotype for the recovery of inorganic pollutants, it is important to know if only the presence of the pollutant, i.e. U(VI) in our study, can trigger the desirable growth form.
4. Study gene expression of S. natans under such changing conditions (O2, Fe, U, etc.)
Reverse Transcription qPCR will be used to separately quantify the RNA of S. natans present in filaments and single cells, using the same filtration procedure as for sthA-qPCR. It will be possible to correlate the physiological changes observed under varying environmental conditions with the transcriptom of this microorganism.
6.3.2. Role of iron phosphate-mediated scavenging of inorganic pollutants
Amorphous iron phosphate particles described in this PhD thesis have great potential for heavy metal and radionuclide scavenging due to the high reactivity associated to their
140 General overview and Perspectives mineralogy. Furthermore, their impact in natural ecosystems needs to be evaluated as they could be more frequent in the environment that it was initially thought. In addition, S. natans filaments and especially biofilms have been used here as a natural immobilization agent for iron phosphate particles, suggesting that artificial immobilization techniques such as the use of carrier materials or filtration methods traditionally necessaries in physicochemical treatments (Hua et al., 2012; Xu et al., 2012) could be minimized. These findings set the fundamental bases for new research to:
1. Evaluate amorphous iron phosphate potential as scavenger
A systematic study of heavy metals and radionuclides scavenging by iron phosphate particles is of urgent interest. Abiotic as well as biotic experiments are required to compare the reactivity of such particles and ferrihydrite, until now the most frequent poorly-ordered iron mineral used for inorganic pollutant scavenging.
2. Investigate U(VI) removal by iron phosphates attached to S. natans at larger scale
S. natans biofilm presented good performance when used to immobilize iron- bearing particles and uranium. In this context, uranium removal at larger scale by iron phosphates immobilized in a S. natans biofilm reactor should be further investigated.
6.3.3. Uranium relationship with S. natans
Biosorption studies based on experimental as well as on modelling data presented in this PhD demonstrated that S. natans filaments have high affinity for U(VI), interestingly also under neutrophilic conditions, due to the specific functional groups present on their surface. However, as seen in filamentation studies, mastered culture conditions controlling the dual morphotype of S. natans open new questions to:
1. Evaluate the differences in U(VI) biosorption for S. natans single cells vs filaments
The work presented here demonstrates that S. natans morphotype can be changed depending on the environmental conditions. Therefore, uranium scavenging should be investigated for both growth morphotypes, considering the potential differences in functional groups (identity and concentration) and thus in affinity constants.
141 Chapter 6
2. Investigate U(VI) scavenging mechanisms
Biosorption is the main scavenging mechanism under these particular conditions but several microorganisms have been reported to retain U(VI) through complexation as well as due to biomineralization of U(VI)-phosphates (with inorganic phosphorus released after enzymatic activity of bacteria) (Beazley, 2009; Salome et al., 2013). Such alternative mechanism of U(VI) removal should be investigated for S. natans.
3. Study U(VI) removal by S. natans biofilms
U(VI) removal under circumneutral pH remains a challenge due to the chemical speciation of uranium and its high solubility. In this context, abitily of S. natans to form stable biofilms and the good affinity of S. natans for U(VI) should stimulate further research at larger scale using biofilm reactors.
142 General overview and Perspectives
References
Anderson, C.R. and Pedersen, K. (2003) In situ growth of Gallionella biofilms and partitioning of lanthanides and actinides between biological material and ferric oxyhydroxides. Geobiology 1: 169–178.
Beazley, M.J. (2009) Non reductive biomineralization of uranium (VI) as a result of microbial phosphatase activity. PhD Thesis. Georgia Institute of Technology, USA.
Beazley, M.J., Martinez, R.J., Webb, S.M., Sobecky, P. a., and Taillefert, M. (2011) The effect of pH and natural microbial phosphatase activity on the speciation of uranium in subsurface soils. Geochim. Cosmochim. Acta 75: 5648–5663.
Brugge, D., de Lemos, J.L., and Oldmixon, B. (2005) Exposure pathways and health effects associated with chemical and radiological toxicity of natural uranium: a review. Rev. Environ. Health 20: 177–193.
Esposito, A., Pagnanelli, F., Lodi, A., Solisio, C., and Vegliò, F. (2001) Biosorption of heavy metals by Sphaerotilus natans: an equilibrium study at different pH and biomass concentrations. Hydrometallurgy 60: 129–141.
Florea, L., Noe-Stinson, C., Brewer, J., Fowler, R., Kearns, B.J., and Greco, A. (2011) Iron oxide and calcite associated with Leptothrix sp. biofilms within an estavelle in the upper Floridan aquifer. Int. J. Speleol. 40: 205–219.
Fortin, D. and Langley, S. (2005) Formation and occurrence of biogenic iron-rich minerals. Earth-Science Rev. 72: 1–19.
Fowle, D.A., Fein, J.B., and Martin, A.M. (2000) Experimental study of uranyl adsorption onto Bacillus subtilis. 34: 3737–3741.
Gino, E., Starosvetsky, J., Kurzbaum, E., and Armon, R. (2010) Combined chemical- biological treatment for prevention/rehabilitation of clogged wells by an iron-oxidizing bacterium. Environ. Sci. Technol. 44: 3123–3129.
143 Chapter 6
Gorman-Lewis, D., Elias, P.E., and Fein, J.B. (2005) Adsorption of aqueous uranyl complexes onto Bacillus subtilis cells. Environ. Sci. Technol. 39: 4906–4912.
Hua, M., Zhang, S., Pan, B., Zhang, W., Lv, L., and Zhang, Q. (2012) Heavy metal removal from water/wastewater by nanosized metal oxides: A review. J. Hazard. Mater. 211- 212: 317–331.
Katsoyiannis, I.A. and Zouboulis, A.I. (2002) Removal of arsenic from contaminated water sources by sorption onto iron-oxide-coated polymeric materials. Water Res. 36: 5141–55.
Kelly, S.D., Boyanov, M.I., Bunker, B.A., Fein, J.B., Fowle, D.A., Yee, N., and Kemner, K.M. (2001) XAFS determination of the bacterial cell wall functional groups responsible for complexation of Cd and U as a function of pH. J. Synchrotron Radiat. 8: 946–948.
Kennedy, C.B., Gault, a. G., Fortin, D., Clark, I.D., and Ferris, F.G. (2011) Retention of iodide by bacteriogenic iron oxides. Geomicrobiol. J. 28: 387–395.
Langley, S., Gault, A.G., Ibrahim, A., Takahashi, Y., Renaud, R., Fortin, D., et al. (2009) Sorption of strontium onto bacteriogenic iron oxides. Environ. Sci. Technol. 43: 1008–1014.
Langmuir, D. (1997) Aqueous Environmental Geochemistry Prentice H. Upper Saddle River, New Jersey.
Li, W.-W. and Yu, H.-Q. (2014) Insight into the roles of microbial extracellular polymer substances in metal biosorption. Bioresour. Technol. 160: 15–23.
Martinez, R.E., Pedersen, K., and Ferris, F.G. (2004) Cadmium complexation by bacteriogenic iron oxides from a subterranean environment. J. Colloid Interface Sci. 275: 82– 89.
Martinhon, C.C.R., Italiani, F.D.M., Padilha, P.D.M., Bijella, M.F.T.B., Delbem, A.C.B., and Buzalaf, M.A.R. (2006) Effect of iron on bovine enamel and on the composition of the dental biofilm formed “in situ”. Arch. Oral Biol. 51: 471–475.
Moyes, L.N., Parkman, R.H., Charnock, J.M., Vaughan, D.J., Livens, F.R., Hughes, C.R., and Braithwaite, A. (2000) Uranium uptake from aqueous solution by interaction with
144 General overview and Perspectives goethite, lepidocrocite, muscovite, and mackinawite: An X-ray Absorption Spectroscopy study. Environ. Sci. Technol. 34: 1062–1068.
Mulder, E.G. and van Veen, W.L. (1963) Investigations on the Sphaerotilus-Leptothrix group. Antoine van Leeuwenhoek 29: 121–153.
Pagnanelli, F., Beolchini, F., Di Biase, A., and Vegliò, F. (2004) Biosorption of binary heavy metal systems onto Sphaerotilus natans cells confined in an UF/MF membrane reactor: dynamic simulations by different Langmuir-type competitive models. Water Res. 38: 1055– 1061.
Park, S., Kim, D.-H., Lee, J.-H., and Hur, H.-G. (2014) Sphaerotilus natans encrusted with nanoball-shaped Fe(III) oxide minerals formed by nitrate-reducing mixotrophic Fe(II) oxidation. FEMS Microbiol. Ecol. 90: 1–10.
Salome, K.R., Green, S.J., Beazley, M.J., Webb, S.M., Kostka, J.E., and Taillefert, M. (2013) The role of anaerobic respiration in the immobilization of uranium through biomineralization of phosphate minerals. Geochim. Cosmochim. Acta 106: 344–363.
Seder-Colomina, M., Morin, G., Benzerara, K., Ona-Nguema, G., Pernelle, J.-J., Esposito, G., and van Hullebusch, E.D. (2014) Sphaerotilus natans, a neutrophilic iron-related sheath- forming bacterium: perspectives for metal remediation strategies. Geomicrobiol. J. 31: 64–75.
Sheng, L. and Fein, J.B. (2013) Uranium adsorption by Shewanella oneidensis MR-1 as a function of dissolved inorganic carbon concentration. Chem. Geol. 358: 15–22.
Sheng, L., Szymanowski, J., and Fein, J.B. (2011) The effects of uranium speciation on the rate of U(VI) reduction by Shewanella oneidensis MR-1. Geochim. Cosmochim. Acta 75: 3558–3567.
Shopska, M., Cherkezova-Zheleva, Z.P., Paneva, D.G., Iliev, M., Kadinov, G.B., Mitov, I.G., and Groudeva, V.I. (2012) Biogenic iron compounds: XRD, Mossbauer and FTIR study. Cent. Eur. J. Chem. 11: 215–227.
Suzuki, T., Kanagawa, T., and Kamagata, Y. (2002) Identification of a gene essential for sheathed structure formation in Sphaerotilus natans, a filamentous sheathed bacterium. Appl. Environ. Microbiol. 68: 365–371.
145 Chapter 6
Wei, Q. and Ma, L.Z. (2013) Biofilm matrix and its regulation in Pseudomonas aeruginosa. Int. J. Mol. Sci. 14: 20983–21005.
Xu, P., Zeng, G.M., Huang, D.L., Feng, C.L., Hu, S., Zhao, M.H., et al. (2012) Use of iron oxide nanomaterials in wastewater treatment: a review. Sci. Total Environ. 424: 1–10.
146
Appendix 1: Valorization of the PhD research work
Papers
Seder-Colomina, M., Morin, G., Benzerara, K., Ona-Nguema, G., Pernelle, J-J., Esposito, G. and Van Hullebusch, E.D. (2014) Sphaerotilus natans, a neutrophilic iron-related sheath- forming bacterium: perspectives for metal remediation strategies. Geomicrobiol. J. 31: 64-75. DOI: 10.1080/01490451.2013.806611
Seder-Colomina, M., Goubet, A., Lacroix, S., Morin, G., Ona-Nguema, G., Esposito, G., Van Hullebusch, E.D. and Pernelle, J-J. (2014) Moderate oxygen depletion as a factor favouring the filamentous growth of Sphaerotilus natans. Journal of Applied Microbiology, Submitted.
Seder-Colomina, M., Morin, G., Brest, J., Ona-Nguema, G., Gordien, N., Pernelle, J-J., Van Hullebusch, E.D. and Mathon, O. (2014) Uranium (VI) scavenging by amorphous iron phosphate encrusting Sphaerotilus natans filaments. Environmental Science and Technology, To be submitted.
Seder-Colomina, M., Morin, G., Gélabert, A., Ardo, S., Ona-Nguema, G., Pernelle, J-J., Van Hullebusch, E.D. (2014) Uranium (VI) biosorption by Sphaerotilus natans filaments: An integrated approach. Geochimica et Cosmochimica Acta, To be submitted.
Jain, R., Seder-Colomina, M., Jordan, N., Cosmidis, J., Van Hullebusch, E.D., Weiss, S., Dessia, P., Farges, F., Lens, P.N.L. (2014) Entrapped elemental selenium nanoparticles increases settleablity and hydrophilicity of activated sludge. Journal of Hazardous Materials, To be submitted.
Conferences
Seder-Colomina M, van Hullebusch ED, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G (June 2013) Iron biomineralization by a neutrophilic Leptothrix-like sheath- forming bacterium. FIMIN Conference 2013 - Iron Biogeochemistry, From Molecular Processes to Global Cycles (Ascona, Switzerland). Poster presentation.
147 Appendix 1
Pernelle J-J, Seder-Colomina M, Goubet A, Benzerara K, Ona-Nguema G, Lacroix S, van Hullebusch ED, Morin G (March 2013) Differential molecular-based monitoring of the filamentous growth of Sphaerotilus natans. 12th Symposium on Bacterial Genetics and Ecology - BAGECO (Ljubljana, Slovenia). Poster presentation.
Summerschool presentations
Seder-Colomina M, Morin G, Ona-Nguema G, Pernelle J-J, Esposito G, van Hullebusch ED (July 2014) Filamentous growth of neutrophilic bacterium Sphaerotilus natans and its role in the scavenging of inorganic pollutants. Summer school on Biological Treatment of Solid Waste. University of Cassino and Southern Lazio (Cassino, Italy). Oral presentation.
Seder-Colomina M, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G, van Hullebusch ED (June 2013) Factors affecting iron biomineralization and filamentous growth of neutrophilic bacterium Sphaerotilus natans. Summer school on Contaminated Sediments: characterization and remediation. UNESCO-IHE (Delft, The Netherlands). Oral presentation.
Seder-Colomina M, van Hullebusch ED, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G (June 2012) Mechanisms of iron biomineralization by neutrophilic bacteria. Influence on inorganic pollutant scavenging. Summer school on Contaminated Soils: from characterization to remediation, Université Paris-Est (Champs-sur-Marne, France). Oral presentation.
Seminars
Seder-Colomina M, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G, van Hullebusch ED (January 2014) Factors affecting filamentous growth and iron biomineralization by Sphaerotilus natans as model bacterium. PhD Day, Université Paris-Est (Champs-sur-Marne, France). Oral presentation.
Seder-Colomina M, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G, van Hullebusch ED (April 2013) Factors affecting iron biomineralization and filamentous growth of neutrophilic bacterium Sphaerotilus natans. PhD Day, Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France). Oral presentation.
148 Appendix 1
Seder-Colomina M, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G, van Hullebusch ED (January 2013) Mechanisms of iron biomineralization by neutrophilic bacteria. Influence on inorganic pollutant scavenging. PhD Day, PhD Day, Université Paris- Est (Champs-sur-Marne, France). Oral presentation.
Seder-Colomina M, Morin G, Benzerara K, Ona-Nguema G, Pernelle J-J, Esposito G, van Hullebusch ED (April 2012) Mechanisms of iron biomineralization by neutrophilic bacteria. Influence on inorganic pollutant scavenging. PhD Day, Institut de Minéralogie, de Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France). Poster presentation.
Divers
Co-organization of the PhD Day at the Université Paris-Est. January 2013. Université Paris-Est (Champs-sur-Marne, France).
Co-supervision of a MSc student and her project “Spéciation de l’uranium dans les sédiments lacustres: Synthèse et analyse de composés modèles”. March – July 2013. Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France).
149
Appendix 2: Activities during the PhD
Academic courses
• Advanced Applied Engineering Mathematics: Prof. Luigi Frunzo, University of Naples Federico II. March – June 2014. University of Naples Federico II (Naples, Italy). • Water and Soil Treatment Technologies: Prof. Virender Sharma, Florida Institute of Technology, USA. May 2013. Université Paris-Est (Champs-sur-Marne, France). • Wastewater treatment Technologies and Modelling: Prof. Giovanni Esposito, University of Cassino and Southern Lazio, Italy. June 2012. Université Paris-Est (Champs-sur-Marne, France).
Scientific communication courses
• Write Right - Rédaction et structuration de l'article scientifique. October 2013. AgroParisTech (Paris, France). • Poster power - Préparation de posters. February 2013. AgroParisTech (Paris, France). • Communiquer sur sa thèse: l'exposé oral efficace. November 2012. AgroParisTech (Paris, France).
Laboratory courses
• Microscopie électronique à Balayage. November 2013. Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France). • Manipulation en boîte à gants. December 2012. Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France). • Initiation à la microscopie électronique en transmission: alignement et techniques de base. May 2012. Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France).
Scientific Divulgation
• Fête de la Science (2012). Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France).
150 Appendix 2
• Fête de la Science (2013). Institut de Minéralogie, Physique des Matériaux et de Cosmochimie – IMPMC (Paris, France).
151