Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. uemNoh Pureum (Hymenoptera: Myrmicinae) emeryi Vollenhovia and in polymorphism infection Wolbachia morphology wing host between Association ui,21) ti oyopi o omlln n bratsotwn eghi ues h w morphs two The queens. in length wing short aberrant & Wright and 2015; long Booher, normal & for Guenard, polymorphic Wetterer, 2007; is Suman, It & 2011). (Kjar & America Kubik, Peeters North invaded 2012; has Peeters, species this 1991; Peeters, a 1991). a 1995; emeryi not Villet, Tsuji, play Vollenhovia is 1992; & wing wings Heinze, Heinze the & ants, However, 1992; Tinaut In 2001; Heinze, success. Ito, & breeding with (Buschinger 1986). and associated subfamilies (Roff, dispersal all phenotype insects determines principal non which in qua the flight, strategies sine nuptial is used reproductive in morph be symbiotic role and wing and can salient distribution, strategy, traits, analyses reproductive dispersal, secondary these phenotype, direct Furthermore, Among as such selection. traits communities. secondary and bacterial between flow, including relationships populations, gene evaluate about diversity, to information genetic extensive provide distribution, data genetic genetic using analyses structure Population morph. L the Introduction from derived is morph to S resistance the potential that with reproduction. revealed associated clonal analysis is influence phylogenetic morph not Interestingly, S A the rare. Cytb). trait. that very phenotypic and propose is We a morph COII, and (S) (COI, symbiont short-winged genes with the a mitochondrial infected and between in-depth three were populations, performed using We Korean morphs America in L traits. predominant North all polymorphic is and and morph Japan, of mode (L) structure Korea, reproductive long-winged and from unique The dynamics its populations population into ant the insight about of the provide known in analyses may is polymorphism which little length arise wing importance, species, a workers evolutionary ant ant is and sterile this there the ecological Furthermore, while its In clonally, general. Despite in produced strategies. caste. insects are Hymenopteran queen reproductive and males and species and ant distributions, queens other unlike structures, Myrmicinae), sexually, colony (Hymenoptera: complex Wheeler show emeryi ants, Vollenhovia including insects, eusocial Many Abstract 2020 5, May 6 5 4 3 2 1 Choe Chun ainlIsiueo Ecology of Institute National University Konkuk Institute Research Forest Korea Sciences available Biological not of Affiliation School University National Seoul University Womans Ewha 3 nsvrlseis igesesadwn euto nrpoutv nsaewdsra across widespread are ants reproductive in reduction wing and Winglessness species. several in n isn Jeong Gilsang and , 1 en-onOh Seung-Yoon , hee Hmnpea ymcne sacmo n pce nei oEs Asia; East to endemic species ant common a is Myrmicinae) (Hymenoptera: Wheeler Wolbachia 2 hl l oenSmrh lacked morphs S Korean all while , oenPark Soyeon , 6 1 3 asn Kwon Taesung , Wolbachia Wolbachia neto,adthat and infection, 4 ogwnKim Yonghwan , eosrtn oe association novel a demonstrating , Wolbachia 5 Jae , neto does infection Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. rmrstWpc,R(ern&Wnsr 00 tteaporaeanaigtmeaue(al ) To 1). (Table temperature annealing appropriate the at 2000) Windsor, & (Werren 72 R at WspecF, min of set mitochondrial 1–2 status primer three 95 temperature, infection the at targeting annealing the min sets each 3 examine for primer at denaturation The min follows: 1. 1 as Table was in profile listed for temperature are the specific analyses between were for relationship genes used the sets investigate (Kobayashi primer similarity to forms The genetic chosen sexual morph. were mitochondrial S four on genes the the based and mitochondrial while The similarity, morph type Therefore, relationships. L genetic wing 2011). genetic nuclear to mitochondrial 2008, its according from al., by groups different et two morphs are wing into male) other two divided S of from forms were and distinguished sexual queen, was among S queen relationships male, genetic S L nuclear the queen, that manufacturer’s (L revealed morphs the 2011) -20 to (2008, at al. according kept et Germany), Kobayashi was Hilden, DNA of Kit, genomic Tissue body extracted and The whole Blood instructions. the DNeasy (Qiagen from kit extracted commercial was 1–3 DNA analyses, genetic Genomic For trees. PCR rotten forests, and species of EtOH. or extraction ant bark 100% mountains this the DNA in were Since under sacrificed sites found S1). were were collection (Table colony colonies the States per sampled wood, United of individuals the rotten number in in large one particularly a and conditions, and Japan, moist in in eight lives Korea, usually South in locations of 65 colonies or individuals Either of Collection morphs; methods winged two population & the Materials the of 1) time divergence examine approximate to the were and 3) of Japan; study ubiquity and the this Korea 4) of from of morphs aims genes winged mitochondrial specific two the The of structure biology. genetic population of and Stouthamer, importance evolutionary 2008; distribution and Suh, ecological & feminization, the Jeong incompatibility, Despite 2004; induces cytoplasmic Sasaki, Infection including 1999). & 2014). Hurst, Ishikawa, host, Hammerstein, & 2016; Kubo, the & Breeuwer, (Fujii, Ballard, in Zug, parthenogenesis & 2005; Moreau, alterations and Correa Gross, & reproductive male-killing, & 2008; Russell, of Stoll, Miller, Rubin, Feldhaar, types Kautz, & , various Zientz 2008; (Bourtzis, 1997; Werren, arthropods Werren, & other 2013; Telschow, and Schlattmann, selfish ants) Hammerstein, a (including Hilgenboecker, by insects infection as to such due be genetically might to The system 2004). rise Stouthamer reproductive crazy giving & unusual longhorn thereby (Jeong invasive an sex, manipulator highly Such opposite reproductive the the in lineages. by some and contamination clonal in 2005) genetic homogeneous found allowing al., first without et evolve Fournier system might 2006; the al., to & et similar Foucaud Trindl, ant very 2007; Satoh, is al., ant Nakayama, system et fire Ohkawara, Foucaud little workers reproduction ant the sterile 2011; clonal other while of unusual 2008, Unlike clonally, populations This Ohkawara, produced monogynous, 1994). are & 2006). typically males Yamauchi, Hasegawa, are Heinze, and & (Kobayashi, morph queens (Kinomura (L) general, sexually polygynous long-winged in arise insects the are Hymenopteran of colonies and colonies morph and species (S) nature, in short-winged coexist while to thought not are Wolbachia aarcialongicornis Paratrechina Wolbachia .emeryi V. infection. atru samtral-neie noybotta net ievreyo invertebrates of variety wide a infects that endosymbiont maternally-inherited a is bacterium Wolbachia .emeryi V. samples Pac,Goimn elr 01.Sls lnlrpouto nbt sexes both in reproduction clonal Selfish 2011). Keller, & Goodisman, (Pearcy, neto natseis n )ptnilrltosisbtenhs phenotype host between relationships potential 5) and species; ant in infection Wolbachia amni auropunctata Wasmannia .emeryi V. ecpin eePtfrCIad2v n 82frCI) h PCR The COII). for r8v2 and 21v2 and COI for Pat were (exceptions igotcPRwspromduigthe using performed was PCR diagnostic , eecletdfo 4lctosbten21–03 including 2010–2013, between locations 74 from collected were .emeryi V. 2 ° .emeryi V. ,adafia xeso tpa 72 at step extension final a and C, .emeryi V. ° )tepyoegahcrltosisaogthe among relationships phylogeographic the 2) ; Fuad sop osa,Ry rvl 2010; Orivel, & Rey, Loiseau, Estoup, (Foucaud, ni ute analyses. further until C ° and ,floe y3 ylso i t95 at min 1 of cycles 35 by followed C, ape trdi 0%EO sn a using EtOH 100% in stored samples Wolbachia itei nw bu their about known is little , Wolbachia ° o i.To min. 5 for C -specific ° C, Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. Q517 Q512 n Q515 Jne aoann 00.Jne aoann(00 estimated extracted. (2010) were Savolainen holarctic (million estimates & of their MYA Jansen the 2010). time 1 Savolainen, from divergence & approximately gyne (Jansen the diverged S GQ255145) i.e., have and the used, GQ255192, were to of GQ255197, MYA, date thought 3 divergence lineages, and approximate xavieri monophyletic MYA, the 2 of estimate ago), sets to years Three used was queen. method L lineage clock morph relaxed S The the USA). of CA, origin Jose, & the Forster, San of (Bandelt, Inc., Estimation haplotypes (Adobe between CS6 steps Illustrator 1000 Adobe using at using haplotypes limit data the connection among fixed relationships a MEGA. phylogenetic R with in infer model 4.6.10), to substitution employed (ver. fit was Network best algorithm the 2013. joining selecting PowerPoint after median Microsoft calculated The using were the haplotypes edited USA, on among the and distances Based i.e., DnaSP Genetic G, 2010). using region Lischer, determined (excluding & were regions (Excoffier variation) seven lacks 3.5.1.2) for COI which patterns (ver. the expansion Arlequin for demographic using expansion distribution, replicates demographic mismatch 1000 and Fu’s with evolution and ( performed of D were model statistics (Tajima’s the tests index test variance neutrality To fixation molecular gene, were of permutations. overall Analysis H 1000 the and gene. with each including G performed and Regions regions regions, site. eight F. this among all region for (AMOVA) at labeled calculated collected was were indices sample Korea, diversity the of Molecular of mainland represented respectively. characteristics the D Japan, unique from a and Region far the Yeosu-si, USA C. island on represented the volcanic based region E a of coast, designated region Island, southern range was and Jeju the the zone) area on Within temperate on southeastern spot (subtropical-warm the regions southwestern central 2011). forest the and to (Yi, broad-leaved A, B, according region evergreen lines designated region the isothermal grouped was designated area with were central was overlaid data the area peninsula zone), (Andersen, sequence (temperate diversity Korean Hence, forests community the broad-leaved ant deciduous of 2003). and map Tschinkel, vegetation vegetation ground & a between Lubertazzi reported 1997; & been (Librado 1995, has 5.10) GenBank correlation The (ver. sequences. good DnaSP 1994). acid using A determined Gibson, amino were & translated Haplotypes the Higgins, S1. 2009). with Table Thompson, Rozas, in along 1994; shown (Kumar, GenBank Nei, are 5.2) to numbers & (ver. accession submitted Tamura, MEGA were Kumar, in sequences embedded 2008; ClustalW aligned Tamura, using & analyzed Dudley, and Nei, aligned were sequences resultant The analyses maximum demographic for and structure directions genetic both Population in read were sequences analysis Kit; cases, Data Purification all Stain PCR In Gel QIAquick Acid (Qiagen Nucleic sequencing. kit TopGreen commercial clarity. to with a dyed prior using gel Germany) Ger- purified agarose Erlangen, and Hilden, 1% Gmbh, Korea) a (Peqlab Seoul, in visualized Base, Thermocycler were (Genomic Gradient amplicons Universal Research, PCR PeqSTAR (MJ The Controller a Thermal or many). Programmable USA) PTC-100 MA, a Waltham, either 16 Inc., using with conducted along was amplification amplification each PCR for used was Korea) Seongnam, Biotechnology, μ (iNtRON Kit PreMix PCR FtsZ as presented that confirm fdsildwtr 1 water, distilled of l h,19) h altp ewr a dtdmnal n eosrce ihtergoa distribution regional the with reconstructed and manually edited was network haplotype The 1999). ¨ ohl, rmr eeue o C codn otemto ecie yBaldo by described method the to according PCR for used were primers and , Wolbachia .tobiasi M. Wolbachia neto,PRuigafamn ftecl yl gene cycle cell the of fragment a using PCR infection, μ and fec rmr(0po)ad5n ftmlt DNA. template of ng 5 and pmol) (10 primer each of l .georgica M. fe ntefis igotcPRwt oiiecontrol. positive a with PCR diagnostic first the in -free Myrmica epciey(eBn c.N:F843,G253,GQ255141, GQ255131, FJ824432, No: Acc. (GenBank respectively , nsuigmtcodiladncergns h O aaand data COI the genes; nuclear and mitochondrial using ants F S F,19;Tjm,18)admsac itiuintests distribution mismatch and 1989) Tajima, 1997; (Fu, ) ymc excelsa Myrmica 3 and .taediosa M. FtsZ F ST a efre sn samples using performed was tal et n pairwise and ) , 20) h Maxime The (2006). . .sulcinodis M. Wolbachia F -specific ST and was , M. Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. i altps(altps1 ,4 ,1,ad3)wr itiue ntoo oergosadteother the 1). and and (Figure 1, regions 36 haplotype more haplotype from or to derived two belonged were in 17.2% samples distributed haplotypes C, were Seventeen USA region 34) The in regions. and 32.8% unique 17, 1). A, 7, to (Figure region 4, restricted D in 2, were region samples 1, haplotypes in of (haplotypes accounting 8.6% 41.4% haplotypes samples, and morph including Six L B, individuals), Korean the (58 region in samples in predominant was of of 1 analysis 40.0% haplotype COI, The for for variation. network 5). haplotype haplotype (Table the no in In showed E samples region 1.6 the in = because informative except max significant, population network not rejected, not was Haplotype and that the be were population, indicating evaluate B E USA not to F), the region region could used i.e., except region model in was G, regions in region expansion distribution all 0.0 46.2 mismatch for the = = observed indexes that max The raggedness (min suggesting A–D. and The D regions history. E in and expansion region that The demographic in C than 5). 9.2 slower B, (Table was = A, growth growth (min population regions high recent in comparatively and were low sudden The indicating very S8. D), evolution. were and region Tajima’s neutral expansion S7, indicating of genotypes. 5, significant, Tables certain time statistically on in not selection summarized was from are Tajima’s resulted gene negative diversity each detected haplotype for we 4). pairwise (Table parameters COI, G highest expansion For region the population and and C and differentiation, region Neutrality significant between showed comparison combinations detected greater the We pairwise showed for 28 genes 0.91731 S4). was of three and out All 3 (Table 23 1989). (0%–4.37%) gene, Barton, regions & within Slatkin than high 1987; (73.25%–75.90%) ( regions (Slatkin, rate among generation migration variation estimated per migrants the and 0.07 COI, size For was population isolated. effective the genetically is are populations regional that observed The analyses island). demographic (Jeju and Table F structure S2). and region (Table genetic (COI) in 2 haplotypes Population highest Table unique were in (Cytb) shown and ( are 26 diversity COII, gene nucleotide and and from each Both specimen Cytb, (COII), for Cytb). a and 25 and for regions (COI), genes (COII eight bp) 37 S3 for (839 identified indices Cytb We diversity and molecular colonies. bp), Overall ant (663 COII 145 bp), of (1224 each COI mitochondrial the analyzed We diversity Molecular morphology. wing whether their examine to to respect used with Results was uncertainty to USA) and owing IL, morph excluded Chicago, wing were 17.0; between individuals (Release relationship SPSS a is in there test Inc.). independence (Adobe chi-square CS6 The Illustrator (ver. and Adobe FigTree trees morphology using using were 15000 wing density), data between first trees posterior additional Association (highest the with The HPD discarding edited appropriateness. 95% after further with tree heights was visualized, It median and examine was 1.40). with tree estimates using to resultant tree generations parameter The 1.5) credibility burn-in. 1000 for clade (ver. as every maximum Tracer distributions a sampled Posterior using to were Markov 2007). visualized consolidated Trees Bayesian Rambaut, were method, generations. & scores clock million the as (Drummond likelihood 100 For criterion, 1.8.0) 1994). for information al., (ver. Bayesian 0.61287) run et the BEAST was sites: Kumar on invariant Carlo 2008; based al., Monte of model et chain substitution proportion (Kumar evolutionary 1.26247; MEGA fit using value: best determined shape the as distribution selected (gamma was model HKY+G+I The F ST npiws obntosbtenrgosE ,G n Tbe4 5 n 6.FrteCOI the For S6). and S5, 4, (Table H and G, F, E, regions between combinations pairwise in F ST ausfrCI OI n ybwr .8,067 n .0,rsetvl,indicating respectively, 0.803, and 0.687, 0.781, were Cytb and COII, COI, for values m stepooto ftepplto htmgae nec generation) each in migrates that population the of proportion the is D Wolbachia ausfrrgosA ,adD niaigta h current the that indicating D, and C, A, regions for values π Wolbachia n altp iest ( diversity haplotype and ) 4 neto status infection neto.Frsaitclaayi,tetreUSA three the analysis, statistical For infection. τ austa ersn h estimated the represent that values τ h D ausi ein ,F n H and F, E, regions in values erae nteodrCOI, order the in decreased ) o ein ,E ,adH and F, E, B, regions for N e m, where F N ST e Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. a eepandb h erdciesrtg n i-aigbhvo.Sls lnlrpouto forms reproduction D) clonal and Selfish C, This A, behavior. 5). (region sib-mating (Table regions and marker three neutral strategy a in reproductive is Populations the after DNA by (Japan) mitochondrial 2). 4). H explained although (Figure Table region selection, be morph and and purifying may 1 E L undergoing region (Figure the be region, between (Japan) to from event(s) this H seem migration divaricated region in a morph in detected found S we populations is & the tree, to Yamauchi, phylogenetic morph related Fukushima, COI closely S Ishii, the (Ohkawara, are the In 4) pairwise population) (Table populations; morph and nest network S other natal haplotype Korean the the The in in occurs 2002). 2015). pairwise than always Heinze, Mikheyev, F), almost population & (region mating (Miyakawa E island its Japan region and the in the than situation low in other extremely the an dispersal populations, to indicates Korean similar 0.781) COI: the colonization, for In regional index after fixation (overall rate regions dispersal among isolation genetic H strong region The haplotype in frequencies had and 3b). peninsula, compositions (Figure Korean haplotype Korea the can Discussion than The in of morph lower D. S those mainland was to the from the 1 which A different from hap in regions were isolated of (Yeosu-si), of (Japan). (Japan) frequency is E those H the which region from region D, (Jeju), populations, distant region in F Korean compositions In that In region C. to and 3b). and similar found, (Figure B, was haplotypes regions be A, Moreover, E all other regions 2. region the peninsula, in clade in in haplotype Korean in that morph dominant the haplotypes B a S (USA) to was regions the G belongs 1 in to region Hap represented E and morph highly region (Japan) L more H though the slightly region C, Even of was with A, D. ratio 2 group Regions and the a Clade C, formed 3a. 2. region A, Figure clade demar- the regions in to from The in shown 1 2). than are clade (Figure F data, of tree ratios and composition phylogenetic similar haplotype Bayesian showed and the D clade in and with clades two maps, into vegetation divided cated were regions haplotypes eight COI the The in frequencies 2006). haplotype al., and et clade (Ohkawara COI morphs wing both in occurs reproduction that suggest and also 26) harbored results 25, 7) (Hap Tokyo (Hap of from free populations populations Wolbachia were morph whereas 24) S infected (Hap with Korean completely were Gifu the infected 22), of be (Hap Toyama None to and Ishikawa individuals. proved morph which S individuals, Wolbachia the morph in L polymorphic the was of all Unlike MYA) on 0.0003–0.7164 HPD: Based (95% and MYA morphology 0.2 haplotypes. USA around Wing and morph occurred The MYA), morph S 0.0053–9.278 L monophyletic, species. the the HPD: the were from (95% 2). with morph MYA of haplotypes (Figure S monophyletic 2.7078 history the morph approximately not the of diverged S only divergence well was in clades the Japanese included as once two and 1 USA, and the only earlier dating, Clade the Korean place diverged molecular and took The 2). 36) Japan, event (Figure (Hap transformation Korea, haplotypes. morph haplotype wing from morph 1 L the haplotypes clade ancestral S that included i.e., the and implying 2 clades, from L two clade derived into both while was divided as haplotypes, morph clearly morph S were L the haplotypes Korean the and that 2, observed clade we and tree, phylogenetic in the haplotypes In showed estimates morph Cytb time L divergence dominant and morph and the S COII relationships to Korean Phylogenetic for than the networks S1). genes, haplotypes three and Haplotype Japanese all 1 For to (Figure related 1). S1). Korea (Figure closely (Figure COI more mutation for were that singleton haplotypes to a patterns distribution by haplotype differed similar these of 16 neto ttsi hsatseis( species ant this in status infection u h aaeeSmrhppltoscletdfo h i-otenpr fJpn i.e., Japan, of part mid-northern the from collected populations morph S Japanese the but , Wolbachia Wolbachia Wolbachia infection sntivle ncoa erdcini h n pce eas clonal because species ant the in reproduction clonal in involved not is Fgr ) h igdvlpetptencreae togywith strongly correlated pattern development wing The 2). (Figure n 4,Pearson 142, = F 5 ST eut niaeta ouain nrgo (the E region in populations that indicate results χ 2 100.339, = F ST Wolbachia ausidctdmr limited more indicated values df 1, = , Wolbachia P < .0) These 0.001). infection Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. hsatbsdo yepouto rmteSmrhclne Nh 04 o,Pr,Co,&Jeong, & Choe, to Park, gene(s) resistant the Noh, gene(s) that 2014; possible the is (Noh, and it colonies formation, case, morph the morph is S S that the the If from for 2015). Ohkawara, production responsible & gyne Hasegawa, Kobayashi, L Okamoto, on 2018; based ant this ad,L,Htp,J .D,Jle,K . odnti,S . ie,S . huhr,R . Werren, . . . R., endosymbiont R. Choudhury, the A., for S. system Biber, typing R., sequence S. Bordenstein, Multilocus A., K. (2006). Jolley, D., H. C. J. J. Hotopp, groups communities: ant L., American functional Baldo, North in on organization Australia. of based patterns with and comparison communities, groups Functional a ant (1997). disturbance. N. Australian A. and Andersen, stress of to classification relation A in 10.2307/2846070 life-forms plant (1995). parallel (Ewha which N. Kern Suehiro, Elizabeth A. W. (OIST) Andersen, Dr. Kobayashi, Mihkeyev thank K. S. We Dr. Dr. and specimens. Jang, References Okamoto Japanese manuscript. Y. M. providing the reviewing and Dr. Mr. for to results to University) and the Womans given University) on are Korea (Kyoto Top5 of commenting thanks Nambaat Foundation Global for Research Y. Special Ewha National and 2011- an the Mizumoto, C00027). and No: by N. NIE-C-2020-22) (Grant supported was No. Planning No: Future Jeong (Grant (Grant G. & Ecology (NRF) University. ICT Womans of Science, Ewha Institute of of National Grant Ministry the Research the by National by the and of funded 0030500), Program (NRF), Development & Korea Research of International Foundation the by supported was research This between Acknowledgements association an of report with first the characteristics. infected is of were this evolution potential knowledge, form, the our with ancestral parallel of in predominant free populations in were Japanese the case morphs morphs, the S derived is L rare as all morphs, 2013). conclusion, both Foucaud, in & In Vavre, place similar Duron, takes Jeong, is Aebi, it parthenogenesis 2004; Loiseau, since of Facon, Sasaki, caste, induction Estoup, & queen particular, ant Ishikawa, the In the of Kubo, 1999). production in (Fujii, Hurst, development reproduction & these queen host Breeuwer, with interpreting to on Stouthamer, variation when effects 2008; lineage-specific The However, manipulative Suh, show 2009). & its Whiting, insects 2). for & morph Austin, known Hymenopteran (Figure S Cameron, is events (Dowton, because the evolution recent of necessary that mitochondrial prevalence to very indicate is respect the evolutionarily estimates caution elucidate divergence are data, to Our infection divergence gene(s) of perspective. such loss evolutionary investigate mechanistic and to a important from be insects will It interactions. resistance of evolution and formation wing of emergence between of relationship morphs positive to two a the suggest ants, we invasive Instead, the Unlike 2). case. (Figure our morph & in S Oyafuso, the Kauppinen, haplotypes, in COI emeryi Tsutsui, disappeared the V. 2005; but of Keller, tree morph, Loiseau, phylogenetic & L Facon, the Pedersen, ancestral Estoup, on Rey, Reuter, Based 2006; 2013; 2003). Shoemaker, Foucaud, & Grosberg, & Heer, Vavre, De of Duron, Ahrens, loss (Bouwma, Aebi, the genotypes. habitats in on associated new result selection exploring non-randomly may while of or selection relaxed signature loci and linked the effect for Therefore, Founder selection nuclear- disequilibrium. reflect linkage paternal may marker enhances to neutral behavior similar a sib-mating males, and in gynes, bondage in mitochondrial bonds nuclear-mitochondrial maternal strong Wolbachia r nei ntergo eivsiae.Tetopooe assaentlkl ola h loss the lead to likely not are causes proposed two The investigated. we region the in endemic are neto nteat pgntcfcosmyb novdi omto ftewn atr in pattern wing the of formation in involved be may factors Epigenetic ant. the in infection ora fBiogeography of Journal .emeryi V. Wolbachia, nteatspecies, ant the In . tlati oenppltos n eeprilyifce in infected partially were and populations, Korean in least at 6 3-6.di 10.1111/j.1365-2699.1997.00137 doi: 433-460. , Wolbachia Wolbachia Wolbachia Wolbachia ora fBiogeography of Journal Wolbachia neto nsm naieatspecies ant invasive some in infection Wolbachia obci pipientis Wolbachia neto eitne otebs of best the To resistance. infection neto n otmorphological host and infection a o otiuet clonal to contribute not may neto,ehbtepistatic exhibit infection, neto seieti the in evident is infection .auropunctata W. Wolbachia Wolbachia . Wolbachia 52.doi: 15-29. , ple and Applied hl the while , bacterium (Rey, in Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. asn . aoann .(00.Mlclrpyoeyo h n rb ymcn Hmnpea Formi- (Hymenoptera: Myrmicini tribe ant the of phylogeny Molecular (2010). many cidae). R. How Savolainen, (2008). & G., H. Jansen, J. Werren, 10.1111/j.1574-6968.2008.01110.x & doi: 215-220. A., Telschow, (2), with P., infected Schlattmann, are P., species Hammerstein, K., Hilgenboecker, strategies. reproductive Ant 10.1007/bf02515814 (1995). doi: K. bacteriophage 149. Tsuji, the & of J., characterization Heinze, and Isolation (2004). and T. hitchhiking Sasaki, 317 growth, & H., population from Ishikawa, against WO T., mutations Kubo, of Y., neutrality Fujii, of tests Statistical selection. (1997). background ant. repro- Clonal fire X. ant. (2005). little L. Y. fire Keller, the Fu, & in little J., females Breton, the sexu- Le and H., Rare of males Jourdan, by (2006). J., populations Foucaud, duction J., A. introduced Orivel, Estoup, A., of Estoup, & D., system Fournier, D., reproduction Konghouleux, clonal A., the Loiseau, 60 Sex in Evolution, J., (2007). events Breton, A. reproduction Le Estoup, al H., . . Jourdan, . J., lab. J., Foucaud, the Breton, Le ant. from A., fire insights Loiseau, little and H., male bev/msm180 the J. evidence parthenogenesis, in Delabie, new Thelytokous clonality J., ant: Orivel, and (2010). D., fire Fournier, J. little J., po- Orivel, Foucaud, the & perform in to O., determination Rey, programs 105 caste A., of Heredity, genetic series Loiseau, and new A., clonality a Estoup, 3.5: J., ver Foucaud, Windows. suite and Arlequin Linux (2010). under 10.1111/j.1755-0998.2010.02847.x E. analyses H. genetics Lischer, trees. pulation & sampling by L., analysis for Excoffier, evolutionary Bayesian rapidly approaches BEAST: both Phylogenetic (2007). 7 A. with Biology, (2009). Rambaut, Evolutionary lineage & F. J., Hymenoptera–A A. M. the Drummond, Whiting, in & data D., genomes. sequence 10.1016/j.ympev.2009.04.001 mitochondrial A. genome evolving Austin, slowly mitochondrial and L., of analysis S. the Cameron, M., Dowton, (2016). O. W. J. 1991. manipulator. Ballard, Aug master & 19-22 C., (Belgium), C. Leuven Correa, Insects, Social of Congress (1992). European J. First Heinze, of & prevalence A., (2008). Buschinger, and A. T. Distribution Miller, (2006). & D. K., Shoemaker, Bourtzis, & J., C. DeHeer, 89-93. E., M. Ahrens, Wolbachia M., A. Bouwma, 16 evolution, and biology Molecular R & P., Forster, H.-J., Bandelt, 72 microbiology, environmental 4,18-18 o:10.1016/j.bbrc.2004.03.164 doi: 1183-1188. (4), olgclJunlo h ina oit,160 Society, Linnean the of Journal Zoological Wolbachia nitoue ouain ftefieant fire the of populations introduced in 2,2522 o:10.1038/hdy.2009.169 doi: 205-212. (2), 8,14-67 o:10.1554/06-099.1 doi: 1646-1657. (8), rnir nEooyadEvolution and Ecology in Frontiers natrpdendosymbiont. arthropod an , eeis 147 Genetics, 1,24 o:10.1002/9780471650126.dob0817 doi: 214. (1), Wolbachia h,A 19) einjiigntok o nern nrseicphylogenies. intraspecific inferring for networks Median-joining (1999). A. ¨ ohl, 1) 0871.di 10.1128/aem.00731-06 doi: 7098-7110. (11), oeua ilg n vlto,24 evolution, and biology Molecular – ttsia nlsso urn data. current of analysis statistical ?–a 1,3-8 o:10.1093/oxfordjournals.molbev.a026036 doi: 37-48. (1), netsymbiosis Insect oyopimo eaerpoutvsi ants. in reproductives female of Polymorphism 2,9595 o:10.1093/molbev/msl052 doi: 915-925. (2), Wolbachia oeua hlgntc n vlto,52 Evolution, and Phylogenetics Molecular aue 435 Nature, iceia n ipyia eerhcommunications, research biophysical and Biochemical 7 oeossinvicta Solenopsis R Press. CRC : soitoswt net:wnigo oigaanta against losing or winning insects: with associations 3,4245 o:10.1111/j.1096-3642.2009.00604.x doi: 482-495. (3), oeua clg eore,10 resources, ecology Molecular , 3 eerhso ouainEooy 37 Ecology, Population on Researches 5.doi: 153. , 74) 2013.doi:10.1038/nature03705 1230-1234. (7046), 10.3389/fevo.2015.00153 . 1) 4527.di 10.1093/mol- doi: 2465-2473. (11), netmlclrbiology molecular Insect ESMcoilg etr,281 Letters, Microbiology FEMS ae rsne tthe at presented Paper 3,5457 doi: 564-567. (3), 2,5259 doi: 512-519. (2), . , 2,135- (2), 15 BMC (1), Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. haaa . aaaa . ao,A,Tid,A,&Hiz,J 20) lnlrpouto n ge- and reproduction Clonal (2006). J. ant, Heinze, queen-polymorphic & a A., in Trindl, and differences A., polymorphism caste Satoh, Queen netic M., Nakayama, (2002). K., J. Ohkawara, Heinze, & of K., IUSSI morphs Yamauchi, of wing ant, Y., myrmicine two Fukushima, in the behaviour H., reproductive of Ishii, estimation size K., Ohkawara, Genome (2018). G. Jeong, doi: & J.C., emeryi Choe, Vollenhovia S.Y., Park, P., Noh, Ancient an micinae). Supports Loci (2014). Determination P. Sex Noh, of Bees. Mapping Honey QTL and (2015). Ants S. in A. Pathway Mikheyev, north & in gradient O., vegetation M. Miyakawa, ground polymorphism a across DNA change flatwoods. of community pine Ant analysis longleaf (2003). comprehensive Florida’s W. for Tschinkel, software & D., a Lubertazzi, v5: DnaSP (2009). for J. software data. Rozas, analysis & genetics P., evolutionary Librado, molecular MEGA: (1994). M. formatics/10.2.189 evolutionary Nei, for & software microcomputers. K., biologist-centric Tamura, a S., MEGA: Kumar, (2008). K. sequences. Tamura, protein & and DNA J., of Dudley, analysis M., Nei, S., 105 Kumar, America, of Society relationships Entomological Phylogenetic the (2012). of K. Ohkawara, & of E., populations Hasegawa, repro- among M., clonal Okamoto, K., and Tamura, forms K., Kobayashi, ant wing the between of flow form gene 10.1007/s00040-010-0131-0 long-winged No the doi: (2011). in K. males ant Ohkawara, by the & duction of E., males Hasegawa, by K., Kobayashi, reproduction Clonal (2008). ant K. Ohkawara, Japanese & emeryi myrmicine E., the Hasegawa, by K., invasion Kobayashi, of records 109 First Washington, of (2007). Society W. T. popula- Suman, natural emeryi & the S., in D. gynandromorphs Kjar, of occurrence Frequent ant 10.1007/bf01242298 (1994). the K. of Yamauchi, tion & diversity. comparing K., bacterial ants: Kinomura, of uncover microbiome the to Surveying methods (2013). S. 79 traditional C. microbiology, Moreau, with & A., pyrosequencing J. Russell, 454 E., parthenogenesis- B. Rubin, S., the Kautz, in virginity (2008). 38 Research, E. functional tomological Suh, female & G., of Jeong, Genetics (2004) R. 10.1038/sj.hdy.6800617 Stouthamer, & Wolbachia G., Jeong, 10.5656/KSAE.2018.10.0.044 iifrais 25 Bioinformatics, (Wheeler). MWelr(yeotr:Friia)i h ntdStates. United the in Formicidae) (Hymenoptera: Wheeler WM Hkad nvriyPes apr,Jpn,206. Japan), Sapporo, Press, University (Hokkaido M hss,Eh oasUniversity. Womans Ewha thesis), (MS netdprsti wasp parasitoid infected olnoi emeryi Vollenhovia ouainsrcueadmcoit fVlehvaeey hee Hmnpea Myr- (Hymenoptera: Wheeler emeryi Vollenhovia of microbiota and structure Population 2,5554 o:10.1128/aem.03107-12 doi: 525-534. (2), optrapiain ntebocecs AIS 10 CABIOS, biosciences: the in applications Computer noooia cec,11 Science, Entomological Hmnpea ymcne.Kra ora fApidEtmlg,5() 317-322. 57(4), Entomology, Applied of Journal Korean Myrmicinae). (Hymenoptera: Vollenhovia 1,4-8 o:10.1111/j.1748-5967.2008.00135.x doi: 41-48. (1), 1) 4115.di 10.1093/bioinformatics/btp187 doi: 1451-1452. (11), 3,596-604. (3), Wolbachia ora fisc cec,3 science, insect of Journal ns ihpriua ou nteeouino igmorphology. wing of evolution the on focus particular with ants, LSGnt 11 Genet, PLoS Hmnpea Formicidae). (Hymenoptera: eeou nawai Telenomus rensi iifrais 9 bioinformatics, in Briefings idcdrpoutv nmle n hi uueapplications. future their and anomalies reproductive -induced olnoi emeryi Vollenhovia 3,4441 o:10.1603/an11038 doi: 454-461. (3), 2,1712 o:10.1111/j.1479-8298.2008.00272.x doi: 167-172. (2), 1) 1066 o:10.1371/journal.pgen.1005656. doi: e1005656. (11), olnoi emeryi Vollenhovia 8 olnoi emeryi Vollenhovia Hmnpea Scelionidae). (Hymenoptera: . nPoednso I nentoa Congress International XIV of Proceedings In 1,2.di 10.1093/jis/3.1.21 doi: 21. (1), netsScax 41 Sociaux, Insectes 4,2936 o:10.1093/bib/bbn017 doi: 299-306. (4), . netsscax 58 sociaux, Insectes rceig fteEntomological the of Proceedings 2,1911 o:10.1093/bioin- doi: 189-191. (2), . ilg etr,2 letters, Biology ple n environmental and Applied Heredity 3,2328 doi: 273-278. (3), 3,359-363. (3), 4 0.doi: 402. 94, 2,163-168. (2), Vollenhovia Vollenhovia Annals En- Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. e,O,Etu,A,Fcn . osa,A,Ab,A,Drn . ar,F,&Fuad .(03.Dis- (2013). J. Foucaud, & F., Vavre, system O., reproductive ant not Duron, fire and A., little process Aebi, invasion the reflects in A., manipulators polymorphism Loiseau, reproductive B., endosymbiotic of Facon, of Loss tribution A., Estoup, (2005). O., L. Rey, Keller, & S., ant Argentine J. invasive Hymenoptera. Pedersen, social in M., morphology queen Reuter, of evolution 46 the look entomology, and dispersal of which Colony review (2001). Annual forms F. Ito, adult & sporadic C., and Peeters, ants, Formicidae). distinct of (Hymenoptera: subfamilies two all queens across winged reproductives of wingless ants: of loss evolution Convergent in (2012). C. intercastes queens. Peeters, and winged and queens workers Ergatoid 10.1007/bf01242708 between intermediate ant. (1991). crazy morphologically longhorn the C. in 278 inbreeding Sciences, Peeters, without Biological mating of Sib B: Society reproduction (2011). Royal L. asexual the Keller, and & of Proceedings A., Sexual M. Goodisman, (2015). M., Pearcy, K. Ohkawara, ant, & myrmicine a E., in Hasegawa, queens K., Kobayashi, M., Okamoto, doi:10.1098/rsbl.2006.0491 o,D .(96.Teeouino igdmrhs ninsects. in dimorphism wing of evolution The (1986). A. D. Roff, nal.pone.0058467 ern .H 19) ilg of nurev.ento.42.1.587 Biology (1997). H. J. Werren, evo- and 10.1080/00222939100770641 distribution The in in foundation (2003). Colony queens K. (1991). H. R. M. Grosberg, Villet, & F., A. Oyafuso, ( N., of S. habitats. history arid Kauppinen, lutionary from D., of queens N. sensitivity ant Tsutsui, in the reduction 10.1007/bf01131809 improving Wing doi: W: (1992). and CLUSTAL 84-85. J. penalties (2), Heinze, gap & (1994). A., position-specific J. polymor- Tinaut, weighting, T. DNA sequence Gibson, by through choice. & hypothesis matrix alignment G., weight mutation sequence D. neutral multiple Higgins, the progressive D., testing J. for Thompson, method Statistical phism. (1989). (1999). F. D. Tajima, G. Hurst, & reproduction. levels average nurev.micro.53.1.71 A., arthropod estimating J. for of methods Breeuwer, lator indirect three R., of Stouthamer, comparison A (1989). flow. H. gene N. populations. of Barton, natural & of M., structure Slatkin, geographic the and flow Gene 236 (1987). M. Slatkin, 10.2307/2408759 ieihm humile Linepithema 40) 8-9.di 10.1126/science.3576198 doi: 787-792. (4803), eeis 123 Genetics, Plectroctena vlto,43 Evolution, Wolbachia 3,585-595. (3), ). uli cd eerh 22 Research, Acids Nucleic ieihm humile Linepithema oeua Ecology Molecular Hmnpea Formicidae). (Hymenoptera: olnoi emeryi Vollenhovia 7,14-38 o:10.2307/2409452 doi: 1349-1368. (7), neto nntv n nrdcdppltoso h naieagnieant argentine invasive the of populations introduced and native in infection Wolbachia 1,6160 o:10.1146/annurev.ento.46.1.601 doi: 601-630. (1), amni auropunctata Wasmannia nulRvesi irbooy 53 Microbiology, in Reviews Annual lcrceamandibularis Plectroctena . , . 12 eeiy 94 Heredity, nulrve fetmlg,42 entomology, of review Annual 1) 3057-3068. (11), Hmnpea Formicidae). (Hymenoptera: 2) 6348.di 10.1093/nar/22.22.4673 doi: 4673-4680. (22), ymclgclNw,16 News, Myrmecological 9 ora fNtrlHsoy 25 History, Natural of Journal 3,3439 o:10.1038/sj.hdy.6800601 doi: 364-369. (3), Wolbachia 11) 6728.di 10.1098/rspb.2010.2562 doi: 2677-2681. (1718), . lSoe 8 one, PloS obci pipientis Wolbachia .Sih n h vlto fergatoid of evolution the and Smith, F. netsScax 38 Sociaux, Insectes neto uigclnsto nthe in colonisation during infection 1,7-0.di 10.1146/an- doi: 71-102. (1), 3,e86.di 10.1371/jour- doi: e58467. (3), ymclNw,21 News, Myrmecol Evolution 75-91. , 1,5769 o:10.1146/an- doi: 587-609. (1), auwseshfe,79 Naturwissenschaften, Science(Washington), irba manipu- microbial : 0912.doi: 1009-1020. , 4,9993 doi: 979-983. (4), 1,11.doi: 1-15. (1), 13-17. , Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. iueS1. Figure S7 Tables S5 Tables S4. Table S3. Table article. S2. this Table of version online the S1. in Table found be the can in information included supporting Additional are sample each of information sequences Supporting the S1). for (Table numbers section accession fungal information GenBank Supporting studying and currently locations is Sampling Oh He S-Y. research. anomalies. symbiont-host omics-based reproductive on and accessibility thesis. and focusing behavior Data student interactions MSc into PhD host-symbiont interest her a in research Park of interested his S. is part determination expanding project. sex Jeong is draft a PhD in first G. is a interested the J.C. interactions. as is wrote This Noh Park, approach immune Noh Park P. metagenomic P. S. S. a insects. manuscript. and samples. using analysis. Oh, the in Korean ecology approved statistical S-Y. the evolution and Noh, performed of P. reviewed social Park most authors research. and S. All collected the designed Jeong article. work. and the G. molecular conceived of and the Jeong Kim, of G. Y. and most Kwon, Choe conducted T. Oh Park, S-Y. S. and Oh, S-Y. Noh, P. of assessment critical A contributions nice? Author turned guys Bad hosts. ants. (2015). with arthropod P. associated in Hammerstein, world microbial & the R., into Zug, Insights Korea. (2005). South R. 184 Gross, in microbiology, InTech & of changes S., Archives Stoll, (Croatia): monsoonal H., Feldhaar, Rijeka Asian E., of Zientz, East effects. spread to ecological for responses and Geographic vegetation Record 10.5772/23920 foundations Holocene Locality change–geophysical New mate (2011). USA. (2015). A S. Maryland, Yi, B. (2011). in D. E. Formicidae) 10.3157/021.122.0210 Kubik, Booher, & & (Hymenoptera: B., B., J. Wright, Guenard, K., emeryi J. Wetterer, (2000). 10.1098/rspb.2000.1139 M. D. Windsor, equilibrium? & H., J. Werren, Hmnpea Formicidae). (Hymenoptera: MV o iohnra OIadCt of Cytb Cytb and and COII COII mitochondrial mitochondrial for of AMOVA regions eight of for haplotypes indices Cytb diversity and Molecular COII, COI, mitochondrial the in Variants for Information and and altp ewrsfrCI n Cytb and COII for networks Haplotype rceig fteRylSceyo odnB ilgclSine,267 Sciences, Biological B: London of Society Royal the of Proceedings S8. S6. ilgclReviews Biological etaiyts o COII for test Neutrality pairwise Population .emeryi V. 4,1926 o:10.1007/s00203-005-0041-0 doi: 199-206. (4), sa Myrmecology Asian samples , F 90 ST Wolbachia 1,8-1.Doi: 89-111. (1), ausbtenrgosfrCI n Cytb and COII for regions between values 10 neto rqece niscs vdneo global a of evidence insects: in frequencies infection noooia es 122 News, Entomological . .emeryi V. 10.1111/brv.12098 olnoi emeryi Vollenhovia .emeryi V. 15) 2718.doi: 1277-1285. (1450), Wolbachia 2,1012 doi: 170-172. (2), 5-7.doi: 157-178. , MWheeler WM Vollenhovia mutualisms Cli- Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. h π nTi 6 RAF seFR: WspecF F: ftsZ R: VeCB-F1 F: rRNA 16s Cytb OIF 12R 82ATATTCACAATTGGGTTAGATGTAGA r8v2 R: 21v2 F: COII Nh Index 2. Table primer. reverse R: primer, forward F: 1. Table R: LCO-a F: name Primer COI name Primer Locus Locus / nTv oeua iest nie o ih ein fmtcodilCOI mitochondrial of regions eight for indices diversity Molecular study this in used Primers :ftsZ F: WspecR VeCB-R1 Ve13-sR2 R: Ve13-sF2 F: Ve13-sR1 R: Ve13-sF1 F: :EglR a GAGGAGGAGACCCCATTTTAT Pat R: Engel F: ftsZ HCO-a R1 1R: F1 AGCTTCGAGTGAAACCAATTC CATACCTATTCGAAGGGATAG TGTATGGGGATTCAATTACTTGTG TGCCCTAATACTCAATTAGCCTTT TTGTTAGAGATAGGGGGACACAA GAATATTTTT CTG- ATTAACCGCC- TATTGGGATAGGG CAAATTATT- AATGT- ATGTACATTATTTGGGAAGCACTAGC AGCTGCGGCTTCAAATCCA TCCAATGCACTAATCTGCCATATTA TCRAGYAATGGATTRGATAT ATYATGGARCATATAAARGATAG Purpose TAAACTTDGGRTGWCCAAAAAATCA CCYCGWATAAATAAYATAAGATTTTGA Purpose (5’-3’) sequences Primer (5’-3’) sequences Primer 11 igotcPCR diagnostic specific Wolbachia Sequencing and PCR eunig-Dsge obe to Designed - Sequencing C 55–60 PCR Sequencing and PCR igotcPCR diagnostic specific Wolbachia Sequencing and PCR - - 55 52–60 45–50 54 45–50 ( temperature Annealing ( temperature Annealing ° ° )Reference Reference C) C) ° ° ad tal., et Baldo C ern& Werren C ° ° ° ° eindt be to Designed C Kazuya C eindt be to Designed C eindt be to Designed C ido,2000 Windsor, emeryi for specific emeryi for specific haaa 2012 Ohkawara, & Hasegawa, Okamoto, Tamura, Kobayashi, al. emeryi for specific 2006 emeryi for specific 1994 Simon V. V. V. V. et 0.560 0.063 12.2 12 (36) A ( Region Ns ) 0.473 0.176 24.5 3 (14) B ( Region Ns ) 0.377 0.040 47 5 (24) C ( Region Ns ) 0.853 0.069 13.5 9 (17) D ( Region Ns ) 0.549 0.043 - 4 (23) E ( Region Ns ) 0.867 0.233 10.5 4 (6) F ein( Region Ns ) 0 0 - 1 (3) G ( Region Ns ) 0.779 0.061 17 7 (22) H ( Region Ns ) 0.557 0.086 20.783 (145) Total 37 ± ± ± (145) Total 37 0.289 0.078 13.769 (145) Total 37 Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. S .11035* .14007* .62016* .84*0.1001 0.0854** - 0.1568** 0.1672 0.0178** 0.0124 0.3451** - 0.77577** - 0.0161 0.66380** 0.54368 - 0.29224** 0.83311** 0.69558** - 0.86605** 0.86393** 0.72167** - 0.88401** 0.89815** 0.91731** 0.80042** -0.01882 0.91318** - 0.74100** SSD 0.64864** ( Tau 0.50484** Tajima’s 0.75978** 0.04035 0.09881* - 0.87579** 0.87031** 5. Table 0.76830** 0.88699** -0.00838 P -0.01541 H Region 0.09915* G Region - F Region E Region D Region C Region B Region A Region 4. Table freedom. of degrees = d.f. 3. Table Ns Index agdesidx015 .83015 .13039* .87-019 0.1801 0.1293 - 0.1867 0.3297** 0.1103 0.1952 0.3843 0.1052 index Raggedness P < < ubro ape examined; samples of number , .5 **P 0.05; 0.01. τ . . . . . 62-1. 9.0728 11.9 - 46.2 9.2 1.6 3.0 0.0 0.7 ) D etaiyts o COI for test Neutrality pairwise Population of COI mitochondrial for AMOVA Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , < .1*P 0.01 oa 4 100.00 144 74.81 21.92 84 7 variation of Percentage d.f. 3.27 Total 53 populations Within regions within populations Among regions Among variation of Source einARgo einCRgo einERgo einGRgo H Region G Region F Region E Region D Region C Region B Region A Region < .5 **P 0.05; F ST Nh ausbtenrgosfrCOI for regions between values ubro haplotypes; of number , < .1*P 0.01 .emeryi V. 12 < .5 **P 0.05; nTi / < nTv .1*P 0.01 215* .14-.25*-.04*167 .56-108 -0.2922 1.0687 - 1.4576 1.6972 -2.4064** -2.6215** 0.6124 -2.1452** 3)B(4 2)D(7 2)F()G()H(22) H (3) G (6) F (23) E (17) D (24) C (14) B (36) A ( Region h ai ftastost transversions; to transitions of ratio the , P < 0.01. Ns < ein( Region ) .5 **P 0.05; Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , < .1*P 0.01 < .5 **P 0.05; π, uloiediversity; nucleotide < .1*P 0.01 < .5 **P 0.05; h altp diversity. haplotype , < P .1*P 0.01 < 0.01. Ns ein( Region ) Ns < ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , .5 **P 0.05; Ns ein( Region ubro ape examined; samples of number , < Ns .1*P 0.01 ) < .5 **P 0.05; < Nh .1*P 0.01 ubro haplotypes; of number , < .5 **P 0.05; P < < 0.01. Ns 0.01 nTi ein( Region ) Ns / nTv ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide P < 0.01. Ns ein( Region ) Ns h altp diversity. haplotype , ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , Ns ( Region ubro ape examined; samples of number , Ns ) Nh P ubro haplotypes; of number , < 0.01. Ns ein( Region ) Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , P < 0.01. π, Ns uloiediversity; nucleotide ein( Region ) Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , h altp diversity. haplotype , Ns ( Region ubro ape examined; samples of number , Ns ) P < 0.01. Ns ein( Region ) Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , P < 0.01. Ns Mean ) Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , π, uloiediversity; nucleotide h altp diversity. haplotype , P Ns ( Region < ubro ape examined; samples of number , 0.01. Ns Ns ) ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , Nh ubro haplotypes; of number , nTi / nTv ± ± ± ± ± P h ai ftastost transversions; to transitions of ratio the , < 0.01. Ns ubro ape;SD u fsurddvain ** deviation. squared of sum SSD, samples; of number , π, uloiediversity; nucleotide h altp diversity. haplotype , 15.6562 1.8168 0.1192 s.d. 0.1253 P < 0.01. Ns ubro ape;SD u fsurddeviation. squared of sum SSD, samples; of number , Ns ( Region ubro ape examined; samples of number , Ns ) Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , Ns ( Region ubro ape examined; samples of number , Ns ) Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , Ns ( Region ubro ape examined; samples of number , Ns ) Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , Ns ( Region ubro ape examined; samples of number , Ns ) Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , Ns (145) Total ubro ape examined; samples of number , Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , oa (145) Total Ns ubro ape examined; samples of number , Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , oa (145) Total Ns ubro ape examined; samples of number , Nh ubro haplotypes; of number , nTi / nTv h ai ftastost transversions; to transitions of ratio the , π, uloiediversity; nucleotide h altp diversity. haplotype , Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. nnw.Baksur osrpeetptnilymsighpoye.Tenme fsotvria lines steps. mutational vertical five short than of more indicate number type lines wing The vertical stripe, short crossed Five haplotypes. morph morph; steps. missing wing S mutational The potentially of stripe, represent number region. diagonal the the dots morph; represents in the L square haplotypes solid, on Black particular Numbers patterns: the unknown. following color-coded. with the are individuals by of regions represented number is Geographic the respectively. indicate mutations, charts of pie number the and frequency 1. Figure altp ewr o O.Crl ieadln eghaepootoa otehaplotype the to proportional are length line and size Circle CO1. for network Haplotype 13 Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. ipae:L=ln-igd hr-igd nnw,K=Kra aa,U=UA = W USA, = U Japan, haplotype. morph = S J the Korea, of = occurrence the K and unknown, clades = two u the of short-winged, nodes = and identity, S country long-winged, morph, Wolbachia = Wing L COI. using displayed: inference Bayesian on based 2. Figure o lrt,alohrnd ro asrpeetn 5 P r eoe,ecp hs o the for those except removed, are HPD 95% representing bars error node other all clarity, For . siaino iegnetm ewe h op n h neta op haplotypes morph L ancestral the and morph S the between time divergence of Estimation 14 Wolbachia neto ttsare status infection Posted on Authorea 3 Mar 2020 — CC BY 4.0 — https://doi.org/10.22541/au.158325434.48523234 — This a preprint and has not been peer reviewed. Data may be preliminary. rse tie b altp rprinfrec fsxrgos h igehpoye nec einare pies. unknown, the region type on each presented wing in are stripe; haplotypes haplotypes morph, single dominant S The The solid; pies. regions. the morph, six for in L of shown gray orange; each are dark 2, for proportion in shown clade (pattern) proportion and type blue; Haplotype combined wing (b) 1, and Clade (color) stripe. Clade crossed regions. (a) six region. of each each from examined samples of 3. Figure eeainmpo ot oe,wt i hrs(i 01.Pesz spootoa otenumber the to proportional is size Pie 2011). (Yi, charts pie with Korea, South of map Vegetation 15