Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart

International Journal of Molecular Sciences

Article Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart

Ali H. El-Far 1,* , Yaser H. A. Elewa 2,3,* , Elsayeda-Zeinab A. Abdelfattah 4, Abdel-Wahab A. Alsenosy 1 , Mustafa S. Atta 5 , Khalid M. Abou-Zeid 4, Soad K. Al Jaouni 6, Shaker A. Mousa 7 and Ahmed E. Noreldin 8

1 Department of Biochemistry, Faculty of Veterinary Medicine, Damanhour University, Damanhour 22511, Egypt; [email protected] 2 Department of Histology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44519, Egypt 3 Laboratory of Anatomy, Faculty of Veterinary Medicine, Basic Veterinary Sciences, Hokkaido University, Sapporo 060-0818, Japan 4 Animal Care Unit, Medical Research Institute, Alexandria University, Alexandria 21544, Egypt; [email protected] (E.-Z.A.A.); [email protected] (K.M.A.-Z.) 5 Department of Physiology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh 33516, Egypt; [email protected] 6 Department of Hematology/Pediatric Oncology, Yousef Abdulatif Jameel Scientiﬁc Chair of Prophetic Medicine Application, Faculty of Medicine, King Abdulaziz University, Jeddah 21589, Saudi Arabia; [email protected] 7 Pharmaceutical Research Institute, Albany College of Pharmacy and Health Sciences, Rensselaer, NY 12144, USA; [email protected] Citation: El-Far, A.H.; Elewa, Y.H.A.; 8 Histology and Cytology Department, Faculty of Veterinary Medicine, Damanhour University, Abdelfattah, E.-Z.A.; Alsenosy, Damanhour 22511, Egypt; [email protected] A.-W.A.; Atta, M.S.; Abou-Zeid, K.M.; * Correspondence: [email protected] (A.H.E.-F.); [email protected] (Y.H.A.E.) Al Jaouni, S.K.; Mousa, S.A.; Noreldin, A.E. Thymoquinone and Curcumin Abstract: D-galactose (D-gal) administration causes oxidative disorder and is widely utilized in Defeat Aging-Associated Oxidative aging animal models. Therefore, we subcutaneously injected D-gal at 200 mg/kg BW dose to assess Alterations Induced by D-Galactose the potential preventive effect of thymoquinone (TQ) and curcumin (Cur) against the oxidative in Rats’ Brain and Heart. Int. J. Mol. alterations induced by D-gal. Other than the control, vehicle, and D-gal groups, the TQ and Cur Sci. 2021, 22, 6839. https://doi.org/ treated groups were orally supplemented at 20 mg/kg BW of each alone or combined. TQ and Cur 10.3390/ijms22136839 effectively suppressed the oxidative alterations induced by D-gal in brain and heart tissues. The TQ

Academic Editors: David Vauzour and Cur combination significantly decreased the elevated necrosis in the brain and heart by D-gal. and Cristina Angeloni It significantly reduced brain caspase 3, calbindin, and calcium-binding adapter molecule 1 (IBA1), heart caspase 3, and BCL2. Expression of mRNA of the brain and heart TP53, p21, Bax, and CASP-3 Received: 25 May 2021 were significantly downregulated in the TQ and Cur combination group along with upregulation of Accepted: 18 June 2021 BCL2 in comparison with the D-gal group. Data suggested that the TQ and Cur combination is a Published: 25 June 2021 promising approach in aging prevention.

Publisher’s Note: MDPI stays neutral Keywords: thymoquinone; curcumin; D-galactose; oxidative stress; anti-aging with regard to jurisdictional claims in published maps and institutional afﬁl- iations. 1. Introduction Aging is a deteriorative process that occurs mainly due to oxidative stress, leading to numerous oxidative stress-associated diseases because of the accumulation of reactive Copyright: © 2021 by the authors. oxygen species (ROS) and reduced antioxidant capability [1,2]. A D-galactose (D-gal)- Licensee MDPI, Basel, Switzerland. induced aging model is a commonly utilized model to investigate anti-aging drugs [3]. This article is an open access article When D-gal accumulates in the body, it can react with the free amines of amino acids in distributed under the terms and proteins and peptides, forming advanced glycation end products (AGEs) [4]. Consequently, conditions of the Creative Commons AGEs interact with speciﬁc receptors (RAGE) in many cell types and induce the activation Attribution (CC BY) license (https:// of the downstream nuclear factor kappa-B (NF-κB), and other signaling pathways, resulting creativecommons.org/licenses/by/ in ROS generation, which could accelerate the aging process [4,5]. The elevated ROS and 4.0/).

Int. J. Mol. Sci. 2021, 22, 6839. https://doi.org/10.3390/ijms22136839 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 2 of 22

activation of the downstream nuclear factor kappa-B (NF-κB), and other signaling pathways, resulting in ROS generation, which could accelerate the aging process [4,5]. The elevated ROS and reactive nitrogen species (RNS), including superoxide anion and nitric oxide, lead to cellular damages in protein, lipid, and DNA that are able to favor the development of different diseases, including tumors, neurodegenerative disorders, aging, and an inflammatory processes [6–9]. Int. J. Mol. Sci. 2021, 22, 6839 Natural compounds act as preventive antioxidant agents against different age-asso-2 of 22 ciated alterations [10]. Thymoquinone (TQ) is an active compound of Nigella sativa seeds with diverse biological activities such as antioxidant, antitoxic, anti-inflammatory, antidiabetic, and anticancer activities (Figure 1) [11–15]. TQ showed a positive elevation in liver reactive nitrogen species (RNS), including superoxide anion and nitric oxide, lead to cellular glutathione levels and enhancement of total oxidant status of blood in a rat model with damages in protein, lipid, and DNA that are able to favor the development of different carbon tetrachloride-induced hepatotoxicity [16]. Also, TQ protects cardiac muscles diseases, including tumors, neurodegenerative disorders, aging, and an inflammatory against diabetic oxidative stress by upregulation of nuclear factor-erythroid-2-related fac- processes [6–9]. tor 2 (Nrf2), which improved the antioxidant potential of the cardiac muscles and allevi- Natural compounds act as preventive antioxidant agents against different age- ated the inflammatory process [12]. Moreover, TQ alleviates the testicular damage in dia- associated alterations [10]. Thymoquinone (TQ) is an active compound of Nigella sativa seedsbetic rats with through diverse its biological powerful activities antioxidant such and as antioxidant, hypoglycemic antitoxic, effects anti-inflammatory,[11]. Additionally, antidiabetic,TQ shows a regenerative and anticancer potential activities for (Figure treating1)[ damaged11–15]. TQ periph showederal anerves positive [17]. elevation in liverCurcumin glutathione (Cur) levels is anda yellow enhancement pigment obtained of total oxidant from Curcuma status of longa blood, commonly in a rat model used withas a spice carbon and tetrachloride-induced food-coloring agent hepatotoxicity (Figure 1). It [has16]. preventive Also, TQ protects or putative cardiac therapeutic muscles againstproperties diabetic because oxidative of its anti-inflammatory, stress by upregulation antioxidant, of nuclear anti-aging, factor-erythroid-2-related and anticancer poten- factor 2tial (Nrf2), [18–24]. which improved the antioxidant potential of the cardiac muscles and alleviated the inflammatoryFor the antioxidant process potential [12]. Moreover, of both TQTQ alleviates and Cur, thewe testicularinvestigated damage their inanti-aging diabetic ratspotential through either its alone powerful or in antioxidant combination and against hypoglycemic the oxidative effects alterations [11]. Additionally, in rats’ brains TQ showsand hearts a regenerative induced by potential the D-gal-aging for treating model. damaged peripheral nerves [17].

FigureFigure 1.1. ChemicalChemical Structure.Structure. ((AA)) thymoquinonethymoquinone (PubChem(PubChem CID;CID; 10281).10281). ((BB)) curcumincurcumin (PubChem(PubChem CID;CID; 969516).969516).

2. ResultsCurcumin (Cur) is a yellow pigment obtained from Curcuma longa, commonly used as a spice and food-coloring agent (Figure1). It has preventive or putative therapeu- 2.1. Biochemical Parameters tic properties because of its anti-inflammatory, antioxidant, anti-aging, and anticancer potentialFigure [18 2– 24revealed]. no significant changes in serum glucose and creatinine levels and alanineFor aminotransferase the antioxidant potential (ALT, EC of 2.6.1.2) both TQactivity and Cur,between we investigatedall groups. In their contrast, anti-aging rats in potentialthe D-gal+TQ+Cur either alone group or in exhibited combination a significant against the reduction oxidative in alterations aspartatein aminotransferase rats’ brains and hearts(AST, EC induced 2.6.1.1) by (p the < 0.05) D-gal-aging activity model.and urea (p < 0.05), and uric acid (p < 0.001) level compared with the D-gal. D-gal+TQ and D-gal+Cur groups also revealed a marked lower uric 2.acid Results than the control, vehicle, and D-gal groups. 2.1. Biochemical Parameters Figure2 revealed no significant changes in serum glucose and creatinine levels and alanine aminotransferase (ALT, EC 2.6.1.2) activity between all groups. In contrast, rats in the D-gal+TQ+Cur group exhibited a significant reduction in aspartate aminotransferase (AST, EC 2.6.1.1) (p < 0.05) activity and urea (p < 0.05), and uric acid (p < 0.001) level compared with the D-gal. D-gal+TQ and D-gal+Cur groups also revealed a marked lower uric acid than the control, vehicle, and D-gal groups.

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 3 of 22 Int. J. Mol. Sci. 2021, 22, 6839 3 of 22

Figure 2. Serum biochemical parameters. (A) glucose (mg/dL). (B) ALT (U/L). (C) AST (U/L). (D) Figureurea (mg/dL).2. Serum (biochemicalE) creatinine parameters. (mg/dL). (F(A)) uric glucose acid (mg/dL). ( DataB) ALT were (U/L). analyzed (C) AST with (U/L). one-way (D) ureaANOVA, (mg/dL). followed (E) creatinine by Tukey’s (mg/dL). multiple (F) comparison uric acid (mg/dL). test. * p

Int. J. Mol. Sci. 2021, 22, 6839 4 of 22

2.3. Histopathological Assessment of the Rat’s Spleen Negative control and vehicle groups showed the normal splenic architecture (Figure S2A,B). In contrast, the D-gal group showed marked alterations within their white and red pulp; this included depletion of a red pulp component and deformity of white pulp (Figure S2C). D-gal+TQ group showed improvement of white bulb architecture (Figure S2D). D-gal+Cur group revealed a relatively normal splenic structure (Figure S2E). D-gal+TQ+Cur group showed the best protection of the splenic architecture (Figure S2F). Statistical analysis of splenic lesions scores declared that the animals treated with D-gal had signiﬁcantly higher splenic red pulp depletion and splenic nodules deformity scores than rats in the control group. However, compared with rats in the D-gal group, D- gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups signiﬁcantly reduced the splenic lesion score (Figure S2G,H).

2.4. Histopathological Assessment of Rat’s Kidney Negative control and vehicle groups showed the normal hippocampal architecture (Figure S3A,B). On the other hand, the D-gal group revealed congestion of glomerular and intertubular capillaries, degenerative and necrotic changes of renal tubules, and in- tratubular eosinophilic proteinaceous materials (Figure S3C). The D-gal+TQ group showed improvement of renal structure with lower necrosis than the D-gal group (Figure S3D). The D-gal+Cur group revealed a relatively normal renal structure as the negative control group (Figure S3E). The D-gal+TQ+Cur group showed the best protection of the renal architecture (Figure S3F). Statistical analysis of hippocampal lesion scores declared that the animals treated with D-gal had signiﬁcantly higher renal necrosis and congestion scores than rats in the control group. However, compared with rats in the D-gal group, D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups showed a signiﬁcant reduction in the renal lesions score (Figure S3G,H).

2.5. Histopathological Assessment of Rat’s Cerebellum Negative control and vehicle groups showed the normal cerebellar architecture that consisted of uniform molecular, granular, and Purkinje cell layers (Figure S4A,B). However, the D-gal group showed loss and necrosis of Purkinje cells in the Purkinje cells layer, neurons in the granular layer, and neurons in the molecular layer (Figure S4C). The D- gal+TQ group showed enhancement in the number of Purkinje cells in the Purkinje cells layer with a lower number of pyknotic nuclei than the D-gal group (Figure S4D). D-gal+Cur showed a nearly normal cerebellar structure as the negative control group (Figure S4E). D- gal+TQ+Cur revealed the highest prevention against D-gal (Figure S4F). Statistical analysis of cerebellar lesion scores indicated that the animals administrated with the D-gal had a markedly (p < 0.001) higher cerebellar necrosis score than the rats in the control group. On the other hand, compared with the rats in the D-gal+TQ group, D-gal+Cur, and D- gal+TQ+Cur groups showed a marked (p < 0.001) reduction in the cerebellar lesions score (Figure S4G). in D-gal+TQ+Cur, the cerebellar necrosis extent was signiﬁcantly decreased compared with D-gal+TQ (p < 0.001) and D-gal+Cur (p < 0.01) groups.

2.6. Immunohistochemistry Assessment of Cerebellum Negative control and vehicle groups showed negative caspase 3 reactions in all cerebellar layers (Figure3A,B), while the D-gal group showed the highest caspase 3 responses in all cerebellar layers (Figure3C). D-gal+TQ showed a reduced allocation of caspase 3 reacted nuclei compared to the D-gal group (Figure3D). D-gal+Cur showed a shallow distribution of caspase 3 in the nuclei (Figure3E). The lowest caspase reaction could be seen in D-gal+TQ+Cur (Figure3F). A signiﬁcant ( p < 0.001) elevated expression of caspase 3 was revealed in the nuclei of the cerebellar layers in the D-gal group compared with the control rats by Statistical analysis caspase 3 allocations. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the expression of caspase 3 was signiﬁcantly (p < 0.001) Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 5 of 22

Int. J. Mol. Sci. 2021, 22, 6839 5 of 22 3 was revealed in the nuclei of the cerebellar layers in the D-gal group compared with the control rats by Statistical analysis caspase 3 allocations. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the expression of caspase 3 was significantly (p < 0.001) low- loweredered (Figure (Figure 3G).3G). A Asignificant signiﬁcant reduction reduction (p (

FigureFigure 3.3.Immunohistochemical Immunohistochemical stainingstaining of of ratrat cerebellumcerebellum byby caspasecaspase 3.3. ((AA)) negativenegative controlcontrol group.group. (B(B)) vehicle vehicle group.group. ((CC)) D-galD-gal groupgroup revealingrevealing strong strong caspase caspase 3 3 reaction reaction inin PurkinjePurkinje cellscells layerlayer (PCL),(PCL), in granular cells layer (GL) and in molecular cells layer (ML). (D) D-gal+TQ group. (E) D-gal+Cur in granular cells layer (GL) and in molecular cells layer (ML). (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the cerebellum in different group. (F) D-gal+TQ+Cur group. (G) Quantiﬁcation of caspase 3 in the cerebellum in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multi- µ groups.ple comparison Scale bar test. = 50 ***m. p < Data 0.001 were vs. analyzedcontrol. ++ withp < 0.01 one-way and +++ ANOVA, p < 0.001 followedvs. vehicle. by xxx Tukey’s p < 0.001 multiple vs. D- ++ +++ xxx comparisongal. ɸɸɸ p < 0.001 test. vs. *** D-gal+TQ.p < 0.001 vs.### p control. < 0.001 vs. pD-gal+TQ+Cur.< 0.01 and Errorp < 0.001 bars vs.represent vehicle. meanp ±< SD. 0.001 n = vs.10. D-gal. φφφ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.In the rat cerebellum, the staining by immunohistochemistry of calbindin showed the highest calbindin reaction in the Purkinje cells of negative control and vehicle groups (Fig- In the rat cerebellum, the staining by immunohistochemistry of calbindin showed ure 4A,B). However, in all cerebellar layers, the D-gal group revealed a negative calbindin the highest calbindin reaction in the Purkinje cells of negative control and vehicle groups reaction (Figure 4C). In D-gal+TQ, a more elevated number of positive calbindin Purkinje (Figure4A,B). However, in all cerebellar layers, the D-gal group revealed a negative calbindincells was reactiondisplayed (Figure than 4inC). the In D-gal D-gal+TQ, group a more(Figure elevated 4D). A numbermoderate of number positive calbindinof positive Purkinjecalbindin cells Purkinje was displayed cells was thanrevealed in the in D-gal D-gal+Cur group (Figure 44E).D). AD-gal+TQ+Cur moderate number revealed of positivethe highest calbindin number Purkinje of positive cells calbindin was revealed Purkinje in D-gal+Cur cells (Figure (Figure 4F). 4InE). the D-gal+TQ+Cur D-gal group, a revealed the highest number of positive calbindin Purkinje cells (Figure4F). In the D- gal group, a signiﬁcant (p < 0.001) lowering in the expression of the number of positive calbindin Purkinje cells was revealed by statistical analysis of the number of positive Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 6 of 22

Int. J. Mol. Sci. 2021, 22, 6839 6 of 22

significant (p < 0.001) lowering in the expression of the number of positive calbindin Purkinje cells was revealed by statistical analysis of the number of positive calbindin calbindinPurkinje cells Purkinje compared cells compared with the withcontrol the rats. control In rats.the D-gal+TQ, In the D-gal+TQ, D-gal+Cur, D-gal+Cur, and D- andgal+TQ+Cur D-gal+TQ+Cur treated treatedrats, the rats, low the number low number of positive of positive calbindin calbindin Purkinje Purkinje cells was cells signifi- was signiﬁcantlycantly (p < 0.001) (p < 0.001)raised raised(Figure (Figure 4G). 4G).

FigureFigure 4.4. ImmunohistochemicalImmunohistochemical stainingstaining ofof ratrat cerebellumcerebellum byby calbindin.calbindin. ((AA)) negativenegative controlcontrol groupgroup showingshowing highhigh reaction reaction in in calbindin calbindin in manyin many Purkinje Purkinje cells cells (arrow). (arrow). (B) vehicle (B) vehicle group. group. (C) D-gal (C) groupD-gal revealinggroup revealing no calbindin no calbindin reaction reaction in necrotic in necrotic Purkinje Purkinje cells (arrowhead).cells (arrowhead). (D) D-gal+TQ (D) D-gal+TQ group. group. (E) (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of positive Purkinje cells in dif- D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantiﬁcation of positive Purkinje cells in different ferent groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸ p < +++ xxx φ comparison0.05 vs. D-gal+TQ. test. *** ###p p< < 0.001 0.001 vs. vs. control. D-gal+TQ+Cur.p < 0.001 Error vs. bars vehicle. representp mean< 0.001 ± SD. vs. D-gal.n = 10. p < 0.05 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10. In rat cerebellum, the staining by immunohistochemistry of ionized calcium-binding In rat cerebellum, the staining by immunohistochemistry of ionized calcium-binding adapter molecule 1 (IBA1) revealed a low number of microglia in negative control and adapter molecule 1 (IBA1) revealed a low number of microglia in negative control and vehicle groups (Figure 5A,B). However, in all cerebellar layers, the D-gal group showed vehicle groups (Figure5A,B). However, in all cerebellar layers, the D-gal group showed the the highest microglia (Figure 5C). In D-gal+TQ, a lower number of microglia was revealed highest microglia (Figure5C). In D-gal+TQ, a lower number of microglia was revealed than than in the D-gal group (Figure 5D). A moderate number of microglia was shown in D- in the D-gal group (Figure5D). A moderate number of microglia was shown in D-gal+Cur gal+Cur (Figure 5E). D-gal+TQ+Cur revealed the lowest number of microglia (Figure 5F). (Figure5E). D-gal+TQ+Cur revealed the lowest number of microglia (Figure5F). In the D-gal group, a signiﬁcant (p < 0.001) lowering in the expression of the number of microglia by statistical analysis reduced the number of microglia compared with the control rats. In

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 7 of 22

Int. J. Mol. Sci. 2021, 22, 6839 7 of 22

In the D-gal group, a significant (p < 0.001) lowering in the expression of the number of microglia by statistical analysis reduced the number of microglia compared with the con- thetrol D-gal+TQ,rats. In the D-gal+Cur,D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur and D-gal+TQ+Cur treated rats, treated the low rats, number the low of number microglia of wasmicroglia signiﬁcantly was significantly (p < 0.001) ( raisedp < 0.001) (Figure raised5G). (Figure 5G).

Figure 5. Immunohistochemical staining of rat cerebellum by ionized calcium-binding adapter mol- Figure 5. Immunohistochemical staining of rat cerebellum by ionized calcium-binding adapter ecule 1 (IBA1). (A) negative control group showed few microglia. (B) vehicle group. (C) D-Gal group molecule 1 (IBA1). (A) negative control group showed few microglia. (B) vehicle group. (C) D-Gal showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur groupgroup. showed (G) Quantification many positive of microglia. IBA1 in the (D) cerebellu D-gal+TQm group. in different (E) D-gal+Cur groups. group. Scale bar (F) D-gal+TQ+Cur= 50 µm. Data group.were analyzed (G) Quantification with one-way of IBA1ANOVA, in the followed cerebellum by Tukey’s in different multiple groups. comparisonScale bar =test 50. µ**m p. < Data 0.01 wereand *** analyzed p < 0.001 with vs. one-waycontrol. + ANOVA, p < 0.05 and followed +++ p < by0.001 Tukey’s vs. vehicle. multiple xxx comparisonp < 0.001 vs. test. D-gal.** p ɸɸɸ< 0.01p < 0.001and ***vs.p D-gal+TQ.< 0.001 vs. ### control. p < 0.001+ p vs.< 0.05D-gal+TQ+Cur. and +++ p < 0.001Error vs. bars vehicle. representxxx p mean< 0.001 ± SD.vs. D-gal.n = 10. φφφ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10. 2.7. Histopathological Assessment of Rat’s Hippocampus 2.7. Histopathological Assessment of Rat’s Hippocampus Negative control and vehicle groups showed normal hippocampal architecture (Fig- Negative control and vehicle groups showed normal hippocampal architecture ure S5A,B). However, in the D-gal group, the necrosis of dentate gyrus neurons was in- (Figure S5A,B). However, in the D-gal group, the necrosis of dentate gyrus neurons was tensive. Also, the layers and number of hippocampal cells were lowered with disordered intensive. Also, the layers and number of hippocampal cells were lowered with disordered cells and most cells were shrunken, with pyknosis in nuclei (Figure S5C). D-gal+TQ cells and most cells were shrunken, with pyknosis in nuclei (Figure S5C). D-gal+TQ showed lower necrotic hippocampal cells than the D-gal group (Figure S5D). A relatively normal hippocampal structure was revealed in D-gal+Cur compared with the negative control

Int. J. Mol. Sci. 2021, 22, 6839 8 of 22

group (Figure S5E). The highest protective effects on hippocampal architecture were seen in D-gal+TQ+Cur (Figure S5F). A signiﬁcant (p < 0.001) more elevated hippocampal necrosis scores in the D-gal group were revealed by statistical analysis of hippocampal lesion scores than the control group rats. On the other hand, in the D-gal group, D-gal+TQ (p < 0.01), D- gal+Cur (p < 0.001), and D-gal+TQ+Cur (p < 0.001) groups, rats showed a marked lowering in the hippocampal lesions score (Figure S5G). Hippocampal necrosis in D-gal+TQ+Cur was markedly (p < 0.001) decreased compared with D-gal+TQ and D-gal+Cur.

2.8. Immunohistochemistry Assessment of Hippocampus Negative control and vehicle groups revealed a negative reaction for caspase 3 in the hippocampus (Figure6A,B), while the strongest caspase 3 reaction was revealed in the D-gal group (Figure6C). A lower caspase 3 distribution was shown in D-gal+TQ than the D-gal group (Figure6D). A very low distribution of caspase 3 nuclei was revealed in D-gal+Cur (Figure6E). The weakest caspase 3 reaction was seen in D-gal+TQ+Cur (Figure6F). In the D-gal group, a marked ( p < 0.001) elevated expression of caspase 3 was revealed by statistical analysis of the number of caspase 3 nuclei in the hippocampal layers with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the high caspase 3 expression was markedly (p < 0.001) lowered (Figure6G). Caspase 3 levels in D-gal+TQ+Cur were markedly (p < 0.001) decreased compared to for D-gal+TQ and D-gal+Cur groups. Immunohistochemical staining of rat hippocampal dentate gyrus with calbindin revealed strong calbindin reaction negative control and vehicle groups (Figure7A,B). However, a reduced calbindin reaction was seen in the D-gal group (Figure7C). A more elevated number of positive calbindin cells D-gal+TQ was revealed than the D-gal group (Figure7D). D-gal+Cur revealed a moderate number of positive calbindin cells ( Figure7E ). D-gal+TQ+Cur revealed the highest number of positive calbindin cells (Figure7F). In the D-gal group, a marked (p < 0.001) reduction in the expression of positive calbindin cells was revealed by statistical analysis of positive calbindin cells compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the reduction in expression of positive calbindin cells was markedly (p < 0.001) elevated (Figure7G). Hippocampal calbindin was signiﬁcantly (p < 0.001) increased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur. Immunohistochemical staining of rat hippocampal dentate gyrus by ionized calcium- binding adapter molecule 1 (IBA1) revealed a low number of microglia in negative control and vehicle groups (Figure8A,B). However, in the D-gal group, the highest number of microglia in all layers was shown (Figure8C). A lower number of microglia was revealed in the D-gal+TQ than the D-gal group (Figure8D). A moderate number of microglia was shown in D-gal+Cur (Figure8E). D-gal+TQ+Cur revealed the lowest number of microglia (Figure8F). In the D-gal group, a marked ( p < 0.001) reduction in the number of microglia was revealed by statistical analysis of the number of microglia compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the reduction in the number of microglia was markedly (p < 0.001) elevated (Figure8G). Hippocampal IBA1 content was signiﬁcantly (p < 0.001) increased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur. Int.Int. J. J. Mol. Mol. Sci. Sci. 20212021,, 22, 6839x FOR PEER REVIEW 9 of 229 of 22

FigureFigure 6. 6.Immunohistochemical Immunohistochemical staining staining of of rat rat hippocampus hippocampus by caspaseby caspase 3. (A 3.) negative(A) negative control control group.group. ( B(B)) vehicle vehicle group. group. (C ()C D-gal) D-gal group group revealing revealing strong strong caspase caspase 3 reaction. 3 reaction. (D) D-gal+TQ(D) D-gal+TQ group. group. ((EE)) D-gal+Cur D-gal+Cur group. group. (F ()F D-gal+TQ+Cur) D-gal+TQ+Cur group. group. (G )(G Quantiﬁcation) Quantification of caspase of caspase 3 in the3 in hippocampus the hippocampus inin differentdifferent groups. groups. Scale Scale bar bar = 50= 50µm. µm Data. Data were were analyzed analyzed with with one-way one-way ANOVA, ANOVA, followed followed by by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D- Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = D-gal. φφφ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. 10. n = 10. Immunohistochemical staining of rat hippocampal dentate gyrus with calbindin revealed strong calbindin reaction negative control and vehicle groups (Figure 7A,B). How- ever, a reduced calbindin reaction was seen in the D-gal group (Figure 7C). A more elevated number of positive calbindin cells D-gal+TQ was revealed than the D-gal group (Figure 7D). D-gal+Cur revealed a moderate number of positive calbindin cells (Figure 7E). D-gal+TQ+Cur revealed the highest number of positive calbindin cells (Figure 7F). In the D-gal group, a marked (p < 0.001) reduction in the expression of positive calbindin cells was revealed by statistical analysis of positive calbindin cells compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the reduction in expression of positive calbindin cells was markedly (p < 0.001) elevated (Figure 7G). Hip- pocampal calbindin was significantly (p < 0.001) increased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur.

Int.Int. J. J. Mol. Mol. Sci. Sci. 20212021,, 22, x 6839 FOR PEER REVIEW 10 of10 22 of 22

FigureFigure 7. 7.Immunohistochemical Immunohistochemical staining staining of rat of hippocampus rat hippocampus by calbindin. by calbindin. (A) negative (A) control negative group control showinggroup showing the high the reaction high ofreaction calbindin. of calbindin. (B) vehicle ( group.B) vehicle (C) D-galgroup. group (C) D-gal showed group many showed positive many microglia.positive microglia. (D) D-gal+TQ (D) D-gal+TQ group. (E) group. D-gal+Cur (E) group.D-gal+Cur (F) D-gal+TQ+Cur group. (F) D-gal+TQ+Cur group. (G) Quantiﬁcation group. (G) Quan- oftification positive of cells positive in different cells in groups. different Scale groups. bar = 50 Scaleµm. bar Data = were50 µm analyzed. Data were with analyzed one-way ANOVA,with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. vehicle. xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10. xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10. Immunohistochemical staining of rat hippocampal dentate gyrus by ionized calcium- binding adapter molecule 1 (IBA1) revealed a low number of microglia in negative control and vehicle groups (Figure 8A,B). However, in the D-gal group, the highest number of microglia in all layers was shown (Figure 8C). A lower number of microglia was revealed in the D-gal+TQ than the D-gal group (Figure 8D). A moderate number of microglia was shown in D-gal+Cur (Figure 8E). D-gal+TQ+Cur revealed the lowest number of microglia (Figure 8F). In the D-gal group, a marked (p < 0.001) reduction in the number of microglia was revealed by statistical analysis of the number of microglia compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the reduction in the number of microglia was markedly (p < 0.001) elevated (Figure 8G). Hippocampal IBA1 content was significantly (p < 0.001) increased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur.

Int. J. Mol. Sci. 2021, 22, 6839 11 of 22 Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 11 of 22

Figure 8.8. ImmunohistochemicalImmunohistochemical stainingstaining ofof ratrat hippocampushippocampus byby ionizedionized calcium-bindingcalcium-binding adapteradapter molecule 1 1 (IBA1). (IBA1). (A ()A the) the negative negative control control group group showed showed few fewmicroglia. microglia. (B) vehicle (B) vehicle group. group.(C) D- (galC) D-galgroupgroup showed showed many manypositive positive microglia. microglia. (D) D-gal+TQ (D) D-gal+TQ group. group.(E) D-gal+Cur (E) D-gal+Cur group. group.(F) D- gal+TQ+Cur group. (G) Quantification of IBA1 in the hippocampus in different groups. Scale bar = (F) D-gal+TQ+Cur group. (G) Quantiﬁcation of IBA1 in the hippocampus in different groups. 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple com- *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p +++ xxx φφφ parison< 0.001 vs. test. D-gal+TQ+Cur. *** p < 0.001 vs. Error control. bars representp < 0.001 mean vs. vehicle.± SD. n = 10.p < 0.001 vs. D-gal. p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.

2.9. Histopathological Assessment of Rat’s HeartHeart Negative controlcontrol and and vehicle vehicle groups groups showed showed normal normal cardiac cardiac architecture architecture(Figure (Figure S6A,B). However,S6A,B). However, the disarrayed the disarrayed necrotic necrotic myoﬁbers myofibers were demonstrated were demonstrated in the D-galin the groupD-gal (groupFigure (Figure S6C). D-gal+TQ S6C). D-gal+TQ showed showed reduced reduced necrosis necrosis and improvement and improvement of cardiac of cardiac myocytes my- (Figureocytes (Figure S6D). AS6D). relatively A relatively normal normal cardiac cardiac structure structure as a negativeas a negative control control group group was was revealedrevealed in in D-gal+Cur D-gal+Cur (Figure (Figure S6E). S6E). The The best best protection protection of of cardiac cardiac architecturearchitecture waswas shownshown inin D-gal+TQ+CurD-gal+TQ+Cur (Figure (Figure S6F). S6F). A marked (p < 0.001) higher cardiac necrosisnecrosis scorescore waswas declared by statisticalstatistical analysis of cardiac lesionlesion scores than the ratsrats inin thethe controlcontrol groupgroup or inin thethe D-galD-gal group.group. OnOn thethe otherother hand,hand,D-gal+TQ, D-gal+TQ, D-gal+Cur,D-gal+Cur, andand D-gal+TQ+CurD-gal+TQ+Cur groups revealedrevealed aa markedmarked ((pp << 0.001) lower cardiac lesion scorescore thanthan thethe ratsrats D-galD-gal groupgroup ((FigureFigure S6GS6G).). D-gal+TQ+CurD-gal+TQ+Cur exhibited a considerable ((p << 0.001) reduction inin heartheart tissuetissue necrosis comparedcompared withwith D-gal+TQD-gal+TQ and D-gal+Cur.

Int. J. Mol. Sci. 2021, 22, 6839 12 of 22 Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 12 of 22

2.10.2.10. ImmunohistochemistryImmunohistochemistry AssessmentAssessment ofof HeartHeart InIn negativenegative controlcontrol andand vehiclevehicle groups,groups, ratrat cardiaccardiac sectionssections stainedstained immunohisto-immunohisto- chemicallychemically byby Bcl2Bcl2 revealedrevealed thethe highesthighest reactionreaction ofof Bcl2Bcl2 inin cardiaccardiac myocytesmyocytes (Figure(Figure9 9A,B).A,B). However,However, aa weakweak Bcl2Bcl2 responseresponse inin mostmost cardiaccardiac myocytesmyocytes waswas shownshown inin thethe D-galD-gal groupgroup (Figure(Figure9 C).9C). A A stronger stronger Bcl2 Bcl2 reaction reaction was was revealed revealed in the in D-gal+TQthe D-gal+TQ group group (Figure (Figure9D). The 9D). D-gal+CurThe D-gal+Cur group group indicated indicated a moderate a moderate Bcl2 response Bcl2 response (Figure9 E).(Figure D-gal+TQ+Cur 9E). D-gal+TQ+Cur showed theshowed strongest the strongest Bcl2 reaction Bcl2 (Figurereaction9F). (Figure A marked 9F). A ( markedp < 0.001) (p lowered< 0.001) lowered Bcl2expression Bcl2expres- was revealedsion was inrevealed the D-gal in the group D-gal by group statistical by statistical analysis ofanalysis Bcl2 distribution of Bcl2 distribution in the cardiac in the my-car- ocytesdiac myocytes compared compared with the controlwith the rats. control A reduced rats. A Bcl2 reduced expression Bcl2 expression in the D-gal in group the D-gal was signiﬁcantlygroup was (significantlyp < 0.001) increased (p < 0.001) in the D-gal+TQ,increased in D-gal+Cur, the D-gal+TQ, and D-gal+TQ+Cur D-gal+Cur, treatedand D- ratsgal+TQ+Cur (Figure9G). treated Cardiac rats Bcl2 (Figure content 9G). was Cardiac markedly Bcl2 (contentp < 0.001) was elevated markedly in D-gal+TQ+Cur (p < 0.001) ele- comparedvated in D-gal+TQ+Cur to in D-gal+TQ compared and D-gal+Cur. to in D-gal+TQ and D-gal+Cur.

FigureFigure 9.9. ImmunohistochemicalImmunohistochemical staining staining of of ratrat heartheart byby Bcl2.Bcl2.( (AA)) negativenegative control control group. group. ( (BB)) vehicle vehicle group.group. (C) D-gal group. ( (DD)) D-gal+TQ D-gal+TQ group. group. (E ()E D-gal+Cur) D-gal+Cur group. group. (F) (D-gal+TQ+CurF) D-gal+TQ+Cur group. group. (G) Quantification of Bcl2 in different groups. Scale bar = 50 µm. Data were analyzed with one-way (G) Quantiﬁcation of Bcl2 in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars xxx p φφφ p ### p vehicle.represent mean< 0.001 ± SD. vs. n = D-gal. 10. < 0.001 vs. D-gal+TQ. < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.

Int. J. Mol. Sci. 2021, 22, 6839 13 of 22 Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 13 of 22

A negative caspase 3 reactions inin allall myocytes werewere revealedrevealed inin negativenegative controlcontrol andand vehiclevehicle groupsgroups (Figure(Figure 1010A,B).A,B). InIn contrast,contrast, thethe strongeststrongest caspasecaspase 33 reactionreaction inin allall cardiaccardiac myocytes was revealed inin thethe D-galD-gal groupgroup (Figure(Figure 1010C).C). InIn D-gal+TQ,D-gal+TQ, aa lessless reducedreduced caspasecaspase 33 distributiondistribution waswas shownshown thanthan thethe D-galD-gal groupgroup (Figure(Figure 1010D).D). AA veryvery lowlow caspasecaspase 3 distributiondistribution waswas revealedrevealed inin D-gal+CurD-gal+Cur (Figure 1010E).E). TheThe weakestweakest caspasecaspase 33 reactionsreactions couldcould bebe seenseen inin D-gal+TQ+Cur D-gal+TQ+Cur (Figure (Figure 10 10F).F). In In the the D-gal D-gal group group compared compared with with the the control con- rats,trol rats, A marked A marked (p <0.001) (p < 0.001) a high a expression high expression of caspase of caspase 3 by statistical 3 by statistical analysis analysis of caspase of 3caspase distribution. 3 distribution. The increased The increased caspase caspase 3 expression 3 expression markedly markedly reduced reduced in the D-gal+TQ in the D- p p p (gal+TQ< 0.01) (p, D-gal+Cur< 0.01), D-gal+Cur ( < 0.001), (p < and0.001), D-gal+TQ+Cur and D-gal+TQ+Cur ( < 0.001) (p < 0.001) treated treated rats (Figure rats (Figure 10G). Cardiac caspase 3 content was markedly (p < 0.001) decreased in D-gal+TQ+Cur compared 10G). Cardiac caspase 3 content was markedly (p < 0.001) decreased in D-gal+TQ+Cur to in D-gal+TQ and D-gal+Cur. compared to in D-gal+TQ and D-gal+Cur.

Figure 10. ImmunohistochemicalImmunohistochemical staining staining of of rat rat heart heart by by caspase caspase 3. 3.(A) ( Anegative) negative control control group. group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction in nuclei. (D) D-gal+TQ group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction in nuclei. (D) D-gal+TQ (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the heart in dif- group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantiﬁcation of caspase 3 in the heart ferent groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s inmultiple different comparison groups. Scale test. *** bar p = < 500.001µm. vs. Data control. were +++ analyzed p < 0.001 withvs. vehicle. one-way xx p ANOVA, < 0.01 and followed xxx p < 0.001 by +++ xx Tukey’svs. D-gal. multiple ### p < 0.001 comparison vs. D-gal+TQ+Cur. test. *** p < Error 0.001 vs.bars control. represent meanp < 0.001 ± SD. vs. n = vehicle. 10. p < 0.01 and xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.

Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 14 of 22

2.11. Effect of Thymoquinone and Curcumin on the Aging-Altered Genes in the Brain A marked increase in the expression of TP53 was revealed in D-gal (p < 0.001), D- gal+TQ (p < 0.05), and D-gal+Cur (p < 0.001) in comparison with the control group. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur, the TP53 were markedly downregulated (p < 0.001) compared with the D-gal group. Besides, TP53 in the D-gal+Cur group was markedly (p < 0.05) elevated compared with the D-gal+TQ+Cur combination group (Figure 11A). The illustrated data in Figure 11B showed significant (p < 0.001) upregulation of p21 Int. J. Mol. Sci. 2021, 22, 6839 in D-gal compared with the control, while D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur14 of 22 groups, the p21 relative gene expression was markedly (p < 0.001) downregulated compared with the D-gal. BCL2 relative expression was markedly (p < 0.001) downregulated in D-gal compared 2.11. Effect of Thymoquinone and Curcumin on the Aging-Altered Genes in the Brain with the control, while in comparison with the D-gal, the BCL2 expressions were signifi- cantlyA (p marked < 0.001) increase upregulated in the in expression the D-gal+TQ, of TP53 D-gal+Cur,was revealed and D-gal+TQ+Cur in D-gal (p < groups 0.001), (FigureD-gal+TQ 11C). (p In< 0.05),contrast, and in D-gal+Cur the D-gal group, (p < 0.001) the relative in comparison expressions with of the Bax control (Figure group. 11D) andIn the CASP- D-gal+TQ,3 (Figure D-gal+Cur, 11E) were andmarkedly D-gal+TQ+Cur, (p < 0.001) theupregulatedTP53 were in markedlycomparison downregu- with the control,lated (p while< 0.001 in) the compared D-gal+TQ, with D-gal+Cur, the D-gal and group. D-gal+TQ+Cur Besides, TP53 groups,in the the D-gal+Cur expression group lev- elswas of markedly Bax and CASP-3 (p < 0.05) were elevated markedly compared (p < 0.001) with downregulated the D-gal+TQ+Cur in D-gal+TQ, combination D-gal+Cur, group and(Figure D-gal+TQ+Cur 11A). groups in comparison with the D-gal (Figure 11C).

FigureFigure 11. 11. ExpressionExpression of of fold fold changes changes of of brain brain ( (AA)) TP53TP53,,( (BB)) p21p21,,( (CC)) BCL2BCL2,,( (DD)) BaxBax,, and and ( (EE)) CASP-3CASP-3..

DataData were analyzedanalyzed withwith one-way one-way ANOVA, ANOVA, followed followed by by Tukey’s Tukey’s multiple multiple comparison comparison test. test.* p < * 0.05p <, + ++ +++ xxx 0.05,** p <** 0.01,p < 0.01, and and *** p***

The illustrated data in Figure 11B showed signiﬁcant (p < 0.001) upregulation of p21 in D-gal compared with the control, while D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups, the p21 relative gene expression was markedly (p < 0.001) downregulated compared with the D-gal. BCL2 relative expression was markedly (p < 0.001) downregulated in D-gal compared with the control, while in comparison with the D-gal, the BCL2 expressions were signiﬁ- cantly (p < 0.001) upregulated in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups (Figure 11C). In contrast, in the D-gal group, the relative expressions of Bax (Figure 11D) and CASP-3 (Figure 11E) were markedly (p < 0.001) upregulated in comparison with the control, while in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups, the expression lev- Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 15 of 22

Int. J. Mol. Sci. 2021, 22, 6839 15 of 22

2.12. Effect of Thymoquinone and Curcumin on the Aging-Altered Genes in Heart els ofThereBax and is aCASP-3 significantwere upregulation markedly (p of< 0.001)the TP53 downregulated relative expression in D-gal+TQ, levels in D-gal+Cur, D-gal (p < and0.001) D-gal+TQ+Cur and D-gal+Cur groups (p < 0.05) in comparison in comparison with with the D-galthe control. (Figure In 11 theC). D-gal+TQ (p < 0.01) and D-gal+TQ+Cur (p < 0.001) groups, TP53 was markedly downregulated in comparison 2.12.with Effectthe D-gal of Thymoquinone (Figure 12A). and Curcumin on the Aging-Altered Genes in Heart ThereIn Figure is a 12B, signiﬁcant the data upregulation revealed significant of the TP53 upregulationrelative expression in p21 in D-gal levels (p in < D-gal0.001) (andp < 0.001D-gal+Cur) and D-gal+Cur(p < 0.05) in (comparisonp < 0.05) in with comparison the control. with Also, the control.it was significantly In the D-gal+TQ upreg- (ulatedp < 0.01) in andD-gal+TQ D-gal+TQ+Cur (p < 0.05) and (p < D-gal+TQ+Cur 0.001) groups, (TP53p < 0.001)was groups markedly compared downregulated with the inD- comparisongal. with the D-gal (Figure 12A).

FigureFigure 12.12. ExpressionExpression ofof foldfold changeschanges ofof heartheart ((AA)) TP53TP53,(, (BB)) p21p21,(, (CC)) BCL2BCL2,(, (DD)) BaxBax,, andand ((EE)) CASP-3CASP-3.. DataData werewere analyzed analyzed with with one-way one-way ANOVA, ANOVA, followed followed by Tukey’sby Tukey’s multiple multiple comparison comparison test. *test.p < 0.05* p < and0.05 ***andp ***< 0.001 p < 0.001 vs. control.vs. control.++ p++

InA Figuresignificant 12B, thedownregulation data revealed ( signiﬁcantp < 0.001) upregulationof the BCL2 expression in p21 in D-gal in the (p

Int. J. Mol. Sci. 2021, 22, 6839 16 of 22

D-gal+TQ (p < 0.001), D-gal+Cur (p < 0.01), and D-gal+TQ+Cur (p < 0.001) groups, Bax was signiﬁcantly downregulated in comparison with the D-gal. A marked (p < 0.001) increase of CASP-3 relative expression levels was revealed in D-gal compared with the control and vehicle groups. In contrast, it was signiﬁcantly (p < 0.001) downregulated in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups in comparison with the D-gal.

3. Discussion Aging (senescence) is the loss of organ and tissue function gradually with time [25]. The losses of age-associated functions are because of the cumulation of oxidative damage macromolecules (proteins, DNA, and lipids) by ROS and RNS [26]. Senescent cells pile through aging and have been involved in enhancing various age-related diseases [27]. Senescence inducers led to upregulation of p53, which elevated the cyclin-dependent kinase inhibitor p21(WAF1/CIP1), mainly mediating G1 growth arrest [28]. The mechanism D-gal inducing aging is well recognized and based on generation of ROS and RNS that induce inflammation and apoptosis of different body cells [4,5]. In the current study, we assessed the aging and apoptotic markers due to D-gal administration and the protective role of TQ, Cur and their combination. D-gal significantly upregulated p21 and TP53, leading to aging oxidative alterations in brain and heart tissues. D-gal- induced upregulation of p21 and p53 in mouse [29] and rat [30] models treated by D-gal. Moreover, western blot results revealed upregulation of the p53/p21 signaling pathway in mice’s hippocampus [31]. TQ, Cur, and their combination significantly downregulated the increased expression of p21 and TP53 because of D-gal. Also, TQ is responsible for apoptosis induction in colorectal cancer by inhibiting the p53-dependent CHEK1 [32]. Some rationales suggest that curcumin’s anti-aging function is due to its ability to postpone cellular senescence in cells building the vasculature [32]. An elevated ROS level accompanies humans’ aging and higher animals in mitochondria, inducing apoptosis, lowering the functioning cells’ number [33]. D-gal-stimulated brain aging exhibited changes in cognitive function and brain mitochondria [34]. Also, hypertrophy of the myocytes and myocytes’ loss are characteristic foraging in the mam- malian heart [35]. During heart failure and normal heart aging, necrosis and apoptosis mechanisms are involved in myocyte cell loss [36,37]. In the present study, D-gal induced necrosis and apoptosis of brain and heart tissues monitored by upregulation of apoptotic (CASP-3 and Bax genes and caspase 3 protein) and downregulation of antiapoptotic (Blc2 gene and protein) markers. In the same context, D-gal induced significant decreases in the Bax/Bcl-2 ratio and caspase-3 in mice’s brains [38] and rats [39]. Also, D-gal markedly lowered the Bax/Bcl-2 ratio and caspase-3 in aging rats’ cardiomyocytes [40]. In contrast, TQ and Cur attenuated the necrotic and apoptotic alterations of rats’ brains and hearts, especially their combination. Similarly, Abulfadl et al. [41] stated that TQ prevented D- gal/AlCl3-induced cognitive decline by promoting synaptic plasticity and cholinergic function and suppressing neuronal apoptosis oxidative damage and neuroinflammation in rats. Also, curcumin minimized the alterations induced in Purkinje cells [42] and cleaved caspase-3 expression [43] in rats due to D-gal. Calcium has a pivotal role in the neurodegeneration process and has an essential role as an intracellular signaling mediator [44]. Therefore, multiple injury pathways meet to stimulate an extra increase in intracellular calcium levels, inducing a series of caspases leading to the apoptosis onset. So, the calcium homeostasis maintenance within neurons is essential to their health, including many mechanisms [45]. Calbindin is a calcium-binding protein that protects neurons against damage caused by excessive Ca2+ elevation [46]. Thus, in the current investigation, D-gal induced reduced brain calbindin in rats leading to activation of caspase 3 that induced apoptosis of brain tissue, while TQ, Cur, and their combinations attenuated the calbindin reduction due to D-gal. There is no published article regarding the influence of D-gal or TQ on brain calbindin expression. At the same time, Int. J. Mol. Sci. 2021, 22, 6839 17 of 22

curcuminoid submicron particle consumption inverted spatial memory deficits and the loss of calbindin in the hippocampus of the Alzheimer’s disease mouse model [47]. IBA1 is a cytoskeleton protein localized only in macrophages and microglia [48]. The IBA1 expression is upregulated in stimulated microglia after ischemia [49], peripheral nerve injury [50,51], and many brain diseases [52]. In the present investigation, we recognized a marked elevation in IBA1 expression in brain tissue. Similarly, D-gal significantly increased the neuroinflammatory marker, IBA1, in the mouse brain [53,54]. Conversely, TQ and Cur and their combinations significantly reduced the elevated IBA1 in response to D-gal.

4. Materials and Methods 4.1. Ethics Statement Faculty of Veterinary Medicine Ethics Committee, University of Damanhour, Egypt endorsed this investigation (DVM-034-20, January 2020), according to the NIH Guide for the Care and Use of Laboratory Animals.

4.2. Experimental Design Forty-eight adults male Wistar rats (120 ± 20 g) were purchased from the Center of Medical Research and Services, Alexandria University, Egypt and housed in standard laboratory conditions with a 12 h light/dark cycle. Drinking water and food pellets were provided ad libitum. The ingredients of the basal diet are listed in Table1[ 11]. After 10 days, the rats were randomly allocated into six groups (n = 8 per group) in three replicates each, including control group; raised on distilled water administered by gavage and basal diet along with a subcutaneous injection of physiological saline solution (0.9%), vehicle group; raised on corn oil was administered with gavage and basal diet along with a subcutaneous injection of physiological saline solution (0.9%) for 42 days, D-gal group, raised on basal diet and injected subcutaneously with 200 mg of D-gal dissolved in saline solution per kg body weight (BW) and corn oil orally per day for 42 days [55]; The D-gal+TQ group, reared on a basal diet and injected subcutaneously with 200 mg of D-gal per kg BW daily along with oral supplementation of TQ (Sigma-Aldrich, St. Louis, MO, USA) dissolved in corn oil by a dose of 20 mg per kg BW daily for 42 days [56]. The D-gal+Cur group, reared on basal diet and injected subcutaneously with 200 mg of D-gal per kg BW daily along with oral supplementation of Cur (Sigma-Aldrich) dissolved in corn oil by a dose of 20 mg per kg BW daily for 42 days [21,57], and D-gal+TQ+Cur group; received the basal diet and injected subcutaneously with 200 mg of D-gal per kg BW daily along with oral supplementation of TQ (20 mg per kg BW.) and Cur (20 mg per kg BW) dissolved in corn oil daily for 42 days (Figure 13).

Table 1. Ingredients of the basal diet.

Ingredients g/kg Diet Corn ﬂour 529.5 Casein 200 Sucrose 100 Soybean oil 70 Cellulose 50 Mineral mix 35 Vitamin mix 10 L-cystine 3 Choline 2.5 Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 18 of 22 Int. J. Mol. Sci. 2021, 22, 6839 18 of 22

FigureFigure 13. 13.Experimental Experimental design design scheme. scheme. D-gal; D-gal; D-galactose, D-galactose, S/C; S/C; subcutaneous, subcutaneous, TQ; TQ; thymoquinone, thymoquinone, Cur;Cur; curcumin, curcumin, B.W.; B.W.; body body weight. weight.

4.3.4.3. Sampling Sampling ToTo confirm confirm the the correct correct sampling, sampling, rats rats were were anesthetized anesthetized with with an intravenousan intravenous pentobar- pento- bitalbarbital injection injection (30 mg/kg) (30 mg/kg) in each in each group group (n = 5 ( pern = 5 group) per group) on day on 42. day Samples 42. Samples of blood of wereblood leftwere to coagulateleft to coagulate and then and centrifuged then centrifuged for 15 min for at 15 1409 min× atg to1409 obtain xg to serum obtain for serum biochemical for bio- analyses.chemical analyses. ForFor sample sample fixation,fixation, parts of of each each rat’s rat’s br brainain and and heart heart were were washed washed with with phosphate phos- phatebuffer buffer saline saline (PBS, (PBS, pH 7.4) pH and 7.4) fixed and fixedin 4% in paraformaldehyde 4% paraformaldehyde dissolved dissolved in PBS in for PBS histo- for histopathologypathology and and immunohistochemistry immunohistochemistry examinatio examinations.ns. For For relative relative expression expression analyses analyses of ◦ ofmRNA, mRNA, other other parts parts of of the the brain brain and heart werewere frozenfrozen at at− −8080 °C.C. Also,Also, liver,liver, spleen, spleen, and and kidneykidney samples samples were were taken taken for for histopathology. histopathology. 4.4. Biochemical, Histopathological, Immunohistochemical, and Reverse Transcription-Polymerase 4.4. Biochemical, Histopathological, Immunohistochemical, and Reverse Transcription- Chain Reaction (RT-PCR) Assessments Polymerase Chain Reaction (RT-PCR) Assessments Serum samples were subjected to determination of glucose, AST, ALT, creatinine, urea, and uricSerum acid samples levels following were subjected the instructions to determinat of theion manufacturer of glucose, (Biodiagnostic, AST, ALT, creatinine, Dokki, Giza,urea, Egypt). and uric acid levels following the instructions of the manufacturer (Biodiagnostic, Dokki,Histopathological Giza, Egypt). [58], immunohistochemistry [59,60], and RT-PCR assessments of brain andHistopathological heart samples [58], were immunohistochemistry done as described in our [59,60], previous and study,RT-PCR El-Far assessments et al. [61 ].of Antibodiesbrain and usedheart insamples the immunohistochemical were done as described assay in are our listed previous in Table study,2, and El-Far the primer’set al. [61]. sequenceAntibodies of testedused in genes the immunohistochemical is listed in Table3. assay are listed in Table 2, and the primer’s sequence of tested genes is listed in Table 3.

Int. J. Mol. Sci. 2021, 22, 6839 19 of 22

Table 2. Antibodies, sources, working dilutions, and conditions for antigen retrieval (10 mM citrate buffer at pH 6.0).

Antibody Source Dilution Antigen Retrieval Heating Condition Rabbit polyclonal (9662, Cell Signaling Technology, 10 mM citrate buffer 1:300 105 ◦C, 20 min anti-caspase 3 Danvers, MA, USA (pH 6.0) Rabbit polyclonal 10 mM citrate buffer (019-19741, Wako Osaka, Japan) 1:1200 105 ◦C, 20 min anti-Iba1 (pH 6.0) Rabbit polyclonal (E10340, Spring Bioscience, 10 mM citrate buffer 1:500 105 ◦C, 20 min anti-calbindin antibody Pleasanton, CA, USA (pH 6.0) Rabbit polyclonal 10 mM citrate buffer (SC-492, Santa Cruz, CA, USA) 1:300 90 ◦C, 20 min anti-bcl2 (pH 6.0)

Table 3. Primers’ sequences for RT-PCR.

Accession Genes Genes Forward (50-30) Reverse (50-30) No./References p21 GTGAGACACCAGAGTGCAAGA ACAGCGATATCGAGACACTCA [62] TP53 CACAGTCGGATATGAGCATC GTCGTCCAGATACTCAGCAT BCL2 GATTGTGGCCTTCTTTGAGT ATAGTTCCACAAAGGCATCC NM_016993/[63] Bax GGCGAATTGGCGATGAACTG ATGGTTCTGATCAGCTCGGG NM_017059/[64] CASP-3 TTTGCGCCATGCTGAAACT ACGAGTGAGGATGTGCATGAATT NM_012922.2 GAPDH TCAAGAAGGTGGTGAAGCAG AGGTGGAAGAATGGGAGTTG NM_017008.4/[65] (Housekeeping) Bax, Bcl-2-associated X protein; BCL2, B-cell lymphoma 2; CASP-3, caspase-3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

4.5. Statistical Analyses Data were analyzed with one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test using GraphPad Prism 5 (San Diego, CA, USA). All declarations of signiﬁcance depended on p < 0.05.

5. Conclusions Aging is associated with oxidative stress alterations in different body organs. D-gal induced histopathological changes in the brain, heart, liver, spleen, and kidney tissues, besides signiﬁcantly enhancing apoptosis. TQ and Cur defeated the oxidative alterations of the brain and heart activated by D-gal. Interestingly, the TQ and Cur combination exhibited more protection for brain and heart tissues than TQ or Cur supplemented alone. These results proved the anti-aging potential of a TQ and Cur supplementary combination.

Supplementary Materials: The following are available online at https://www.mdpi.com/article/10 .3390/ijms22136839/s1. Author Contributions: Conceptualization, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.- Z., S.K.A.J., S.A.M., and A.E.N.; methodology, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., and A.E.N.; software, A.H.E.-F.; validation, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; formal analysis, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; investigation, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., and A.E.N.; resources, A.H.E.-F., Y.H.A.E., and E.-Z.A.A.; data curation, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., and A.E.N.; writing—original draft preparation, A.H.E.- F.; writing—review and editing, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., S.A.M., and A.E.N.; visualization, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; supervision, A.H.E.-F., S.K.A.J., and S.A.M.; project administration, A.H.E.-F.; funding acquisition, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Int. J. Mol. Sci. 2021, 22, 6839 20 of 22

Institutional Review Board Statement: The study was conducted according to the guidelines of the NIH for the Care and Use of Laboratory Animals and approved by the Institutional Review Board of the Faculty of Veterinary Medicine, University of Damanhour, Egypt (DVM-034-20, January 2020). Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available in the currect article or supplementary material. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Chen, W.K.; Tsai, Y.L.; Shibu, M.A.; Shen, C.Y.; Chang-Lee, S.N.; Chen, R.J.; Yao, C.H.; Ban, B.; Kuo, W.W.; Huang, C.Y. Exercise training augments Sirt1-signaling and attenuates cardiac inflammation in D-galactose induced-aging rats. Aging 2018, 10, 4166–4174. [CrossRef] 2. Davalli, P.; Mitic, T.; Caporali, A.; Lauriola, A.; D’Arca, D. ROS, Cell Senescence, and Novel Molecular Mechanisms in Aging and Age-Related Diseases. Oxid. Med. Cell. Longev. 2016, 2016, 1–18. [CrossRef] 3. Zhao, F.; Zhou, Y.; Gao, L.; Qin, X.; Du, G. [Advances in the study of the rat model of aging induced by D-galactose]. Yao Xue Xue Bao 2017, 52, 347–354. 4. Hegab, Z. Role of advanced glycation end products in cardiovascular disease. World J. Cardiol. 2012, 4, 90. [CrossRef] 5. Frimat, M.; Daroux, M.; Litke, R.; Nevière, R.; Tessier, F.J.; Boulanger, E. Kidney, heart and brain: Three organs targeted by ageing and glycation. Clin. Sci. 2017, 131, 1069–1092. [CrossRef][PubMed] 6. Vivarelli, S.; Falzone, L.; Basile, M.S.; Candido, S.; Libra, M. Nitric Oxide in Hematological Cancers: Partner or Rival? Antioxid. Redox Signal. 2021, 34, 383–401. [CrossRef][PubMed] 7. Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: A Key Modulator in Neurodegenerative Diseases. Molecules 2019, 24, 1583. [CrossRef] 8. Chen, X.; Guo, C.; Kong, J. Oxidative stress in neurodegenerative diseases. Neural Regen. Res. 2012, 7, 376–385. [CrossRef] 9. Sahni, S.; Hickok, J.R.; Thomas, D.D. Nitric oxide reduces oxidative stress in cancer cells by forming dinitrosyliron complexes. Nitric Oxide Biol. Chem. 2018, 76, 37–44. [CrossRef][PubMed] 10. Ma, Y.; Ma, B.; Shang, Y.; Yin, Q.; Wang, D.; Xu, S.; Hong, Y.; Hou, X.; Liu, X. Flavonoid-Rich Ethanol Extract from the Leaves of Diospyros kaki Attenuates D-Galactose-Induced Oxidative Stress and Neuroinflammation-Mediated Brain Aging in Mice. Oxid. Med. Cell. Longev. 2018, 2018, 1–12. [CrossRef][PubMed] 11. Atta, M.S.; Almadaly, E.A.; El-Far, A.H.; Saleh, R.M.; Assar, D.H.; Al Jaouni, S.K.; Mousa, S.A. Thymoquinone Defeats Diabetes- Induced Testicular Damage in Rats Targeting Antioxidant, Inflammatory and Aromatase Expression. Int. J. Mol. Sci. 2017, 18, 919. [CrossRef] 12. Atta, M.S.; El-Far, A.H.; Farrag, F.A.; Abdel-Daim, M.M.; Al Jaouni, S.K.; Mousa, S.A. Thymoquinone attenuates cardiomyopathy in streptozotocin-treated diabetic rats. Oxid. Med. Cell. Longev. 2018, 2018, 1–10. [CrossRef] 13. El-Far, A. Thymoquinone Anticancer Discovery: Possible Mechanisms. Curr. Drug Discov. Technol. 2015, 12, 80–89. [CrossRef] 14. El-Far, A.H.; Al Jaouni, S.K.; Li, W.; Mousa, S.A. Protective roles of thymoquinone nanoformulations: Potential nanonutraceuticals in human diseases. Nutrients 2018, 10, 1369. [CrossRef] 15. El-Far, A.H.; Korshom, M.A.; Mandour, A.A.; El-Bessoumy, A.A.; El-Sayed, Y.S. Hepatoprotective efficacy of Nigella sativa seeds dietary supplementation against lead acetate-induced oxidative damage in rabbit—Purification and characterization of glutathione peroxidase. Biomed. Pharmacother. 2017, 89, 711–718. [CrossRef][PubMed] 16. Demiroren, K.; Basunlu, M.T.; Erten, R.; Cokluk, E. A comparison of the effects of thymoquinone, silymarin and N-acetylcysteine in an experimental hepatotoxicity. Biomed. Pharmacother. 2018, 106, 1705–1712. [CrossRef] 17. Üstün, R.; O˘guz,E.K.; ¸Seker, A.; Korkaya, H. Thymoquinone protects DRG neurons from axotomy-induced cell death. Neurol. Res. 2018, 40, 930–937. [CrossRef] 18. Menon, V.P.; Sudheer, A.R. Antioxidant and anti-inflammatory properties of curcumin. Adv. Exp. Med. Biol. 2007, 595, 105–125. 19. Samarghandian, S.; Azimi-Nezhad, M.; Farkhondeh, T.; Samini, F. Anti-oxidative effects of curcumin on immobilization-induced oxidative stress in rat brain, liver and kidney. Biomed. Pharmacother. 2017, 87, 223–229. [CrossRef] 20. Chakraborty, M.; Bhattacharjee, A.; Kamath, J.V. Cardioprotective effect of curcumin and piperine combination against cyclophosphamide-induced cardiotoxicity. Indian J. Pharmacol. 2017, 49, 65–70. [CrossRef][PubMed] 21. Banji, D.; Banji, O.J.F.F.; Dasaroju, S.; Annamalai, A.R.R. Piperine and curcumin exhibit synergism in attenuating d-galactose induced senescence in rats. Eur. J. Pharmacol. 2013, 703, 91–99. [CrossRef] 22. Kunnumakkara, A.B.; Diagaradjane, P.; Anand, P.; Kuzhuvelil, H.B.; Deorukhkar, A.; Gelovani, J.; Guha, S.; Krishnan, S.; Aggarwal, B.B. Curcumin sensitizes human colorectal cancer to capecitabine by modulation of cyclin D1, COX-2, MMP-9, VEGF and CXCR4 expression in an orthotopic mouse model. Int. J. Cancer 2009, 125, 2187–2197. [CrossRef][PubMed] 23. Hu, S.; Xu, Y.; Meng, L.; Huang, L.; Sun, H. Curcumin inhibits proliferation and promotes apoptosis of breast cancer cells. Exp. Ther. Med. 2018, 16, 1266–1272. [CrossRef][PubMed] Int. J. Mol. Sci. 2021, 22, 6839 21 of 22

24. Shakibaei, M.; Mobasheri, A.; Lueders, C.; Busch, F.; Shayan, P.; Goel, A. Curcumin enhances the effect of chemotherapy against colorectal cancer cells by inhibition of NF-κB and Src protein kinase signaling pathways. PLoS ONE 2013, 8, e57218. [CrossRef] 25. Flatt, T. A new definition of aging? Front. Genet. 2012, 3, 148. [CrossRef][PubMed] 26. Beckman, K.B.; Ames, B.N. The free radical theory of aging matures. Physiol. Rev. 1998, 78, 547–581. [CrossRef][PubMed] 27. Regulski, M.J. Cellular Senescence: What, Why, and How. Wounds 2017, 29, 168–174. 28. Galanos, P.; Vougas, K.; Walter, D.; Polyzos, A.; Maya-Mendoza, A.; Haagensen, E.J.; Kokkalis, A.; Roumelioti, F.M.; Gagos, S.; Tzetis, M.; et al. Chronic p53-independent p21 expression causes genomic instability by deregulating replication licensing. Nat. Cell Biol. 2016, 18, 777–789. [CrossRef] 29. Wang, Z.L.; Chen, L.B.; Qiu, Z.; Chen, X.B.; Liu, Y.; Li, J.; Wang, L.; Wang, Y.P. Ginsenoside Rg1 ameliorates testicular senescence changes in D-gal-induced aging mice via anti-inflammatory and antioxidative mechanisms. Mol. Med. Rep. 2018, 17, 6269–6276. [CrossRef] 30. Sun, J.; Jing, S.; Jiang, R.; Wang, C.; Zhang, C.; Chen, J.; Li, H. Metabolomics study of the therapeutic mechanism of schisandra chinensis lignans on aging rats induced by D-galactose. Clin. Interv. Aging 2018, 13, 829–841. [CrossRef] 31. Li, Q.; Zeng, J.; Su, M.; He, Y.; Zhu, B. Acetylshikonin from Zicao attenuates cognitive impairment and hippocampus senescence in D-galactose-induced aging mouse model via upregulating the expression of SIRT1. Brain Res. Bull. 2018, 137, 311–318. [CrossRef] 32. Gali-Muhtasib, H.; Kuester, D.; Mawrin, C.; Bajbouj, K.; Diestel, A.; Ocker, M.; Habold, C.; Foltzer-Jourdainne, C.; Schoenfeld, P.; Peters, B.; et al. Thymoquinone triggers inactivation of the stress response pathway sensor CHEK1 and contributes to apoptosis in colorectal cancer cells. Cancer Res. 2008, 68, 5609–5618. [CrossRef][PubMed] 33. Isaev, N.K.; Genrikhs, E.E.; Oborina, M.V.; Stelmashook, E.V. Accelerated aging and aging process in the brain. Rev. Neurosci. 2018, 29, 233–240. [CrossRef][PubMed] 34. Shwe, T.; Pratchayasakul, W.; Chattipakorn, N.; Chattipakorn, S.C. Role of D-galactose-induced brain aging and its potential used for therapeutic interventions. Exp. Gerontol. 2018, 101, 13–36. [CrossRef] 35. Olivetti, G.; Melissari, M.; Capasso, J.M.; Anversa, P. Cardiomyopathy of the aging human heart. Myocyte loss and reactive cellular hypertrophy. Circ. Res. 1991, 68, 1560–1568. [CrossRef] 36. Kajstura, J.; Cheng, W.; Sarangarajan, R.; Li, P.; Li, B.; Nitahara, J.A.; Chapnick, S.; Reiss, K.; Olivetti, G.; Anversa, P. Necrotic and apoptotic myocyte cell death in the aging heart of Fischer 344 rats. Am. J. Physiol. 1996, 271, H1215–H1228. [CrossRef] 37. Kung, G.; Konstantinidis, K.; Kitsis, R.N. Programmed necrosis, not apoptosis, in the heart. Circ. Res. 2011, 108, 1017–1036. [CrossRef] 38. Zhang, X.; Wu, J.Z.; Lin, Z.X.; Yuan, Q.J.; Li, Y.C.; Liang, J.L.; Zhan, J.Y.X.; Xie, Y.L.; Su, Z.R.; Liu, Y.H. Ameliorative effect of supercritical fluid extract of Chrysanthemum indicum Linnén against D-galactose induced brain and liver injury in senescent mice via suppression of oxidative stress, inflammation and apoptosis. J. Ethnopharmacol. 2019, 234, 44–56. [CrossRef][PubMed] 39. Ullah, F.; Ali, T.; Ullah, N.; Kim, M.O. Caffeine prevents d-galactose-induced cognitive deficits, oxidative stress, neuroinflammation and neurodegeneration in the adult rat brain. Neurochem. Int. 2015, 90, 114–124. [CrossRef] 40. Sun, S.L.; Guo, L.; Ren, Y.C.; Wang, B.; Li, R.H.; Qi, Y.S.; Yu, H.; Chang, N.D.; Li, M.H.; Peng, H.S. Anti-apoptosis effect of polysaccharide isolated from the seeds of Cuscuta chinensis Lam on cardiomyocytes in aging rats. Mol. Biol. Rep. 2014, 41, 6117–6124. [CrossRef] 41. Abulfadl, Y.S.; El-Maraghy, N.N.; Ahmed, A.A.E.; Nofal, S.; Badary, O.A. Protective effects of thymoquinone on D-galactose and aluminum chloride induced neurotoxicity in rats: Biochemical, histological and behavioral changes. Neurol. Res. 2018, 40, 324–333. [CrossRef] 42. Banji, D.; Banji, O.J.F.F.; Dasaroju, S.; Kumar Ch, K. Curcumin and piperine abrogate lipid and protein oxidation induced by d-galactose in rat brain. Brain Res. 2013, 1515, 1–11. [CrossRef] 43. Banji, O.J.F.F.; Banji, D.; Ch, K. Curcumin and hesperidin improve cognition by suppressing mitochondrial dysfunction and apoptosis induced by D-galactose in rat brain. Food Chem. Toxicol. 2014, 74, 51–59. [CrossRef][PubMed] 44. Fairless, R.; Williams, S.K.; Diem, R. Dysfunction of neuronal calcium signalling in neuroinflammation and neurodegeneration. Cell Tissue Res. 2014, 357, 455–462. [CrossRef][PubMed] 45. Fairless, R.; Williams, S.K.; Diem, R. Calcium-Binding Proteins as Determinants of Central Nervous System Neuronal Vulnerability to Disease. Int. J. Mol. Sci. 2019, 20, 2146. [CrossRef][PubMed] 46. Ouh, I.-O.; Kim, Y.-M.; Gim, S.-A.; Koh, P.-O. Focal cerebral ischemic injury decreases calbindin expression in brain tissue and HT22 cells. Lab. Anim. Res. 2013, 29, 156. [CrossRef] 47. Tai, Y.H.; Lin, Y.Y.; Wang, K.C.; Chang, C.L.; Chen, R.Y.; Wu, C.C.; Cheng, I.H. Curcuminoid submicron particle ameliorates cognitive deficits and decreases amyloid pathology in Alzheimer’s disease mouse model. Oncotarget 2018, 9, 10681–10697. [CrossRef] 48. Sasaki, Y.; Ohsawa, K.; Kanazawa, H.; Kohsaka, S.; Imai, Y. Iba1 is an actin-cross-linking protein in macrophages/microglia. Biochem. Biophys. Res. Commun. 2001, 286, 292–297. [CrossRef] 49. Ito, D.; Tanaka, K.; Suzuki, S.; Dembo, T.; Fukuuchi, Y. Enhanced Expression of Iba1, Ionized Calcium-Binding Adapter Molecule 1, After Transient Focal Cerebral Ischemia In Rat Brain. Stroke 2001, 32, 1208–1215. [CrossRef] 50. Ton, B.H.T.; Chen, Q.; Gaina, G.; Tucureanu, C.; Georgescu, A.; Strungaru, C.; Flonta, M.L.; Sah, D.; Ristoiu, V. Activation profile of dorsal root ganglia Iba-1 (+) macrophages varies with the type of lesion in rats. Acta Histochem. 2013, 115, 840–850. [CrossRef] Int. J. Mol. Sci. 2021, 22, 6839 22 of 22

51. Romero-Sandoval, A.; Chai, N.; Nutile-McMenemy, N.; DeLeo, J.A. A comparison of spinal Iba1 and GFAP expression in rodent models of acute and chronic pain. Brain Res. 2008, 1219, 116–126. [CrossRef] 52. Eitzen, U.V.; Egensperger, R.; Kösel, S.; Grasbon-Frodl, E.M.; Imai, Y.; Bise, K.; Kohsaka, S.; Mehraein, P.; Graeber, M.B. Microglia and the Development of Spongiform Change in Creutzfeldt-Jakob Disease. J. Neuropathol. Exp. Neurol. 1998, 57, 246–256. [CrossRef] 53. Ullah, R.; Jo, M.H.; Riaz, M.; Alam, S.I.; Saeed, K.; Ali, W.; Rehman, I.U.; Ikram, M.; Kim, M.O. Glycine, the smallest amino acid, confers neuroprotection against D-galactose-induced neurodegeneration and memory impairment by regulating c-Jun N-terminal kinase in the mouse brain. J. Neuroinflamm. 2020, 17, 303. [CrossRef][PubMed] 54. Duan, S.; Wang, X.; Chen, G.; Quan, C.; Qu, S.; Tong, J. Inhibiting RIPK1 Limits Neuroinflammation and Alleviates Postoperative Cognitive Impairments in D-Galactose-Induced Aged Mice. Front. Behav. Neurosci. 2018, 12, 138. [CrossRef][PubMed] 55. Fan, J.; Yang, X.; Li, J.; Shu, Z.; Dai, J.; Liu, X.; Li, B.; Jia, S.; Kou, X.; Yang, Y.; et al. Spermidine coupled with exercise rescues skeletal muscle atrophy from D-gal-induced aging rats through enhanced autophagy and reduced apoptosis via AMPK-FOXO3a signal pathway. Oncotarget 2017, 8, 17475–17490. [CrossRef][PubMed] 56. Abulfadl, Y.; El-Maraghy, N.; Ahmed, A.E.; Nofal, S.; Abdel-Mottaleb, Y.; Badary, O. Thymoquinone alleviates the experimentally induced Alzheimer’s disease inflammation by modulation of TLRs signaling. Hum. Exp. Toxicol. 2018, 37, 1092–1104. [CrossRef] 57. Xu, Y.; Lin, D.; Li, S.; Li, G.; Shyamala, S.G.; Barish, P.A.; Vernon, M.M.; Pan, J.; Ogle, W.O. Curcumin reverses impaired cognition and neuronal plasticity induced by chronic stress. Neuropharmacology 2009, 57, 463–471. [CrossRef] 58. Bancroft, J.; Layton, C. The Hematoxylin and eosin. In Theory Practice of Histological Techniques, 7th ed.; Suvarna, S.K., Layton, C., Bancroft, J.D., Eds.; Churchill Livingstone of El Sevier: Philadelphia, PA, USA, 2013. 59. Noreldin, A.E.; Elewa, Y.H.A.; Kon, Y.; Warita, K.; Hosaka, Y.Z. Immunohistochemical localization of osteoblast activating peptide in the mouse kidney. Acta Histochem. 2018, 120, 323–328. [CrossRef] 60. Noreldin, A.E.; Sogabe, M.; Yamano, Y.; Uehara, M.; Mahdy, M.A.A.; Elnasharty, M.A.; Sayed-Ahmed, A.; Warita, K.; Hosaka, Y.Z. Spatial distribution of osteoblast activating peptide in the rat stomach. Acta Histochem. 2016, 118, 109–117. [CrossRef] 61. El-Far, A.H.; Lebda, M.A.; Noreldin, A.E.; Atta, M.S.; Elewa, Y.H.A.; Elfeky, M.; Mousa, S.A. Quercetin Attenuates Pancreatic and Renal D-Galactose-Induced Aging-Related Oxidative Alterations in Rats. Int. J. Mol. Sci. 2020, 21, 4348. [CrossRef] 62. Zaragozá, R.; García, C.; Rus, A.D.; Pallardó, F.V.; Barber, T.; Torres, L.; Miralles, V.J.; Viña, J.R. Inhibition of liver trans- sulphuration pathway by propargylglycine mimics gene expression changes found in the mammary gland of weaned lactating rats: Role of glutathione. Biochem. J. 2003, 373, 825–834. [CrossRef][PubMed] 63. Dkhil, M.A.; Al-Khalifa, M.S.; Al-Quraishy, S.; Zrieq, R.; Moneim, A.E.A. Indigofera oblongifolia mitigates lead-acetateinduced kidney damage and apoptosis in a rat model. Drug Des. Dev. Ther. 2016, 10, 1847–1856. [CrossRef] 64. Mohseni, M.; Mihandoost, E.; Shirazi, A.; Sepehrizadeh, Z.; Bazzaz, J.T.; Ghazi-khansari, M. Melatonin may play a role in modulation of bax and bcl-2 expression levels to protect rat peripheral blood lymphocytes from gamma irradiation-induced apoptosis. Mutat. Res. Mol. Mech. Mutagen. 2012, 738–739, 19–27. [CrossRef][PubMed] 65. Wu, N.; Sarna, L.K.; Siow, Y.L.; O, K. Regulation of hepatic cholesterol biosynthesis by berberine during hyperhomocysteinemia. Am. J. Physiol. Integr. Comp. Physiol. 2011, 300, R635–R643. [CrossRef]