USOO901 1834B1
(12) United States Patent (10) Patent No.: US 9,011,834 B1 McKenzie et al. (45) Date of Patent: Apr. 21, 2015
(54) COMPOSITIONS AND METHODS 7,632,520 B2 * 12/2009 Khandelwal ...... 424/464 (71) Applicant: Seres Health, Inc., Cambridge, MA 7,708,9887,731,976 B2 6,5, 2010 CobbFarmer (US) 7,763,420 B2 7/2010 Stritzker et al. (72) Inventors: Gregory McKenzie, Arlington, MA 7.981,411 B2 7/2011 Nadeau et al. (US); Mary-Jane Lombardo 7.998.473 B2 8/2011 Boileau et al. Ncity Spid 8,021,6548,034,601 B2 10/20119/2011 RehbergerBoileau et al. . Cook, Brooklyn, NY (US); Marin 8,039,006 B2 10/2011 Prato Vulic, Boston, MA (US); Geoffrey von 8, 147,482 B2 4/2012 Shimizu Maltzahn, Boston, MA (US); Brian 8, 187,590 B2 5, 2012 Farmer Goodman, Boston, MA (US); John 8,236,508 B2 8/2012 Mutharasan Grant Aunins, Doylestown, PA (US); E. R: 258 ity Matthew R. Henn, Somerville, MA 2001.0036453 A1 11, 2001 Reid (US); David Arthur Berry, Brookline, 2004/0028689 A1 2/2004 Borody MA (US); Jonathan Winkler, Boston, 2005, 0180962 A1 8, 2005 RaZ MA (US) 2006/0046246 A1 3/2006 Zeng et al. 2006,0188523 A1 8, 2006 Pei (73) Assignee: Seres Health, Inc., Cambridge, MA 2006/0233830 A1 10/2006 Wong (US) 2007/0141 139 A1 6/2007 Vandenberg 2009/O197249 A1 8, 2009 Gillevet
(*) Notice: Subject to any disclaimer, the term of this 38899. A. R388 BlocaZZari et et hal. past is, G adjusted under 35 2011/0081320 A1 4/2011 Westall et al. .S.C. 154(b) by 0 days. 2011/0113863 A1 5/2011 Fuhrmann et al. 2011/O189132 A1 8/2011 Garner et al. (21) Appl. No.: 14/197,044 2011/0280840 A1 11/2011 Blaser (22) Filed: Mar. 4, 2014 2012/0020950 A1 1/2012 Davis et al. Related U.S. Application Data (Continued)Continued (63) Continuation of application No. FOREIGN PATENT DOCUMENTS PCT/US2014/014745, filed on Feb. 4, 2014. EP 0033584 A3 1, 1981 (60) Provisional application No. 61/926,918, filed on Jan. EP O433299 A4 4f1992 13, 2014, provisional application No. 61/760,584, (Continued) filed on Feb. 4, 2013, provisional application No. OTHER PUBLICATIONS 61/760,585, filed on Feb. 4, 2013, provisional application No. 61/760,574, filed on Feb. 4, 2013, Aas, J., Gessert, C.E., and Bakken, J.S. (2003), Recurrent provisional application No. 61/760,606, filed on Feb. Clostridium difficile colitis: case series involving 18 patients treated 4, 2013. with donor stool administered via a nasogastric tube. Clinical infec tious Diseases 36(5), 580-585. Int. C. Achtman, M., and Wagner, M. (2008), Microbial diversity and the (51) genetic nature of microbial species. Nat. Rev. Microbiol. 6(6), 431 AOIN 63/00 (2006.01) 440. (52) U.S. C. Accoceberry, I. et al., “One-Step Purification of Enterocytozoon CPC ...... A61 K35/742 (2013.01) Bieneusi Spores from Human Stools by Immunoaffinity Expanded Field of Classification Search Bed Adsorption.” Journal of Clinical Microbiology, May 2001, pp. (58) 1974-1951, vol.39, No. 5. None Allen-Vercoe, E., Reid, G., Viner, N., Gloor, G.B., Hota, S., Kim, P., See application file for complete search history. Lee, C. O'Doherty, K. Vanner, S.J., Weese, J.S., et al. (2012), A Canadian Working Group report on fecal microbial therapy: micro (56) References Cited bial ecosystems therapeutics, Can. J. Gastroenterol. 26(7), 457-462. Allen-Vercoe, E., Strauss, J., and Chadee, K. (2011). Fusobacterium U.S. PATENT DOCUMENTS nucleatum: an emerging gutpathogen? Gut Microbes 2(5), 294-298. Anderson, K.F., Lonsway, D.R., Rasheed, J.K., Biddle, J., Jensen, B., 3,009,864 A 11, 1961 Gordon-Aldterton et al. McDougal., L.K., Carey, R.B., Thompson, A., Stocker, S., Limbago, 3,228,838 A 1/1966 Rinfret B. et al. (2007). Evaluation of Methods to Identify the Klebsiella 3,608,030 A 9, 1971 Tint pneumoniae Carbapenemase in Enterobacteriaceae, J. Clin. 4,077,227 A 3, 1978 Larson Microbiol. 45(8), 2723-2725. 4,205,132 A 5, 1980 Sandine 4,655,047 A 4, 1987 Temple (Continued) 4,689,226 A 8, 1987 Nurmi 4,839,281 A 6, 1989 Gorbach et al. Primary Examiner — Albert Navarro 5,196.205 A 3/1993 Borody (74) Attorney, Agent, or Firm — Fenwick & West LLP 5.425,951 A 6, 1995 Goodrich 5,443,826 A 8/1995 Borody (57) ABSTRACT 5,599,795 A 2f1997 McCann Disclosed herein are therapeutic compositions containing 5,648,206 A 7, 1997 Goodrich non-pathogenic, germination-competent bacterial spores, for 5,965,128 A 10/1999 Doyle et al. the prevention, control, and treatment of gastrointestinal dis 6,589.771 B1 7/2003 Marshall eases, disorders and conditions and for general nutritional 6,645,530 B1 1 1/2003 Borody health. 7.427,398 B2 9, 2008 Baillon et al. 7.628,982 B2 12/2009 Klaviniskis 28 Claims, 21 Drawing Sheets US 9,011,834 B1 Page 2
(56) References Cited (2011). Enterotypes of the human gut micreobiome. Nature 473(7346), 174-180. U.S. PATENT DOCUMENTS Atarashi, K., Tanoue, T., Oshima, K., Suda, W., Nagano, Y. Nishikawa, H., Fukuda, S., Saito, T., Narushima, S., Hase, K., et al. 2012, 0021429 A1 1/2012 Rublee 2012, 0021921 A1 1/2012 Scott (2013). Treg induction by a rationally selected mixture of Clostridia 2012fOO58094 A1 3/2012 Blaser strains from the human microbiota. Nature 500(7461), 232-236. 2012fOO64592 A1 3/2012 O'Mullan et al. Atarashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwahara, T., 2012/O1286.33 A1 5/2012 Veiga et al. Momos, Y. Cheng. G., Yamasaki. S., Saito, T., Ohba, Y, et al. (2011), 2012/O128634 A1 5/2012 Veiga Induction of colonic regulator T cells by indigenous Clostridium 2012fO149584 A1 6, 2012 Ole species. Science 331(6015), 337-341. 2012fO1652.15 A1 6/2012 Andersen Backhed, F. etal (2004). The gut microbiota as an environment factor 2012/0177650 A1 7/2012 Borody 2012fO2O7726 A1 8/2012 Lipkin that regulates fat storage, PNAS, Nov. 2, 2014, pp. 15718-15723, vol. 2012fO238468 A1 9, 2012 Tuk 101, No. 44. 2012,0264.637 A1 10/2012 Brodie Bader, J., Albin, A., and Stahl, U. (2012). Spore-forming bacteria and 2012fO276.149 A1 11/2012 Littman their utilisation as probiotics. Benef Microbes 3(1), 65-75. 2012fO276201 A1 11/2012 Trachtman Bakken, J.S. (2009), Fecal bacteriotherapy for recurrent Clostridium 2012,0315249 A1 12/2012 Olmstead difficile infection. Anaerobe 15(6), 285-209. 2013, OO17999 A1 1/2013 Fremont Bakken, J.S., Borody, T., Brandt, L.J., Brill, J.V. Demarco, D.C., 2013/0022575 A1 1/2013 Cassity 2013,0045274 A1 2/2013 Hlavka Frankos, M.A., Kelly, C. Khoruts, A., Louie, T., Martinelli, L.P., et 2013,0045874 A1 2, 2013 Ehrlich al. (2011). Treatin Clostridium difficile infection with fecal 2013, O149339 A1 6, 2013 Honda microbiota transplantation. Clin. Gastroenterol. Hepatol. 9(12), 2013/014.9375 A1 6, 2013 Geall 1044-1049. 2013,0266539 A1 10/2013 Borody Barreau, M., Pagnier, I., and La Scola, B. (2013). Improving the 2014/0045744 A1 2/2014 Gordon Identification of anaerobes in the clinical microbiology laboratory through MALDI-TOF mass spectrometry. Anaerobe 22, 123-125. FOREIGN PATENT DOCUMENTS Bauer, T.M. et al., “Derivation and Validation of Guidelines for Stool Cultures for Enteropathogenic Bacteria. Other Than Clostridium dif EP 1107772 B1 4/2006 EP 1631312 B1 9, 2008 ficile in Hospitalized Adults.”The Journal of the American Medical EP 2337569 A2 6, 2011 Association, Jan. 17, 2001, pp. 313-319. EP 2338989 A1 6, 2011 Ben-Amor, K., Heilig, H. Smidt, H. Vaughan, E.E., Abee, T., and De EP 2519108 A1 11 2012 Vos, W.M. (2005). Genetic diversity of viable, injured, and dead fecal EP O47982O B1 T 2014 bacteria assessed by fluorescene-activated cell sorting and 16S rRNA WO WO 20O2/OO7741 A1 1, 2002 gene analysis, Applied and Environmental Microbiology 71 (8), WO WO 2005/110445 A2 11/2005 4679-4689. WO WO 2006/O12586 A2 2, 2006 WO WO 2008/O76696 A2 6, 2008 Berstad, A. et al., “Fecal Fat Determination with a Modified Titration WO WO 2008/083157 A2 T 2008 Method.” Scandinavian Journal of Gastroenterology, 2010, pp. 603 WO WO 2010/030997 A1 3, 2010 607, vol. 45. WO WO 2010/062369 A2 6, 2010 Bhatia, A et al., "Proionibacterium Acnes and Chronic Diseases.”The WO WO 2010, 124387 A1 11, 2010 Infectious Etiology of Chronic Diseases: Defining the Relationship, WO WO 2010, 151842 A2 12/2010 Enhancing the Research, and Mitigating the Effects: Workship Sum WO WO 2011/005756 A1 1, 2011 mary. Knobler, S.L. et al. (eds.), 2004, pp. 74-80, may be down WO WO 2011/022542 A2 2, 2011 loaded at
(56) References Cited Claesson, M.J. Wang, Q., O'Sullivan, O. Greene-Diniz, R., Cole, J.R., Ross, R.P., and O’Toole, P.W. (2010). Comparison of two next OTHER PUBLICATIONS generation sequencing technologies for resolving highly complex microbiota composition using tandem variable 16S rRNA gene Borriello, S.P., and Barclay, F.E. (1986). An in-vitro model of regions. Nucleic Acids Res 38(22), e200. colonisation resistance to Clostridium difficile infection, Journal of Clemente, J.C., Ursell, L.K., Parfrey, L.W., and Knight, R. (2012). Medical Microbiology 21(4), 299-309. The impact of the gut microbiota on human health; an integrative Borriello, S.P., and Honour, P. (1981) Simplified procedure for the view. Cell 148(6), 1258-1270. routine isolation of Clostridium difficile from faeces. J Clin Pethol D'Souza, D.H., and Su, X. (2010). Efficacy of chemical treatments 34(10), 1124-1127. against Murine norovirus, Feline calicivirus, and MS2 bacterioph Boyles, W.A., and Lincoln, R.E. (1958). Separation and concentra age. Foodborne Pathogens and Disease 7(3), 319-326. tion or bacterial spores and vegetative cells by foam flotation, Appl David, L.A. Maurice, C.F., Carmody, R.N., Gootenberg, D.B. But Microbiol 6(5), 327-334. ton, J.E., Wolfe, B.E., Ling, A.V. Devlin, A.S. Varma, Y. Fischbach, Brandt, L.J., (2012). Fecal Transplantation for the Treatment of M.A., et al. (2013). Diet rapidly and reproducibly alters the human Clostridium difficile Infection. Gastroenterol Hepatol (NY)8(3). 191 gut microbiome. Nature advance online publication. 194. De Angelis, M., Piccolo, M., Vannini, L., Siragusa, S., De Giacomo, Brandt, L.J. Aroniadis, O.C., Mellow, M., Kanatzar, A., Kelly, C. A., Serrazzanetti, D.I., Cristofori, F., Guerzoni, M.E., Gobbetti, M., Park, T., Stollman, N., Rohlke. F., and Surawicz, C. (2012). Long and, Francavilla, R. (2013). Fecal Microbiota and Metabolome of Term Follow-Up of Colonoscopic Fecal Microbiota Transplant for Children with Autism and Pervasive Developmental Disorder Not Recurrent Clostridium difficile infection. The American Journal of Otherwise Specified, PLoS ONE 8(10), e76993. Gastroenterology 107(7), 1079-1087. DeVos, W.M. (2013) Fame and future of faecal transplantations— Bräuniger, S. Peters, J., Borchers, U., and Kao, M. (2000). Further developing next-generation therapies with synthetic microbiomes: studies on thermal resistance of bovine parvovirus against moist and Fame and future of faecal transplantations. Microbial Biotechnology dry heat. International Journal of Hygiene and Environmental Health 6(4), 316-325. 203(1), 71-75. Defined Fecal Microbiota Transplantation for Clostridium difficile Broda, D.M., De Lacy, K.M., and Bell. R.G. (1998). Efficacy of heat Diarrhea, (56) References Cited Grabow, W.O., Clay, C.G., Dhaliwal. W. Vrey, M.A., and Müller, E E. (1999). Elimination of viruses, phages, bacteria and OTHER PUBLICATIONS Cryptosporidium by a new generation Aquaguard point-of-usa water treatment unit. Zentralbi Hyg Umweltmed 202(5). 399-410. bacteriotherapy for recurrent Clostridium difficile infection: A retro Greenway, F. Wang, S., and Heiman, M. (2014). A novel cobiotic spective evaluation of 31 patients. Scandinavian Journal of Infectious containing a prebiotic and an antioxidant augments the glucose con Diseases 46(2), 89-97. trol and gastrointestinal tolerability of metformin: a case report. Endt, K., Stecher, B., Chaffron, S., Slacke, E., Tchitchek, N., Beneficial Microbes 5(1), 20-32. Benecke, A., Van Maele, L., Sirard, J.-C., Mueller, A.J., Grehan, M.J., Borody, T.J., Leis, S.M., Campbell, J., Mitchell, H., Heikenwalder, M., et al. (2010). The Microbiota Mediates Pathogen Clearance from the Gut Lumen after Non-Typhoidal Salmonella and Wettstein, A. (2010). Durable alteration of the colonic microbiota Diarrhea. PLoS Pathog 6(9), e1001097. by the administration of donor fecal flora. J. Clin. Gastroenterol. Everard, A., Belzer, C., Geurts, L., Ouwerkerk, J.P., Druart, C., 44(8), 551-561. Bindels, L.B., Guiot, Y., Derrien, M., Muccioli, G.G., Delzenne, Grimoud, J. et el. “In Vitro Screening of Probiotic Lactic Acid N.M., et al. (2013). Cross-talk between Akkermansia muciniphila Bacteria and Prebiotic Glucooligosaccharides to Select Effective and intestinal epithelium controls diet-induced obesity. Proceedings Synbiotios.” Anaerobe, Clincal Microbiology, Oct. 2010, pp. 493 of the National Academy of Sciences 110(22), 9066-9071. 500, vol. 16, No. 5. Fairhead, H., Setlow, B., Waites, W.M., and Setlv, P. (1994). Small, Hamilton, M.J., Weingarden, A.R., Sadowsky, M.J., and Khoruts, A. acid-soluble proteins bound to DNA protect Bacillus subtillis spores (2012). Standardized frozen preparation tor transplantation of fecal from being killed by freeze-drying. Applied and Environmental microbiota for recurrent Clostridium difficile infection. Am. J. Microbiology 60(7), 2647-2649. Gastroenterol. 107(5), 761-767. Faith, J.J. Ahern, P.P. Ridaura, V.K., Cheng, J., and Gordon, J.I. Hamilton, M.J., Weingarden, A.R., Unno, T., Khoruts, A., and (2014), Indentifying Gut Microbe-Host Phenotype Relationships Sadowsky, M.J. (2013). High-throughput DNA sequence analysis Using Combinatorial Communities in Gnotobiotic Mice. Sci Transl reveals stable engraftment of gut microbiota following transplanta Med 6(220), 220ral 1-220ral 1. tion of prevlousiy frozen facal bacteria. Gut Microbes. 4(2), 125-135. Fakhry, S., Sorrentini, I., Ricca, E., De Felice, M., and Baccigalupi, Harmsen, H. J. M. Gibson, G. R. Elfferich, P. Raangs, G. C., L. gastrointestinal tract. Journal of Applied Microbiology 105(6), Wildeboer-Veloo, A. C. M., Argais, A., Roberfroid, M. B., and Well 2178-2186. ing G.W. (2000). Comparison of viable cell counts and fluorescence Fell Jr., N.F. Pellegrino, P.M., and Gillespie, J.B. (2001). Mitigating in situ hybridization using specific rRNA-based probes for the quan phosphate interference in bacterial endospore detection by Tb tification of human fecal bacteria. FEMS Microbiology Letters dipicollinate photoluminescence, Analytica Chimica Acta 426(1), 183(1), 125-129. 43-50. Harrison, F. “Bacterial Cooperation in the Wild in the Clinic: Are Fichtel, J., Köster, J., RullKötter, J., and Sass, H. (2007). Spore Pathogen Social Behaviours Relevant Outside the dipicolinioc acid contents used for estimating the number of Laboratory?"Bioessays, Dec. 27, 2012, pp. 108-112, vol. 35. No. 2. endospores in sediments FEMS Microbiology Ecology 61(3). 522 Hasan, J.A. Japal, K.M., Christensen, E.R. and Samalot-Freire, L.C. 532. (2011). In vitro production of Clostridium difficile spores for use in Fischbach, M.A., Bluestone, J.A., and Lim, W.A. (2013). Cell-Based the efficacy evaluation of disinfectants: a precollaborative investiga Therapeutics; The Next Pillar of Medicine, Sci Transl Med 5(179) tion. J AOAC Int94(1), 259-272. 179ps7. Hayashi, Y et al., “Western Blot (Immunoblot) Assay of Small Fonseca, F. Beal, C., and Corrieu, G. (2001). Operating Conditions Round-Structured Virus Associated with an Acute Gastroenteritis That Affect the Resistance of Lactic Acid Bacteria to Freezing and Outbreak in Tokyo.” Journal of Clinical Microbiology, Aug. 1989, Frozen Storage. Cryobiology 43(3), 189-198. pp. 1728-1733, vol. 27. Franz, C.M.A.P. Huch, M., Abriouel, H., Holzapfel, W., and Galvez, Hell, M., Bernhofer, C., Stalzer, P., Kern, J.M., and Claassen, E. A. (2011). Enterococci as probiotics and their implications in food (2013). Probiotics in Clostridium difficile infection: reviewing the safety, International Journal of Food Microbiology 151(2), 125-140. need for a multistrain probiotic. Beneficial Microbes 4(1), 39-51. Friedman-Moraco, R.J., Mehta, A.K., Lyon, G.M., and Kraft, C.S. Hemmerling, A., Harrison, W., Schroeder, A., Park, J., Korn, A., (2014). Fecal Microbiota Transplantation for Refractory Clostridium Shiboski, S., Foster-Rosales, A., and Cohen, C.R. (2010). Phase 2a difficile Colitis in Solid Organ Transplant Recipients: Fecal Study Assesing Colonization Efficiency, Safety, and Acceptability of Microbiota Transplantation in Solid Organ Transplant Recipients. Lactobacillus crispatus CTV-05 in Women With Bacterial Vaginosis: American Journal of Transplantation 14(2), 477-480. Sexually transmitted Diseases 37(12), 745-750. Fuentes, S. Van Nood, E., Tims, S., Heikamp-DeJong, I., Ter Braak, Herron, P.R., and Wellington, E.M.H. (1990). New Method for C.J., Keller, J.J. Zoetendal, E.G., and DeVos, W.M. (2014). Reset of Extraction of Streptomycete Spores from Soil and Application to the a critically disturbed microbial ecosystem; faecal transplant in recur Study of Lysogeny in Sterile Amended and Nonsterile Soil. Appl rent Clostridium difficile infection, The ISME Journal. Environ Microbiol 56(5), 1406-1412. Gevers, D., Kugathasan, S., Denson, L.A., Vazquez-Baeza, Y. Van Hewitt, J., Rivera-Aban, M., and Greening, G.E. (2009). Evaluation Treuren, W., Ren, B., Schwager, E., Knights, D., Song, S.J., Yassour, of murine norovirus and hepatitus A virus in heatinactivation studies. M., et al., (2014). The Treatment-Naive Microbiome in New-Onset Journal of Applied Microbiology 107(1), 65-71. Crohn's Disease. Cell Host & Microbe 15(3), 382-392. Hindle, A.A. and Hall, E.A.H. (1999). Dipicolinic Acid (DPA) assay Gilligan, P.H. (2013). Identification of Pathogens by Ciassical Clini revisited and appraised for spore detection. The Analyst 124(11), cal Tests. In The Prokaryotes, E. Rosenberg, E.F. DeLong, S. Lory, E. 1599-1604. Stackebrandt, and F. Thompson, eds. (Springer Berlin Heidelberg), Hirsch, E.B., and Tam. V.H. (2010). Detection and treatment options pp. 57-89. for Klebsiella pneumoniae carbapenemases (KPCs): an energing Goodman, A.L., Kallstrom, G., Faith, J.J., Reyes, A., Moore, A., cause of multidrug-resistant infection. J. Antimicrob. Chemother. Dantas, G., and Gordon, J.I. (2011). From the Cover: Extensive 65(6), 1119-1125. personal human gut microbiota culture collections characterized and Hofsten, B.V. (1966), Partition of Escherichia coli in an aqueous manipulated in gnotobiotic mice. Proceedings of the National Acad polymer two-phase sytem. Experimental Cell Research 41(1), 117 emy of Sciences 108(15), 6252-6257. 123. Goodman, N.S., Gottfried, R.J., and Rogoff, M.H. (1967). Biphasic Holmes, E., Kinross, J., Gibson. G.R., Burcelin, R., Jia, W., Petters system separation of spores and crystals of Bacillus thuringiensis. son, S., and Nicholson, J.K. (2012). Therapeutic Modulation oi Journal of Bacteriology 94(2), 485. Microbiota-Host Metabolic Interations, Science Translated Medi Gould, G.W., and Sale, A.J. (1970). Initiation of germination of cine 4(137), 137 rv6-137rv6. bactarial spores by hydrostatic pressure, J. Gen. Microbiol. 60(3), Hoppe, B., Groothoff, J.W., Hulton, S.-A., Cochat, P. Niaudet, P. 335-346. Kemper, M.J., Deschenes, G., Unwin, R., and Miller, D. (2011). US 9,011,834 B1 Page 5 (56) References Cited Kanehisa Laboratories. KEGG: Kyoto encyclopedia of genes and genomes. (56) References Cited Mevissen-Verhage, E.A., Marcelis, J.H. Vos, M.N. De, Amerongen, W.C.H., and Verhoef, J. (1987). Bifidobacterium, Bacteroides, and OTHER PUBLICATIONS Clostridium spp. in fecal samples from breast-fed and and bottle-fed infants with and without iron supplement. J. Clin. Microbiol. 25(2), Lawley, T.D., Clare, S. Walker, A.W., Stares, M.D. Connor, T.R., 258-289. Raisen, C., Goulding, D., Rad, R., Schreiber, F. Brandt, C., et al. Miller, R.S., and Hoskin, L.C. (1981). Mucin degradation in human (2012). Targeted Restoration of the Intestinal Microbiota with a colon ecosystems. Fecal population densities of mucin-degrading Simple, Defined Bacteriotherapy Resolves Relapsing Clostridium bacteria estimated by a “most probable number'method. Gastroen difficle Disease in Mice. PLoS Pathog 8(10), e1002995. terology 81(4), 759-765. Lawson, P.A., Song, Y. Liu, C., Molitoris, D.R., Vaisanen, M.-L. Miyamoto-Shinohara, Y. Sukenobe, J., Imaizumi, T., Nakahara, T., Collins, M.D., and Finegold, S.M. (2004), Anaerothruncus and Others (2008). Survival of freeze-dried bacteria. The Journal of colihominis gen, nov... sp. nov., from human faeces. Int J Syst Evol General and Applied Microbiology 54(1), 9. Microbiol 54(2), 413-417. Morgan, C.A., Herman, N., White, P.A., and Vesey, G. (2006). Pres Lee, I.-K., and Liu, J.-W. (2006). Clinical characteristics and risk ervation of micro-organisms by drying: A review Journal of Micro factors for mortality in Morganella morigami bacteremia. J biological Methods 66(2), 183-193. Microbiol Immunol Infect 39(4), 328-334. Murri, M., Leiva, I., Gomez-Zumaquero. J.M., Tinahones, F.J., Lee, J.S., Cha, D.S., and Park, H.J. (2004). Survival of Freeze-Dried Cardona, F. Soriguer, F., and Queipo-Ortuio, M.I. (2013). Gut Lactobacilus bulgaricus KFRI 673 in Chitosan-Coated Calcium microbiota in children with type 1 diabetes differs from that in Alginate Microparticles. J. Agric. Food Chem. 52(24). 7300-7305. healthy children, a case-control study. BMC Med 11(1), 1-12. Lee, M., Hesek, D., Shah, I.M., Oliver, A.G., Dworkin, J., and Myllyluoma, E. et al., “Effects of Muitispectes Probiotic Combina Mobashery, S. (2010). Synthetic peptidoglycan motifs for germina tion on Helicobacter pylori infection in Vitro.” Clinical and Vaccine tion of bacterial spores. Chembiochem 11(18), 2525-2529. Immunology, Sep. 2008, pp. 1472-1482, vol. 15, No. 9. Lehar, J. (2007). Chemical combination effects predict connectivity Nicholson, W.L., and Law, J.F. (1999). Method for purification of in biological systems, Molecular Systems Biology, pp. 1-14, vol. 3 bacterial endospores from soils: UV resistance of natural Sonoran Article No. 80. desert soil poputations of iD Bacillus spp. with reference to Lemon, K.P. Armitage, G.C., Relman, D.A., and Fischbach, M.A. B. subtilis. strain 168. Journal of Microbiological Methods 35(1), (2012), Microbiota-Targeted Therapies: An Ecological Perspective. 13-21. Science Translational Medicine 4(137), 137 rv5-137rv5. NIH human microbiome project. (56) References Cited Quigley, E.M.M. et al., “Small Intestinal Bacterial Overgrowth: Roles of Antibiotics, Prebiotics and Probiotics.” Gastroenterology, OTHER PUBLICATIONS Feb. 2006, pp. 78-90, vol. 130. Raibaud, P., Ducluzeau, R., Dubos, F., Hudault, S., Bewa, H., and www.path.org/publications/files/TS vaccine stability table in Muller, M.C. (1980) Implantation ofbacteria from the digestive tract vest.pdf>Accessed Mar. 21, 2014. ofman and various animals gnotobiotic mice. Am J ClinNutr 33(11). PCT International Search Report and Written Opinion, PCT Appli 2440-2447. cation No. PCT/US 14/14744, May 21, 2014, 36 pages. Ramirez, N., and Abel-Santos, E. (2010), Requirements for germi PCT International Search Report and Written Opinion, PCT Appli nation of Clostridium sordellii spores in vitro, J. Bacteriol. 192(2), cation No. PCT/US 14/14747, Jun. 13, 2014, 27 pages. 418-425. PCT International Search Report and Written Opinion, PCT Appli Rao, A.V. Shiwnarain, N., and Maharaj, l. (1989). Survival of cation No. PCT/US 14/14738, Jul. 30, 2014, 32 pages. Microencapsulated Bifidobacterium pseudolongum in Simulated PCT International Search Report and Written Opinion, PCT Appli Gastric and intestinal Juices. Canadian institute of Food Science and cation No. PCT/US 14/14745, Jul. 30, 2014, 31 pages. Technology Journal 22(4), 345-349. PCT International Search Report and Written Opinion, PCT Appli Reeves, A.E., Koenigsknecht, M.J., Bergin, I.L., and Young, V.B. cation No. PCT/US 14/14745, May 16, 2014, 2 pages. (2012). Suppression of Clostridium difficile in the Gastrointestinal PCT International Search Report and Written Opinion, PCT Appli Tracts of Germfree Mice Inoculated with a Murine Isolate from the cation No. PCT/US 13/71758, May 5, 2014, 45 pages. Family Lachnospiraceae. Infection and Immunity 80(11), 3786 Peck, M.W. et al., “Development and Application of a New Method 3794. for Specific and Sensitive Enumeration of Spores of Nonproteolytic Rexroad, J., Wiethoff, C.M., Jones, L.S., and Middaugh, C.R. (2002). Clostridium Botulinum Types B, E and F in Foods and Food Materi Lyophilization and the thermostability of vaccines. Cell Preservation als.” Applied and Environmental Microbiology, Oct. 2010, pp. 6607 Technology 1(2), 91-104. 6614, vol. 76, No. 19. Ridaura, V.K., Faith, J.J., Rey, F.E., Cheng, J., Duncan, A.E., Kau, Pehkonen, K.S., Roos, Y.H., Miao, S., Ross, R.P., and Stanton, C. A.L., Griffin, N.W., Lombard, V., Henrissat, B., Bain, J.R., et al., (2008). State transitions and physicochemical aspects of cryoprotec (2013). Gut Microbiota from Twins Discordant for Obesity Modulate tion and stabilization in freeze-drying of Lactobacillus Metabolism in Mice. Science 341 (6150), 1241214-1241214. rhamnosusGG (LGG). Journal of Applied Microbiology 104(6), Rode, L.J., and Foster, J.W. (1961). Germination of bacterial spores 1732-1743. with alkyl primary amines1.J. Bacteriol 81 (5), 768-779. Pheighambardoust, S.H., Golshan Tafti, A., and Hesari, J. (2011). Roffe, C. (1996). Biotherapy for antibiotic-associated and other diar Application of spray drying for preservation of lactic acid starter rhoeas. J. Infect. 32(1), 1-10. cultures: a review. Trends in Food Science & Technology 22(5), 215 Rohlke. F. Surawicz, C.M., and Stollman, N. (2010). Fecal flora 224. reconstitution for recurrent Clostridium difficile and methodology, J. Pellegrino, P.M., Fell JR. N.F., and Gillespie, J.B. (2002). Enhanced Clin. Gastroenterol. 44(8), 567-570. spore detection using dipicolinate extraction techniques. Analytica Rosen, D.L., Sharpless, C., and McGown, L.B. (1997). Bacterial Chimica Acta 455(2), 167-177. Spore detection and Determination by Use of Terbium Dipicolinate Perez, F. Pultz. M.J., Endimiani, A., Bonomo, R.A., and Donskey, Photoluminescence. Anal. Chem. 69(6). 1082-1085. C.J. (2011). Effect of antibiotic treatmentonestablishment and elimi Sack, D.A., Shimko, J., Sack, R.B., Gomes, J.G., Macleod, K., ation of intestinal colonization by KPC-producing Klebsiella O'Sullivan, D., and Spriggs, D. (1997). Comparison of alternative pneumoniae in mice. Antimicrob. Agents Chemother. 55(6), 2585 buffers for use with a new live oral cholera vaccine, Peru-15, in 2589. outpatient volunteers. Infect. Immun. 65(6), 2107-2111. Perez, J., Springthorpe, V.S., and Sattar, S.A. (2011). Clospore: a Sacks, L.E., and Alderton, G. (1961). Behaviour ofbacterial spores in liquid medium for producing high titers of semi-purified spores of aqueous polymer two-phase systems. J. Bacteriol. 82,331-341. Clostridium difficile. J AOAC Int 84(2), 618-626. Sahlstrom, L., Bagge, E., Emmoth, E., Holmqvist, A., Danielsson Petrof. E.O., Claud, E.C., Gloor, G.B., and Allen-Vercoe, E. (2013a). Tham, M.-L., and Albihn, A. (2008). A laboratory study of survival of Microbial ecosystems therapeutics: a new paradigm in medicine? Selected microorganisms after heat treatment of biowaste used in Beneficial Microbes 4(1), 53-65. biogas plants. Bioresour. Technol. 99(16), 7859-7865. Petrof. E.O., Gloor, G.B., Vanner, S.J., Weese, S.J., Carter, D., Santivarangkna, C., Kulozik, U., and Foerst, P. (2007). Alternative Daigneault, M.C., Brown, E.M., Schroeter, K., and Allen-Vercoe, E. Drying Processes for the Industrial Preservation of Lactic Acid 2013b). Stool substitute transplant therapy for the eradication of Starter Cultures. Biotechnology Progress 23(2), 302-315. Clostridium diffile infection: “RePOOPulating” the gut. Microbiome Sattar, S.A., Jason, T., Bidawid, S., and Farber, J. (2000). Foodborne 1(1), 3. spread of hepatitis A: recent studies on virus Survival, transfer and Petrof. E.O. et al., “Stool Subtitute Transplant Therapy for the Eradi inactivation. The Canadian Journal of Infectious Diseases 11(3), 159. cation of Clostridium difficile infection: RePOOPulating” The Gut Savaiano, D.A., Ritter, A.J., Klaenhammer, T., Walker, M.R. Carlson, Microbiome, Jan. 9, 2013, pp. 1-12, vol. 1, No. 3. H.L.F., and Ruckle, J. (2012). A Novel High Purity Short-Chain Picot, A., and Lacroix, C. (2004). Encapsulation of bifidabacteria in Galacto-Oligosaccharide (RP-G28) Improves Lactose Digestion and whey protein-based microcapsules and Survival in simulated Symptoms of Lactose Intolerance. Gastroenterology 142(5), S-182. gastrointestinal conditions and in yoghurt, International Dairy Jour Savaiano, D.A., Ritter, A.J., Klaenhammer, T.R., Walker, W.A., nal 14(6), 505-515. James, G.M., Longcore, A.T., Chandler, J.R., and Foyt, H.L. (2013). Pinn, D. et al. (2013), Follow-up Study of Fecal Microbiota Trans Improving lactose digestion and symptoms of lactose intolerance plantation (FMT) for the Treatment of Refractory Irritable Bowel with a novel galacto-oligosaccharide (RP-G28): a randomized, Syndrome (IBS). Abstract ACG 2013. double-blind clinical trial. Nutrition Journal 12(1), 160. Postgate, J.R., and Hunter, J.R. (1961). On the Survival of Frozen Seale, R.B., Flint, S.H. McQuillan, A.J., and Bremer, P.J. (2008). Bacteria. J Gen Microbiol 26(3), 267-378. Recovery of Spores from Thermophilic Dairy Bacilli and Effects of Prilassnig, M. et al., “Are Probiotics Detectable in Human Feces Their Surface Characteristics on Attachment to Different Surfaces. After Oral Uptake by Healthy Volunteers?” The Middle European Appl Environ Microbiol 74(3), 731-737. Journal of Medicine, Aug. 2007, pp. 456-462, vol. 119, Nos. 15-16. Seo, M., Inoue, I., Tanaka, M., Matsuda, N., Nakano, T., Awata, T., Putlz, N.J., Hoyen, C.K., and Donskey, C.J. (2004), Inhibition of Katayama, S., Alpers, D.H., and Komoda, T. (2013), Clostridium methicillin-resistant Staphylococcus aureus by an in vitro continu butyricum Miyairi 588 improves high-fat diet-induced non-alcoholic ous-flow culture containing human stool microflora, FEMS fatty liver disease in rats. Dig. Dis. Sci. 58(12), 3534-3544. Microbiology Letters 241(2), 201-205. Stelow, B., Cowan, A.E., and Setlow, P. (2003). Germination of Queenan, A.M., and Bush, K. (2007). Carbapenemases: the Versatile spores of Bacillus subtilis with dodecylamine, Journal of Applied B-Lactamases. Clin. Microbiol. Rev. 2003), 440-458. Microbiology 95(3), 637-648. US 9,011,834 B1 Page 8 (56) References Cited Su, W.J., Waechter, M.J., Bourlioux. P. Dolegeal, M., Fourniat, J., and Mahuzier, G. (1987). Role of volatile fatty acids in coloniztion OTHER PUBLICATIONS resistance to Clostridium difficile in gnotobiotic mice. Infect. Immun. 55(7), 1686-1691. Stelow, B., Yu, J., Li, Y-Q., and Setlow, P. (2013). Analysis of the Talwalkar, A., and Kailasapathy, K. (2003). Effect of germination kinectics of individual Bacillus subtilis spores treated microencapsulation on oxygen toxicity in probiotic bacteria. Austra with hydrogen peroxide or sodium hypochlorite. Letters in Applied lian Journal of Dairy Technology 58(1), 36-39. Microbiology 57(4), 259-265. Tamir, H., and Gilvarg, C. (1996). Density Gradient Centrifugation Shafaat, H.S., and Ponce, A. (2006). Applications of a Rapid for the Seperation of Sporulating Forms of Bacteria J. Biol. Chem. Endospore Viability Assay for Monitoring UV Inactivation and Char 241(5), 1085-1090. acterizing Arctic Ice Cores, Appl Environ Microbiol 72(10), 6808 Tanaka, M. et al., “Increased Fasting Plasma Ghrelin Levels in 6814. Patients with BulimiaNervosa.” European Journal of Endocrinology, Shah, I.M., Laaberki, M.-H., Popham, D.L., and Dworkin, J. (2008). June 2002, pp. 1-3, vol. 146. A. eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in Taur, Y., and Pamer, E.G. (2014). Harnessing Microbiota to Kill a response to peptidoglycan fragments. Cell 135(3), 486-496. Pathogen: Fixing the microbiota to treat Clostridium difficile infec Shah, N.P. "Symposium: Probiotic Bacteria: Probiotic Bacteria: tions. Nature Medicine 20(3), 246-247. Selective Enumeration and Survival in Dairy Foods.” Oct. 7, 1999, 14 Taur.Y., Xavier, J.B., Lipuma, L., Ubeda, C., Goldberg, J., Gobourne, pageS. A., Lee, Y.J., Dubin, K.A., Socci, N.D., Viale, A., et al. (2012). Shah, N.P. etal. “Microencapsulation of Probiotic Bacteria and Their Intestinal Domination and the Risk of Bacteremia in Patients Under Survival in Frozen Fermented Dairy Desserts.” The Australian Jour going Allogeneic Hematopoietic Stem Cell Transplantation. Clin nal of Dairy Technology, Oct. 2000, pp. 139-144, vol. 55, No. 3. Infect Dis 55(7), 905-914. Shah, S. (2012). Clostridium difficile in inflammatory Bowel Disease: The Human MicrobiomeProject Consortium (2012). Structure, func a dangerous mix (Clostridium difficile Symposium, Miriam Hospital, tion and diversity of the healthy human microbiome. Nature Providence, RI). 486(7402), 207-214. Shahinas, D., Silverman, M., Sittler, T., Chiu, C., Kim, P., Allen Tisa, L.S., Koshikawa, T., and Gerhardt, P. (1982). Wet and dry Vercoe, E. Weese, S. Wong, A., Low, D.e., and Pillai, D.R. (2012). bacterial spore densities determined by buoyant sedimentation. Toward an Understanding of Changes in Diversity Associated with Applied and Environmental Microbiology 43(6), 1307-1310. Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep Tvede, M., and Rask-Madsen, J. (1989). Bacteriotherapy for chronic Sequencing mBio 3(5), e()0338-12-e?)0338-12. relapsing Clostridium difficile diarrhoea in six patients. Lancet Sharpe, E.E., Nickerson, K.W. Bulla JR. L.A., and Aronson, J.N. 1(8648), 1156-1160. (1975). Separation of spores and parasporal crystals of Bacillus Ubenda, C., Bucci, V., Caballero, S., Djukovic, A., Toussaint, N.C., thuringiensis in gradients of certain X-ray contrasting agents. Applied Equinda, M., Lipuma, L., Ling, L., Gobourne, A., No, D., et al. Microbiology 30(6), 1052. (2013). Intestinal Microbiota Containing Barnesiella Species Cures Vancomycin-Resistant Enterococcus faecium Colonization. Infect, Sheu, T.-Y., Marshall, R.T., and Heymann, H. (1993). Improving Immun. 81(3),965-973. Survival of Culture Bacteria in Frozen Desserts by Microentrapment. Ubenda, C., Taur. Y., Jenq, R.R. Equinda, M.J., Son, T., Samstein, Journal of Dairy Science 76(7), 1902-1907. M. Viale, A., Socci, N.D., Van Den Brink, M.R.M., Kamboj. M., et Siaterlis, A., Deepika, G., and Charalampopoulos, D. (2009). Effect al. (2010). Vancomycin-resistant Enterococcus domination of intes of culture medium and cryoprotectants on the growth and Survival of tinal microbiota is enabled by antibiotic treatment in mice and pre probiotic lactobacilli during freeze drying. Letters in Applied cedes bloodstream invasion in humans. Journal of Clinical Investi Microbiology 48(3), 295-301. gation 120(12), 4332-4341. Sigma-Tau. VSL#3. (56) References Cited Wroblewski. D., Hannett, G.E., Bopp, D.J., Dumyati, G.K., Halse, T.A., Dumas, N.B., and Musser, K.A. (2009). Rapid Molecular Char OTHER PUBLICATIONS acterization of Clostridium difficile and Assessment of Populations of C. dificile in Stool Specimens, Journal of Clinical MIcrobiology Wagman, J., and Weneck, E.J. (1963), Preservation of bacteria by circulating-gas freeze drying, Applied Microbiology 1 1(3), 244-248. 47(7), 2142-2148. Waites, W.M., and Wyatt, L.R. (1971), Germination of spores of Yamakawa, K. et al., “Enhancement of Clostridium difficile Toxin Clostridium bifermenians by certain amino acids, lactate and Production in Biotin-Limited Condition' J. Med. Microbiol., Feb. pyruvate in the presence of Sodium potassium ions, J. Gen, 1996, pp. 111-114, vol. 44, No. 2. Microbiol, 67(2), 215-222. Yamamura, H., Hayakawa, M., and Imura, Y. (2003). Application of Waites, W.M., and Wyatt, L.R. (1974). The effect of pH, germinants Sucrose-gradient centrifugation for selective isolation of Nocardia and temperature on the germination of spores of Clostridium spp. from soil. Journal of Applied Microbiology 95(4), 677-685. bifermentan. J. Gen. Microbiol 80(1). 253-256. Yang, W.-W., and Ponce, A. (2009). Rapid endospore viability assay Walker, A.W., and Lawley, T.D. (2012), Therapeutic molulation of of Costridium sporogenes spores. INternational Journal of Food intestinal dysbiosis. Pharmacological Research 69(1), 75-86. Microbiology 133(3), 213-216. Wang, M. et al., “Comparison of Bacterial Diversity Along the Yang, W.-W., and Ponce, A. (2011). Validation of a Clostridium Human Intestinal Tract by Direct Cloning and Sequencing of 16S Endospore Viability Assay and Analysis of Greenland Ices and rRNA Genes' FEMS Microbioiogy Ecology, 2005, pp. 219-231, vol. Atacama Desert Soils. Appl. Environ. Microbiol. 77(7), 2352-2358. 54. Yang. W.-W. Crow-Willard, E.N., and Ponce, A. (2009). Production Wang, S., and Curtiss III, R. (2014). Development of Streptococcus and characterization of pure Clostridium spore Suspensions. J. Appl. pneumoniae Vaccines Using Live Vectors. Vaccines 2(1), 49-88. Microbiol. 106(1), 27-33. Weingarden, A.R., Chen, C., Bobr, A.Yao, D., Lu, Y. Nelson, V.M., Yang, W.W. (2010). Fast Viability Assessment of Clostridium Spores Sadowsky, M.J., and Khoruts, A. (2013). Microbiota transplantation Survival in Extreme Environments. PhD thesis California Institute of restores normal fecal bile acid composition in recurrent Clostridium Technology. difficile infection AJP: Gastrointestinal and Liver Physiology 306(4), G310-G319. Yi. X., and Setlow, P. (2010). Studies of the Commitment Step in the Wiencek, K.M. et al., “Hydrophobicity of Bacillusand Clostridium Germination of Spores of Bacillus Species, J. Bacteriol. 192(13), Spores,” Applied and Environmental Microbiology, Sep. 1990, pp. 3424-3433. 2600-2605, vol. 56, No. 9. Yung, P.T., and Ponce, A. (2008). Fast Sterility Assessment by Wilson, K.H., and Sheagren, J.N. (1983). Antagonism of toxigenic Germinable-Endospore Biodosimetry. Appl. Environ. Microbiol. Clostridium difficile by nontoxigenic C. difficile. Journal ofInfectious 74(24), 7669-7674. Diseases 147(4). 733. Yunoki, M., Tsujikawa, M., Urayama, T., Sasaki, Y. Morita, M., Wilson, K.H., Silva, J., and Fekety, F.R. (1981). Suppression of Tanaka, H., Hattori, S., Takechi, K., and Ikuta, K. (2003). Heat Clostridium difficile by Normal Hamster Cecal Flora and Prevention sensitivity of human parvovirus B19. Vox Sanguinis 84(3), 164-169. of Antibiotic-Associated Cecitis. Infect Immun34(2), 626-628. Zeng, Y. Fan, H., Chiueh, G., Pham, B., Matin, R., Lechuga-Bal Wilson, K, et al., “Role of Competition For Nutrients in Suppression lesteros, D., Truong, V.L., Joshi, S.B., and Middaugh, C.R. (2009). of Clostridium difficile by The Colonic Microflora,” Infection and Towards development of stable formulations of a live attenuated Immunity, Oct. 1988, pp. 2610-2614m vol. 56, No. 10. bacterial vaccine: a preformulation study facilitated by a biophysical Woo, T.D.H., Oka, K., Takahashi, M., Hojo, F. Osaki, T., Hanawa, T., approach. Hum Vaccin 5(5), 322-331. Kurata, S. Yonezawa, H., and Kamiya. S. (2011). Inhibition of the Zhao, J., Krishna, V., Moudgil, B., and Koopman, B. (2008). Evalu cytotoxic effect of Clostridium dificile in vitro by Clostridium ation of endospore purification methods applied to Bacillis cereus. butyricum MIYAIRI 588 strain. J. Med. Microbiol. 60(Pt 11), 1617 Separation and Purification Technology 61(3), 341-347. 1625. United States Office Action, U.S. Appl. No. 14/313,828, Dec. 10, Wróbel, B. (2008), Statistical measures ofuncertainty for branches in 2014, 7 pages. Phylogenetic trees inferred from molecular sequences by using model-based methods. J. Appl. Genet. 49(1), 49-67. * cited by examiner U.S. Patent Apr. 21, 2015 Sheet 2 of 21 US 9,011,834 B1 FG. 2 U.S. Patent Apr. 21, 2015 Sheet 3 of 21 US 9,011,834 B1 s U.S. Patent Apr. 21, 2015 Sheet 5 of 21 US 9,011,834 B1 ********* U.S. Patent Apr. 21, 2015 Sheet 6 of 21 US 9,011,834 B1 ************%)ºg **********•ágo?ºgº? ?+zo+abot§.#{{{3|? «isotaoot***********å U.S. Patent Apr. 21, 2015 Sheet 7 of 21 US 9,011,834 B1 §ž§§§§ §§§§§§ ?žÅ$:$¿************************************************ §******* }??) (unp) earns too U.S. Patent Apr. 21, 2015 Sheet 8 of 21 US 9,011,834 B1 {}{}{}; (ufry) reagansea U.S. Patent Apr. 21, 2015 Sheet 9 of 21 US 9,011,834 B1 uerºnaoanods Donations colored by Donor 38:8: 8:8 ?(~~~~~~~~~~~~3 8: 8-33 it G. 9 U.S. Patent Apr. 21, 2015 Sheet 10 of 21 US 9,011,834 B1 & 3s: &: s: & {} : 88. s s 3. in to in to n (extease ionio U.S. Patent Apr. 21, 2015 Sheet 11 of 21 US 9,011,834 B1 E-4 M2GSC-ys 8 BS Ox 8 Ca-PA 3 RF 8. SGF 3 wic 8 FBS 8 thi Sw8-ys M26SC M2GSCLys F.G. 11 U.S. Patent Apr. 21, 2015 Sheet 12 of 21 US 9,011,834 B1 oxgapated on GAM/manitol & GAMFOSinuin n-83 Ruminococcus othetism Ruminococci's atts Costidium sporican iostricium javalense is sortiei 109 EtOH plated on PEA sheep blood -262 Ramirococcurs sp. K Runninococcusatists NCB * ry Raininococcurs abus 7 FG 2 U.S. Patent Apr. 21, 2015 Sheet 13 of 21 US 9,011,834 B1 3?ô?ôG U.S. Patent Apr. 21, 2015 Sheet 14 of 21 US 9,011,834 B1 ic: ; 8: Sweet 8:a:: 388-8 : 8.83: . 8-ysogype ::::::: x + iysozyme 3888-83 : & SC 8 Activation Temperature 3.088-88 go 3.008-0s w 5 3.338-38 - 83-ysexeye 388-33 . s 83 s 83C Activation emperature F.G. 14 U.S. Patent Apr. 21, 2015 Sheet 15 of 21 US 9,011,834 B1 80+300°T U.S. Patent Apr. 21, 2015 Sheet 17 of 21 US 9,011,834 B1 C. oo N (a o o go o C Q 3A 88 . f c was a O) co w o a co N. co w war wa C C C &Os - Aed O &Ailee feAA U.S. Patent Apr. 21, 2015 Sheet 18 of 21 US 9,011,834 B1 x83 : 38883 ::::::::8: U.S. Patent Apr. 21, 2015 Sheet 19 of 21 US 9,011,834 B1 ?ºuve,92C](%18)zodi U.S. Patent Apr. 21, 2015 Sheet 20 of 21 US 9,011,834 B1 særpedsdnouºsinbou?saprouanong U.S. Patent Apr. 21, 2015 Sheet 21 of 21 US 9,011,834 B1 US 9,011,834 B1 1. 2 COMPOSITIONS AND METHODS U.S. Pat. No. 8,034,601. Probiotics, however, have been lim ited to a very narrow group of genera and a correspondingly RELATED APPLICATIONS limited number of species; as such, they do not adequately replace the missing natural microflora of the GI tract in many This application is a continuation of International Appli situations. cation No. PCT/US2014/014745, filed on Feb. 4, 2014, Thus practitioners have a need for a method of populating entitled “Compositions and Methods, which claims priority a subject's gastrointestinal tract with a diverse and useful to U.S. Provisional Application No. 61/760,584, filed Feb. 4, selection of microbiota in order to alter a dysbiosis. 2013 and U.S. Provisional Application No. 61/760,585, filed Therefore, in response to the need for durable, efficient, Feb. 4, 2013, and U.S. Provisional Application No. 61/760, 10 and effective compositions and methods for treatment of GI 574, filed Feb. 4, 2013, and U.S. Provisional Application No. diseases by way of restoring or enhancing microbiota func 61/760,606, filed Feb. 4, 2013, and U.S. Provisional Appli tions, we address these and other shortcomings of the prior art cation No. 61/926,918, filed Jan. 13, 2014. These applications by providing compositions and methods for treating Subjects. are all incorporated by reference in their entirety for all pur poses. 15 SUMMARY OF THE INVENTION REFERENCE TO ASEQUENCE LISTING Disclosed herein are therapeutic compositions containing non-pathogenic, germination-competent bacterial spores, for This application includes a Sequence Listing Submitted the prevention, control, and treatment of gastrointestinal dis electronically as a text file named 2597OUS CRF se eases, disorders and conditions and for general nutritional quencelisting..txt, created on Apr. 21, 2014, with a size of health. These compositions are advantageous in being Suit 4.324.487 bytes. The sequence listing is incorporated by ref able for safe administration to humans and other mammalian CCC. Subjects and are efficacious in numerous gastrointestinal dis eases, disorders and conditions and in general nutritional BACKGROUND 25 health. Mammals are colonized by microbes in the gastrointestinal BRIEF DESCRIPTION OF THE DRAWINGS (GI) tract, on the skin, and in other epithelial and tissue niches Such as the oral cavity, eye surface and vagina. The gas FIG. 1A provides a schematic of 16S rRNA gene and trointestinal tract harbors an abundant and diverse microbial 30 denotes the coordinates of hypervariable regions 1-9 (V1 community. It is a complex system, providing an environment V9). Coordinates of V1-V9 are 69-99, 137-242, 433-497, or niche for a community of many different species or organ 576-682, 822-879, 986-1043, 1117-1173, 1243-1294, and isms, including diverse strains of bacteria. Hundreds of dif 1435-1465 respectively, based on numbering using E. coli ferent species may form a commensal community in the GI system of nomenclature defined by Brosius et al., Complete tract in a healthy person, and this complement of organisms 35 nucleotide sequence of a 16S ribosomal RNA gene (16S evolves from the time of birth to ultimately form a function rRNA) from Escherichia coli, PNAS 75(10):4801-4805 ally mature microbial population by about 3 years of age. (1978). FIG. 1B highlights in bold the nucleotide sequences Interactions between microbial strains in these populations for each hypervariable region in the exemplary reference E. and between microbes and the host, e.g. the host immune coli 16S sequence described by Brosius et al. system, shape the community structure, with availability of 40 FIG. 2 shows a photograph of a CsCl gradient demonstrat and competition for resources affecting the distribution of ing the spore separation from other residual habitat material. microbes. Such resources may befood, location and the avail FIG.3 shows three phase contrast image demonstrating the ability of space to grow or a physical structure to which the progressive enrichment of spores from a fecal Suspension; microbe may attach. For example, host diet is involved in ethanol treated, CsCl purified spore preparation; and an etha shaping the GI tract flora. 45 nol treated, CsCl purified, Sucrose purified spore preparation. A healthy microbiota provides the host with multiple ben FIG. 4 shows a set of survival curves demonstrating effi efits, including colonization resistance to a broad spectrum of cacy of the spore population in a mouse prophylaxis model of pathogens, essential nutrient biosynthesis and absorption, C. difficile. and immune stimulation that maintains a healthy gut epithe FIG. 5 provides a set of survival curves demonstrating lium and an appropriately controlled systemic immunity. In 50 efficacy of the spore population in a hamster relapse preven settings of dysbiosis or disrupted symbiosis, microbiota tion model of C. difficile. functions can be lost or deranged, resulting in increased sus FIG. 6 demonstrates the cell viability under a variety of ceptibility to pathogens, altered metabolic profiles, or induc ethanol and heat treatments for varying lengths of time. tion of proinflammatory signals that can result in local or FIG. 7 demonstrates cell survivability from four donor systemic inflammation or autoimmunity. Thus, the intestinal 55 fecal samples after heat treatment at 60 C for 5 minutes. microbiota plays a significant role in the pathogenesis of FIG. 8 demonstrates that ethanol reduces both anaerobic many diseases and disorders, including a variety of patho and aerobic bacterial species by several orders of magnitude genic infections of the gut. For instance, Subjects become in seconds. more Susceptible to pathogenic infections when the normal FIG.9 demonstrates the spore concentration of fecal dona intestinal microbiota has been disturbed due to use of broad 60 tions from multiple donors over time. spectrum antibiotics. Many of these diseases and disorders FIG. 10 shows the strong correlation and linear correspon are chronic conditions that significantly decrease a subjects dence between the measurement of DPA concentration by a quality of life and can be ultimately fatal. coupled fluorescence assay and the viable spore colony form Manufacturers of probiotics have asserted that their prepa ing units rations of bacteria promote mammalian health by preserving 65 FIG. 11 demonstrates the effect on various germination the natural microflora in the GI tract and reinforcing the treatments on the ability to cultivate vegetative bacteria from normal controls on aberrant immune responses. See, e.g., a spore population. US 9,011,834 B1 3 4 FIG. 12 demonstrates the increase in bacterial diversity alternative embodiments of the structures and methods illus from using a germinant treatment to grow vegetative bacteria trated herein may be employed without departing from the from spore populations. principles of the invention described herein. FIG. 13 demonstrates the role of heat activation at various temperatures on spores from three different donor fecal DESCRIPTION OF THE TABLES samples. FIG. 14 demonstrates a lysozyme treatment with heat acti Table 1. List of Operational Taxonomic Units (OTU) with Vation improves germination at most temperatures. taxonomic assignments made to Genus, Species, and Phylo FIG. 15 demonstrates spore concentrations present in a genetic Clade. Clade membership of bacterial OTUs is based fecal sample grown on various medias. 10 on 16S sequence data. Clades are defined based on the topol FIG. 16 demonstrates similar spore production from incu ogy of a phylogenetic tree that is constructed from full-length bating plates for 2 and 7 days after a spore population was germinated on plates with various medias. 16S sequences using maximum likelihood methods familiar FIG. 17 demonstrates the protective efficacy of the spore to individuals with ordinary skill in the art of phylogenetics. population in mice challenged with C. difficile as measured by 15 Clades are constructed to ensure that all OTUs in a given the change in weight of mice over the course of the experi clade are: (i) within a specified number of bootstrap Sup ment. Each plot tracks the change in the individual mouse's ported nodes from one another, and (ii) within 5% genetic weight relative to day -1 over the course of the experiment. similarity. OTUs that are within the same clade can be distin The number of deaths over the course of the experiment is guished as genetically and phylogenetically distinct from indicated at the top of the chart and demonstrated by a line OTUs in a different clade based on 16S-V4 sequence data, termination prior to day 6. The top panels (from left to right) while OTUs falling within the same clade are closely related. are the vehicle control arm, the fecal Suspension arm, and the OTUs falling within the same clade are evolutionarily closely untreated naive control arm, while the bottom panels are the related and may or may not be distinguishable from one ethanol treated, gradient purified spore preparation; the etha another using 16S-V4 sequence data. Members of the same nol treated, gradient purified, “germinable' spore prepara 25 clade, due to their evolutionary relatedness, play similar func tion, and ethanol treated, gradient purified, “sporulatable' tional roles in a microbial ecology Such as that found in the preparation. human gut. Compositions Substituting one species with FIG. 18 demonstrates the microbial diversity measured in another from the same clade are likely to have conserved the ethanol treated spore treatment sample and patient pre ecological function and therefore are useful in the present and post-treatment samples. Total microbial diversity is 30 invention. All OTUs are denoted as to their putative capacity defined using the Chao 1 Alpha-Diversity Index and is mea to form spores and whether they area Pathogen or Pathobiont sured at the same genomic sampling depths to confirm (see Definitions for description of “Pathobiont'). NIAID Pri adequate sequence coverage to assay the microbiome in the ority Pathogens are denoted as Category-A, Category-B, target samples. The patient pretreatment (purple) harbored a or Category-C, and Opportunistic Pathogens are denoted as microbiome that was significantly reduced in total diversity 35 as compared to the ethanol treated spore treatment (red) and OP. OTUs that are not pathogenic or for which their ability patient post treatment at days 5 (blue), 14 (orange), and 25 to exist as a pathogen is unknown are denoted as N. The (green). SEQ ID Number denotes the identifier of the OTU in the FIG. 19 demonstrates how the patient microbial ecology is Sequence Listing File and Public DB Accession denotes the shifted by treatment with an ethanol treated spore treatment 40 identifier of the OTU in a public sequence repository. from a dysbiotic state to a state of health. Principle coordi Table 2 contains bacterial OTUs identified from the 16s nates analysis based on the total diversity and structure of the analysis of the ethanol treated spore population before and microbiome (Bray Curtis Beta Diversity) of the patient pre after a CsCl gradient purification. and post-treatment delineates that the combination of engraft Table 3 contains the mortality and weight change of mice ment of the OTUs from the spore treatment and the augmen 45 treated with a donor fecal Suspension and an ethanol and/or tation of the patient microbial ecology leads to a microbial heat-treated spore preparation at various dilutions, ecology that is distinct from both the pretreatment micro Table 4 contains OTUs identified from spore forming spe biome and the ecology of the ethanol treated spore treatment. cies generated by picking colonies from a spore preparation FIG. 20 demonstrates the augmentation of bacteroides spe involving various heat treatments cies in patients treated with the spore population. Comparing 50 Table 5 contains OTUs not identified in untreated fecal the number of Bacteroides colonies from fecal Suspensions slurries, but identified in ethanol treated or heat treated spore pre-treatment and in week 4 post treatment reveals an populations. increase of 4 logs or greater. Colonies were enumerated by Table 6 contains OTUs identified from an ethanol treated serial dilution and plating on Bacteroides Bile Esculin agar spore population isolated from a microbiome sample from which is highly selective for the B. fragilis group. Species 55 donor A. were determined by 16S full-length sequence identification. Table 7 contains OTUs identified from an ethanol treated FIG. 21 demonstrates the increase in number of species spore population isolated from a microbiome sample from engrafting and species augmenting in patient’s microbiomes donor B. after treatment with an ethanol-treated spore population. Table 8 contains OTUs identified from an ethanol treated Relative abundance of species that engrafted or augmented as 60 spore population isolated from a microbiome sample from described were determined based on the number of 16S donor C. sequence reads. Each plot is from a different patient treated Table 9 contains OTUs identified from an ethanol treated with the ethanol-treated spore population for recurrent C. spore population isolated from a microbiome sample from difficile. donor D. The figures depict various embodiments of the present 65 Table 10 contains OTUs identified from an ethanol treated invention for purposes of illustration only. One skilled in the spore population isolated from a microbiome sample from art will readily recognize from the following discussion that donor E. US 9,011,834 B1 5 6 Table 11 contains OTUs identified from an ethanol treated Subject, typically a mammal Such as a human, including spore population isolated from a microbiome sample from eukaryotes, archaea, bacteria, and viruses (including bacte donor F. rial viruses i.e., phage). Table 12 contains OTUs identified from growing ethanol “Microbiome' refers to the genetic content of the commu treated spore populations on various media types. nities of microbes that live in and on the human body, both Table 13. Species identified as “germinable' and “sporu Sustainably and transiently, including eukaryotes, archaea, latable by colony picking approach Table YYY. Species identified as “germinable' using 16S bacteria, and viruses (including bacterial viruses (i.e., V4 NGS approach. phage)), wherein "genetic content includes genomic DNA, Table ZZZ. Species identified as “sporulatable' using 16s RNA such as ribosomal RNA, the epigenome, plasmids, and V4 NGS approach. 10 all other types of genetic information. Table AC shows spore content data from 3 different ethanol “Microbial Carriage' or simply “Carriage” refers to the treated spore preparations used to Successfully treat 3 patients population of microbes inhabiting a niche within or on suffering from recurrent C. difficile infection. humans. Carriage is often defined in terms of relative abun Table AD. DPA doses in Table AC when normalized to dance. For example, OTU1 comprises 60% of the total micro 4x10 SCFU per dose 15 bial carriage, meaning that OTU1 has a relative abundance of Table GB. OTUs detected by a minimum of ten 16S-V4 60% compared to the other OTUs in the sample from which sequence reads in at least a one ethanol treated spore prepa the measurement was made. Carriage is most often based on ration (pan-microbiome). OTUs that engraft in a treated genomic sequencing data where the relative abundance or patients and the percentage of patients in which they engraft carriage of a single OTU or group of OTUs is defined by the are denoted, as are the clades, spore forming status, and number of sequencing reads that are assigned to that OTU/s Keystone OTU status. Starred OTUs occur in >80% of the relative to the total number of sequencing reads for the ethanol preps and engraft in a 50% of the treated patients. sample. Table GC ranks the top 20 OTUs by CES with the further “Microbial Augmentation” or simply “augmentation' requirement that an OTU must be shown to engraft to be a refers to the establishment or significant increase of a popu considered an element of a core ecology. 25 lation of microbes that are (i) absent or undetectable (as Table GD: Subsets of the Core Ecology tested in the C. determined by the use of standard genomic and microbiologi difficile mouse model cal techniques) from the administered therapeutic microbial Table GE: Results of bacterial compositions tested in a C. composition, (ii) absent, undetectable, or present at low fre difficile mouse model. Table GF. OTUs and their clade assignments tested in quencies in the host niche (as example: gastrointestinal tract, ternary combinations with results in the in vitro inhibition 30 skin, anterior-nares, or vagina) before the delivery of the assay microbial composition, and (iii) are found after the adminis Table Z.A. Microbial compositions administered via oral tration of the microbial composition or significantly increase, gavage on Day -1 for instance 2-fold, 5-fold, 1x10, 1x10, 1x10, 1x10, Table TAB. Population of OTUs on Days 2, 3 and 4 fol 1x10, 1x10", or greater than 1x10, in cases where they were lowing dosing with Microbial Compositions 35 present at low frequencies. The microbes that comprise an Table TAC. Population of clades on Days 2, 3 and 4 fol augmented ecology can be derived from exogenous sources lowing dosing with Microbial Compositions Such as food and the environment, or grow out from micro Table TAD. Mortality by experimental group in mice chal niches within the host where they reside at low frequency. lenged with 104.5 C. difficile spores on Day 0 The administration of the therapeutic microbial composi 40 tion induces an environmental shift in the target niche that DETAILED DESCRIPTION promotes favorable conditions for the growth of these com mensal microbes. In the absence of treatment with a thera Overview peutic microbial composition, the host can be constantly Disclosed herein are therapeutic compositions containing exposed to these microbes; however, Sustained growth and non-pathogenic, germination-competent bacterial spores, for 45 the positive health effects associated with the stable popula the prevention, control, and treatment of gastrointestinal dis tion of increased levels of the microbes comprising the aug eases, disorders and conditions and for general nutritional mented ecology are not observed. health. These compositions are advantageous in being Suit “Microbial Engraftment' or simply "engraftment” refers able for safe administration to humans and other mammalian to the establishment of OTUs comprising atherapeutic micro Subjects and are efficacious in numerous gastrointestinal dis 50 bial composition in a target niche that are absent in the treated eases, disorders and conditions and in general nutritional host prior to treatment. The microbes that comprise the health. While spore-based compositions are known, these are engrafted ecology are found in the therapeutic microbial generally prepared according to various techniques such as composition and establish as constituents of the host micro lyophilization or spray-drying of liquid bacterial cultures, bial ecology upon treatment. Engrafted OTUs can establish resulting in poor efficacy, instability, Substantial variability 55 for a transient period of time, or demonstrate long-term sta and lack of adequate safety and efficacy. bility in the microbial ecology that populates the host post It has now been found that populations of bacterial spores treatment with a therapeutic microbial composition. The can be obtained from biological materials obtained from engrafted ecology can induce an environmental shift in the mammalian Subjects, including humans. These populations target niche that promotes favorable conditions for the growth are formulated into compositions as provided herein, and 60 of commensal microbes capable of catalyzing a shift from a administered to mammalian Subjects using the methods as dysbiotic ecology to one representative of a health state. provided herein. “Ecological Niche' or simply "Niche' refers to the eco logical space in which a an organism or group of organisms DEFINITIONS occupies. Niche describes how an organism or population or 65 organisms responds to the distribution of resources, physical “Microbiota refers to the community of microorganisms parameters (e.g., host tissue space) and competitors (e.g., by that occur (Sustainably or transiently) in and on an animal growing when resources are abundant, and when predators, US 9,011,834 B1 7 8 parasites and pathogens are scarce) and how it in turn alters on the skin itself, in Saliva, mucus of the respiratory tract, or those same factors (e.g., limiting access to resources by other secretions of the genitourinary tract (i.e., biological matter organisms, acting as a food source for predators and a con associated with the microbial community). Substantially free Sumer of prey). of residual habitat products means that the bacterial compo “Dysbiosis” refers to a state of the microbiota of the gut or sition no longer contains the biological matter associated with other body area in a Subject, including mucosal or skin Sur the microbial environment on or in the human or animal faces in which the normal diversity and/or function of the subject and is 100% free, 99% free, 98% free, 97% free, 96% ecological network is disrupted. This unhealthy State can be free, or 95% free of any contaminating biological matter due to a decrease in diversity, the overgrowth of one or more associated with the microbial community. Residual habitat pathogens or pathobionts, symbiotic organisms able to cause 10 products can include abiotic materials (including undigested disease only when certain genetic and/or environmental con food) or it can include unwanted microorganisms. Substan ditions are present in a subject, or the shift to an ecological tially free of residual habitat products may also mean that the microbial network that no longer provides an essential func bacterial composition contains no detectable cells from a tion to the host Subject, and therefore no longer promotes human or animal and that only microbial cells are detectable. health. 15 In one embodiment, substantially free of residual habitat “Pathobionts’ or “Opportunistic Pathogens' refers to sym products may also mean that the bacterial composition con biotic organisms able to cause disease only when certain tains no detectable viral (including bacterial viruses (i.e., genetic and/or environmental conditions are present in a Sub phage)), fungal, mycoplasmal contaminants. In another ject. embodiment, it means that fewer than 1x10%, 1x10%, “Phylogenetic tree' refers to a graphical representation of 1x10%, 1x10%, 1x10%, 1x107%, 1x10 of the the evolutionary relationships of one genetic sequence to viable cells in the bacterial composition are human or animal, another that is generated using a defined set of phylogenetic as compared to microbial cells. There are multiple ways to reconstruction algorithms (e.g. parsimony, maximum likeli accomplish this degree of purity, none of which are limiting. hood, or Bayesian). Nodes in the tree represent distinctances Thus, contamination may be reduced by isolating desired tral sequences and the confidence of any node is provided by 25 constituents through multiple steps of streaking to single a bootstrap or Bayesian posterior probability, which mea colonies on Solid media until replicate (such as, but not lim Sures branch uncertainty. ited to, two) streaks from serial single colonies have shown “Operational taxonomic units.” “OTU (or plural, only a single colony morphology. Alternatively, reduction of “OTUs) refer to a terminal leaf in a phylogenetic tree and is contamination can be accomplished by multiple rounds of defined by a nucleic acid sequence, e.g., the entire genome, or 30 serial dilutions to single desired cells (e.g., a dilution of 10 a specific genetic sequence, and all sequences that share or 10), such as through multiple 10-fold serial dilutions. sequence identity to this nucleic acid sequence at the level of This can further be confirmed by showing that multiple iso species. In some embodiments the specific genetic sequence lated colonies have similar cell shapes and Gram staining may be the 16S sequence or a portion of the 16S sequence. In behavior. Other methods for confirming adequate purity other embodiments, the entire genomes of two entities are 35 include genetic analysis (e.g. PCR, DNA sequencing), serol sequenced and compared. In another embodiment, select ogy and antigen analysis, enzymatic and metabolic analysis, regions such as multilocus sequence tags (MLST), specific and methods using instrumentation Such as flow cytometry genes, or sets of genes may be genetically compared. In 16S with reagents that distinguish desired constituents from con embodiments, OTUs that share >97% average nucleotide taminants. identity across the entire 16S or some variable region of the 40 “Clade' refers to the OTUs or members of a phylogenetic 16S are considered the same OTU (see e.g. Claesson M J. tree that are downstream of a statistically valid node in a Wang Q, O'Sullivan O, Greene-Diniz R. Cole J R, Ros RP. phylogenetic tree. The clade comprises a set of terminal and O’Toole PW. 2010. Comparison of two next-generation leaves in the phylogenetic tree that is a distinct monophyletic sequencing technologies for resolving highly complex micro evolutionary unit and that share some extent of sequence biota composition using tandem variable 16S rRNA gene 45 similarity. regions. Nucleic Acids Res 38: e200. Konstantinidis KT, In microbiology, “16S sequencing or “16S-rRNA' or Ramette A, and Tiede J.M. 2006. The bacterial species defi “16S refers to sequence derived by characterizing the nucle nition in the genomic era. Philos Trans R Soc Lond B Biol Sci otides that comprise the 16S ribosomal RNA gene(s). The 361: 1929-1940.). In embodiments involving the complete bacterial 16S rDNA is approximately 1500 nucleotides in genome, MLSTs, specific genes, or sets of genes OTUS that 50 length and is used in reconstructing the evolutionary relation share >95% average nucleotide identity are considered the ships and sequence similarity of one bacterial isolate to same OTU (see e.g. Achtman M, and Wagner M. 2008. another using phylogenetic approaches. 16S sequences are Microbial diversity and the genetic nature of microbial spe used for phylogenetic reconstruction as they are in general cies. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis KT, highly conserved, but contain specific hyperVariable regions Ramette A, and Tiede J.M. 2006. The bacterial species defi 55 that harbor sufficient nucleotide diversity to differentiate gen nition in the genomic era. Philos Trans R Soc Lond B Biol Sci era and species of most bacteria. 361: 1929-1940.). OTUs are frequently defined by comparing The “V1-V9 regions” of the 16S rRNA refers to the first sequences between organisms. Generally, sequences with through ninth hypervariable regions of the 16S rRNA gene less than 95% sequence identity are not considered to form that are used for genetic typing of bacterial samples. These part of the same OTU. OTUs may also be characterized by 60 regions in bacteria are defined by nucleotides 69-99, 137-242, any combination of nucleotide markers or genes, in particular 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243 highly conserved genes (e.g., "house-keeping genes), or a 1294 and 1435-1465 respectively using numbering based on combination thereof. Such characterization employs, e.g., the E. coli system of nomenclature. Brosius et al., Complete WGS data or a whole genome sequence. nucleotide sequence of a 16S ribosomal RNA gene from “Residual habitat products’ refers to material derived from 65 Escherichia coli, PNAS 75(10):4801-4805 (1978). In some the habitat for microbiota within or on a human or animal. For embodiments, at least one of the V1,V2, V3, V4, V5, V6, V7, example, microbiota live in feces in the gastrointestinal tract, V8, and V9 regions are used to characterize an OTU. In one US 9,011,834 B1 9 10 embodiment, the V1,V2, and V3 regions are used to charac The term “Phylogenetic Diversity” refers to the biodiver terize an OTU. In another embodiment, the V3, V4, and V5 sity present in a given Network Ecology or Core Network regions are used to characterize an OTU. In another embodi Ecology based on the OTUs that comprise the network. Phy ment, the V4 region is used to characterize an OTU. A person logenetic diversity is a relative term, meaning that a Network of ordinary skill in the art can identify the specific hypervari Ecology or Core Network that is comparatively more phylo able regions of a candidate 16S rRNA by comparing the genetically diverse than another network contains a greater candidate sequence in question to a reference sequence and number of unique species, genera, and taxonomic families. identifying the hyperVariable regions based on similarity to Uniqueness of a species, genera, or taxonomic family is gen the reference hyperVariable regions, or alternatively, one can erally defined using a phylogenetic tree that represents the 10 genetic diversity all species, genera, or taxonomic families employ Whole Genome Shotgun (WGS) sequence character relative to one another. In another embodiment phylogenetic ization of microbes or a microbial community. diversity may be measured using the total branch length or The term “subject” refers to any animal subject including average branch length of a phylogenetic tree. humans, laboratory animals (e.g., primates, rats, mice), live “Spore' or “endospore” refers to an entity, particularly a Stock (e.g., cows, sheep, goats, pigs, turkeys, and chickens), 15 bacterial entity, which is in a dormant, non-vegetative and and household pets (e.g., dogs, cats, and rodents). The Subject non-reproductive stage. Spores are generally resistant to envi may be suffering from a dysbiosis, including, but not limited ronmental stress Such as radiation, desiccation, enzymatic to, an infection due to a gastrointestinal pathogen or may beat treatment, temperature variation, nutrient deprivation, and risk of developing or transmitting to others an infection due to chemical disinfectants. a gastrointestinal pathogen. A “spore population” refers to a plurality of spores present The term “phenotype” refers to a set of observable charac in a composition. Synonymous terms used herein include teristics of an individual entity. As example an individual spore composition, spore preparation, ethanol treated spore subject may have a phenotype of “health' or “disease’. Phe fraction and spore ecology. A spore population may be puri notypes describe the state of an entity and all entities within a fied from a fecal donation, e.g. via ethanol or heat treatment, phenotype share the same set of characteristics that describe 25 or a density gradient separation or any combination of meth the phenotype. The phenotype of an individual results in part, ods described herein to increase the purity, potency and/or orin whole, from the interaction of the entities genome and/or concentration of spores in a sample. Alternatively, a spore microbiome with the environment. population may be derived through culture methods starting The term “Network Ecology” refers to a consortium of from isolated spore former species or spore former OTUs or OTUs that co-occur in some number of subjects. As used 30 from a mixture of Such species, either in vegetative or spore herein, a “network” is defined mathematically by a graph form. delineating how specific nodes (i.e. OTUs) and edges (con In one embodiment, the spore preparation comprises spore nections between specific OTUs) relate to one another to forming species wherein residual non-spore forming species define the structural ecology of a consortium of OTUs. Any have been inactivated by chemical or physical treatments given Network Ecology will possess inherent phylogenetic 35 including ethanol, detergent, heat, Sonication, and the like; or diversity and functional properties. A Network Ecology can wherein the non-spore forming species have been removed also be defined in terms of function where for example the from the spore preparation by various separations steps nodes would be comprised of elements such as, but not lim including density gradients, centrifugation, filtration and/or ited to, enzymes, clusters of orthologous groups (COGS: chromatography; or wherein inactivation and separation http://www.ncbi.nlm.nih.gov/books/NBK21090/), or KEGG 40 methods are combined to make the spore preparation. In yet pathways (www.genome.jp/kegg/). another embodiment, the spore preparation comprises spore The terms “Network Class”, “Core Network” and “Core forming species that are enriched over viable non-spore form Network Ecology” refer to a group of network ecologies that ers or vegetative forms of spore formers. In this embodiment, in general are computationally determined to comprise ecolo spores are enriched by 2-fold, 5-fold, 10-fold, 50-fold, 100 gies with similar phylogenetic and/or functional characteris 45 fold, 1000-fold, 10,000-fold or greater than 10,000-fold com tics. A Core Network therefore contains important biological pared to all vegetative forms of bacteria. In yet another features, defined either phylogenetically or functionally, of a embodiment, the spores in the spore preparation undergo group (i.e., a cluster) of related network ecologies. One rep partial germination during processing and formulation Such resentation of a Core Network Ecology is a designed consor that the final composition comprises spores and vegetative tium of microbes, typically non-pathogenic bacteria, that rep 50 bacteria derived from spore forming species. resents core features of a set of phylogenetically or A “germinant' is a material or composition or physical functionally related network ecologies seen in many different chemical process capable of inducing vegetative growth of a Subjects. In many occurrences, a Core Network, while bacterium that is in a dormant spore form, or group of bacteria designed as described herein, exists as a Network Ecology in the spore form, either directly or indirectly in a host organ observed in one or more subjects. Core Network ecologies are 55 ism and/or in vitro. useful for reversing or reducing a dysbiosis in Subjects where A 'sporulation induction agent' is a material or physical the underlying, related Network Ecology has been disrupted. chemical process that is capable of inducing sporulation in a The term “Keystone OTU refers to one or more OTUs that bacterium, either directly or indirectly, in a host organism are common to many network ecologies and are members of and/or in vitro. networks ecologies that occur in many Subjects (i.e. are per 60 To “increase production of bacterial spores' includes an vasive) (FIG. 1). Due to the ubiquitous nature of Keystone activity or a sporulation induction agent. “Production' OTUs, they are central to the function of network ecologies in includes conversion of vegetative bacterial cells into spores healthy Subjects and are often missing or at reduced levels in and augmentation of the rate of Such conversion, as well as subjects with disease. Keystone OTUs may exist in low, mod decreasing the germination ofbacteria in spore form, decreas erate, or high abundance in Subjects. 65 ing the rate of spore decay in vivo, or ex vivo, or to increasing The term “non-Keystone OTU refers to an OTU that is the total output of spores (e.g. via an increase in Volumetric observed in a Network Ecology and is not a keystone OTU. output of fecal material). US 9,011,834 B1 11 12 The “colonization' of a host organism includes the non eases, disorders and conditions and for general nutritional transitory residence of a bacterium or other microscopic health. These compositions are advantageous in being Suit organism. As used herein, “reducing colonization of a host able for safe administration to humans and other mammalian Subject’s gastrointestinal tract (or any other microbiotal Subjects and are efficacious in numerous gastrointestinal dis niche) by a pathogenic bacterium includes a reduction in the eases, disorders and conditions and in general nutritional residence time of the pathogen in the gastrointestinal tract as health. While spore-based compositions are known, these are well as a reduction in the number (or concentration) of the generally prepared according to various techniques such as pathogen in the gastrointestinal tractor adhered to the luminal lyophilization or spray-drying of liquid bacterial cultures, Surface of the gastrointestinal tract. Measuring reductions of resulting in poor efficacy, instability, Substantial variability adherent pathogens may be demonstrated, e.g., by a biopsy 10 and lack of adequate safety and efficacy. sample, or reductions may be measured indirectly, e.g., by It has now been found that populations of bacterial spores measuring the pathogenic burden in the stool of a mammalian can be obtained from biological materials obtained from host. mammalian Subjects, including humans. These populations A “combination' of two or more bacteria includes the are formulated into compositions as provided herein, and physical co-existence of the two bacteria, either in the same 15 administered to mammalian Subjects using the methods as material or product or in physically connected products, as provided herein. well as the temporal co-administration or co-localization of Provided herein are therapeutic compositions containing a the two bacteria. purified population of bacterial spores. As used herein, the A “cytotoxic' activity or bacterium includes the ability to terms “purify”, “purified” and “purifying refer to the state of kill a bacterial cell. Such as a pathogenic bacterial cell. A a population (e.g., a plurality of known or unknown amount “cytostatic' activity or bacterium includes the ability to and/or concentration) of desired bacterial spores, that have inhibit, partially or fully, growth, metabolism, and/or prolif undergone one or more processes of purification, e.g., a selec eration of a bacterial cell. Such as a pathogenic bacterial cell. tion or an enrichment of the desired bacterial spore, or alter To be free of “non-comestible products’ means that a bac natively a removal or reduction of residual habitat products as terial composition or other material provided herein does not 25 described herein. In some embodiments, a purified popula have a Substantial amount of a non-comestible product, e.g., tion has no detectable undesired activity or, alternatively, the a product or material that is inedible, harmful or otherwise level or amount of the undesired activity is at or below an undesired in a product suitable for administration, e.g., oral acceptable level or amount. In other embodiments, a purified administration, to a human Subject. Non-comestible products population has an amount and/or concentration of desired are often found in preparations of bacteria from the prior art. 30 bacterial spores at or above an acceptable amount and/or As used herein the term “vitamin' is understood to include concentration. In other embodiments, the ratio of desired-to any of various fat-soluble or water-soluble organic substances undesired activity (e.g. spores compared to vegetative bacte (non-limiting examples include vitamin A, Vitamin B1 (thia ria), has changed by 2-, 5-, 10-, 30-, 100-, 300-, 1x10", 1x10, mine), Vitamin B2 (riboflavin), Vitamin B3 (niacin or niaci 1x10, 1x107, 1x10, or greater than 1x10. In other embodi namide), Vitamin B5 (pantothenic acid), Vitamin B6 (pyri 35 ments, the purified population of bacterial spores is enriched doxine, pyridoxal, or pyridoxamine, or pyridoxine as compared to the starting material (e.g., a fecal material) hydrochloride), Vitamin B7 (biotin), Vitamin B9 (folic acid), from which the population is obtained. This enrichment may and Vitamin B12 (various cobalamins; commonly cyanoco be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, balamin in Vitamin Supplements), vitamin C, Vitamin D. Vita 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, min E, vitamin K. K1 and K2 (i.e. MK-4, MK-7), folic acid 40 99.9999%, 99.9999%, or greater than 99.999999% as com and biotin) essential in minute amounts for normal growth pared to the starting material. and activity of the body and obtained naturally from plant and In certain embodiments, the purified populations of bacte animal foods or synthetically made, pro-Vitamins, deriva rial spores have reduced or undetectable levels of one or more tives, analogs. pathogenic activities, such as toxicity, an ability to cause As used herein, the term “minerals' is understood to 45 infection of the mammalian recipient Subject, an undesired include boron, calcium, chromium, copper, iodine, iron, mag immunomodulatory activity, an autoimmune response, a nesium, manganese, molybdenum, nickel, phosphorus, metabolic response, or an inflammatory response or a neuro potassium, selenium, silicon, tin, Vanadium, zinc, or combi logical response. Such a reduction in a pathogenic activity nations thereof. may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, As used herein, the term “antioxidant’ is understood to 50 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, include any one or more of various Substances such as beta 99.9999%, or greater than 99.9999% as compared to the carotene (a vitamin A precursor), vitamin C, vitamin E, and starting material. In other embodiments, the purified popula selenium) that inhibit oxidation or reactions promoted by tions of bacterial spores have reduced sensory components as Reactive Oxygen Species (“ROS) and other radical and non compared to fecal material. Such as reduced odor, taste, radical species. Additionally, antioxidants are molecules 55 appearance, and umami. capable of slowing or preventing the oxidation of other mol Provided are purified populations of bacterial spores that ecules. Non-limiting examples of antioxidants include astax are substantially free of residual habitat products. In certain anthin, carotenoids, coenzyme Q10 ("00010), flavonoids, embodiments, this means that the bacterial spore composition glutathione, Goji (wolfberry), hesperidin, lactowolfberry, lig no longer contains a Substantial amount of the biological nan, lutein, lycopene, polyphenols, selenium, vitaminA, Vita 60 matter associated with the microbial community while living min C, Vitamin E. zeaxanthin, or combinations thereof. on or in the human or animal Subject, and the purified popu lation of spores may be 100% free, 99% free, 98% free, 97% COMPOSITIONS OF THE INVENTION free, 96% free, or 95% free of any contamination of the biological matter associated with the microbial community. Disclosed herein are therapeutic compositions containing 65 Substantially free of residual habitat products may also mean non-pathogenic, germination-competent bacterial spores, for that the bacterial spore composition contains no detectable the prevention, control, and treatment of gastrointestinal dis cells from a humanoranimal, and that only microbial cells are US 9,011,834 B1 13 14 detectable, in particular, only desired microbial cells are and fecal transmissible pathogens using standard techniques detectable. In another embodiment, it means that fewer than known to one in the art (e.g. nucleic acid testing, serological 1x10%, 1x10%, 1x10%, 1x10%, 1x10%, testing, antigen testing, culturing techniques, enzymatic 1x107%, 1x10% of the cells in the bacterial composition assays, assays of cell free fecal filtrates looking for toxins on are human or animal, as compared to microbial cells. In susceptible cell culture substrates). another embodiment, the residual habitat product present in In some embodiments, donors are also selected for the the purified population is reduced at least a certain level from presence of certain genera and/or species that provide the fecal material obtained from the mammalian donor sub increased efficacy of therapeutic compositions containing ject, e.g., reduced by at least about 10%, 20%, 30%, 40%, these genera or species. In other embodiments, donors are 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 10 preferred that produce relatively higher concentrations of 99.9%, 99.99%. 99.999%, 99.9999%, or greater than 99.9999%. spores in fecal material than other donors. In further embodi In one embodiment, substantially free of residual habitat ments, donors are preferred that provide fecal material from products or substantially free of a detectable level of a patho which spores having increased efficacy are purified; this genic material means that the bacterial composition contains 15 increased efficacy is measured using in vitro or in animal no detectable viral (including bacterial viruses (i.e., phage)), studies as described below. In some embodiments, the donor fungal, or mycoplasmal or toxoplasmal contaminants, or a may be subjected to one or more pre-donation treatments in eukaryotic parasite Such as a helminth. Alternatively, the puri order to reduce undesired material in the fecal material, and/ fied spore populations are Substantially free of an acellular or increase desired spore populations. material, e.g., DNA, viral coat material, or non-viable bacte It is advantageous to screen the health of the donor Subject rial material. Alternatively, the purified spore population may prior to and optionally, one or more times after, the collection processed by a method that kills, inactivates, or removes one of the fecal material. Such screening identifies donors carry or more specific undesirable viruses, such as an enteric virus, ing pathogenic materials such as viruses (HIV, hepatitis, including norovirus, poliovirus or hepatitis A virus. polio) and pathogenic bacteria. Post-collection, donors are As described herein, purified spore populations can be 25 screened about one week, two weeks, three weeks, one demonstrated by genetic analysis (e.g., PCR, DNA sequenc month, two months, three months, six months, one year or ing), serology and antigen analysis, microscopic analysis, more than one year, and the frequency of such screening may microbial analysis including germination and culturing, and be daily, weekly, bi-weekly, monthly, bi-monthly, semi methods using instrumentation Such as flow cytometry with yearly or yearly. Donors that are screened and do not test reagents that distinguish desired bacterial spores from non 30 positive, either before or after donation or both, are consid desired, contaminating materials. ered “validated donors. Exemplary biological materials include fecal materials Solvent Treatments. Such as feces or materials isolated from the various segments To purify the bacterial spores, the fecal material is sub of the Small and large intestines. Fecal materials are obtained jected to one or more solvent treatments. A solvent treatment from a mammalian donor Subject, or can be obtained from 35 is a miscible solvent treatment (either partially miscible or more than one donor subject, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, fully miscible) or an immiscible solvent treatment. Miscibil 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 750, ity is the ability of two liquids to mix with each to form a 1000 or from greater than 1000 donors, where such materials homogeneous solution. Water and ethanol, for example, are are then pooled prior to purification of the desired bacterial fully miscible Such that a mixture containing water and etha spores. In another embodiment, fecal materials can be 40 nol in any ratio will show only one phase. Miscibility is obtained from a single donor Subject over multiple times and provided as a wit/wt %, or weight of one solvent in 100 g of pooled from multiple samples e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, final solution. If two solvents are fully miscible in all propor 15, 20, 25, 30, 32, 35, 40, 45, 48, 50, 100 samples from a tions, their miscibility is 100%. Provided as fully miscible single donor. Solutions with water are alcohols, e.g., methanol, ethanol, In alternative embodiments, the desired bacterial spores 45 isopropanol, butanol, propanediol, butanediol, etc. The alco are purified from a single fecal material sample obtained from hols can be provided already combined with water; e.g., a a single donor, and after Such purification are combined with solution containing 10%, 20%, 25%, 30%, 35%, 40%, 45%, purified spore populations from other purifications, either 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% or from the same donor at a different time, or from one or more greater than 95%. Other solvents are only partially miscible, different donors, or both. 50 meaning that only some portion will dissolve in water. Mammalian donor Subjects are generally of good health Diethyl ether, for example, is partially miscible with water. and have microbiota consistent with such good health. Often, Up to 7 grams of diethyl ether will dissolve in 93 g of water to the donor subjects have not been administered antibiotic com give a 7% (wit/wt %) solution. If more diethyl ether is added, pounds within a certain period prior to the collection of the a two-phase solution will result with a distinct diethyl ether fecal material. In certain embodiments, the donor Subjects are 55 layer above the water. Other partially miscible materials not obese or overweight, and may have body mass index include ethers, propanoate, butanoate, chloroform, (BMI) scores of below 25, such as between 18.5 and 24.9. In dimethoxyethane, or tetrahydrofuran. In contrast, an oil Such other embodiments, the donor subjects are not mentally ill or as an alkane and water are immiscible and form two phases. have no history or familial history of mental illness. Such as Further, immiscible treatments are optionally combined with anxiety disorder, depression, bipolar disorder, autism spec 60 a detergent, eitheranionic detergent or a non-ionic detergent. trum disorders, Schizophrenia, panic disorders, attention defi Exemplary detergents include Triton X-100. Tween 20, cit (hyperactivity) disorders, eating disorders or mood disor Tween 80, Nonidet P40, a pluronic, or a polyol. The solvent ders. In other embodiments, the donor subjects do not have treatment steps reduces the viability of non-spore forming irritable bowel disease (e.g., crohn's disease, ulcerative coli bacterial species by 10%, 20%, 30%, 40%, 50%, 60%, 70%, tis), irritable bowel syndrome, celiac disease, colorectal can 65 80%, 85%, 90%, 95%, 99%, 99.9%, 99.99%, 99.999%, or cer or a family history of these diseases. In other embodi 99.9999%, and it may optionally reduce the viability of con ments, donors have been screened for blood borne pathogens taminating protists, parasites and/or viruses. US 9,011,834 B1 15 16 Chromatography Treatments. 50 degree Celsius environment. In preferred embodiments To purify spore populations, the fecal materials are Sub the temperature and duration of the thermal treatment are jected to one or more chromatographic treatments, either sufficient to kill or remove pathogenic materials while not sequentially or in parallel. In a chromatographic treatment, a Substantially damaging or reducing the germination-compe Solution containing the fecal material is contacted with a solid tency of the spores. In other preferred embodiments, the medium containing a hydrophobic interaction chromato temperature and duration of the thermal treatment is short graphic (HIC) medium or an affinity chromatographic enough to reduce the germination of the spore population. medium. In an alternative embodiment, a Solid medium Irradiation Treatments. capable of absorbing a residual habitat product present in the Provided are methods of treating the fecal material or sepa fecal material is contacted with a solid medium that adsorbs a 10 rated contents of the fecal material with ionizing radiation, residual habitat product. In certain embodiments, the HIC typically gamma irradiation, ultraviolet irradiation or elec medium contains Sepharose or a derivatized Sepharose Such tron beam irradiation provided at an energy level sufficient to as butyl Sepharose, octyl Sepharose, phenyl Sepharose, or kill pathogenic materials while not substantially damaging butyl-s Sepharose. In other embodiments, the affinity chro the desired spore populations. For example, ultraviolet radia matographic medium contains material derivatized with 15 tion at 254 nm provided at an energy level below about 22,000 mucin type I, II, III, IV, V, or VI, or oligosaccharides derived microwatt seconds per cm will not generally destroy desired from or similar to those of mucins type I, II, III, IV, V, or VI. spores. Alternatively, the affinity chromatographic medium contains Centrifugation and Density Separation Treatments. material derivatized with antibodies that recognize spore Provided are methods of separating desired spore popula forming bacteria. tions from the other components of the fecal material by Mechanical Treatments. centrifugation. A solution containing the fecal material is Provided herein is the physical disruption of the fecal mate Subjected to one or more centrifugation treatments, e.g., at rial, particularly by one or more mechanical treatment such as about 200xg, 1000xg, 2000xg, 3000xg, 4000xg, 5000xg, blending, mixing, shaking, Vortexing, impact pulverization, 6000xg, 7000xg,8000xgorgreater than 8000xg. Differential and Sonication. As provided herein, the mechanical disrupt 25 centrifugation separates desired spores from undesired non ing treatment Substantially disrupts a non-spore material spore material; at low forces the spores are retained in solu present in the fecal material and does not Substantially disrupt tion, while at higher forces the spores are pelleted while a spore present in the fecal material, or it may disrupt the Smaller impurities (e.g., virus particles, phage, microscopic spore material less than the non-spore material, e.g. 2-fold fibers, biological macromolecules such as free protein, less, 5-, 10-, 30-, 100-, 300-, 1000- or greater than 1000-fold 30 nucleic acids and lipids) are retained in Solution. For example, less. Furthermore, mechanical treatment homogenizes the a first low force centrifugation pellets fibrous materials; a material for Subsequent sampling, testing, and processing. second, higher force centrifugation pellets undesired eukary Mechanical treatments optionally include filtration treat otic cells, and a third, still higher force centrifugation pellets ments, where the desired spore populations are retained on a the desired spores while Smaller contaminants remain in Sus filter while the undesirable (non-spore) fecal components to 35 pension. In some embodiments density or mobility gradients pass through, and the sporefraction is then recovered from the or cushions (e.g., step cushions). Such as CsCl, Percoll, Ficoll, filter medium. Alternatively, undesirable particulates and NycodenZ. Histodenz or Sucrose gradients, are used to sepa eukaryotic cells may be retained on a filter while bacterial rate desired spore populations from other materials in the cells including spores pass through. In some embodiments the fecal material. spore fraction retained on the filter medium is subjected to a 40 Also provided herein are methods of producing spore diafiltration step, wherein the retained spores are contacted populations that combine two or more of the treatments with a wash liquid, typically a sterile saline-containing solu described herein in order to synergistically purify the desired tion or other diluent Such as a water compatible polymer spores while killing or removing undesired materials and/or including a low-molecular polyethylene glycol (PEG) solu activities from the spore population. It is generally desirable tion, in order to further reduce or remove the undesirable fecal 45 to retain the spore populations under non-germinating and components. non-growth promoting conditions and media, in order to Thermal Treatments. minimize the growth of pathogenic bacteria present in the Provided herein is the thermal disruption of the fecal mate spore populations and to minimize the germination of spores rial. Generally, the fecal material is mixed in a saline-contain into vegetative bacterial cells. ing solution such as phosphate-buffered saline (PBS) and 50 Purified Spore Populations. Subjected to a heated environment, such as a warm room, As described herein, purified spore populations contain incubator, water-bath, or the like, such that efficient heat combinations of commensal bacteria of the human gut micro transfer occurs between the heated environment and the fecal biota with the capacity to meaningfully provide functions of material. Preferably the fecal material solution is mixed dur a healthy microbiota when administered to a mammalian ing the incubation to enhance thermal conductivity and dis 55 subject. Without being limited to a specific mechanism, it is rupt particulate aggregates. Thermal treatments can be modu thought that such compositions inhibit the growth of a patho lated by the temperature of the environment and/or the gen Such as C. difficile, Salmonella spp., enteropathogenic E. duration of the thermal treatment. For example, the fecal coli, Fusobacterium spp., Klebsiella spp. and Vancomycin material or a liquid comprising the fecal material is subjected resistant Enterococcus spp., so that a healthy, diverse and to a heated environment, e.g., a hot water bath of at least about 60 protective microbiota can be maintained or, in the case of 20, 25, 30,35, 40, 45,50,55,60, 65,70, 75,80, 85,90,95, 100 pathogenic bacterial infections such as C. difficile infection, or greater than 100 degrees Celsius, for at least about 1, 5, 10. repopulate the intestinal lumen to reestablish ecological con 15, 20, 30, 45 seconds, or 1,2,3,4,5,6,7,8,9, 10, 15, 20, 25, trol over potential pathogens. In one embodiment, the purified 30, 40, or 50 minutes, or 1,2,3,4,5,6,7,8,9, 10 or more than spore populations can engraft in the host and remain present 10 hours. In certain embodiments the thermal treatment 65 for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 occurs at two different temperatures, such as 30 seconds in a days, 14 days, 21 days, 25 days, 30 days, 60 days, 90 days, or 100 degree Celsius environment followed by 10 minutes in a longer than 90 days. Additionally, the purified spore popula US 9,011,834 B1 17 18 tions can induce other healthy commensal bacteria found in a bacterial spores or types of bacterial spores are generated in healthy gut to engraft in the host that are not present in the culture and combined to form a purified spore population. In purified spore populations or present at lesser levels and other alternative embodiments, one or more of these culture therefore these species are considered to “augment” the deliv generated spore populations are combined with a fecal mate ered spore populations. In this manner, commensal species rial-derived spore population to generate a hybrid spore popu augmentation of the purified spore population in the recipi lation. Bacterial compositions may contain at least two types ent's gut leads to a more diverse population of gut microbiota of these preferred bacteria, including strains of the same then present initially. species. For instance, a bacterial composition may comprise Preferred bacterial genera include Acetanaerobacterium, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7. Acetivibrio, Alicyclobacillus, Alkaliphilus, Anaerofustis, 10 at least 8, at least 9, at least 10, at least 11, at least 12, at least Anaerosporobacter, Anaerostipes, Anaerotruncus, Anoxyba 13, at least 14, at least 15, at least 16, at least 17, at least 18, cillus, Bacillus, Bacteroides, Blautia, Brachyspira, Breviba at least 19, or at least 20 or more than 20 types of bacteria, as cillus, Bryantella, Bulleidia, Butyricicoccus, Butyrivibrio, defined by species or operational taxonomic unit (OTU) Catenibacterium, Chlamydiales, Clostridiaceae, Clostridi encompassing such species. ales, Clostridium, Collinsella, Coprobacillus, Coprococcus, 15 Thus, provided herein are methods for production of a Coxiella, Deferribacteres, Desulfitobacterium, Desulfoto composition containing a population of bacterial spores Suit maculum, Dorea, Eggerthella, Erysipelothrix, Erysipelot able for therapeutic administration to a mammalian Subject in richaceae, Ethanoligenens, Eubacterium, Faecalibacterium, need thereof. And the composition is produced by generally Filifactor, Flavonifactor, Flexistipes, Fulvimonas, Fusobac following the steps of: (a) providing a fecal material obtained terium, Gemmiger; Geobacillus, Gloeobacter, Holdemania, from a mammalian donor Subject; and (b) Subjecting the fecal Hydrogenoanaerobacterium, Kocuria, Lachnobacterium, material to at least one purification treatment or step under Lachnospira, Lachnospiraceae, Lactobacillus, Lactonifac conditions such that a population of bacterial spores is pro tor, Leptospira, Lutispora, Lysinibacillus, Mollicutes, duced from the fecal material. The composition is formulated Moorella, Nocardia, Oscillibacter, Oscillospira, Paenibacil such that a single oral dose contains at least about 1x10' lus, Papillibacter, Pseudoflavonifactor, Robinsoniella, Rose 25 colony forming units of the bacterial spores, and a single oral buria, Ruminococcaceae, Ruminococcus, Saccharomono dose will typically contain about 1x10", 1x10, 1x10, SpOra, Sarcina, Solobacterium, Sporobacter, 1x107, 1x10, 1x10, 1x10", 1x10'', 1x10", 1x10", Sporolactobacillus, Streptomyces, Subdoligranulum, Sutter 1x10", 1x10', or greater than 1x10' CFUs of the bacterial ella, Syntrophococcus, Thermoanaerobacter, Thermobifida, spores. The presence and/or concentration of a given type of Turicibacter 30 bacterial spore may be known or unknown in a given purified Preferred bacterial species are provided at Table 1 and spore population. If known, for example the concentration of demarcated as spore formers. Where specific strains of a spores of a given strain, or the aggregate of all strains, is e.g., species are provided, one of skill in the art will recognize that 1x10, 1x10, 1x10, 1x107, 1x10, 1x10, 1x10, 1x10'', other strains of the species can be substituted for the named 1x10", 1x10", 1x10, 1x10', or greater than 1x10' strain. 35 viable bacterial spores per gram of composition or per admin In some embodiments, spore-forming bacteria are identi istered dose. fied by the presence of nucleic acid sequences that modulate In some formulations, the composition contains at least sporulation. In particular, signature sporulation genes are about 0.5%, 1%, 2%. 5%, 10%, 20%, 30%, 40%, 50%, 60%, highly conserved across members of distantly related genera 70%, 80%, 90% or greater than 90% spores on a mass basis. including Clostridium and Bacillus. Traditional approaches 40 In some formulations, the administered dose does not exceed of forward genetics have identified many, if not all, genes that 200, 300, 400, 500, 600, 700, 800, 900 milligrams or 1, 1.1, are essential for sporulation (spo). The developmental pro 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9 grams in mass. gram of sporulation is governed in part by the Successive The bacterial spore compositions are generally formulated action of four compartment-specific sigma factors (appearing for oral or gastric administration, typically to a mammalian in the order OF, OE, OG and OK), whose activities are con 45 Subject. In particular embodiments, the composition is for fined to the forespore (OF and OG) or the mother cell (OE and mulated for oral administration as a solid, semi-solid, gel, or OK). In other embodiments, spore-forming bacteria are iden liquid form, Such as in the form of a pill, tablet, capsule, or tified by the biochemical activity of DPA producing enzymes lozenge. In some embodiments, such formulations contain or or by analyzing DPA content of cultures. As part of the bac are coated by an enteric coating to protect the bacteria through terial sporulation, large amounts of DPA are produced, and 50 the stomach and Small intestine, although spores are generally comprise 5-15% of the mass of a spore. Because not all viable resistant to the stomach and Small intestines. In other embodi spores germinate and grow under known media conditions, it ments, the bacterial spore compositions may be formulated is difficult to assess a total spore count in a population of with a germinant to enhance engraftment, or efficacy. In yet bacteria. As such, a measurement of DPA content highly other embodiments, the bacterial spore compositions may be correlates with spore content and is an appropriate measure 55 co-formulated or co-administered with prebiotic Substances, for characterizing total spore content in a bacterial popula to enhance engraftment or efficacy. tion. The bacterial spore compositions may be formulated to be Provided are spore populations containing more than one effective in a given mammalian Subject in a single adminis type of bacterium. As used herein, a “type' or more than one tration or over multiple administrations. For example, a single “types of bacteria may be differentiated at the genus level, 60 administration is substantially effective to reduce Cl. difficile the species, level, the sub-species level, the strain level or by and/or Cl. difficile toxin content in a mammalian Subject to any other taxonomic method, as described herein and other whom the composition is administered. Substantially effec wise known in the art. tive means that Cl. difficile and/or Cl. difficile toxin content in In some embodiments all or essentially all of the bacterial the subject is reduced by at least 10%, 2%, 30%, 40%, 50%, spores present in a purified population are obtained from a 65 60%, 70%, 80%, 90%. 95%, 98%, 99% or greater than 99% fecal material treated as described herein or otherwise known following administration of the composition. Alternatively, in the art. In alternative embodiments, one or more than one efficacy may be measured by the absence of diarrheal Symp US 9,011,834 B1 19 20 toms or the absence of carriage of C. difficile or C. difficile Enterococcus faecalis (previously known as Streptococcus toxin after 2 day, 4 days, 1 week, 2 weeks, 4 weeks, 8 weeks faecalis), Clostridium innocuum, Clostridium ramosum, or longer than 8 weeks. Bacteroides ovatus, Bacteroides vulgatus, Bacteroides Bacterial Compositions thetaoiotaomicron, Escherichia coli (1109 and 1108-1), Provided are bacteria and combinations of bacteria of the Clostridum bifermentans, and Blautia producta (previously human gut microbiota with the capacity to meaningfully pro known as Peptostreptococcus productus). In an alternative vide functions of a healthy microbiota when administered to embodiment, at least one of the preceding species is not mammalian hosts. Without being limited to a specific mecha Substantially present in the bacterial composition. nism, it is thought that such compositions inhibit the growth, In another embodiment, the bacterial composition com proliferation, and/or colonization of one or a plurality of 10 prises at least one and preferably more than one of the fol pathogenic bacteria in the dysbiotic microbiotal niche, so that lowing: Acidaminococcus intestinalis, Bacteroides ovatus, a healthy, diverse and protective microbiota colonizes and two strains of Bifidobacterium adolescentis, two strains of populates the intestinal lumen to establish or reestablish eco Bifidobacterium longum, Blautia producta, Clostridium logical control over pathogens or potential pathogens (e.g., cocleatum, Collinsella aerofaciens, two strains of Dorea lon Some bacteria are pathogenic bacteria only when present in a 15 gicatena, Escherichia coli, Eubacterium desmolans, Eubac dysbiotic environment). Inhibition of pathogens includes terium eligens, Eubacterium limosum, four strains of Eubac those pathogens such as C. difficile, Salmonella spp., entero terium rectale, Eubacterium ventriosumi, Faecalibacterium pathogenic Ecoli, multi-drug resistant bacteria Such as Kleb prausnitzii, Lachnospira pectinoshiza, Lactobacillus casei, siella, and E. coli, Carbapenem-resistent Enterobacteriaceae Lactobacillus casei/paracasei, Paracateroides distasonis, (CRE), extended spectrum beta-lactam resistant Enterococci Raoultella sp., one strain of Roseburia (chosen from Rose (ESBL), and Vancomycin-resistant Enterococci (VRE). buria faecalis or Roseburia faecis), Roseburia intestinalis, As used herein, a “type' or more than one “types of two strains of Ruminococcus torques, two strains of Rumino bacteria may be differentiated at the genus level, the species, coccus obeum, and Streptococcus mitis. In an alternative level, the sub-species level, the strain level or by any other embodiment, at least one of the preceding species is not taxonomic method, as described herein and otherwise known 25 Substantially present in the bacterial composition. in the art. In yet another embodiment, the bacterial composition Bacterial compositions may comprise two types of bacteria comprises at least one and preferably more than one of the (termed “binary combinations” or “binary pairs') or greater following: Barnesiella intestinihominis, Lactobacillus reu than two types of bacteria. For instance, a bacterial compo teri; a species characterized as one of Enterococcus hirae, sition may comprise at least 2, at least 3, at least 4, at least 5, 30 Enterococus faecium, or Enterococcus durans; a species at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, characterized as one of Anaerostipes caccae or Clostridium at least 12, at least 13, at least 14, at least 15, at least 16, at least indolis; a species characterized as one of Staphylococcus 17, at least 18, at least 19, at least 20, or at least 21, 22, 23, 24, warneri or Staphylococcus pasteuri; and Adlercreutzia 25, 26, 27, 28, 29 30, 31, 32, 33, 34,35, 36, 37, 38, 39, or at equolifaciens. In an alternative embodiment, at least one of least 40, at least 50 or greater than 50 types of bacteria, as 35 the preceding species is not Substantially present in the bac defined by species or operational taxonomic unit (OTU), or terial composition. otherwise as provided herein. In other embodiments, the bacterial composition com In another embodiment, the number of types of bacteria prises at least one and preferably more than one of the fol present in a bacterial composition is at or below a known lowing: Clostridium absonium, Clostridium argentinense, value. For example, in Such embodiments the bacterial com 40 Clostridium baratii, Clostridium bartlettii, Clostridium bifer position comprises 50 or fewer types of bacteria, such as 49. mentans, Clostridium botulinum, Clostridium butyricum, 48, 47,46, 45, 44, 43,42, 41,40,39,38, 37, 36,35,34, 33, 32, Clostridium cadaveris, Clostridium Camis, Clostridium cella 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, tum, Clostridium chauvoei, Clostridium clostridioforme, 14, 13, 12, 11, or 10 or fewer, or 9 or fewer types of bacteria, Clostridium cochlearium, Clostridium difficile, Clostridium 8 or fewer types of bacteria, 7 or fewer types of bacteria, 6 or 45 fallax, Clostridium felsineum, Clostridium ghonii, fewer types of bacteria, 5 or fewer types of bacteria, 4 or fewer Clostridium glycolicum, Clostridium haemolyticum, types of bacteria, or 3 or fewer types of bacteria. In another Clostridium hastiforme, Clostridium histolyticum, embodiment, a bacterial composition comprises from 2 to no Clostridium indolis, Clostridium innocuum, Clostridium more than 40, from 2 to no more than 30, from 2 to no more irregulare, Clostridium limosum, Clostridium malenomina than 20, from 2 to no more than 15, from 2 to no more than 10, 50 tum, Clostridium novyi, Clostridium Oroticum, Clostridium or from 2 to no more than 5 types of bacteria. paraputrificum, Clostridium perfingens, Clostridium pili Bacterial Compositions Described by Species forme, Clostridium putrefaciens, Clostridium putrificum, Bacterial compositions may be prepared comprising at Clostridium ramosum, Clostridium sardiniense, Clostridium least two types of isolated bacteria, chosen from the species in Sartagoforme, Clostridium Scindens, Clostridium septicum, Table 1. 55 Clostridium sordellii, Clostridium sphenoides, Clostridium In one embodiment, the bacterial composition comprises at spiroforme, Clostridium sporogenes, Clostridium subtermi least one and preferably more than one of the following: male, Clostridium symbiosum, Clostridium tertium, Enterococcus faecalis (previously known as Streptococcus Clostridium tetani, Clostridium welchii, and Clostridium vil faecalis), Clostridium innocuum, Clostridium ramosum, losum. In an alternative embodiment, at least one of the pre Bacteroides ovatus, Bacteroides vulgatus, Bacteroides 60 ceding species is not Substantially present in the bacterial thetaoiotaomicron, Escherichia coli (1109 and 1108-1), composition. Clostridum bifermentans, and Blautia producta (previously In one embodiment, the bacterial composition comprises at known as Peptostreptococcus productus). In an alternative least one and preferably more than one of the following: embodiment, at least one of the preceding species is not Clostridium innocuum, Clostridum bifermentans, Substantially present in the bacterial composition. 65 Clostridium butyricum, Bacteroides fragilis, Bacteroides In one embodiment, the bacterial composition comprises at thetaiotaomicron, Bacteroides uniformis, three Strains of least one and preferably more than one of the following: Escherichia coli, and Lactobacillus sp. In an alternative US 9,011,834 B1 21 22 embodiment, at least one of the preceding species is not tium, Eubacterium CH-1, Staphylococcus epidermidis, Pep Substantially present in the bacterial composition. to streptococcus BL, Eubacterium limosum, Bacteroides In one embodiment, the bacterial composition comprises at praeacutus, Bacteroides L., Fusobacterium mortiferum I. least one and preferably more than one of the following: Fusobacterium naviforme, Clostridium innocuum, Clostridium bifermentans, Clostridium innocuum, Clostridium ramosum, Propionibacterium acnes, Rumino Clostridium butyricum, three strains of Escherichia coli, coccus flavefaciens, Ruminococcus AT, Peptococcus AU-1. three strains of Bacteroides, and Blautia producta. In an Eubacterium AG, -AK, -AL -AL-1, -AN; Bacteroides fragi alternative embodiment, at least one of the preceding species lis SS. ovatus, -SS. d, -SS. f. Bacteroides L-1, L-5; Fusobacte is not Substantially present in the bacterial composition. rium nucleatum, Fusobacterium mortiferum, Escherichia In one embodiment, the bacterial composition comprises at 10 coli, Streptococcus morbilliorum, Peptococcus magnus, Pep least one and preferably more than one of the following: tococcus G, AU-2; Streptococcus intermedius, Ruminococ Bacteroides sp., Escherichia coli, and non pathogenic cus lactaris, Ruminococcus CO Gemmiger X, Coprococcus Clostridia, including Clostridium innocuum, Clostridium BH, -CC, Eubacterium tenue, Eubacterium ramulus, Eubac bifermentans and Clostridium ramosum. In an alternative terium AE, -AG-H, -AG-M, -AJ, -BN-1; Bacteroides clostri embodiment, at least one of the preceding species is not 15 diiformis SS. clostridliformis, Bacteroides coagulans, Substantially present in the bacterial composition. Bacteroides Orails, Bacteroides ruminicola SS. brevis, -SS. In one embodiment, the bacterial composition comprises at ruminicola, Bacteroides splanchnicus, Desuifomonas pigra, least one and preferably more than one of the following: Bacteroides L-4, -N-i: Fusobacterium H, Lactobacillus G, Bacteroides species, Escherichia coli and non-pathogenic and Succinivibrio A. In an alternative embodiment, at least Clostridia, such as Clostridium butyricum, Clostridium bifer one of the preceding species is not substantially present in the mentans and Clostridium innocuum. In an alternative bacterial composition. embodiment, at least one of the preceding species is not Bacterial Compositions Described by Operational Taxo Substantially present in the bacterial composition. nomic Unit (OTUs) In one embodiment, the bacterial composition comprises at Bacterial compositions may be prepared comprising at least one and preferably more than one of the following: 25 least two types of isolated bacteria, chosen from the species in Bacteroides caccae, Bacteroides capillosus, Bacteroides Table 1. coagulans, Bacteroides distasonis, Bacteroides eggerthii, In one embodiment, the OTUs can be characterized by one Bacteroides forsythus, Bacteroides fragilis, Bacteroides fra or more of the variable regions of the 16S sequence (V1-V9). gilis-ryhn, Bacteroides gracilis, Bacteroides levi, Bacteroi These regions in bacteria are defined by nucleotides 69-99, des macacae, Bacteroides merdae, Bacteroides ovatus, 30 137-242, 433-497, 576-682,822-879,986-1043, 1117-1173, Bacteroides pneumosintes, Bacteroides putredinis, Bacteroi 1243-1294 and 1435-1465 respectively using numbering des pyogenes, Bacteroides splanchnicus, Bacteroides ster based on the E. coli system of nomenclature. (See, e.g., Bro coris, Bacteroides tectum, Bacteroides thetaiotaomicron, sius et al., Complete nucleotide sequence of a 16S ribosomal Bacteroides uniformis, Bacteroides ureolyticus, and RNA gene from Escherichia coli, PNAS 75(10):4801-4805 Bacteroides vulgatus. In an alternative embodiment, at least 35 (1978)). In some embodiments, at least one of the V1,V2, V3, one of the preceding species is not substantially present in the V4, V5, V6, V7, V8, and V9 regions are used to characterize bacterial composition. an OTU. In one embodiment, the V1,V2, and V3 regions are In one embodiment, the bacterial composition comprises at used to characterize an OTU. In another embodiment, the V3, least one and preferably more than one of the following: V4, and V5 regions are used to characterize an OTU. In Bacteroides, Eubacteria, Fusobacteria, Propionibacteria, 40 another embodiment, the V4 region is used to characterize an Lactobacilli, anaerobic cocci, Ruminococcus, Escherichia OTU. coli, Gemmiger, Desulfomonas, and Peptostreptococcus. In Bacterial Compositions Exclusive of Certain Bacterial an alternative embodiment, at least one of the preceding spe Species Or Strains cies is not substantially present in the bacterial composition. In one embodiment, the bacterial composition does not In one embodiment, the bacterial composition comprises at 45 comprise at least one of Enterococcus faecalis (previously least one and preferably more than one of the following: known as Streptococcus faecalis), Clostridium innocuum, Bacteroides fragilis SS. Vulgatus, Eubacterium aerofaciens, Clostridium ramosum, Bacteroides ovatus, Bacteroides vul Bacteroides fragilis SS. Thetaiotaomicron, Blautia producta gatus, Bacteroides thetaoiotaomicron, Escherichia coli (previously known as Peptostreptococcus productus II), (1109 and 1108-1), Clostridum bifermentans, and Blautia Bacteroides fragilis SS. Distasonis, Fusobacterium praus 50 producta (previously known as Peptostreptococcus produc nitzii, Coprococcus eutactus, Eubacterium aerofaciens III, tus). Blautia producta (previously known as Peptostreptococcus In another embodiment, the bacterial composition does not productus I), Ruminococcus bronii, Bifidobacterium adoles comprise at least one of Acidaminococcus intestinalis, centis, Gemmiger formicilis, Bifidobacterium longum, Bacteroides ovatus, two species of Bifidobacterium adoles Eubacterium Siraeum, Ruminococcus torques, Eubacterium 55 centis, two species of Bifidobacterium longum, Collinsella rectale III-H, Eubacterium rectale IV. Eubacterium eligens, aerofaciens, two species of Dorea longicatena, Escherichia Bacteroides eggerthii, Clostridium leptum, Bacteroides fra coli, Eubacterium eligens, Eubacterium limosum, four spe gilis SS. A., Eubacterium biforme, Bifidobacterium infantis, cies of Eubacterium rectale, Eubacterium ventriosumi, Eubacterium rectale III-F. Coprococcus comes, Bacteroides Faecalibacterium prausnitzii, Lactobacillus casei, Lactoba capillosus, Ruminococcus albus, Eubacterium formicigener 60 cillus paracasei, Paracateroides distasonis, Raoultella sp., ans, Eubacterium hallii, Eubacterium ventriosum I, Fuso one species of Roseburia (chosen from Roseburia faecalis or bacterium russii, Ruminococcus obeum, Eubacterium rectale Roseburia faecis), Roseburia intestinalis, two species of II, Clostridium ramosum I, Lactobacillus leichmanii, Rumi Ruminococcus torques, and Streptococcus mitis. nococcus Cailidus, Butyrivibrio crossotus, Acidaminococcus In yet another embodiment, the bacterial composition does fermentans, Eubacterium ventriosum, Bacteroides fragilis SS. 65 not comprise at least one of Barnesiella intestinihominis, fragilis, Bacteroides AR, Coprococcus catus, Eubacterium Lactobacillus reuteri; a species characterized as one of hadrum, Eubacterium cylindroides, Eubacterium ruminan Enterococcus hirae, Enterococus faecium, or Enterococcus US 9,011,834 B1 23 24 durans; a species characterized as one of Anaerostipes caccae sonis, Fusobacterium prausnitzii, Coprococcus eutactus, or Clostridium indolis; a species characterized as one of Sta Eubacterium aerofaciens III, Blautia producta (previously phylococcus warneri or Staphylococcus pasteuri; and Adler known as Peptostreptococcus productus I), Ruminococcus creutzia equolifaciens. bromii, Bifidobacterium adolescentis, Gemmiger formicilis, In other embodiments, the bacterial composition does not Bifidobacterium longum, Eubacterium Siraeum, Ruminococ comprise at least one of Clostridium absonium, Clostridium cus torques, Eubacterium rectale III-H. Eubacterium rectale argentinense, Clostridium baratii, Clostridium bifermentans, IV, Eubacterium eligens, Bacteroides eggerthii, Clostridium Clostridium botulinum, Clostridium butyricum, Clostridium leptum, Bacteroides fragilis SS.A., Eubacterium biforme, Bifi cadaveris, Clostridium camis, Clostridium cellatum, dobacterium infantis, Eubacterium rectale III-F. Coprococ Clostridium chauvoei, Clostridium clostridioforme, 10 cus comes, Bacteroides capillosus, Ruminococcus albus, Clostridium cochlearium, Clostridium difficile, Clostridium Eubacterium formicigenerans, Eubacterium hallii, Eubacte fallax, Clostridium felsineum, Clostridium ghonii, rium ventriosum I, Fusobacterium russii, Ruminococcus Clostridium glycolicum, Clostridium haemolyticum, Obeum, Eubacterium rectale II, Clostridium ramosum I. Lac Clostridium hastiforme, Clostridium histolyticum, tobacillus leichmanii, Ruminococcus Cailidus, Butyrivibrio Clostridium indolis, Clostridium innocuum, Clostridium 15 crossotus, Acidaminococcus fermentans, Eubacterium ven irregulare, Clostridium limosum, Clostridium malenomina triosum, Bacteroides fragilis SS. fragilis, Bacteroides AR, tum, Clostridium novyi, Clostridium Oroticum, Clostridium Coprococcus catus, Eubacterium hadrum, Eubacterium paraputrificum, Clostridium perfingens, Clostridium pili cylindroides, Eubacterium ruminantium, Eubacterium CH-1, forme, Clostridium putrefaciens, Clostridium putrificum, Staphylococcus epidermidis, Peptostreptococcus BL, Eubac Clostridium ramosum, Clostridium sardiniense, Clostridium terium limosum, Bacteroides praeacutus, Bacteroides L. Sartagoforme, Clostridium scindens, Clostridium septicum, Fusobacterium mortiferum I, Fusobacterium naviforme, Clostridium sordellii, Clostridium sphenoides, Clostridium Clostridium innocuum, Clostridium ramosum, Propionibac spiroforme, Clostridium sporogenes, Clostridium subtermi terium acnes, Ruminococcus flavefaciens, Ruminococcus AT, male, Clostridium symbiosum, Clostridium tertium, Peptococcus AU-1, Eubacterium AG. -AK. -AL -AL-1, Clostridium tetani, Clostridium welchii, and Clostridium vil 25 -AN; Bacteroides fragilis SS. ovatus, -SS. d, -SS. f. Bacteroides losum. L-1, L-5. Fusobacterium nucleatum, Fusobacterium mor In another embodiment, the bacterial composition does not tiferum, Escherichia coli, Streptococcus morbilliorum, Pepto comprise at least one of Clostridium innocuum, Clostridum coccus magnus, Peptococcus G, AU-2; Streptococcus inter bifermentans, Clostridium butyricum, Bacteroides fragilis, medius, Ruminococcus lactaris, Ruminococcus CO Bacteroides thetaiotaomicron, Bacteroides uniformis, three 30 Gemmiger X, Coprococcus BH, -CC: Eubacterium tenue, strains of Escherichia coli, and Lactobacillus sp. Eubacterium ramulus, Eubacterium AE, -AG-H, -AG-M, In another embodiment, the bacterial composition does not -AJ, -BN-1; Bacteroides clostridiiformis ss. clostridliformis, comprise at least one of Clostridium bifermentans, Bacteroides coagulans, Bacteroides Orails, Bacteroides Clostridium innocuum, Clostridium butyricum, three strains ruminicola SS. brevis, -SS. ruminicola, Bacteroides splanch of Escherichia coli, three strains of Bacteroides, and Blautia 35 nicus, Desuifomonas pigra, Bacteroides L-4, -N-i; Fusobac producta (previously known as Peptostreptococcus produc terium H, Lactobacillus G, and Succinivibrio A. tus). Inhibition of Bacterial Pathogens In another embodiment, the bacterial composition does not In some embodiments, the bacterial composition provides comprise at least one of Bacteroides sp., Escherichia coli, and a protective or therapeutic effect against infection by one or non pathogenic Clostridia, including Clostridium innocuum, 40 more GI pathogens of interest. Clostridium bifermentans and Clostridium ramosum. A list of exemplary bacterial pathogens is provided in Table In another embodiment, the bacterial composition does not 1 as indicated by pathogen status. comprise at least one of more than one Bacteroides species, In some embodiments, the pathogenic bacterium is Escherichia coli and non-pathogenic Clostridia, such as selected from the group consisting of Yersinia, Vibrio, Tre Clostridium butyricum, Clostridium bifermentans and 45 ponema, Streptococcus, Staphylococcus, Shigella, Salmo Clostridium innocuum. nella, Rickettsia, Orientia, Pseudomonas, Neisseria, Myco In another embodiment, the bacterial composition does not plasma, Mycobacterium, Listeria, Leptospira, Legionella, comprise at least one of Bacteroides caccae, Bacteroides Klebsiella, Helicobacter, Haemophilus, Francisella, capillosus, Bacteroides coagulans, Bacteroides distasonis, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebac Bacteroides eggerthii, Bacteroides forsythus, Bacteroides 50 terium, Clostridium, Chlamydia, Chlamydophila, Campylo fragilis, Bacteroides fragilis-ryhn, Bacteroides gracilis, bacter, Burkholderia, Brucella, Borrelia, Bordetella, Bifido Bacteroides levi, Bacteroides macacae, Bacteroides merdae, bacterium, Bacillus, multi-drug resistant bacteria, extended Bacteroides ovatus, Bacteroides pneumosintes, Bacteroides spectrum beta-lactam resistant Enterococci (ESBL), Carbap putredinis, Bacteroides pyogenes, Bacteroides splanchnicus, enem-resistent Enterobacteriaceae (CRE), and Vancomycin Bacteroides Stercoris, Bacteroides tectum, Bacteroides 55 resistant Enterococci (VRE). thetaiotaomicron, Bacteroides uniformis, Bacteroides ure In Some embodiments, these pathogens include, but are not Olyticus, and Bacteroides vulgatus. limited to, Aeromonas hydrophila, Campylobacter fetus, Ple In another embodiment, the bacterial composition does not Siomonas Shigelloides, Bacillus cereus, Campylobacter comprise at least one of Bacteroides, Eubacteria, Fusobac jejuni, Clostridium botulinum, Clostridium difficile, teria, Propionibacteria, Lactobacilli, anaerobic cocci, Rumi 60 Clostridium perfingens, enteroaggregative Escherichia coli, nococcus, Escherichia coli, Gemmiger, Desulfomonas, and enterohemorrhagic Escherichia coli, enteroinvasive Escheri Peptostreptococcus. chia coli, enterotoxigenic Escherichia coli (such as, but not In another embodiment, the bacterial composition does not limited to, LT and/or ST), Escherichia coli O157:H7, Helico comprise at least one of Bacteroides fragilis SS. Vulgatus, bacter pylori, Klebsiellia pneumonia, Lysteria monocytoge Eubacterium aerofaciens, Bacteroides fragilis SS. Thetaio 65 nes, Plesiomonas Shigelloides, Salmonella spp., Salmonella taOmicron, Blautia producta (previously known as Pep typhi, Salmonella paratyphi, Shigella spp., Staphylococcus to streptococcus productus II), Bacteroides fragilis SS. Dista spp., Staphylococcus aureus, Vancomycin-resistant entero US 9,011,834 B1 25 26 coccus spp., Vibrio spp., Vibrio cholerae, Vibrio para mammalian recipient Subject, an immunomodulatory activ haemolyticus, Vibrio vulnificus, and Yersinia enterocolitica. ity, an autoimmune response, a metabolic response, or an In one embodiment, the pathogen of interest is at least one inflammatory response or a neurological response. Such a pathogen chosen from Clostridium difficile, Salmonella spp., reduction in a pathogenic activity may be by 10%, 20%, 30%, pathogenic Escherichia coli, Vancomycin-resistant Entero 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, coccus spp., and extended spectrum beta-lactam resistant 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than Enterococci (ESBL). 99.9999% as compared to the starting material. In other Purified Spore Populations embodiments, the purified populations of bacterial spores have reduced sensory components as compared to fecal mate In some embodiments, the bacterial compositions com rial. Such as reduced odor, taste, appearance, and umami. prise purified spore populations. Purified spore populations 10 Provided are purified populations of bacterial spores that contain combinations of commensal bacteria of the human are substantially free of residual habitat products. In certain gut microbiota with the capacity to meaningfully provide embodiments, this means that the bacterial spore composition functions of a healthy microbiota when administered to a no longer contains a Substantial amount of the biological mammalian subject. Without being limited to a specific matter associated with the microbial community while living mechanism, it is thought that Such compositions inhibit the 15 on or in the human or animal Subject, and the purified popu growth of a pathogen Such as C. difficile, Salmonella spp., lation of spores may be 100% free, 99% free, 98% free, 97% enteropathogenic E. coli, and Vancomycin-resistant Entero free, 96% free, or 95% free of any contamination of the coccus spp., so that a healthy, diverse and protective micro biological matter associated with the microbial community. biota can be maintained or, in the case of pathogenic bacterial Substantially free of residual habitat products may also mean infections such as C. difficile infection, repopulate the intes that the bacterial spore composition contains no detectable tinal lumen to reestablish ecological control over potential cells from a humanoranimal, and that only microbial cells are pathogens. In some embodiments, yeast spores and other detectable, in particular, only desired microbial cells are fungal spores are also purified and selected for therapeutic detectable. In another embodiment, it means that fewer than SC. 1x10%, 1x10%, 1x10%, 1x10%, 1x10%, Disclosed herein are therapeutic compositions containing 25 1x107%, 1x10% of the cells in the bacterial composition non-pathogenic, germination-competent bacterial spores, for are human or animal, as compared to microbial cells. In the prevention, control, and treatment of gastrointestinal dis another embodiment, the residual habitat product present in eases, disorders and conditions and for general nutritional the purified population is reduced at least a certain level from health. These compositions are advantageous in being Suit the fecal material obtained from the mammalian donor sub able for safe administration to humans and other mammalian 30 ject, e.g., reduced by at least about 10%, 20%, 30%, 40%, Subjects and are efficacious in numerous gastrointestinal dis 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, eases, disorders and conditions and in general nutritional 99.9%, 99.99%, 99.999%, 99.9999%, or greater than health. While spore-based compositions are known, these are 99.9999%. generally prepared according to various techniques such as In one embodiment, substantially free of residual habitat lyophilization or spray-drying of liquid bacterial cultures, 35 products or substantially free of a detectable level of a patho resulting in poor efficacy, instability, Substantial variability genic material means that the bacterial composition contains and lack of adequate safety. no detectable viral (including bacterial viruses (i.e., phage)), It has now been found that populations of bacterial spores fungal, or mycoplasmal or toxoplasmal contaminants, or a can be obtained from biological materials obtained from eukaryotic parasite Such as a helminth. Alternatively, the puri mammalian Subjects, including humans. These populations 40 fied spore populations are substantially free of an acellular are formulated into compositions as provided herein, and material, e.g., DNA, viral coat material, or non-viable bacte administered to mammalian Subjects using the methods as rial material. provided herein. As described herein, purified spore populations can be Provided herein are therapeutic compositions containing a demonstrated by genetic analysis (e.g., PCR, DNA sequenc purified population of bacterial spores. As used herein, the 45 ing), serology and antigen analysis, and methods using instru terms “purify”, “purified” and “purifying refer to the state of mentation Such as flow cytometry with reagents that distin a population (e.g., a plurality of known or unknown amount guish desired bacterial spores from non-desired, and/or concentration) of desired bacterial spores, that have contaminating materials. undergone one or more processes of purification, e.g., a selec Exemplary biological materials include fecal materials tion or an enrichment of the desired bacterial spore, or alter 50 Such as feces or materials isolated from the various segments natively a removal or reduction of residual habitat products as of the Small and large intestines. Fecal materials are obtained described herein. In some embodiments, a purified popula from a mammalian donor Subject, or can be obtained from tion has no detectable undesired activity or, alternatively, the more than one donor subject, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, level or amount of the undesired activity is at or below an 20, 25, 30, 35, 40, 45, 50, 75, 100, 200, 300, 400, 500, 750, acceptable level or amount. In other embodiments, a purified 55 1000 or from greater than 1000 donors, where such materials population has an amount and/or concentration of desired are then pooled prior to purification of the desired bacterial bacterial spores at or above an acceptable amount and/or spores. concentration. In other embodiments, the purified population In alternative embodiments, the desired bacterial spores of bacterial spores is enriched as compared to the starting are purified from a single fecal material sample obtained from material (e.g., a fecal material) from which the population is 60 a single donor, and after Such purification are combined with obtained. This enrichment may be by 10%, 20%, 30%, 40%, purified spore populations from other purifications, either 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, from the same donor at a different time, or from one or more 99.9%, 99.99%. 99.999%, 99.9999%, or greater than different donors, or both. 99.9999% as compared to the starting material. Preferred bacterial genera include Acetonema, Alkaliphi In certain embodiments, the purified populations of bacte 65 lus, Alicyclobacillus, Amphibacillus, Ammonifex, Anaero rial spores have reduced or undetectable levels of one or more bacter; Anaerofustis, Anaerostipes, Anaerotruncus, Anoxyba pathogenic activities. Such as toxicity, an infection of the cillus, Bacillus, Blautia, Brevibacillus, Bryantella, US 9,011,834 B1 27 28 Caldicellulosiruptor, Caloramator; Candidatus, Carboxydi 1x10", 1x10", or greater than 1 x 10' CFUs of the bacterial brachium, Carboxydothermus, Clostridium, Cohnella, spores. The presence and/or concentration of a given type of Coprococcus, Dendrosporobacter Desulfitobacterium, Des bacteria spore may be known or unknown in a given purified ulfosporosinus, Desulfotomaculum, Dorea, Eubacterium, spore population. If known, for example the concentration of Faecalibacterium, Filifactor, Geobacillus, Halobacteroides, spores of a given strain, or the aggregate of all strains, is e.g., Heliobacillus, Heliobacterium, Heliophilum, Heliorestis, 1x10, 1x10, 1x10, 1x107, 1x10, 1x10, 1x10", 1x10'', Lachnoanaerobaculum, Lysinibacillus, Moorella, Oceano 1x10", 1x10", 1x10, 1x10', or greater than 1x10' bacillus, Orenia (S.), Oxalophagus, Oxobacter, Paenibacil viable bacterial spores per gram of composition or per admin lus, Pelospora, Pelotomaculum, Propionispora, Roseburia, istered dose. Ruminococcus, Sarcina, Sporobacterium, Sporohalobacter, 10 Sporolactobacillus, Sporomusa, Sporosarcina, Sporoto In some formulations, the composition contains at least maculum, Subdoligranulum, Symbiobacterium, Syntropho about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or botulus, Syntrophospora, Terribacillus, Thermoanaero greater than 90% spores on a mass basis. In some formula bacter, and Thermosinus. tions, the administered dose does not exceed 200, 300, 400, Preferred bacterial species are provided at Table X4. 15 500, 600, 700, 800,900 milligrams or 1, 1.1, 1.2, 1.3, 1.4, 1.5, Where specific strains of a species are provided, one of skill 1.6., 1.7, 1.8, or 1.9 grams in mass. in the art will recognize that other strains of the species can be The bacterial spore compositions are generally formulated substituted for the named strain. for oral or gastric administration, typically to a mammalian In some embodiments, spore-forming bacteria are identi Subject. In particular embodiments, the composition is for fied by the presence of nucleic acid sequences that modulate mulated for oral administration as a solid, semi-solid, gel, or sporulation. In particular, signature sporulation genes are liquid form, Such as in the form of a pill, tablet, capsule, or highly conserved across members of distantly related genera lozenge. In some embodiments, such formulations contain or including Clostridium and Bacillus. Traditional approaches are coated by an enteric coating to protect the bacteria through of forward genetics have identified many, if not all, genes that the stomach and Small intestine, although spores are generally are essential for sporulation (spo). The developmental pro 25 resistant to the stomach and Small intestines. gram of sporulation is governed in part by the Successive The bacterial spore compositions may be formulated to be action of four compartment-specific sigma factors (appearing effective in a given mammalian Subject in a single adminis in the order OF, OE, OG and OK), whose activities are con tration or over multiple administrations. For example, a single fined to the forespore (OF and OG) or the mother cell (OE and administration is substantially effective to reduce Cl. difficile OK). 30 and/or Cl. difficile toxin content in a mammalian Subject to Provided are spore populations containing more than one whom the composition is administered. Substantially effec type of bacterium. As used herein, a “type' or more than one tive means that Cl. difficile and/or Cl. difficile toxin content in “types of bacteria may be differentiated at the genus level, the subject is reduced by at least 10%, 20%, 30%, 40%, 50%, the species, level, the sub-species level, the strain level or by 60%, 70%, 80%, 90%. 95%, 98%, 99% or greater than 99% any other taxonomic method, as described herein and other 35 following administration of the composition. wise known in the art. In some embodiments, all or essentially all of the bacterial METHODS OF THE INVENTION spores present in a purified population are obtained from a fecal material treated as described herein or otherwise known Methods for Determining 16S Sequences in the art. In alternative embodiments, one or more than one 40 OTUs can be defined either by full 16S sequencing of the bacterial spores or types of bacterial spores are generated in rRNA gene, by sequencing of a specific hyperVariable region culture and combined to form a purified spore population. In of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or V9), or other alternative embodiments, one or more of these culture by sequencing of any combination of hyperVariable regions generated spore populations are combined with a fecal mate from this gene (e.g. V1-3 or V3-5). The bacterial 16S rDNA is rial-derived spore population to generate a hybrid spore popu 45 approximately 1500 nucleotides in length and is used in lation. Bacterial compositions may contain at least two types reconstructing the evolutionary relationships and sequence of these preferred bacteria, including strains of the same similarity of one bacterial isolate to another using phyloge species. For instance, a bacterial composition may comprise netic approaches. 16S sequences are used for phylogenetic at least 2, at least 3, at least 4, at least 5, at least 6, at least 7. reconstruction as they are in general highly conserved, but at least 8, at least 9, at least 10, at least 11, at least 12, at least 50 contain specific hyperVariable regions that harbor Sufficient 13, at least 14, at least 15, at least 16, at least 17, at least 18, nucleotide diversity to differentiate genera and species of at least 19, or at least 20 or more than 20 types of bacteria, as most microbes. defined by species or operational taxonomic unit (OTU) Using well known techniques, in order to determine the full encompassing such species. 16S sequence or the sequence of any hyperVariable region of Thus, provided herein are methods for production of a 55 the 16S sequence, genomic DNA is extracted from a bacterial composition containing a population of bacterial spores Suit sample, the 16S rDNA (full region or specific hypervariable able for therapeutic administration to a mammalian Subject in regions) amplified using polymerase chain reaction (PCR). need thereof. And the composition is produced by generally the PCR products cleaned, and nucleotide sequences delin following the steps of: (a) providing a fecal material obtained eated to determine the genetic composition of 16S gene or from a mammalian donor Subject; and (b) Subjecting the fecal 60 Subdomain of the gene. If full 16S sequencing is performed, material to at least one purification treatment or step under the sequencing method used may be, but is not limited to, conditions such that a population of bacterial spores is pro Sanger sequencing. If one or more hyperVariable regions are duced from the fecal material. The composition is formulated used. Such as the V4 region, the sequencing can be, but is not such that a single oral dose contains at least about 1x10' limited to being, performed using the Sanger method or using colony forming units of the bacterial spores, and a single oral 65 a next-generation sequencing method, such as an Illumina dose will typically contain about 1x10, 1x10, 1x10, (sequencing by synthesis) method using barcoded primers 1x107, 1x10, 1x10, 1x10", 1x10'', 1x10", 1x10", allowing for multiplex reactions. US 9,011,834 B1 29 30 OTUs can be defined by a combination of nucleotide mark environment. Cryopreservation treatment is accomplished by ers or genes, in particular highly conserved genes (e.g., freezing a liquid at ultra-low temperatures (e.g., at or below "house-keeping genes), or a combination thereof, full-ge -80°C.). Dried preservation removes water from the culture nome sequence, or partial genome sequence generated using by evaporation (in the case of spray drying or cool drying) or amplified genetic products, or whole genome sequence by Sublimation (e.g., for freeze drying, spray freeze drying). (WGS). Using well defined methods DNA extracted from a Removal of water improves long-term bacterial composition bacterial sample will have specific genomic regions amplified storage Stability attemperatures elevated above cryogenic. If using PCR and sequenced to determine the nucleotide the bacterial composition comprises spore forming species sequence of the amplified products. In the whole genome and results in the production of spores, the final composition shotgun (WGS) method, extracted DNA will be directly 10 can be purified by additional means, such as density gradient sequenced without amplification. Sequence data can be gen centrifugation preserved using the techniques described erated using any sequencing technology including, but not above. Bacterial composition banking can be done by cultur limited to Sanger, Illumina, 454 Life Sciences, Ion Torrent, ing and preserving the Strains individually, or by mixing the ABI, Pacific Biosciences, and/or Oxford Nanopore. strains together to create a combined bank. As an example of Methods for Preparing a Bacterial Composition for 15 cryopreservation, a bacterial composition culture can be har Administration to a Subject vested by centrifugation to pellet the cells from the culture Methods for producing bacterial compositions can include medium, the Supernate decanted and replaced with fresh cul three main processing steps, combined with one or more ture broth containing 15% glycerol. The culture can then be mixing steps. The steps include organism banking, organism aliquoted into 1 mL cryotubes, sealed, and placed at -80° C. production, and preservation. for long-term viability retention. This procedure achieves For banking, the Strains included in the bacterial composi acceptable viability upon recovery from frozen storage. tion may be (1) isolated directly from a specimen or taken Organism production can be conducted using similar cul from a banked stock, (2) optionally cultured on a nutrientagar ture steps to banking, including medium composition and or broth that Supports growth to generate viable biomass, and culture conditions. It can be conducted at larger scales of (3) the biomass optionally preserved in multiple aliquots in 25 operation, especially for clinical development or commercial long-term storage. production. At larger scales, there can be several Subcultiva In embodiments that use a culturing step, the agar or broth tions of the bacterial composition prior to the final cultivation. can contain nutrients that provide essential elements and spe At the end of cultivation, the culture is harvested to enable cific factors that enable growth. An example would be a further formulation into a dosage form for administration. medium composed of 20 g/L glucose, 10 g/L yeast extract, 10 30 This can involve concentration, removal of undesirable g/L Soy peptone, 2 g/L citric acid, 1.5 g/L Sodium phosphate medium components, and/or introduction into a chemical monobasic, 100 mg/L ferric ammonium citrate, 80 mg/L milieu that preserves the bacterial composition and renders it magnesium sulfate, 10 mg/L hemin chloride, 2 mg/L calcium acceptable for administration via the chosen route. For chloride, 1 mg/L menadione. A variety of microbiological example, a bacterial composition can be cultivated to a con media and variations are well known in the art (e.g. R. M. 35 centration of 10' CFU/mL, then concentrated 20-fold by Atlas, Handbook of Microbiological Media (2010) CRC tangential flow microfiltration; the spent medium can be Press). Medium can be added to the culture at the start, may be exchanged by diafiltering with a preservative medium con added during the culture, or may be intermittently/continu sisting of 2% gelatin, 100 mM trehalose, and 10 mM sodium ously flowed through the culture. The strains in the bacterial phosphate buffer. The suspension can then be freeze-dried to composition may be cultivated alone, as a Subset of the bac 40 a powder and titrated. terial composition, or as an entire collection comprising the After drying, the powder can be blended to an appropriate bacterial composition. As an example, a first strain may be potency, and mixed with other cultures and/or a filler Such as cultivated together with a second strain in a mixed continuous microcrystalline cellulose for consistency and ease of han culture, at a dilution rate lower than the maximum growth rate dling, and the bacterial composition formulated as provided of either cell to prevent the culture from washing out of the 45 herein. cultivation. Administration of Bacterial Compositions. The inoculated culture is incubated under favorable condi The bacterial compositions of the invention are suitable for tions for a time sufficient to build biomass. For bacterial administration to mammals and non-mammalian animals in compositions for human use, this is often at 37°C. tempera need thereof. In certain embodiments, the mammalian Subject ture, pH, and other parameter with values similar to the nor 50 is a human Subject who has one or more symptoms of a mal human niche. The environment can be actively con dysbiosis, including but not limited to overgrowth of an trolled, passively controlled (e.g., via buffers), or allowed to undesired pathobiont or pathogen, reduced representation of drift. For example, for anaerobic bacterial compositions (e.g., key bacterial taxa such as the Bacteroidetes or Firmicutes or gut microbiota), an anoxic/reducing environment can be genera or species thereof, or reduced diversity of microbial employed. This can be accomplished by addition of reducing 55 species compared to a healthy individual, or reduced overall agents such as cysteine to the broth, and/or stripping it of abundance of anaerobic bacteria. oxygen. As an example, a culture of a bacterial composition When the mammalian Subject is suffering from a disease, can be grown at 37° C. pH 7, in the medium above, pre disorder or condition characterized by an aberrant micro reduced with 1 g/L cysteine HC1. biota, the bacterial compositions described herein are suitable When the culture has generated sufficient biomass, it can 60 for treatment thereof. In some embodiments, the mammalian be preserved for banking. The organisms can be placed into a Subject has not received antibiotics in advance of treatment chemical milieu that protects from freezing (adding cryopro with the bacterial compositions. For example, the mamma tectants), drying (lyoprotectants), and/or osmotic shock lian Subject has not been administered at least two doses of (osmoprotectants), dispensing into multiple (optionally Vancomycin, metronidazole and/or or similar antibiotic com identical) containers to create a uniform bank, and then treat 65 pound within one week prior to administration of the thera ing the culture for preservation. Containers are generally peutic composition. In other embodiments, the mammalian impermeable and have closures that assure isolation from the Subject has not previously received an antibiotic compound in US 9,011,834 B1 31 32 the one month prior to administration of the therapeutic com To evaluate the Subject, symptoms of dysbiosis are evalu position. In other embodiments, the mammalian Subject has ated post treatment ranging from 1 day to 6 months after received one or more treatments with one or more different administration of the purified spore population. Fecal mate antibiotic compounds and Such treatment(s) resulted in no rial is collected during this period and the microbes present in improvement or a worsening of symptoms. In some embodi the gastrointestinal tract can be assessed by 16S rRNA or ments, the spore composition is administered following a metagenomic sequencing analysis or other analyses com Successful course of antibiotics to prevent dysbiosis and monly used by the skilled artisan. Repopulation by species enhance recovery of a diverse, healthy microbiota. provided by the spore population as well as Augmentation by In some embodiments, the gastrointestinal disease, disor commensal microbes not present in the spore population will 10 occur in this time as the spore population catalyzes a reshap der or condition is diarrhea caused by C. difficile including ing of the gut ecology to a state of healthy biosis. The speci recurrent C. difficile infection, ulcerative colitis, colitis, fication is most thoroughly understood in light of the teach Crohn's disease, or irritable bowel disease. Beneficially, the ings of the references cited within the specification. The therapeutic composition is administered only once prior to embodiments within the specification provide an illustration improvement of the disease, disorder or condition. In some 15 of embodiments and should not be construed to limit the embodiments the therapeutic composition is administered at Scope. The skilled artisan readily recognizes that many other intervals greater than two days, such as once every three, four, embodiments are encompassed. All publications and patents five or six days, or every week or less frequently than every cited in this disclosure are incorporated by reference in their week. Or the preparation may be administered intermittently entirety. To the extent the material incorporated by reference according to a set schedule, e.g., once a day, once weekly, or contradicts or is inconsistent with this specification, the speci once monthly, or when the Subject relapses from the primary fication will Supersede any such material. The citation of any illness. In another embodiment, the preparation may be references herein is not an admission that such references are administered on a long-term basis to individuals who are at prior art. risk for infection with or who may be carriers of these patho Methods of Treating a Subject gens, including individuals who will have an invasive medical 25 In some embodiments, the compositions disclosed herein procedure (such as Surgery), who will be hospitalized, who are administered to a patient or a user(sometimes collectively live in a long-term care or rehabilitation facility, who are referred to as a “subject”). As used herein “administer and exposed to pathogens by virtue of their profession (livestock “administration' encompasses embodiments in which one and animal processing workers), or who could be carriers of person directs another to consume a bacterial composition in pathogens (including hospital workers such as physicians, 30 a certain manner and/or for a certain purpose, and also situ nurses, and other healthcare professionals). ations in which a user uses a bacteria composition in a certain Also provided are methods of treating or preventing a manner and/or for a certain purpose independently of or in mammalian Subject Suffering from or at risk of developing a variance to any instructions received from a second person. metabolic disease, and disorder or condition selected from the Non-limiting examples of embodiments in which one person group consisting of diabetes, metabolic syndrome, obesity, 35 directs another to consume a bacterial composition in a cer heart disease, autoimmune disease, liver disease, and autism tain manner and/or for a certain purpose include when a using the therapeutic compositions provided herein. physician prescribes a course of conduct and/or treatment to In embodiments, the bacterial spore composition is admin a patient, when a parent commands a minor user (such as a istered enterically. This preferentially includes oral adminis child) to consume a bacterial composition, when a trainer tration, or by an oral or nasal tube (including nasogastric, 40 advises a user(such as an athlete) to follow aparticular course nasojejunal, oral gastric, or oral jejunal). In other embodi of conduct and/or treatment, and when a manufacturer, dis ments, administration includes rectal administration (includ tributer, or marketer recommends conditions of use to an end ing enema, Suppository, or colonoscopy). The bacterial com user, for example through advertisements or labeling on pack position may be administered to at least one region of the aging or on other materials provided in association with the gastrointestinal tract, including the mouth, esophagus, stom 45 sale or marketing of a product. ach, Small intestine, large intestine, and rectum. In some The bacterial compositions offer a protective and/or thera embodiments, it is administered to all regions of the gas peutic effect against infection by one or more GI pathogens of trointestinal tract. The bacterial compositions may be admin interest and can be administered after an acute case of infec istered orally in the form of medicaments such as powders, tion has been resolved in order to prevent relapse, during an capsules, tablets, gels or liquids. The bacterial compositions 50 acute case of infection as a complement to antibiotic therapy may also be administered in gel or liquid form by the oral if the bacterial composition is not sensitive to the same anti route or through a nasogastric tube, or by the rectal route in a biotics as the GI pathogen, or to prevent infection or reduce gel or liquid form, by enema or instillation through a colono transmission from disease carriers. Scope or by a Suppository. The present bacterial compositions can be useful in a vari If the composition is administered colonoscopically and, 55 ety of clinical situations. For example, the bacterial compo optionally, if the bacterial composition is administered by sitions can be administered as a complementary treatment to other rectal routes (such as an enema or Suppository) or even antibiotics when a patientis Suffering from an acute infection, if the Subject has an oral administration, the Subject may have to reduce the risk of recurrence after an acute infection has a colonic-cleansing preparation. The colon-cleansing prepa subsided, or when a patient will be in close proximity to ration can facilitate proper use of the colonoscope or other 60 others with or at risk of serious gastrointestinal infections administration devices, but even when it does not serve a (physicians, nurses, hospital workers, family members of mechanical purpose it can also maximize the proportion of those who are ill or hospitalized). the bacterial composition relative to the other organisms pre The present bacterial compositions can be administered to viously residing in the gastrointestinal tract of the Subject. animals, including humans, laboratory animals (e.g., pri Any ordinarily acceptable colonic-cleansing preparation may 65 mates, rats, mice), livestock (e.g., cows, sheep, goats, pigs, be used such as those typically provided when a subject turkeys, chickens), and household pets (e.g., dogs, cats, undergoes a colonoscopy. rodents). US 9,011,834 B1 33 34 In the present method, the bacterial composition can be biota, the bacterial compositions described herein are suitable administered enterically, in other words, by a route of access for treatment thereof. In some embodiments, the mammalian to the gastrointestinal tract. This includes oral administration, Subject has not received antibiotics in advance of treatment rectal administration (including enema, Suppository, or with the bacterial compositions. For example, the mamma colonoscopy), by an oral or nasal tube (nasogastric, nasoje lian Subject has not been administered at least two doses of junal, oral gastric, or oral jejunal), as detailed more fully Vancomycin, metronidazole and/or or similar antibiotic com herein. pound within one week prior to administration of the thera Pretreatment Protocols peutic composition. In other embodiments, the mammalian Prior to administration of the bacterial composition, the Subject has not previously received an antibiotic compound in patient can optionally have a pretreatment protocol to prepare 10 the one month prior to administration of the therapeutic com the gastrointestinal tract to receive the bacterial composition. position. In other embodiments, the mammalian Subject has In certain embodiments, the pretreatment protocol is advis received one or more treatments with one or more different able, such as when a patient has an acute infection with a antibiotic compounds and Such treatment(s) resulted in no highly resilient pathogen. In other embodiments, the pretreat improvement or a worsening of symptoms. ment protocol is entirely optional. Such as when the pathogen 15 In some embodiments, the gastrointestinal disease, disor causing the infection is not resilient, or the patient has had an der or condition is diarrhea caused by C. difficile including acute infection that has been successfully treated but where recurrent C. difficile infection, ulcerative colitis, colitis, the physician is concerned that the infection may recur. In Crohn's disease, or irritable bowel disease. Beneficially, the these instances, the pretreatment protocol can enhance the therapeutic composition is administered only once prior to ability of the bacterial composition to affect the patients improvement of the disease, disorder or condition. In some microbiome. embodiments, the therapeutic composition is administered at As one way of preparing the patient for administration of intervals greater than two days, Such as once every three, four, the microbial ecosystem, at least one antibiotic can be admin five or six days, or every week or less frequently than every istered to alter the bacteria in the patient. As another way of week. In other embodiments, the preparation can be admin preparing the patient for administration of the microbial eco 25 istered intermittently according to a set schedule, e.g., once a system, a standardcolon-cleansing preparation can be admin day, once weekly, or once monthly, or when the Subject istered to the patient to substantially empty the contents of the relapses from the primary illness. In another embodiment, the colon, such as used to prepare a patient for a colonScopy. By preparation may be administered on a long-term basis to “Substantially emptying the contents of the colon, this appli subjects who are at risk for infection with or who may be cation means removing at least 75%, at least 80%, at least 30 carriers of these pathogens, including Subjects who will have 90%, at least 95%, or about 100% of the contents of the an invasive medical procedure (such as Surgery), who will be ordinary volume of colon contents. Antibiotic treatment can hospitalized, who live in a long-term care or rehabilitation precede the colon-cleansing protocol. facility, who are exposed to pathogens by virtue of their If a patient has received an antibiotic for treatment of an profession (livestock and animal processing workers), or who infection, or if a patient has received an antibiotic as part of a 35 could be carriers of pathogens (including hospital workers specific pretreatment protocol, in one embodiment, the anti Such as physicians, nurses, and other health care profession biotic can be stopped in sufficient time to allow the antibiotic als). to be substantially reduced in concentration in the gut before In certain embodiments, the bacterial composition is the bacterial composition is administered. In one embodi administered enterically. This preferentially includes oral ment, the antibiotic can be discontinued 1, 2, or 3 days before 40 administration, or by an oral or nasal tube (including naso the administration of the bacterial composition. In another gastric, nasojejunal, oral gastric, or oral jejunal). In other embodiment, the antibiotic can be discontinued 3, 4, 5, 6, or embodiments, administration includes rectal administration 7 antibiotic half-lives before administration of the bacterial (including enema, Suppository, or colonoscopy). The bacte composition. In another embodiment, the antibiotic can be rial composition can be administered to at least one region of chosen so the constituents in the bacterial composition have 45 the gastrointestinal tract, including the mouth, esophagus, an MIC50 that is higher than the concentration of the antibi stomach, Small intestine, large intestine, and rectum. In some otic in the gut. embodiments, it is administered to all regions of the gas MIC50 of a bacterial composition or the elements in the trointestinal tract. The bacterial compositions can be admin composition can be determined by methods well known in the istered orally in the form of medicaments such as powders, art. Reller et al., Antimicrobial Susceptibility Testing: A 50 capsules, tablets, gels or liquids. The bacterial compositions Review of General Principles and Contemporary Practices, can also be administered ingel or liquid form by the oral route Clinical Infectious Diseases 49(11):1749-1755 (2009). In or through a nasogastric tube, or by the rectal route in a gel or such an embodiment, the additional time between antibiotic liquid form, by enema or instillation through a colonoscope or administration and administration of the bacterial composi by a Suppository. tion is not necessary. If the pretreatment protocol is part of 55 If the composition is administered colonoscopically and, treatment of an acute infection, the antibiotic can be chosen so optionally, if the bacterial composition is administered by that the infection is sensitive to the antibiotic, but the con other rectal routes (such as an enema or Suppository) or even stituents in the bacterial composition are not sensitive to the if the Subject has an oral administration, the Subject can have antibiotic. a colon-cleansing preparation. The colon-cleansing prepara Routes of Administration 60 tion can facilitate proper use of the colonoscope or other The bacterial compositions of the invention are suitable for administration devices, but even when it does not serve a administration to mammals and non-mammalian animals in mechanical purpose, it can also maximize the proportion of need thereof. In certain embodiments, the mammalian Subject the bacterial composition relative to the other organisms pre is a human Subject who has one or more symptoms of a viously residing in the gastrointestinal tract of the Subject. dysbiosis. 65 Any ordinarily acceptable colon-cleansing preparation may When a mammalian Subject is suffering from a disease, be used Such as those typically provided when a subject disorder or condition characterized by an aberrant micro undergoes a colonoscopy. US 9,011,834 B1 35 36 Dosages and Schedule for Administration ment, patients can be screened to determine the composition In some embodiments, the bacteria and bacterial composi of their microbiota to determine the likelihood of successful tions are provided in a dosage form. In certain embodiments, treatment. the dosage form is designed for administration of at least one Combination Therapy OTU or combination thereof disclosed herein, wherein the The bacterial compositions can be administered with other total amount of bacterial composition administered is agents in a combination therapy mode, including anti-micro selected from 0.1 ng to 10g, 10 ng to 1 g, 100 ng to 0.1 g, 0.1 bial agents and prebiotics. Administration can be sequential, mg to 500 mg, 1 mg to 100 mg. or from 10-15 mg. In other over a period of hours or days, or simultaneous. embodiments, the bacterial composition is consumed at a rate In one embodiment, the bacterial compositions are 10 included in combination therapy with one or more anti-mi of from 0.1 ng to 10g a day, 10 ng to 1 g a day, 100 ng to 0.1 crobial agents, which include anti-bacterial agents, anti-fun ga day, 0.1 mg to 500 mga day, 1 mg to 100 mga day, or from gal agents, anti-viral agents and anti-parasitic agents. 10-15 mg a day, or more. Anti-bacterial agents can include cephalosporinantibiotics In certain embodiments, the treatment period is at least 1 (cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin, day, at least 2 days, at least 3 days, at least 4 days, at least 5 15 cefaclor, cefamandole, cefoxitin, cefprozil, and ceftobi days, at least 6 days, at least 1 week, at least 2 weeks, at least prole); fluoroquinolone antibiotics (cipro, Levacquin, floxin, 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, tequin, avelox, and norflox); tetracycline antibiotics (tetracy at least 3 months, at least 4 months, at least 5 months, at least cline, minocycline, Oxytetracycline, and doxycycline); peni 6 months, or at least 1 year. In some embodiments the treat cillin antibiotics (amoxicillin, amplicillin, penicillin V, diclox ment period is from 1 day to 1 week, from 1 week to 4 weeks, acillin, carbenicillin, Vancomycin, and methicillin); and from 1 month, to 3 months, from 3 months to 6 months, from carbapenem antibiotics (ertapenem, doripenem, imipenem/ 6 months to 1 year, or for over a year. cilastatin, and meropenem). In one embodiment, 10 and 10' microorganisms total can Anti-viral agents can include Abacavir, Acyclovir, Ade be administered to the patient in a given dosage form. In fovir, Amprenavir, Atazanavir, Cidofovir, Darunavir, Delavir another embodiment, an effective amount can be provided in 25 dine, Didanosine, Docosanol, Efavirenz, Elvitegravir, from 1 to 500 ml or from 1 to 500 grams of the bacterial Emtricitabine, Enfluvirtide, Etravirine, Famciclovir, Foscar composition having from 10 to 10' bacteria per ml or per net, Fomivirsen, Ganciclovir, Indinavir, Idoxuridine, Lami gram, or a capsule, tablet or Suppository having from 1 mg to Vudine, Lopinavir Maraviroc, MK-2048, Nelfinavir, Nevi 1000 mg lyophilized powder having from 107 to 10' bacte rapine, Penciclovir, Raltegravir, Rilpivirine, Ritonavir, ria. Those receiving acute treatment can receive higher doses 30 Saquinavir, Stavudine, Tenofovir Trifluridine, Valaciclovir, than those who are receiving chronic administration (such as Valganciclovir, Vidarabine, Ibacitabine, Amantadine, Oselta hospital workers or those admitted into long-term care facili mivir, Rimantidine, Tipranavir, Zalcitabine, Zanamivir and ties). Zidovudine. Any of the preparations described herein can be adminis Examples of antifungal compounds include, but are not tered once on a single occasion or on multiple occasions, such 35 limited to polyene antifungals such as natamycin, rimocidin, as once a day for several days or more than once a day on the filipin, nystatin, amphotericin B, candicin, and hamycin; imi day of administration (including twice daily, three times dazole antifungals such as miconazole, ketoconazole, clotri daily, or up to five times daily). In another embodiment, the mazole, econazole, omoconazole, bifonazole, butoconazole, preparation can be administered intermittently according to a fenticonazole, isoconazole, oxiconazole, Sertaconazole, Sul set schedule, e.g., once weekly, once monthly, or when the 40 conazole, and tioconazole; triazole antifungals such as flu patient relapses from the primary illness. In one embodiment, conazole, itraconazole, isavuconazole, ravuconazole, posa the preparation can be administered on a long-term basis to conazole, Voriconazole, terconazole, and albaconazole; individuals who are at risk for infection with or who may be thiazole antifungals such as abafungin; allylamine antifun carriers of these pathogens, including individuals who will gals such as terbinafine, naftifine, and butenafine; and echi have an invasive medical procedure (such as Surgery), who 45 nocandin antifungals such as anidulafungin, caspofungin, will be hospitalized, who live in a long-term care or rehabili and micafungin. Other compounds that have antifungal prop tation facility, who are exposed to pathogens by virtue of their erties include, but are not limited to polygodial, benzoic acid, profession (livestock and animal processing workers), or who ciclopiroX, tolnaftate, undecylenic acid, flucytosine or 5-fluo could be carriers of pathogens (including hospital workers rocytosine, griseofulvin, and haloprogin. Such as physicians, nurses, and other health care profession 50 In one embodiment, the bacterial compositions are als). included in combination therapy with one or more corticos Patient Selection teroids, mesalazine, mesalamine, Sulfasalazine, SulfaSalazine Particular bacterial compositions can be selected for indi derivatives, immunosuppressive drugs, cyclosporin A, mer vidual patients or for patients with particular profiles. For captopurine, azathiopurine, prednisone, methotrexate, anti example, 16S sequencing can be performed for a given 55 histamines, glucocorticoids, epinephrine, theophylline, cro patient to identify the bacteria present in his or her micro molyn Sodium, anti-leukotrienes, anti-cholinergic drugs for biota. The sequencing can either profile the patient’s entire rhinitis, anti-cholinergic decongestants, mast-cell stabilizers, microbiome using 16S sequencing (to the family, genera, or monoclonal anti-IgE antibodies, vaccines, and combinations species level), a portion of the patient's microbiome using thereof. 16S sequencing, or it can be used to detect the presence or 60 A prebiotic is a selectively fermented ingredient that absence of specific candidate bacteria that are biomarkers for allows specific changes, both in the composition and/or activ health or a particular disease state, Such as markers of multi ity in the gastrointestinal microbiota that confers benefits drug resistant organisms or specific genera of concern Such as upon host well-being and health. Prebiotics can include com Escherichia. Based on the biomarker data, a particular com plex carbohydrates, amino acids, peptides, or other essential position can be selected for administration to a patient to 65 nutritional components for the survival of the bacterial com Supplement or complement a patient’s microbiota in order to position. Prebiotics include, but are not limited to, amino restore health or treat or prevent disease. In another embodi acids, biotin, fructooligosaccharide, galactooligosaccha US 9,011,834 B1 37 38 rides, inulin, lactulose, mannan oligosaccharides, oligofruc Furthermore, the number of sequence counts that corre tose-enriched inulin, oligofructose, oligodextrose, tagatose, spond exactly to those in the bacterial composition over time trans-galactooligosaccharide, and Xylooligosaccharides. can be assessed to determine specifically which components Methods for Testing Bacterial Compositions for Populat of the bacterial composition reside in the gastrointestinal tract ing Effect over a particular period of time. In one embodiment, the In Vivo Assay for Determining Whether a Bacterial Com strains of the bacterial composition persist for a desired position Populates a Subjects Gastrointestinal Tract period of time. In another embodiment, the components of the In order to determine that the bacterial composition popu bacterial composition persist for a desired period of time, lates the gastrointestinal tract of a subject, an animal model, while also increasing the ability of other microbes (such as Such as a mouse model, can be used. The model can begin by 10 evaluating the microbiota of the mice. Qualitative assess those present in the environment, food, etc.) to populate the ments can be accomplished using 16S profiling of the micro gastrointestinal tract, further increasing overall diversity, as bial community in the feces of normal mice. It can also be discussed below. accomplished by full genome sequencing, whole genome Ability of Bacterial compositions to Populate Different shotgun sequencing (WGS), or traditional microbiological 15 Regions of the Gastrointestinal Tract techniques. Quantitative assessments can be conducted using The present bacterial compositions can also be assessed for quantitative PCR (qPCR), described below, or by using tra their ability to populate different regions on the gastrointes ditional microbiological techniques and counting colony for tinal tract. In one embodiment, a bacterial composition can be mation. chosen for its ability to populate one or more than one region Optionally, the mice can receive an antibiotic treatment to of the gastrointestinal tract, including, but not limited to the mimic the condition of dysbiosis. Antibiotic treatment can stomach, the Small intestine (duodenum, jejunum, and decrease the taxonomic richness, diversity, and evenness of ileum), the large intestine (the cecum, the colon (the ascend the community, including a reduction of abundance of a sig ing, transverse, descending, and sigmoid colon), and the rec nificant number of bacterial taxa. Dethlefsen et al., The per tum). vasive effects of an antibiotic on the human gut microbiota, as 25 An in vivo study can be conducted to determine which revealed by deep 16S rRNA sequencing, PLoS Biology regions of the gastrointestinal tract a given bacterial compo 6(11):3280 (2008). At least one antibiotic can be used, and sition will populate. A mouse model similar to the one antibiotics are well known. Antibiotics can includeaminogly described above can be conducted, except instead of assess coside antibiotic (amikacin, arbekacin, gentamicin, kanamy ing the feces produced by the mice, particular regions of the cin, neomycin, netilmicin, paromomycin, rhodoStreptomy 30 gastrointestinal tract can be removed and studied individu cin, streptomycin, tobramycin, and apramycin), amoxicillin, ally. For example, at least one particular region of the gas ampicillin, Augmentin (an amoxicillin/clavulanate potas trointestinal tract can be removed and a qualitative or quan sium combination), cephalosporin (cefaclor, defadroxil, cefa titative determination can be performed on the contents of Zolin, cefixime, fefoxitin, cefprozil, ceftazimdime, that region of the gastrointestinal tract. In another embodi cefuroxime, cephalexin), clavulanate potassium, clindamy 35 ment, the contents can optionally be removed and the quali cin, colistin, gentamycin, kanamycin, metronidazole, or van tative or quantitative determination may be conducted on the comycin. As an individual, nonlimiting specific example, the tissue removed from the mouse. mice can be provided with drinking water containing a mix qPCR ture of the antibiotics kanamycin, colistin, gentamycin, met As one quantitative method for determining whether a ronidazole and Vancomycin at 40 mg/kg, 4.2 mg/kg, 3.5 40 bacterial composition populates the gastrointestinal tract, mg/kg, 21.5 mg/kg, and 4.5 mg/kg (mg per average mouse quantitative PCR (qPCR) can be performed. Standard tech body weight), respectively, for 7 days. Alternatively, mice can niques can be followed to generate a standard curve for the be administered ciprofloxacin at a dose of 15-20 mg/kg (mg bacterial composition of interest, either for all of the compo per average mouse body weight), for 7 days. nents of the bacterial composition collectively, individually, If the mice are provided with an antibiotic, a wash out period 45 or in subsets (if applicable). Genomic DNA can be extracted of from one day to three days may be provided with no from samples using commercially-available kits, such as the antibiotic treatment and no bacterial composition treatment. Mo BioPowersoil(R)-htp 96 Well Soil DNA Isolation Kit (Mo Subsequently, the test bacterial composition is adminis Bio Laboratories, Carlsbad, Calif.), the Mo Bio Powersoil(R) tered to the mice by oral gavage. The test bacterial composi DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), tion may be administered in a volume of 0.2ml containing 10 50 or the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, CFUs of each type of bacteria in the bacterial composition. Calif.) according to the manufacturers instructions. Dose-response may be assessed by using a range of doses, In some embodiments, qPCR can be conducted using Hot including, but not limited to 10, 10, 10, 10, 10, 107, 10, MasterMix (5PRIME, Gaithersburg, Md.) and primers spe 10, and/or 109. cific for the bacterial composition of interest, and may be The mice can be evaluated using 16S sequencing, full 55 conducted on a MicroAmp(R) Fast Optical 96-well Reaction genome sequencing, whole genome shotgun sequencing Plate with Barcode (0.1 mL) (Life Technologies, Grand (WGS), or traditional microbiological techniques to deter Island, N.Y.) and performed on a BioRad C1000TM Thermal mine whether the test bacterial composition has populated the Cycler equipped with a CFX96TM Real-Time System (Bio gastrointestinal tract of the mice. For example only, one day, Rad, Hercules, Calif.), with fluorescent readings of the FAM three days, one week, two weeks, and one month after admin 60 and ROX channels. The Cd value for each well on the FAM istration of the bacterial composition to the mice, 16S profil channel is determined by the CFX ManagerTM software ver ing is conducted to determine whether the test bacterial com sion 2.1. The logo (cfu/ml) of each experimental sample is position has populated the gastrointestinal tract of the mice. calculated by inputting a given sample's Cd value into linear Quantitative assessments, including qPCR and traditional regression model generated from the standard curve compar microbiological techniques such as colony counting, can 65 ing the Cd values of the standard curve wells to the known additionally or alternatively be performed, at the same time logo (cfu/ml) of those samples. The skilled artisan may intervals. employ alternative qPCR modes. US 9,011,834 B1 39 40 Methods for Characterization of Bacterial Compositions Pat. No. 4,839,281. Survival of bacteria may be determined In certain embodiments, provided are methods for testing by culturing the bacteria and counting colonies on appropri certain characteristics of bacterial compositions. For ate selective or non-selective media. example, the sensitivity of bacterial compositions to certain Antibiotic Sensitivity Testing environmental variables is determined, e.g., in order to select 5 As a further optional sensitivity test, bacterial composi for particular desirable characteristics in a given composition, tions can be tested for sensitivity to antibiotics. In one formulation and/or use. For example, the constituents in the embodiment, bacterial compositions can be chosen so that the bacterial composition can be tested for pH resistance, bile bacterial constituents are sensitive to antibiotics such that if acid resistance, and/or antibiotic sensitivity, either individu necessary they can be eliminated or Substantially reduced ally on a constituent-by-constituent basis or collectively as a 10 from the patient’s gastrointestinal tract by at least one antibi bacterial composition comprised of multiple bacterial con otic targeting the bacterial composition. stituents (collectively referred to in this section as bacterial Adherence to Gastrointestinal Cells composition). The bacterial compositions may optionally be tested for the pH Sensitivity Testing ability to adhere to gastrointestinal cells. A method for testing If a bacterial composition will be administered other than 15 adherence to gastrointestinal cells is described in U.S. Pat. to the colon or rectum (i.e., for example, an oral route), No. 4,839,281. optionally testing for pH resistance enhances the selection of Methods for Purifying Spores bacterial compositions that will survive at the highest yield Solvent Treatments possible through the varying pH environments of the distinct To purify the bacterial spores, the fecal material is sub regions of the GI tract. Understanding how the bacterial com 20 jected to one or more solvent treatments. A solvent treatment positions react to the pH of the GI tract also assists in formu is a miscible solvent treatment (either partially miscible or lation, so that the number of bacteria in a dosage form can be fully miscible) or an immiscible solvent treatment. Miscibil increased if beneficial and/or so that the composition may be ity is the ability of two liquids to mix with each to form a administered in an enteric-coated capsule or tablet or with a homogeneous solution. Water and ethanol, for example, are buffering or protective composition. As the pH of the stomach 25 fully miscible Such that a mixture containing water and etha can drop to a pH of 1 to 2 after a high-protein meal for a short nol in any ratio will show only one phase. Miscibility is time before physiological mechanisms adjust it to a pH of 3 to provided as a wit/wt %, or weight of one solvent in 100 g of 4 and often resides at a resting pH of 4 to 5, and as the pH of final solution. If two solvents are fully miscible in all propor the small intestine can range from a pH of 6 to 7.4, bacterial tions, their miscibility is 100%. Provided as fully miscible compositions can be prepared that Survive these varying pH 30 Solutions with water are alcohols, e.g., methanol, ethanol, ranges (specifically wherein at least 1%. 5%, 10%, 15%, isopropanol, butanol, etc. The alcohols can be provided 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or as already combined with water; e.g., a solution containing much as 100% of the bacteria can survive gut transit times 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, through various pH ranges). This can be tested by exposing 65%, 70%, 75%, 89%, 85%, 90%. 95% or greater than 95% the bacterial composition to varying pH ranges for the 35 Other solvents are only partially miscible, meaning that only expected gut transit times through those pH ranges. There some portion will dissolve in water. Diethyl ether, for fore, as a nonlimiting example only, 18-hour cultures of bac example, is partially miscible with water. Up to 7 grams of terial compositions can be grown in standard media, Such as diethyl ether will dissolve in 93 g of water to give a 7% (wit/wt gut microbiota medium (“GMM, see Goodman et al., Exten %) solution. If more diethyl ether is added, a two phase sive personal human gut microbiota culture collections char 40 solution will result with a distinct diethyl ether layer above acterized and manipulated in gnotobiotic mice, PNAS 108 the water. Other miscible materials include ethers, (15):6252-6257 (2011)) or another animal-products-free dimethoxyethane, or tetrahydrofuran. In contrast, an oil Such medium, with the addition of pH adjusting agents for a pH of as an alkane and water are immiscible and form two phases. 1 to 2 for 30 minutes, a pH of 3 to 4 for 1 hour, a pH of 4 to 5 Further, immiscible treatments are optionally combined with for 1 to 2 hours, and a pH of 6 to 7.4 for 2.5 to 3 hours. An 45 a detergent, eitheranionic detergent or a non-ionic detergent. alternative method for testing stability to acid is described in Exemplary detergents include Triton X-100. Tween 20, U.S. Pat. No. 4,839,281. Survival of bacteria may be deter Tween 80, Nonidet P40, a pluronic, or a polyol. mined by culturing the bacteria and counting colonies on Chromatography Treatments appropriate selective or non-selective media. To purify spore populations, the fecal materials are Sub Bile Acid Sensitivity Testing 50 jected to one or more chromatographic treatments, either Additionally, in Some embodiments, testing for bile-acid sequentially or in parallel. In a chromatographic treatment, a resistance enhances the selection of bacterial compositions Solution containing the fecal material is contacted with a solid that will survive exposures to bile acid during transit through medium containing a hydrophobic interaction chromato the GI tract. Bile acids are secreted into the small intestine and graphic (HIC) medium or an affinity chromatographic can, like pH, affect the survival of bacterial compositions. 55 medium. In an alternative embodiment, a solid medium This can be tested by exposing the bacterial compositions to capable of absorbing a residual habitat product present in the bile acids for the expected gut exposure time to bile acids. For fecal material is contacted with a solid medium that adsorbs a example, bile acid solutions can be prepared at desired con residual habitat product. In certain embodiments, the HIC centrations using 0.05 mM Tris at pH 9 as the solvent. After medium contains Sepharose or a derivatized Sepharose Such the bile acid is dissolved, the pH of the solution may be 60 as butyl Sepharose, octyl Sepharose, phenyl Sepharose, or adjusted to 7.2 with 10% HC1. Bacterial compositions can be butyl-s Sepharose. In other embodiments, the affinity chro cultured in 2.2 ml of a bile acid composition mimicking the matographic medium contains material derivatized with concentration and type of bile acids in the patient, 1.0 ml of mucin type I, II, III, IV, V, or VI, or oligosaccharides derived 10% sterile-filtered feces media and 0.1 ml of an 18-hour from or similar to those of mucins type I, II, III, IV, V, or VI. culture of the given strain of bacteria. Incubations may be 65 Alternatively, the affinity chromatographic medium contains conducted for from 2.5 to 3 hours or longer. An alternative material derivatized with antibodies that recognize spore method for testing stability to bile acid is described in U.S. forming bacteria. US 9,011,834 B1 41 42 Mechanical Treatments fibrous materials; a second, higher force centrifugation pel Provided herein is the physical disruption of the fecal mate lets undesired eukaryotic cells, and a third, still higher force rial, particularly by one or more mechanical treatment such as centrifugation pellets the desired spores while Small contami blending, mixing, shaking, Vortexing, impact pulverization, nants remain in Suspension. In some embodiments density or and Sonication. As provided herein, the mechanical disrupt mobility gradients or cushions (e.g., step cushions). Such as ing treatment Substantially disrupts a non-spore material Percoll, Ficoll, Nycodenz. Histodenz or sucrose gradients, present in the fecal material and does not Substantially disrupt are used to separate desired spore populations from other a spore present in the fecal material. Mechanical treatments materials in the fecal material. optionally include filtration treatments, where the desired Also provided herein are methods of producing spore spore populations are retained on a filter while the undesir 10 populations that combine two or more of the treatments able (non-spore) fecal components to pass through, and the described herein in order to synergistically purify the desired spore fraction is then recovered from the filter medium. Alter spores while killing or removing undesired materials and/or natively, undesirable particulates and eukaryotic cells may be activities from the spore population. It is generally desirable retained on a filter while bacterial cells including spores pass to retain the spore populations under non-germinating and through. In some embodiments the spore fraction retained on 15 non-growth promoting conditions and media, in order to the filter medium is subjected to a diafiltration step, wherein minimize the growth of pathogenic bacteria present in the the retained spores are contacted with a wash liquid, typically spore populations and to minimize the germination of spores a sterile saline-containing Solution or other diluent, in order to into vegetative bacterial cells. further reduce or remove the undesirable fecal components. Pharmaceutical Compositions and Formulations of the Thermal Treatments Invention Provided herein is the thermal disruption of the fecal mate Formulations rial. Generally, the fecal material is mixed in a saline-contain Provided are formulations for administration to humans ing solution such as phosphate-buffered saline (PBS) and and other subjects in need thereof. Generally the bacterial Subjected to a heated environment, such as a warm room, compositions are combined with additional active and/or incubator, water-bath, or the like, such that efficient heat 25 inactive materials in order to produce a final product, which transfer occurs between the heated environment and the fecal may be in single dosage unit or in a multi-dose format. material. Preferably the fecal material solution is mixed dur In some embodiments, the composition comprises at least ing the incubation to enhance thermal conductivity and dis one carbohydrate. A “carbohydrate” refers to a sugar or poly rupt particulate aggregates. Thermal treatments can be modu mer of sugars. The terms “saccharide.” “polysaccharide.” lated by the temperature of the environment and/or the 30 “carbohydrate and "oligosaccharide' may be used inter duration of the thermal treatment. For example, the fecal changeably. Most carbohydrates are aldehydes or ketones material or a liquid comprising the fecal material is subjected with many hydroxyl groups, usually one on each carbonatom to a heated environment, e.g., a hot water bath of at least about of the molecule. Carbohydrates generally have the molecular 20, 25, 30,35, 40, 45,50,55,60, 65,70, 75,80, 85,90,95, 100 formula CH2O. A carbohydrate can be a monosaccharide, or greater than 100 degrees Celsius, for at least about 1, 5, 10. 35 a disaccharide, trisaccharide, oligosaccharide, or polysaccha 15, 20, 30, 45 seconds, or 1,2,3,4,5,6,7,8,9, 10, 15, 20, 25, ride. The most basic carbohydrate is a monosaccharide. Such 30, 40, or 50 minutes, or 1,2,3,4,5,6,7,8,9, 10 or more than as glucose, Sucrose, galactose, mannose, ribose, arabinose, 10 hours. In certain embodiments the thermal treatment Xylose, and fructose. Disaccharides are two joined monosac occurs at two different temperatures, such as 30 seconds in a charides. Exemplary disaccharides include Sucrose, maltose, 100 degree Celsius environment followed by 10 minutes in a 40 cellobiose, and lactose. Typically, an oligosaccharide 50 degree Celsius environment. In preferred embodiments includes between three and six monosaccharide units (e.g., the temperature and duration of the thermal treatment are raffinose, stachyose), and polysaccharides include six or sufficient to kill or remove pathogenic materials while not more monosaccharide units. Exemplary polysaccharides Substantially damaging or reducing the germination-compe include starch, glycogen, and cellulose. Carbohydrates can tency of the spores. 45 contain modified saccharide units, such as 2'-deoxyribose Irradiation Treatments wherein a hydroxyl group is removed, 2'-fluororibose Provided are methods of treating the fecal material or sepa wherein a hydroxyl group is replace with a fluorine, or rated contents of the fecal material with ionizing radiation, N-acetylglucosamine, a nitrogen-containing form of glucose typically gamma irradiation, ultraviolet irradiation or elec (e.g. 2'-fluororibose, deoxyribose, and hexose). Carbohy tron beam irradiation provided at an energy level sufficient to 50 drates can exist in many different forms, for example, con kill pathogenic materials while not substantially damaging formers, cyclic forms, acyclic forms, stereoisomers, tau the desired spore populations. For example, ultraViolet radia tomers, anomers, and isomers. tion at 254 nm provided at an energy level below about 22,000 In some embodiments, the composition comprises at least microwatt seconds per cm will not generally destroy desired one lipid. As used herein, a "lipid' includes fats, oils, triglyc spores. 55 erides, cholesterol, phospholipids, fatty acids in any form Centrifugation and Density Separation Treatments including free fatty acids. Fats, oils and fatty acids can be Provided are methods of separating desired spore popula saturated, unsaturated (cis or trans) or partially unsaturated tions from the other components of the fecal material by (cis or trans). In some embodiments, the lipid comprises at centrifugation. A solution containing the fecal material is least one fatty acid selected from lauric acid (12:0), myristic Subjected to one or more centrifugation treatments, e.g., at 60 acid (14:0), palmitic acid (16:0), palmitoleic acid (16:1), mar about 1000xg, 2000xg, 3000xg, 4000xg, 5000xg, 6000xg, garic acid (17:0), heptadecenoic acid (17:1), stearic acid (18: 7000xg, 8000xg or greater than 8000xg. Differential cen O), oleic acid (18:1), linoleic acid (18:2), linolenic acid (18:3), trifugation separates desired spores from undesired non octadecatetraenoic acid (18:4), arachidic acid (20:0), eicose spore material; at low forces the spores are retained in Solu noic acid (20:1), eicosadienoic acid (20:2), eicosatetraenoic tion, while at higher forces the spores are pelleted while 65 acid (20:4), eicosapentaenoic acid (20:5) (EPA), docosanoic Smaller impurities (e.g., virus particles, phage) are retained in acid (22:0), docosenoic acid (22:1), docosapentaenoic acid Solution. For example, a first low force centrifugation pellets (22:5), docosahexaenoic acid (22:6) (DHA), and tetra US 9,011,834 B1 43 44 cosanoic acid (24:0). In other embodiments, the composition pecitin, and tragacanth. In another embodiment, the disinte comprises at least one modified lipid, for example, a lipid that grant is an effervescent disintegrant. Non-limiting examples has been modified by cooking. of suitable effervescent disintegrants include sodium bicar In some embodiments, the composition comprises at least bonate in combination with citric acid, and sodium bicarbon one Supplemental mineral or mineral source. Examples of 5 ate in combination with tartaric acid. minerals include, without limitation: chloride, Sodium, cal In another embodiment, the excipient comprises a flavor cium, iron, chromium, copper, iodine, Zinc, magnesium, ing agent. Flavoring agents can be chosen from Synthetic manganese, molybdenum, phosphorus, potassium, and sele flavor oils and flavoring aromatics; natural oils; extracts from nium. Suitable forms of any of the foregoing minerals include plants, leaves, flowers, and fruits; and combinations thereof. soluble mineral salts, slightly soluble mineral salts, insoluble 10 In some embodiments the flavoring agent is selected from mineral salts, chelated minerals, mineral complexes, non cinnamon oils; oil of wintergreen; peppermint oils; clover oil; reactive minerals such as carbonyl minerals, and reduced hay oil; anise oil; eucalyptus; Vanilla; citrus oil such as lemon minerals, and combinations thereof. oil, orange oil, grape and grapefruit oil; and fruit essences In certain embodiments, the composition comprises at including apple, peach, pear, Strawberry, raspberry, cherry, least one Supplemental vitamin. The at least one vitamin can 15 plum, pineapple, and apricot. be fat-soluble or water soluble vitamins. Suitable vitamins In other embodiments, the excipient comprises a Sweet includebut are not limited to vitamin C, vitaminA, vitamin E, ener. Non-limiting examples of Suitable Sweeteners include vitamin B12, vitamin K, riboflavin, niacin, vitamin D, vita glucose (corn Syrup), dextrose, invert Sugar, fructose, and min B6, folic acid, pyridoxine, thiamine, pantothenic acid, mixtures thereof (when not used as a carrier); saccharin and and biotin. Suitable forms of any of the foregoing are salts of its various salts such as the Sodium salt; dipeptide Sweeteners the vitamin, derivatives of the vitamin, compounds having the Such as aspartame; dihydrochalcone compounds, glycyr same or similar activity of the vitamin, and metabolites of the rhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of Vitamin. Sucrose such as Sucralose; and Sugar alcohols such as Sorbitol, In other embodiments, the composition comprises an mannitol, Sylitol, and the like. Also contemplated are hydro excipient. Non-limiting examples of Suitable excipients 25 genated Starch hydrolysates and the synthetic Sweetener 3.6- include a buffering agent, a preservative, a stabilizer, a binder, dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide, par a compaction agent, a lubricant, a dispersion enhancer, a ticularly the potassium salt (acesulfame-K), and Sodium and disintegration agent, a flavoring agent, a Sweetener, and a calcium salts thereof. coloring agent. In yet other embodiments, the composition comprises a In another embodiment, the excipient is a buffering agent. 30 coloring agent. Non-limiting examples of Suitable color Non-limiting examples of Suitable buffering agents include agents include food, drug and cosmetic colors (FD&C), drug sodium citrate, magnesium carbonate, magnesium bicarbon and cosmetic colors (D&C), and external drug and cosmetic ate, calcium carbonate, and calcium bicarbonate. colors (Ext. D&C). The coloring agents can be used as dyes or In Some embodiments, the excipient comprises a preserva their corresponding lakes. tive. Non-limiting examples of suitable preservatives include 35 The weight fraction of the excipient or combination of antioxidants, such as alpha-tocopherol and ascorbate, and excipients in the formulation is usually about 99% or less, antimicrobials, such as parabens, chlorobutanol, and phenol. such as about 95% or less, about 90% or less, about 85% or In other embodiments, the composition comprises a binder less, about 80% or less, about 75% or less, about 70% or less, as an excipient. Non-limiting examples of Suitable binders about 65% or less, about 60% or less, about 55% or less, 50% include starches, pregelatinized starches, gelatin, polyvi 40 or less, about 45% or less, about 40% or less, about 35% or nylpyrolidone, cellulose, methylcellulose, Sodium car less, about 30% or less, about 25% or less, about 20% or less, boxymethylcellulose, ethylcellulose, polyacrylamides, poly about 15% or less, about 10% or less, about 5% or less, about vinyloxoazolidone, polyvinylalcohols, C-Cls fatty acid 2% or less, or about 1% or less of the total weight of the alcohol, polyethylene glycol, polyols, Saccharides, oligosac composition. charides, and combinations thereof. 45 The bacterial compositions disclosed herein can be formu In another embodiment, the composition comprises a lated into a variety of forms and administered by a number of lubricant as an excipient. Non-limiting examples of Suitable different means. The compositions can be administered lubricants include magnesium Stearate, calcium Stearate, Zinc orally, rectally, or parenterally, in formulations containing Stearate, hydrogenated vegetable oils, sterotex, polyoxyeth conventionally acceptable carriers, adjuvants, and vehicles as ylene monostearate, talc, polyethyleneglycol, Sodium ben 50 desired. The term “parenteral as used herein includes sub Zoate, sodium lauryl Sulfate, magnesium lauryl Sulfate, and cutaneous, intravenous, intramuscular, or intrasternal injec light mineral oil. tion and infusion techniques. In an exemplary embodiment, In other embodiments, the composition comprises a dis the bacterial composition is administered orally. persion enhancer as an excipient. Non-limiting examples of Solid dosage forms for oral administration include cap Suitable dispersants include starch, alginic acid, polyvi 55 Sules, tablets, caplets, pills, troches, lozenges, powders, and nylpyrrolidones, guar gum, kaolin, bentonite, purified wood granules. A capsule typically comprises a core material com cellulose, sodium starch glycolate, isoamorphous silicate, prising a bacterial composition and a shell wall that encapsu and microcrystalline cellulose as high HLB emulsifier sur lates the core material. In some embodiments, the core mate factants. rial comprises at least one of a solid, a liquid, and an emulsion. In some embodiments, the composition comprises a disin 60 In other embodiments, the shell wall material comprises at tegrant as an excipient. In other embodiments, the disinte least one of a soft gelatin, a hard gelatin, and a polymer. grant is a non-effervescent disintegrant. Non-limiting Suitable polymers include, but are not limited to: cellulosic examples of Suitable non-effervescent disintegrants include polymers such as hydroxypropyl cellulose, hydroxyethyl cel starches Such as corn starch, potato starch, pregelatinized and lulose, hydroxypropyl methyl cellulose (HPMC), methyl cel modified Starches thereof, Sweeteners, clays, such as bento 65 lulose, ethyl cellulose, cellulose acetate, cellulose acetate nite, micro-crystalline cellulose, alginates, sodium starch phthalate, cellulose acetate trimellitate, hydroxypropylm glycolate, gums such as agar, guar, locust bean, karaya, ethyl cellulose phthalate, hydroxypropylmethyl cellulose US 9,011,834 B1 45 46 Succinate and carboxymethylcellulose sodium; acrylic acid blended with or added to an existing food to fortify the foods polymers and copolymers, such as those formed from acrylic protein nutrition. Examples include food staples (grain, salt, acid, methacrylic acid, methyl acrylate, ammonio methy Sugar, cooking oil, margarine), beverages (coffee, tea, Soda, lacrylate, ethyl acrylate, methyl methacrylate and/or ethyl beer, liquor, sports drinks), Snacks, Sweets and other foods. methacrylate (e.g., those copolymers sold under the trade In one embodiment, the formulations are filled into gelatin name "Eudragit); vinyl polymers and copolymers such as capsules for oral administration. An example of an appropri polyvinyl pyrrolidone, polyvinyl acetate, polyvinylacetate ate capsule is a 250 mg gelatin capsule containing from 10 (up phthalate, vinylacetate crotonic acid copolymer, and ethyl to 100 mg) of lyophilized powder (10 to 10' bacteria), 160 ene-vinyl acetate copolymers; and shellac (purified lac). In mg microcrystalline cellulose, 77.5 mg gelatin, and 2.5 mg yet other embodiments, at least one polymer functions as 10 magnesium stearate. In an alternative embodiment, from 10 taste-masking agents. to 10' bacteria may be used, 10 to 107, 10° to 107, or 10 to Tablets, pills, and the like can be compressed, multiply 10', with attendant adjustments of the excipients if neces compressed, multiply layered, and/or coated. The coating can sary. In an alternative embodiment, an enteric-coated capsule be single or multiple. In one embodiment, the coating mate or tablet or with a buffering or protective composition can be rial comprises at least one of a saccharide, a polysaccharide, 15 used. and glycoproteins extracted from at least one of a plant, a fungus, and a microbe. Non-limiting examples include corn EXAMPLES starch, wheat starch, potato starch, tapioca starch, cellulose, hemicellulose, dextrans, maltodextrin, cyclodextrins, inulins, Below are examples of specific embodiments for carrying pectin, mannans, gum arabic, locust bean gum, mesquite out the present invention. The examples are offered for illus gum, guar gum, gum karaya, gum ghatti, tragacanth gum, trative purposes only, and are not intended to limit the scope funori, carrageenans, agar, alginates, chitosans, or gellan of the present invention in any way. Efforts have been made to gum. In some embodiments the coating material comprises a ensure accuracy with respect to numbers used (e.g., amounts, protein. In another embodiment, the coating material com temperatures, etc.), but some experimental error and devia prises at least one of a fat and an oil. In other embodiments, 25 tion should, of course, be allowed for. the at least one of a fat and an oil is high temperature melting. The practice of the present invention will employ, unless In yet another embodiment, the at least one of a fat and an oil otherwise indicated, conventional methods of protein chem is hydrogenated or partially hydrogenated. In one embodi istry, biochemistry, recombinant DNA techniques and phar ment, the at least one of a fat and an oil is derived from a plant. macology, within the skill of the art. Such techniques are In other embodiments, the at least one of a fat and an oil 30 explained fully in the literature. See, e.g., T. E. Creighton, comprises at least one of glycerides, free fatty acids, and fatty Proteins. Structures and Molecular Properties (W.H. Free acid esters. In some embodiments, the coating material com man and Company, 1993); A. L. Lehninger, Biochemistry prises at least one edible wax. The edible wax can be derived (Worth Publishers, Inc., current addition); Sambrook, et al., from animals, insects, or plants. Non-limiting examples Molecular Cloning. A Laboratory Manual (2nd Edition, include beeswax, lanolin, bayberry wax, carnauba wax, and 35 1989); Methods In Enzymology (S. Colowick and N. Kaplan rice bran wax. Tablets and pills can additionally be prepared eds. Academic Press, Inc.); Remington's Pharmaceutical with enteric coatings. Sciences, 18th Edition (Easton, Pa.; Mack Publishing Com Alternatively, powders or granules embodying the bacte pany, 1990); Carey and Sundberg Advanced Organic Chem rial compositions disclosed herein can be incorporated into a istry 3" Ed. (Plenum Press) Vols A and B (1992). food product. In some embodiments, the food product is a 40 drink for oral administration. Non-limiting examples of a Example 1 suitable drink include fruit juice, a fruit drink, an artificially flavored drink, an artificially sweetened drink, a carbonated Provision of Fecal Material beverage, a sports drink, a liquid diary product, a shake, an alcoholic beverage, a caffeinated beverage, infant formula 45 Fresh fecal samples were obtained from healthy human and so forth. Other suitable means for oral administration donors who have been screened for general good health and include aqueous and nonaqueous solutions, emulsions, Sus for the absence of infectious diseases, and meet inclusion and pensions and Solutions and/or Suspensions reconstituted from exclusion criteria, inclusion criteria include being in good non-effervescent granules, containing at least one of Suitable general health, without significant medical history, physical Solvents, preservatives, emulsifying agents, Suspending 50 examination findings, or clinical laboratory abnormalities, agents, diluents, Sweeteners, coloring agents, and flavoring regular bowel movements with stool appearance typically agents. Type 2, 3, 4, 5 or 6 on the Bristol Stool Scale, and having a In some embodiments, the food product can be a solid BMI-18 kg/m and s25 kg/m. Exclusion criteria generally foodstuff. Suitable examples of a solid foodstuff include included significant chronic or acute medical conditions without limitation a foodbar, a Snack bar, a cookie, a brownie, 55 including renal, hepatic, pulmonary, gastrointestinal, cardio a muffin, a cracker, an ice cream bar, a frozen yogurt bar, and vascular, genitourinary, endocrine, immunologic, metabolic, the like. neurologic or hematological disease, a family history of In other embodiments, the compositions disclosed herein inflammatory bowel disease including Crohn's disease and are incorporated into a therapeutic food. In some embodi ulcerative colitis, Irritable bowel syndrome, colon, stomach ments, the therapeutic food is a ready-to-use food that option 60 or other gastrointestinal malignancies, or gastrointestinal ally contains some or all essential macronutrients and micro polyposis syndromes, or recent use of yogurt or commercial nutrients. In another embodiment, the compositions probiotic materials in which an organism(s) is a primary disclosed herein are incorporated into a Supplementary food component. Samples were collected directly using a com that is designed to be blended into an existing meal. In one mode specimen collection system, which contains a plastic embodiment, the Supplemental food contains some or all 65 Support placed on the toilet seat and a collection container that essential macronutrients and micronutrients. In another rests on the Support. Feces were deposited into the container, embodiment, the bacterial compositions disclosed herein are and the lid was then placed on the container and sealed tightly. US 9,011,834 B1 47 48 The sample was then delivered on ice within 1-4 hours for Example 4 processing. Samples were mixed with a sterile disposable tool, and 2-4 g aliquots were weighed and placed into tubes Spore Purification from Alcohol Treatment and and flash frozen in a dry ice/ethanol bath. Aliquots are frozen Thermal Treatment of Fecal Material at -80 degrees Celsius until use. Optionally, the fecal material was suspended in a solution, A 10% w/v suspension of human feces in PBS was mixed and/or fibrous and/or particulate materials were removed. A with absolute ethanol in a 1:1 ratio and vortexed to mix for 1 frozen aliquot containing a known weight of feces was minute. The Suspension was incubated in a water bath under removed from storage at -80 degrees Celsius and allowed to aerobic conditions at 37 degrees Celsius for 1 hour. After thaw at room temperature. Sterile 1 xPBS was added to create 10 incubation the suspension was centrifuged at 13,000 rpm for a 10% w/v Suspension, and vigorous Vortexing was per 5 minutes to pellet spores. The Supernatant was discarded and formed to suspend the fecal material until the material the pellet was resuspended in equal volume PBS. The ethanol appeared homogeneous. The material was then left to sit for treated spore population was then incubated in a water bathat 10 minutes at room temperature to sediment fibrous and par 80 degrees Celsius for 30 minutes. Glycerol was added to a ticulate matter. The Suspension above the sediment was then 15 final concentration of 15% and the purified sporefraction was carefully removed into a new tube and contains a purified stored at -80 C. spore population. Optionally, the Suspension was then centri fuged at a low speed, e.g., 1000xg, for 5 minutes to pellet Example 5 particulate matter including fibers. The pellet was discarded and the Supernatant, which contained vegetative organisms Spore Purification from Detergent Treatment of and spores, was removed into a new tube. The Supernatant Fecal Material was then centrifuged at 6000xg for 10 minutes to pellet the Vegetative organisms and spores. The pellet was then resus A 10% w/v suspension of human feces in PBS is prepared pended in 1xRBS with vigorous vortexing until the material to contain a final concentration of 0.5 to 2% Triton X-100. appears homogenous. 25 After shaking incubation for 30 minutes at 25 to 37 degrees Celsius, the sample is centrifuged at 1000 g for 5-10 minutes Example 2 to pellet particulate matter and large cells. The bacterial spores are recovered in the Supernatant fraction, where the Spore Purification from Alcohol Treatment of Fecal purified spore population is optionally further treated, such as Material 30 in Example 4. Without being bound by theory, detergent addition to the fecal mixture produces better spore popula A 10% w/v suspension of human fecal material in PBS was tions, at least in part by enhancing separation of the spores mixed with absolute ethanol in a 1:1 ratio and vortexed to mix from particulates thereby resulting in higher yields of spores. for 1 minute. The suspension was incubated at 37 degrees Celsius for 1 hour. After incubation the suspension was cen 35 Example 6 trifuged at 13,000 rpm for 5 minutes to pellet spores. The Supernatant was discarded and the pellet was resuspended in Spore Purification by Chromatographic Separation an equal volume of PBS. Glycerol was added to a final con of Fecal Material centration of 15% and then the purified spore fraction is stored at -80 degrees Celsius. 40 A spore-enriched population Such as obtained from Examples 1-5 above, is mixed with NaCl to a final concen Example 2A tration of 4M total salt and contacted with octyl Sepharose 4 Fast Flow to bind the hydrophobic sporefraction. The resin is Generation of a Spore Preparation from Alcohol washed with 4MNaCl to remove less hydrophobic compo Treatment of Fecal Material 45 nents, and the spores are eluted with distilled water, and the desired enriched spore fraction is collected via UV absor A 10% w/v suspension of human fecal material in PBS was bance. mixed with absolute ethanol in a 1:1 ratio and vortexed to mix for 1 minute. The suspension was incubated at 37 degrees Example 7 Celsius for 1 hour. After incubation the suspension is centri 50 fuged at 13,000 rpm for 5 minutes to concentrate spores into Spore Purification by Filtration of Fecal Material a pellet containing a purified sprore-containing preparation. The Supernatant was discarded and the pellet resuspended in A spore-enriched population Such as obtained from an equal volume of PBS. Glycerol was added to a final con Examples 1-6 above is diluted 1:10 with PBS, and placed in centration of 15% and then the purified spore preparation was 55 the reservoir vessel of a tangential flow microfiltration sys stored at -80 degrees Celsius. tem. A 0.2 um pore size mixed cellulose ester hydrophilic tangential flow filter is connected to the reservoir such as by Example 3 a tubing loop. The diluted spore preparation is recirculated through the loop by pumping, and the pressure gradient Spore Purification from Thermal Treatment of Fecal 60 across the walls of the microfilter forces the supernatant liq Material uid through the filter pores. By appropriate selection of the filter pore size the desired bacterial spores are retained, while A 10% w/v suspension of human fecal material in PBS was Smaller contaminants such as cellular debris, and other con incubated in a water bath at 80 degrees Celsius for 30 minutes. taminants in feces such as bacteriophage pass through the Glycerol was added to a final concentration of 15% and then 65 filter. Fresh PBS buffer is added to the reservoir periodically the enriched spore containing material was stored at -80 to enhance the washout of the contaminants. At the end of the degrees Celsius. diafiltration, the spores are concentrated approximately ten US 9,011,834 B1 49 50 fold to the original concentration. The purified spores are Carlsbad, Calif.) to 18l (Primers adapted from: Wroblewski, collected from the reservoir and stored as provided herein. D. et al. Rapid Molecular Characterization of Clostridium difficile and Assessment of Populations of C. difficile in Stool Example 8 Specimens. Journal of Clinical Microbiology 47:2142-2148 (2009)). This reaction mixture is aliquoted to wells of a Characterization of Purified Spore Populations MicroAmp(R) Fast Optical 96-well Reaction Plate with Bar code (0.1 mL) (Life Technologies, Grand Island, N.Y.). To Counts of viable spores are determined by performing 10 this reaction mixture, 2 ul of extracted genomic DNA is fold serial dilutions in PBS and plating to Brucella Blood added. The qPCR is performed on a BioRad C1000TM Ther Agar Petri plates or applicable solid media. Plates are incu 10 mal Cycler equipped with a CFX96TM Real-Time System bated at 37 degrees Celsius for 2 days. Colonies are counted (BioRad, Hercules, Calif.). The thermocycling conditions are from a dilution plate with 50-400 colonies and used to back calculate the number of viable spores in the population. The 95° C. for 2 minutes followed by 45 cycles of 95°C. for 3 ability to germinate into vegetative bacteria is also demon seconds, 60° C. for 30 seconds, and fluorescent readings of strated. Visual counts are determined by phase contrast 15 the FAM and ROX channels. Other bacterial pathogens can be microscopy. A spore preparation is either diluted in PBS or detected by using primers and a probe specific for the patho concentrated by centrifugation, and a 5 microliter aliquot is gen of interest. placed into a Petroff Hauser counting chamber for visualiza Data Analysis. tion at 400x magnification. Spores are counted within ten 0.05mmx0.05 mm grids and an average spore count per grid The Cd value for each well on the FAM channel is deter is determined and used to calculate a spore count per ml of mined by the CFX ManagerTM Software Version 2.1. The log preparation. Lipopolysaccharide (LPS) reduction in purified 10 (cfu/ml) of each experimental sample is calculated by spore populations is measured using a Limulus amebocyte inputting a given sample's Cd value into linear regression lysate (LAL) assay Such as the commercially available Tox model generated from the standard curve comparing the Cd inSensorTM Chromogenic LAL Endotoxin Assay Kit (Gen 25 values of the standard curve wells to the known log 10 (cfu/ Script, Piscataway, N.J.) or other standard methods known to ml) of those samples. those skilled in the art. Viral pathogens present in a purified spore population are determined by qPCR as described herein and otherwise Example 9 known in the art. 30 Determination of Bacterial Pathogens in Purified Spore Populations Example 10 Bacterial pathogens present in a purified spore population Species Identification are determined by qPCR using specific oligonucleotide prim 35 ers as follows. Standard Curve Preparation. The standard curve is gener The identity of the spore-forming species which grew up ated from wells containing the pathogen of interestata known from a complex fraction can be determined in multiple ways. concentration or simultaneously quantified by selective spot First, individual colonies can be picked into liquid media in a plating. Serial dilutions of duplicate cultures are performed in 40 96 well format, grown up and saved as 15% glycerol stocks at sterile phosphate-buffered saline. Genomic DNA is then -80 C. Aliquots of the cultures can be placed into cell lysis extracted from the standard curve samples along with the buffer and colony PCR methods can be used to amplify and other samples. sequence the 16S rDNA gene (Example 2). Alternatively, Genomic DNA Extraction. colonies may be streaked to purity in several passages on Solid Genomic DNA may be extracted from 100 ul of fecal 45 media. Well separated colonies are streaked onto the fresh samples, fecal-derived samples, or purified spore prepara plates of the same kind and incubated for 48-72 hours at 37 C. tions using the Mo Bio Powersoil(R)-htp 96 Well Soil DNA The process is repeated multiple times in order to ensure Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.) accord purity. Pure cultures can be analyzed by phenotypic- or ing to the manufacturers instructions with two exceptions: sequence-based methods, including 16S rDNA amplification the beadbeating is performed for 2x4:40 minutes using a 50 BioSpec Mini-Beadbeater-96 (BioSpec Products, Bartles and sequencing as described in Examples 11 & 12. Sequence ville, Okla.) and the DNA is eluted in 50 ul of Solution C6. characterization of pure isolates or mixed communities e.g. Alternatively the genomic DNA could be isolated using the plate scrapes and spore fractions can also include whole Mo Bio Powersoil.R DNA. Isolation Kit (Mo Bio Laborato genome shotgun sequencing. The latter is valuable to deter ries, Carlsbad, Calif.), the Sigma-Aldrich Extract-N- 55 mine the presence of genes associated with sporulation, anti AmpTMPlant PCR Kit, the QIAamp DNA Stool Mini Kit biotic resistance, pathogenicity, and virulence. Colonies can (QIAGEN, Valencia, Calif.) according to the manufacturers also be scraped from plates en masse and sequenced using a instructions. massively parallel sequencing method as described in qPCR Composition and Conditions. Examples 11 & 12 such that individual 16S signatures can be The qPCR reaction to detect C. difficile contains 1x Hot 60 identified in a complex mixture. Optionally, the sample can be MasterMix (5PRIME, Gaithersburg, Md.), 900 nM of Wr sequenced prior to germination (if appropriate DNA isolation tCdB-F (AGCAGTTGAATATAGTGGTTTAGTTA procedures are used to lyse and release the DNA from spores) GAGTTG, IDT, Coralville, Iowa), 900 nM of Wr-tcdB-R in order to compare the diversity of germinable species with (CATGCTTTTTTAGTTTCTGGATTGAA, IDT, Coralville, the total number of species in a spore sample. As an alterna Iowa), 250 nM of We-tcdB-P (6FAM-CATCCAGTCT 65 tive or complementary approach to 16S analysis, MALDI CAATTGTATATGTTTCTCCA-MGB, Life Technologies, TOF-mass spec can also be used for species identification (as Grand Island, N.Y.), and PCR Water (Mo Bio Laboratories, reviewed in Anaerobe 22:123). US 9,011,834 B1 51 52 Example 11 HotMasterMix (5PRIME, Gaithersburg, Md.), 250 nM of 27f (AGRGTTTGATCMTGGCTCAG, IDT, Coralville, Iowa), 16S Sequencing to Determine Operational and 250 nM of 1492r (TACGGYTACCTTGTTAYGACTT, Taxonomic Unit (OTU) IDT, Coralville, Iowa), with PCR Water (Mo Bio Laborato ries, Carlsbad, Calif.) for the balance of the volume. Alterna Method for Determining 16S Sequence tively, other universal bacterial primers orthermostable poly OTUs may be defined either by full 16S sequencing of the merases known to those skilled in the art are used. For rRNA gene, by sequencing of a specific hyperVariable region example primers are available to those skilled in the art for the of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or V9), or sequencing of the “V1-V9 regions” of the 16S rRNA (FIG. by sequencing of any combination of hyperVariable regions 10 from this gene (e.g. V1-3 or V3-5). The bacterial 16S rDNA is 1A). These regions refer to the first through ninth hypervari approximately 1500 nucleotides in length and is used in able regions of the 16S rRNA gene that are used for genetic reconstructing the evolutionary relationships and sequence typing of bacterial samples. These regions in bacteria are similarity of one bacterial isolate to another using phyloge defined by nucleotides 69-99, 137-242, 433-497, 576-682, netic approaches. 16S sequences are used for phylogenetic 15 822-879,986-1043, 1117-1173, 1243-1294 and 1435-1465 reconstruction as they are in general highly conserved, but respectively using numbering based on the E. coli system of contain specific hyperVariable regions that harbor Sufficient nomenclature. Brosius et al., Complete nucleotide sequence nucleotide diversity to differentiate genera and species of of a 16S ribosomal RNA gene from Escherichia coli, PNAS most microbes. 75(10):4801-4805 (1978). In some embodiments, at least one Using well known techniques, in order to determine the full of the V1,V2, V3, V4, V5, V6, V7, V8, and V9 regions are 16S sequence or the sequence of any hyperVariable region of used to characterize an OTU. In one embodiment, the V1,V2, the 16S sequence, genomic DNA is extracted from a bacterial and V3 regions are used to characterize an OTU. In another sample, the 16S rDNA (full region or specific hypervariable embodiment, the V3, V4, and V5 regions are used to charac regions) amplified using polymerase chain reaction (PCR). terize an OTU. In another embodiment, the V4 region is used the PCR products cleaned, and nucleotide sequences delin 25 to characterize an OTU. A person of ordinary skill in the art eated to determine the genetic composition of 16S gene or can identify the specific hyperVariable regions of a candidate Subdomain of the gene. If full 16S sequencing is performed, 16S rRNA (in FIG. 1A) by comparing the candidate sequence the sequencing method used may be, but is not limited to, in question to the reference sequence (FIG. 1B) and identify Sanger sequencing. If one or more hyperVariable regions are ing the hyperVariable regions based on similarity to the ref used. Such as the V4 region, the sequencing may be, but is not 30 erence hyperVariable regions. limited to being, performed using the Sanger method or using a next-generation sequencing method, such as an Illumina The PCR is performed on commercially available ther (sequencing by synthesis) method using barcoded primers mocyclers such as a BioRad MyCyclerTM Thermal Cycler allowing for multiplex reactions. (BioRad, Hercules, Calif.). The reactions are run at 94°C. for In addition to the 16S rRNA gene, one may define an OTU 35 2 minutes followed by 30 cycles of 94° C. for 30 seconds, 51° by sequencing a selected set of genes that are known to be C. for 30 seconds, and 68° C. for 1 minute 30 seconds, marker genes for a given species or taxonomic group of followed by a 7 minute extension at 72° C. and an indefinite OTUS. These genes may alternatively be assayed using a hold at 4°C. Following PCR, gel electrophoresis of a portion PCR-based screening strategy. As example, various strains of of the reaction products is used to confirm Successful ampli pathogenic Escherichia coli can be distinguished using 40 fication of a ~ 1.5 kb product. DNAs from the genes that encode heat-labile (LTI, LTIIa, and To remove nucleotides and oligonucleotides from the PCR LTIIb) and heat-stable (STI and STII) toxins, verotoxin types products, 2 ul of HT ExoSap-IT (Affymetrix, Santa Clara, 1, 2, and 2e (VT1, VT2, and VT2e, respectively), cytotoxic Calif.) is added to 5 ul of PCR product followed by a 15 necrotizing factors (CNF 1 and CNF2), attaching and effacing minute incubation at 37° C. and then a 15 minute inactivation mechanisms (eaeA), enteroaggregative mechanisms (Eagg), 45 at 80° C. and enteroinvasive mechanisms (Einv). The optimal genes to Amplification of 16S Sequences for Downstream Charac utilize for taxonomic assignment of OTUs by use of marker terization by Massively Parallel Sequencing Technologies genes will be familiar to one with ordinary skill of the art of Amplification performed for downstream sequencing by sequence based taxonomic identification. short read technologies such as Illumina require amplification Genomic DNA Extraction 50 using primers known to those skilled in the art that addition Genomic DNA is extracted from pure microbial cultures ally include a sequence-based barcoded tag. As example, to using a hot alkaline lysis method. 1 Jul of microbial culture is amplify the 16s hypervariable region V4 region of bacterial added to 9 ul of Lysis Buffer (25 mMNaOH, 0.2 mM EDTA) 16S rDNA, 2 ul of extracted gldNA is added to a 20 ul final and the mixture is incubated at 95°C. for 30 minutes. Sub Volume PCR reaction. The PCR reaction also contains 1 x sequently, the samples are cooled to 4°C. and neutralized by 55 HotMasterMix (5PRIME, Gaithersburg, Md.), 200 nM of the addition of 10 ul of Neutralization Buffer (40 mM Tris V4 515f adapt (AATGATACGGCGACCACCGAGATC HCl) and then diluted 10-fold in Elution Buffer (10 mM TACACTATGGTAATTGTGTGCCAGCMGCC GCGG Tris-HCl). Alternatively, genomic DNA is extracted from TAA, IDT, Coralville, Iowa), and 200 nM of barcoded 806rbc pure microbial cultures using commercially available kits (CAAGCAGAAGACGGCATACGAGAT 12bpGolayBar such as the Mo Bio Ultraclean R. Microbial DNA Isolation Kit 60 code AGTCAGTCAGCCGG ACTACH (Mo Bio Laboratories, Carlsbad, Calif.) or by standard meth VGGGTWTCTAAT, IDT, Coralville, Iowa), with PCR Water ods known to those skilled in the art. (Mo Bio Laboratories, Carlsbad, Calif.) for the balance of the Amplification of 16S Sequences for Downstream Sanger volume. These primers incorporate barcoded adapters for Sequencing Illumina sequencing by synthesis. Optionally, identical rep To amplify bacterial 16S rDNA (FIG. 1A), 2 ulofextracted 65 licate, triplicate, or quadruplicate reactions may be per gDNA is added to a 20 ul final volume PCR reaction. For formed. Alternatively other universal bacterial primers or full-length 16 sequencing the PCR reaction also contains 1 x thermostable polymerases known to those skilled in the art US 9,011,834 B1 53 54 are used to obtain different amplification and sequencing to the Human Microbiome Project, NCBI non-redundant error rates as well as results on alternative sequencing tech database, Greengenes, RDP and Silva. Phylogenetic methods nologies. can be used in combination with sequence similarity methods The PCR amplification is performed on commercially to improve the calling accuracy of an annotation or taxonomic available thermocyclers such as a BioRad MyCyclerTM Ther- 5 assignment. Here tree topologies and nodal structure are used mal Cycler (BioRad, Hercules, Calif.). The reactions are run to refine the resolution of the analysis. In this approach we at 94° C. for 3 minutes followed by 25 cycles of 94° C. for 45 analyze nucleic acid sequences using one of numerous seconds, 50° C. for 1 minute, and 72° C. for 1 minute 30 sequence similarity approaches and leverage phylogenetic seconds, followed by a 10 minute extension at 72° C. and a methods that are well knownto those skilled in theart, includ indefinite hold at 4°C. Following PCR, gel electrophoresis of 10 ing but not limited to maximum likelihood phylogenetic a portion of the reaction products is used to confirm Success reconstruction (see e.g. Liu K, Linder C R. and Warnow T. ful amplification of a ~1.5 kb product. PCR cleanup is per 2011. RAXML and FastTree: Comparing Two Methods for formed as specified in the previous example. Large-Scale Maximum Likelihood Phylogeny Estimation. Sanger Sequencing of Target Amplicons from Pure Homo PLoS ONE 6: e27731. McGuire G, Denham MC, and Bald geneous Samples 15 ing D J. 2001. Models of sequence evolution for DNA To detect nucleic acids for each sample, two sequencing sequences containing gaps. Mol. Biol. Evol 18: 481-490. reactions are performed to generate a forward and reverse Wróbel B. 2008. Statistical measures of uncertainty for sequencing read. For full-length 16S sequencing primers 27f branches in phylogenetic trees inferred from molecular and 1492r are used. 40ng of ExoSap-IT-cleaned PCR prod sequences by using model-based methods. J. Appl. Genet. 49: ucts are mixed with 25 pmol of sequencing primer and Mo 20 49-67.) Sequence reads are placed into a reference phylogeny Bio Molecular Biology Grade Water (Mo Bio Laboratories, comprised of appropriate reference sequences. Annotations Carlsbad, Calif.) to 15 ul total volume. This reaction is sub are made based on the placement of the read in the phyloge mitted to a commercial sequencing organization Such as netic tree. The certainty or significance of the OTU annotation Genewiz (South Plainfield, N.J.) for Sanger sequencing. is defined based on the OTU’s sequence similarity to a refer Massively Parallel Sequencing of Target Amplicons from 25 ence nucleic acid sequence and the proximity of the OTU Heterogeneous Samples sequence relative to one or more reference sequences in the DNA Quantification & Library Construction. The cleaned phylogeny. As an example, the specificity of a taxonomic PCR amplification products are quantified using the Quant assignment is defined with confidence at the the level of iTTM PicoGreen(R) dsDNA Assay Kit (Life Technologies, Family, Genus, Species, or Strain with the confidence deter Grand Island, N.Y.) according to the manufacturers instruc- 30 mined based on the position of bootstrap Supported branches tions. Following quantification, the barcoded cleaned PCR in the reference phylogenetic tree relative to the placement of products are combined such that each distinct PCR product is the OTU sequence being interrogated. at an equimolar ratio to create a prepared Illumina library. Clade Assignments Nucleic Acid Detection. The prepared library is sequenced The ability of 16S-V4 OTU identification to assignan OTU on Illumina HiSeq or MiSeq sequencers (Illumina, San 35 as a specific species depends in part on the resolving power of Diego, Calif.) with cluster generation, template hybridiza the 16S-V4 region of the 16S gene for a particular species or tion, iso-thermal amplification, linearization, blocking and group of species. Both the density of available reference 16S denaturization and hybridization of the sequencing primers sequences for different regions of the tree as well as the performed according to the manufacturers instructions. inherent variability in the 16S gene between different species 16SV4SeqFw (TATGGTAATTGTGTGCCAGCMGC- 40 will determine the definitiveness of a taxonomic annotation. CGCGGTAA), 16SV4SeqRev (AGTCAGTCAGCCGGAC Given the topological nature of a phylogenetic tree and the TACHVGGGTWTCTAAT), and 16SV4Index (ATTA fact that tree represents hierarchical relationships of OTUs to GAWACCCBDGTAGTCCGGCTGACTGACT) (IDT, one another based on their sequence similarity and an under Coralville, Iowa) are used for sequencing. Other sequencing lying evolutionary model, taxonomic annotations of a read technologies can be used such as but not limited to 454, 45 can be rolled up to a higher level using a clade-based assign Pacific Biosciences, Helicos, Ion Torrent, and Nanopore ment procedure (Table 1). Using this approach, clades are using protocols that are standard to someone skilled in the art defined based on the topology of a phylogenetic tree that is of genomic sequencing. constructed from full-length 16S sequences using maximum likelihood or other phylogenetic models familiar to individu Example 12 50 als with ordinary skill in the art of phylogenetics. Clades are constructed to ensure that all OTUs in a given clade are: (i) Sequence Read Annotation within a specified number of bootstrap supported nodes from one another (generally, 1-5 bootstraps), and (ii) within a 5% Primary Read Annotation genetic similarity. OTUs that are within the same clade can be Nucleic acid sequences are analyzed and annotations are to 55 distinguished as genetically and phylogenetically distinct define taxonomic assignments using sequence similarity and from OTUs in a different clade based on 16S-V4 sequence phylogenetic placement methods or a combination of the two data. OTUs falling within the same clade are evolutionarily strategies. A similar approach can be used to annotate protein closely related and may or may not be distinguishable from names, transcription factor names, and any other classifica one another using 16S-V4 sequence data. The power of clade tion schema for nucleic acid sequences. Sequence similarity 60 based analysis is that members of the same clade, due to their based methods include those familiar to individuals skilled in evolutionary relatedness, are likely to play similar functional the art including, but not limited to BLAST, BLASTx, roles in a microbial ecology Such as that found in the human tEBLASTn, tBLASTX, RDP-classifier, DNAclust, and various gut. Compositions Substituting one species with another from implementations of these algorithms such as Qilime or the same clade are likely to have conserved ecological func Mothur. These methods rely on mapping a sequence read to a 65 tion and therefore are useful in the present invention. reference database and selecting the match with the best score Notably, 16S sequences of isolates of a given OTU are and e-value. Common databases include, but are not limited phylogenetically placed within their respective clades, some US 9,011,834 B1 55 56 times in conflict with the microbiological-based assignment ethanol precipitation as described previously (Miller & Hosk of species and genus that may have preceded 16S-based ins, 1981). This medium is referred herein as mucin medium. assignment. Discrepancies between taxonomic assignment Fetal Bovine Serum (Gibco) can be used as a germinant based on microbiological characteristics versus genetic and contains 5% FBS heat inactivated, in Phosphate Buffered sequencing are known to exist from the literature. Saline (PBS, Fisher Scientific) containing 0.137M Sodium Chloride, 0.0027M Potassium Chloride, 0.01 19M Phosphate Example 13 Buffer. Thioglycolate is a germinant as described previously (Kamiya et al Journal of Medical Microbiology 1989) and Germinating Spores contains 0.25M (pH10) sodium thioglycollate. Dodecy 10 lamine solution containing 1 mM dodecylamine in PBS is a Germinating a spore fraction increases the number of germinant. A Sugar Solution can be used as a germinant and viable spores that will grow on various media types. To ger contains 0.2% fructose, 0.2% glucose, and 0.2% mannitol. minate a population of spores, the sample is moved to the Amino acid solution can also be used as a germinant and anaerobic chamber, resuspended in prereduced PBS, mixed contains 5 mMalanine, 1 mMarginine, 1 mM histidine, 1 mM and incubated for 1 hour at 37 C to allow for germination. 15 lysine, 1 mM proline, 1 mMasparagine, 1 mMaspartic acid, Germinants can include amino-acids (e.g., alanine, glycine), 1 mM phenylalanine. A germinant mixture referred to herein Sugars (e.g., fructose), nucleosides (e.g., inosine), bile salts as Germix 3 can be a germinant and contains 5 mMalanine, (e.g., cholate and taurocholate), metal cations (e.g., Mg2+, 1 mMarginine, 1 mM histidine, 1 mM lysine, 1 mM proline, Ca2+), fatty acids, and long-chain alkyl amines (e.g., dode 1 mMasparagine, 1 mMaspartic acid, 1 mM phenylalanine, cylamine, Germination of bacterial spores with alkyl primary 0.2% taurocholate, 0.2% fructose, 0.2% mannitol, 0.2% glu amines' J. Bacteriology, 1961.). Mixtures of these or more cose, 1 mMinosine, 2.5 mM Ca-DPA, and 5 mMKC1. BHIS complex natural mixtures, such as rumen fluid or Oxgal, can medium--DPA is a germinant mixture and contains BHIS be used to induce germination. Oxgal is dehydrated bovine medium and 2 mM Ca-DPA. Escherichia coli spent medium bile composed of fatty acids, bile acids, inorganic salts, Sul Supernatant referred to herein as EcSN is a germinant and is fates, bile pigments, cholesterol, mucin, lecithin, glycuronic 25 prepared by growing E. coli MG 1655 in SweetB/Fos inulin acids, porphyrins, and urea. The germination can also be medium anaerobically for 48 hr, spinning down cells at performed in a growth medium like prereduced BHIS/oxgalI 20,000 rcf for 20 minutes, collecting the supernatant and germination medium, in which BHIS (Brain heart infusion heating to 60 C for 40 min. Finally, the solution is filter powder (37 g/L), yeast extract (5 g/L), L-cysteine HCl (1 sterilized and used as a germinant solution. g/L)) provides peptides, amino acids, inorganic ions and Sug 30 ars in the complex BHI and yeast extract mixtures and OxgalI Example 14 provides additional bile acid germinants. In addition, pressure may be used to germinate spores. The Selection of Media for Growth selection of germinants can vary with the microbe being sought. Different species require different germinants and 35 It is important to select appropriate media to Support different isolates of the same species can require different growth, including preferred carbon sources. For example, germinants for optimal germination. Finally, it is important to Some organisms prefer complex Sugars such as cellobiose dilute the mixture prior to plating because Some germinants over simple Sugars. Examples of media used in the isolation are inhibitory to growth of the vegetative-state microorgan of sporulating organisms include EYA, BHI, BHIS, and isms. For instance, it has been shown that alkyl amines must 40 GAM (see below for complete names and references). Mul be neutralized with anionic lipophiles in order to promote tiple dilutions are plated out to ensure that some plates will optimal growth. Bile acids can also inhibit growth of some have well isolated colonies on them for analysis, or alterna organisms despite promoting their germination, and must be tively plates with dense colonies may scraped and Suspended diluted away prior to plating for viable cells. in PBS to generate a mixed diverse community. For example, BHIS/oxgal Solution is used as a germinant 45 Plates are incubated anaerobically or aerobically at 37 C and contains 0.5xBHIS medium with 0.25% oxgalI (dehy for 48-72 or more hours, targeting anaerobic or aerobic spore drated bovine bile) where 1xEHIS medium contains the fol formers, respectively. lowing per L of solution: 6 g Brain Heart Infusion from solids, Solid Plate Media Include: 7g peptic digest of animal tissue, 14.5 g of pancreatic digest Gifu Anaerobic Medium (GAM, Nissui) without dextrose of casein, 5 g of yeast extract, 5 g sodium chloride, 2 g 50 Supplemented with fructooligosaccharides/inulin glucose, 2.5g disodium phosphate, and 1 g cysteine. Addi (0.4%), mannitol (0.4%), inulin (0.4%), or fructose tionally, Ca-DPA is a germinant and contains 40 mM CaCl2, (0.4%), or a combination thereof. and 40 mM dipicolinic acid (DPA). Rumen fluid (Bar Dia Sweet GAM Gifu Anaerobic Medium (GAM, Nissui) mond, Inc.) is also a germinant. Simulated gastric fluid (Ricca modified, Supplemented with glucose, cellobiose, mal Chemical) is a germinant and is 0.2% (w/v) Sodium Chloride 55 tose, L-arabinose, fructose, fructooligosaccharides/inu in 0.7% (v/v) Hydrochloric Acid. Mucin medium is a germi lin, mannitol and Sodium lactate) nant and prepared by adding the following items to 1 L of Brucella Blood Agar (BBA, Atlas, Handbook of Microbio distilled sterile water: 0.4 g KHPO, 0.53 g Na HPO, 0.3g logical Media, 4th ed, ASM Press, 2010) NHCl, 0.3 g NaCl, 0.1 g MgClx6H2O, 0.11g CaCl, 1 ml PEA sheep blood (Anaerobe Systems; 5% Sheep Blood alkaline trace element Solution, 1 ml acid trace element Solu 60 Agar with Phenylethyl Alcohol) tion, 1 ml vitamin solution, 0.5 mg resaZurin, 4 g NaHCO Egg Yolk Agar (EYA) (Atlas, Handbook of Microbiologi 0.25 g NaSx9H2O. The trace element and vitamin solutions cal Media, 4th ed, ASM Press, 2010) prepared as described previously (Stams et al., 1993). All Sulfite polymyxin milk agar (Mevissen-Verhage et al., J. compounds were autoclaved, except the Vitamins, which Clin. Microbiol. 25:285-289 (1987)) were filter-sterilized. The basal medium was supplemented 65 Mucinagar (Derrien et al., IJSEM 54: 1469-1476 (2004)) with 0.7% (v/v) clarified, sterile rumen fluid and 0.25% (v/v) Polygalacturonate agar (Jensen & Canale-Parola, Appl. commercial hog gastric mucin (Type III: Sigma), purified by Environ. Microbiol. 52:880-997 (1986)) US 9,011,834 B1 57 58 M2GSC (Atlas, Handbook of Microbiological Media, 4th fraction is then run on a Sucrose step gradient with steps of ed, ASM Press, 2010) 67%, 50%, 40%, and 30% (w/v). When centrifuged in a M2 agar (Atlas, Handbook of Microbiological Media, 4th swinging bucket rotor for 10 min at 3200 rcf. The spores run ed, ASM Press, 2010) supplemented with starch (1%), roughly in the 30% and 40% sucrose fractions. The lower mannitol (0.4%), lactate (1.5 g/L) or lactose (0.4%) 5 spore fraction (FIG. 2) is then removed and washed to pro Sweet B. Brain Heart Infusion agar (Atlas, Handbook of duce a concentrated ethanol treated, gradient-purified spore Microbiological Media, 4th ed, ASM Press, 2010) preparation. Taking advantage of the refractive properties of supplemented with yeast extract (0.5%), hemin, cysteine spores observed by phase contrast microscopy (spores are (0.1%), maltose (0.1%), cellobiose (0.1%), soluble bright and refractive while germinated spores and vegetative starch (sigma, 1%), MOPS (50 mM, pH 7). 10 cells are dark) one can see an enrichment of the sporefraction PY-Salicin (peptone-yeast extract agar Supplemented with from a fecal bacterial cell suspension (FIG. 3, left) compared salicin) (Atlas, Handbook of Microbiological Media, to an ethanol treated, CsCl gradient purified, spore prepara 4th ed, ASM Press, 2010). tion (FIG. 3, center), and to an ethanol treated, CsCl gradient Modified Brain Heart Infusion (M-BHI) sweet and sour purified, Sucrose gradient purified, spore preparation (FIG.3, contains the following per L: 37.5g Brain Heart Infusion 15 powder (Remel), 5 gyeast extract, 2.2g meat extract, 1.2 right). g liver extract, 1 g cystein HCl, 0.3 g Sodium thioglyco Furthermore, growth of spores after treatment with a ger late, 10 mg hemin, 2 g soluble starch, 2 gFOS/Inulin, 1 minant can also be used to quantify a viable spore population. g cellobiose, 1 g L-arabinose, 1 g mannitol. 1 Na-lactate, Briefly, samples were incubated with a germinant (OXgalI. 1 mL Tween 80, 0.6 g. MgSO4x7H2O, 0.6 g CaCl2, 6 g 0.25% for up to 1 hour), diluted and plated anaerobically on (NH4)2SO4, 3 g KH2PO4, 0.5 g K2HPO4, 33 mM BBA (Brucella Blood Agar) or similar media (e.g. see Acetic acid, 9 mM propionic acid, 1 mM Isobutyric acid, Examples 4 and 5). Individual colonies were picked and DNA 1 mM isovaleric acid, 15 gagar, and after autoclaving isolated for full-length 16S sequencing to identify the species add 50 mL of 8% NaHCO, solution and 50 mL 1M composition (e.g. see examples 2 and 3). Analysis revealed MOPS-KOH (pH 7). 25 that 22 species were observed in total (Table 2) with a vast Noack-Blaut Eubacterium agar (See Noack et al. J. Nutr. majority present in both the material purified with the gradi (1998) 128:1385-1391) ent and without the gradient, indicating no or inconsequential BHIS az1/ge2 BHIS az/ge agar (Reeves et. al. Infect. shift in the ecology as a result of gradient purification. Spore Immun. 80:3786-3794 (2012)) Brain Heart Infusion yield calculations demonstrate an efficient recovery of 38% agar (Atlas, Handbook of Microbiological Media, 4th 30 of the spores from the initial fecal material as measured by ed, ASM Press, 2010) supplemented with yeast extract germination and plating of spores on BBA or measuring DPA 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% maltose, aztreonam 1 mg/L, gentamycin 2 mg/L count in the sample. BHIS CIn Maz1/ge2 BHIS CInM Brain Heart Infusion Example 16 agar (Atlas, Handbook of Microbiological Media, 4th 35 ed, ASM Press, 2010) supplemented with yeast extract 0.5%, cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, Bacterial Compositions Prevent C. difficile Infection 0.1% maltose, aztreonam 1 mg/L, gentamycin 2 mg/L in a Mouse Model Example 15 40 To test the therapeutic potential of the bacterial composi tions a prophylactic mouse model of C. difficile infection The Purification and Isolation of a Spore Forming (model based on Chen, et al. A mouse model of Clostridium Fraction from Feces difficile associated disease, Gastroenterology 135(6):1984 1992) was used. Two cages of five mice each were tested for To purify and selectively isolate efficacious spores from 45 each arm of the experiment. All mice received an antibiotic fecal material a donation is first blended with Saline using a cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), homogenization device (e.g., laboratory blender) to produce a gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metron 20% slurry (w/v). 100% ethanol is added for an inactivation idazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampi treatment that lasts 10 seconds to 1 hour. The final alcohol cillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their concentration can range from 30-90%, preferably 50-70%. 50 drinking water on days -14 through -5 and a dose of 10 High speed centrifugation (3200 rcf for 10 min) is performed mg/kg. Clindamycin by oral gavage on day -3. On day -1, to remove solvent and the pellet is retained and washed. they received either the test article or vehicle control via oral Subsequently, once the washed pellet is resuspended, a low gavage. On day 0 they were challenged by administration of speed centrifugation step (200 rcf for 4 min) is performed to approximately 4.5 log 10 cfu of C. difficile (ATCC 43255) via remove large particulate vegetative matter and the Superna 55 oral gavage. Optionally a positive control group received tant containing the spores is retained. High speed centrifuga Vancomycin from day -1 through day 3 in addition to the tion (3200 rcf for 10 min) is performed on the supernatant to antibiotic protocol and C. difficile challenge specified above. concentrate the spore material. The pellet is then washed and Feces were collected from the cages for analysis of bacterial resuspended to generate a 20% slurry. This is the ethanol carriage, mortality was assessed every day from day 0 to day treated spore preparation. The concentrated slurry is then 60 6 and the weight and Subsequent weight change of the animal separated with a density based gradient e.g. a CsCl gradient, was assessed with weight loss being associated with C. diffi Sucrose gradient or combination of the two generating a etha cile infection. Mortality and reduced weight loss of the test nol treated, gradient-purified spore preparation. For example, article compared to the vehicle were used to assess the Suc a CsCl gradient is performed by loading a 20% volume of cess of the test article. Additionally, a C. difficile symptom spore suspension on top a 80% volume of a stepwise CsCl 65 scoring was performed each day from day -1 through day 6. gradient (w/v) containing the steps of 64%, 50%, 40% CsCl Clinical Score was based on a 0-4 Scale by combining scores (w/v) and centrifuging for 20 min at 3200 rcf. The spore for Appearance (0-2 pts based on normal, hunched, piloerec US 9,011,834 B1 59 60 tion, or lethargic), and Clinical Signs (0-2 points based on efficacy for the ethanol treated, gradient-purified spores fol normal, wet tail, cold-to-the-touch, or isolation from other lowed by the ethanol treated spores. Both treatments animals). improved Survival percentage over Vancomycin treatment In a naive control arm, animals were challenged with C. alone. difficile. In the Vancomycin positive control arm animals were See FIG. 5: Relapse prevention model with ethanol treated dosed with C. difficile and treated with Vancomycin from day spores and ethanol treated, gradient purified spores -1 through day 3. The negative control was gavaged with PBS alone and no bacteria. The test arms of the experiment tested Example 18 1x, 0.1x, 0.01 x dilutions derived from a single donor prepa ration of ethanol treated spores (e.g. see example 6) or the 10 Clinical Treatment of Recurrent C. difficile in heat treated feces prepared by treating a 20% slurry for 30 min Patients at 80 C. Dosing for CFU counts was determined from the final ethanol treated spores and dilutions of total spores were To assess the efficacy of a test article (e.g., ethanol treated administered at 1x, 0.1x, 0.01x of the spore mixture for the spore preparations, see Example 15) to treat recurrent C. ethanol treated fraction and a 1x dose for the heat treated 15 fraction. difficile in human patients, the following procedure was per Weight loss and mortality were assessed on day 3. The formed to take feces from a healthy donor, inactivate via the negative control, treated with C. difficile only, exhibits 20% ethanol treated spore preparation protocol described below, mortality and weight loss on Day 3, while the positive control and treat recurrent C. difficile in patients presenting with this of 10% human fecal Suspension displays no mortality or indication. Non-related donors were screened for general weight loss on Day 3 (Table 3). EtOH-treated feces prevents health history for absence of chronic medical conditions (in mortality and weight loss at three dilutions, while the heat cluding inflammatory bowel disease; irritable bowel syn treated fraction was protective at the only dose tested. These drome; Celiac disease; or any history of gastrointestinal data indicate that the spore fraction is efficacious in prevent malignancy or polyposis), absence of risk factors for trans ing C. difficile infection in the mouse. 25 missible infections, antibiotic non-use in the previous 6 months, and negative results in laboratory assays for blood Example 17 borne pathogens (HIV, HTLV. HCV. HBV. CMV, HAV and Treponema pallidum) and fecal bacterial pathogens (Salmo The Prophylactic and Relapse Prevention Hamster nella, Shigella, Yersinia, Campylobacter, E. coli 0157), ova Models 30 and parasites, and other infectious agents (Giardia, Cryptosporidium Cyclospora, Isospora) prior to stool dona Previous studies with hamsters using toxigenic and non tion. toxigenic strains of C. difficile demonstrated the utility of the Donor stool was frozen shortly after donation and sampled hamster model in examining relapse post antibiotic treatment for testing. At the time of use, approximately 75 g of donor and the effects of prophylaxis treatments with cecal flora in C. 35 stool was thawed and resuspended in 500 mL of non-bacte difficile infection (Wilson et al. 1981, Wilson et al. 1983, riostatic normal saline and mixed in a single use glass or Borriello et al. 1985) and more broadly gastrointestinal infec plastic blender. The resulting slurry was sequentially passed tious disease. To demonstrate prophylactic use of a testarticle through sterile, disposable mesh screens that remove particles to ameliorate C. difficile infection, the following hamster of size 600, 300 and 200 microns. The slurry was then cen model is used. In a prophylactic model, Clindamycin (10 40 trifuged briefly (200 rcf for 4 min) to separate fibrous and mg/kg, s.c.) is given on day -5, the test article or control is particulate materials, and the Supernatant (containing bacte administered on day -3, and C. difficile challenge occurs on rial cells and spores) was transferred to a fresh container. day 0. In the positive control arm, Vancomycin is then admin Ethanol was added to a final concentration of 50% and the istered on day 1-5 (and vehicle control is delivered on day -3). resulting ~1500 ml slurry was incubated at room temperature Feces are collected on day -5,-4, -1, 1, 3, 5, 7, 9 and fecal 45 for 1 hr with continuous mixing to inactivate vegetative bac samples are assessed for pathogen carriage and reduction by terial cells. Midway through inactivation the slurry was trans microbiological methods, 16S sequencing approaches or ferred to a new bottle to ensure complete contact with the other methods utilized by one skilled in the art. Mortality is ethanol. The solid matter was pelleted in a centrifuge and assessed throughout the experiment through 21 days post C. washed 3 times with normal saline to remove residual etha difficile challenge. The percentage Survival curves show that 50 nol. The final pellet was resuspended in 100% sterile, USP ethanol treated spores and ethanol treated, gradient-purified glycerol at a minimum Volume, and filled into approximately spores better protect the hamsters compared to the Vancomy 30 size 0 delayed release capsules (hypromellose DRcaps, cin control, and vehicle control. Capsugel, Inc.) at 0.65 mL Suspension each. The capsules See FIG. 4: Prophylaxis model with the ethanol treated were immediately capped and placed onto an aluminum spore preparation and the ethanol treated, gradient-purified 55 freezing block held at -80° C. via dry ice to freeze. The frozen spore preparation. capsules were in turn over-capsulated with size 00 DRcaps to In the relapse prevention model, hamsters are challenged enhance capsule stability, labeled, and placed into <-65 C. with toxigenic C. difficile strains on day 0, and treated with storage immediately. The final product was stored at <-65°C. clindamycin by oral gavage on day 1, and Vancomycin dosing until the day and time of use. Encapsulated product may be day 2-6. Test or control treatment was then administered on 60 stored for indefinitely at <-65° C. On the day of dosing day 7, 8, and 9. The groups of hamsters for each arm consist capsules were warmed on wet ice for 1 to 2 hours to improve of 8 hamsterspergroup. Fecal material is collected on day-1. tolerability, and were then dosed with water ad libitium. 1, 3, 5, 7, 10 and 13 and hamster mortality is assessed Patient 1 is a 45-year old woman with a history of C. throughout. Survival curves are used to assess the Success of difficile infection and diarrhea for at least 1 year prior to the testarticle e.g. ethanol treated or ethanol treated, gradient 65 treatment. She has been previously treated with multiple purified spores versus the control treatment in preventing courses of antibiotics followed each time by recurrence of C. hamster death. The Survival curves demonstrate maximum difficile-associated diarrhea. US 9,011,834 B1 61 62 Patient 2 is an 81-year old female who has experienced and 25 h have similar effects, reducing the number of viable recurrent C. difficile infection for 6 months prior to treatment cells by approximately 4 logs, while increasing temperature despite adequate antibiotic therapy following each recur and time at high temperature leads to higher losses in viable CC. cell number, with no colonies detectable at 100° C. at either 24 hours prior to starting oral treatment, CDAD antibiotic 10 min or 1 h. In this experiment no germinants were used. therapy was discontinued. Each patient received a colon After several days of additional growth on plates, a number of preparation procedure intended to reduce the competing colonies were picked from these treated samples and identi microbial burden in the gastrointestinal tract and to facilitate fied by 16S rDNA analysis (e.g. see Examples 11 and 12). repopulation by the spore forming organisms in the investi These included known spore forming Clostridium spp. as gational product. 10 well as species not previously reported to be spore formers On the morning of the first treatment day, the patients including Ruminococcus bromii, and Anaerotruncus coli received a dose of delayed release capsules containing the hominis (Lawson, et al 2004), and a Eubacterium sp. (Table investigational product with water ad libitum. Patients were 4). See FIG. 6: Heat and ethanol treatments reduce cell viabil requested to avoid food for 1 hourthereafter. The next day, the ity patient returned to the clinic to receive an additional dose. 15 To demonstrate that vegetative cells are greatly reduced by Patients were asked to avoid food for 4 hours prior to receiv ethanol treatment, known non-spore forming bacteria are ing their second dose and for 1 hour following dosing. ethanol treated as described previously (e.g. see Example 15) Both patients were followed closely for evidence of relapse and viability was determined by plating on BBA in anaerobic or adverse symptoms following treatment. Patients were con conditions (e.g. see Example 14). Fecal material from four tacted by phone on Day 2, Day 4, and Weeks 1, 2 and 4 and independent donors was exposed to 60 C for 5 min and each was queried about her general status and the condition of Subsequently plated on three types of selective media under her CDAD and related symptoms. Stool samples were col either aerobic (+O) or anaerobic conditions (-O.) (BBA+ lected at baseline and Weeks 1, 2, 4 and 8 post-treatment to aerobic, MacConkey lactose--aerobic, Bacteroides Bile escu assess changes in the gut microbiota via 16S sequencing and lin+anaerobic) to identify known nonsporeforming Entero spore count with methods explained previously (e.g. see 25 bacteria (Survivors on MacConkey agar) and Bacteroides Examples 11 and 12). Through 4 weeks post treatment, each fragilis group species (survivors on Bacteroides Bile Esculin patient has gradually improved with no evidence of C. difficile plates). The detectable limit for these assays was roughly 20 CUCC. cfu/mL. Germinants were not used in this experiment (FIG. Six other patients with recurrent C. difficile-associated 7). Both ethanol and heatinactivation greatly reduces the cell diarrhea were treated in a similar fashion, with no CDI recur 30 viability from fecal material to the limit of detection under rence and no requirement for resumption of antibiotics (total using MacConkey lactose agar and BBE agar. The remaining of 8 patients). Additionally, there were no treatment-related cells identified on BBA media grown in anaerobic conditions serious adverse events. comprise the non-germinant dependent spore forming spe cies. See FIG. 7: Reduction in non-spore forming vegetative Example 19 35 cells by treatment at 60° C. for 5 min Additionally, the ethanol treatment was shown to rapidly Treatment of Fecal Suspensions with Ethanol or kill both aerobic and non-spore forming anaerobic colony Heat Drastically Reduces Vegetative Cell Numbers forming units in 10% fecal Suspensions as determined by and Results in an Enrichment of Spore Forming plating on rich (BBA) media. The reduction of plated CFUs Species 40 decreases four orders of magnitude in seconds as shown in FIG 8. Treatment of a sample, preferably a human fecal sample, in See FIG. 8: Time course demonstrates ethanol reduces both a manner to inactivate or kill substantially all of the vegetative anaerobic and aerobic bacterial CFUs forms of bacteria present in the sample results in selection and enrichment of the sporefraction. Methods for inactivation can 45 Example 20 include heating, Sonication, detergent lysis, enzymatic diges tion (such as lysozyme and/or proteinase K), ethanol or acid Species Identified and Isolated as Spore Formers by treatment, exposure to solvents (Tetrahydrofuran, 1-butanol, Ethanol Treatment 2-butanol, 1.2 propanediol, 1.3 propanediol, butanoate, pro panoate, chloroform, dimethyl ether and a detergent like tri 50 To demonstrate that spore-forming species are enriched by ton X-100, diethyl ether), or a combination of these methods. heat or ethanol treatment methods, a comparison of >7000 To demonstrate the efficacy of ethanol induced inactivation of colony isolates was performed to identify species in a repeat vegetative cells, a 10% fecal suspension was mixed with able fashion (e.g., identified independently in multiple prepa absolute ethanol in a 1:1 ratio and vortexed to mix for 1 min. rations, see examples 1, 2, and 3) only isolated from fecal The suspension was incubated at room temperature for 30 55 suspensions treated with 50% ethanol or heat treatment and min, 1 h, 4 h or 24 h. After incubation the Suspension was not from untreated fecal suspensions (Table 5). These data centrifuged at 13,000 rpm for 5 min to pellet spores. The demonstrate the ability to select for spore forming species Supernatant is discarded and the pellet is resuspended inequal from fecal material, and identify organisms as spore formers Volume of PBS. Viable cells were measured as described not previously described as such in the literature. In each case, below. 60 organisms were picked as an isolated colony, grown anaero To demonstrate the efficacy of heat treatment on vegetative bically, and then Subjected to full-length 16S sequencing in cell inactivation a 10-20% fecal suspension was incubated at order to assign species identity. 70 C, 80 C, 90 C or 100 C for 10 min or 1 h. To further identify spore formers, ethanol treated fecal After ethanol or heat treatment, remaining viable cells samples from donors A, B, C, D, E and F were plated to a were measured after 24h incubation on plates by determining 65 variety of solid media types, single colonies were picked and the bacterial titer on Brucella blood agar (BBA) as a function grown up in broth in a 96 well format (Table 6-11). The 16S of treatment and time (See FIG. 6). Ethanol treatment for 1 h rRNA gene was then amplified by PCR and direct cycle US 9,011,834 B1 63 64 sequencing was performed (See examples 11 and 12). The ID described previously (see Examples 11 and 12). An assess is based on the forward read from direct cycle sequencing of ment of donor diversity could include the cfu/ml of ethanol the 16S rRNA gene. resistant cells on a given media type, or cfu/ml of a given There is Surprising heterogeneity in the microbiome from species using the 16S analysis of colonies picked from that one individual to another (Clemente et al., 2012) and this has media to determine the level of spores of a given species of consequences for determining the potential efficacy of vari interest. This type of culture-based analysis could be comple ous donors to generate useful spore compositions. The mented by culture-independent methods such as qPCR with method described below is useful for screening donors when, probes specific to species or genera of interest or metage for instance, a particular quantity or diversity of spore form nomic sequencing of spore preparations, or 16S profiling of ing organisms is useful or desired for repopulating the micro 10 spore preparations using Illumina 16S variable region biome following antibiotic treatment or treating a particular sequencing approaches (e.g. see Examples 11 and 12). disease or condition. Further, Such screening is useful when there is a need to screen donors for the purpose of isolating Example 21 microorganisms capable of spore formation, or when a puri fied preparation of spore forming organisms is desired from a 15 Quantification of Spore Concentrations. Using DPA particular donor. Assay Total spore count is also a measure of potency of a particu lar donation or purified spore preparation and is vital to deter Methods to assess spore concentration in complex mix mine the quantity of material required to achieve a desired tures typically require the separation and selection of spores dose level. To understand the variability in total spore counts, and Subsequent growth of individual species to determine the donor samples were collected and processed as described in colony forming units. The art does not teach how to quanti prior examples. Donor spore counts in CFU/g were then tatively germinate all the spores in a complex mixture as there determined by growth on media plates at various titrations to are many species for which appropriate germinants have not determine the spore content of the donation. Furthermore, been identified. Furthermore, sporulation is thought to be a DPA assays were used to assess spore content (expressed as 25 stochastic process as a result of evolutionary selection, mean spore equivalents) as described in Example 21. As seen in ing that not all spores from a single species germinate with FIG.9, there is as much as two logs difference in an individual same response to germinant concentration, time and other donor over time and can be up to three logs difference environmental conditions. Alternatively, a key metabolite of between donors. One possible reason for the difference in bacterial spores, dipicolinic acid (DPA) has been developed spore content measures is that nonviable spores and non 30 to quantify spores particles in a sample and avoid interference germinable spores will not be observed by plating but will from fecal contaminants. The assay utilizes the fact that DPA have measurable DPA content. Another possibility is the vari chelates Terbium3+ to form a luminescent complex (Fichte) ability between species of DPA content in spores making etal, FEMS Microbiology Ecology, 2007; Kort et al. Applied Some complex mixtures containing high DPA spores while and Environmental Microbiology, 2005; Shafaat and Ponce, other mixtures contain low DPA content spores. Selecting 35 Applied and Environmental Microbiology, 2006; Yang and donors with high spore counts is important in determining Ponce, International Journal of Food Microbiology, 2009: productivity of isolating spores from fecal donations by iden Hindle and Hall, Analyst, 1999). A time-resolved fluores tifying preferred donors. cence assay detects terbium luminescence in the presence of See FIG. 9: Donation Spore concentrations from clinical DPA giving a quantitative measurement of DPA concentra donors 40 tion in a solution. A fresh fecal sample from donor F was treated as described To perform the assay 1 mL of the spore standard to be in Example 15 to generate an ethanol treated spore fraction, measured was transferred to a 2 mL microcentrifuge tube. germinated with BHIS/OxgalI for 1 has a described (e.g. see The samples were centrifuged at 13000 RCF for 10 min and Example 13), then plated to a variety of media (e.g. See the sample is washed in 1 mL sterile deionized H2O. Wash an example 14). Colonies were picked with a focus on picking 45 additional time by repeating the centrifugation. Transfer the 1 several of each type of morphologically distinct colony on mL solution to hungate tubes and autoclave samples on a each plate to capture as much diversity as possible. Colonies steam cycle for 30 min at 250 C. Add 100 uL of 30 uMTbCl, are counted on a plate of each media type with well isolated solution (400 mM sodium acetate, pH 5.0, 30 uMTbCl) to colonies such that the number of colony forming units per ml the sample. Make serial dilutions of the autoclaved material can be calculated (Table 12). Colonies were picked into one of 50 and measure the fluorescence of each sample by exciting with several liquid media and the 16S rDNA sequences (e.g. see 275 nm light and measuring the emission wavelength of 543 Examples 11 and 12) were determined and analyzed as nm for an integration time of 1.25 ms and a 0.1 ms delay. described above. The number of unique OTUs for each media Purified spores are produced as described previously (e.g. type is shown below with the media with the most unique see http://www.epa.gov/pesticides/methods/MB-28-00.pdf). OTUs at the top (Table 12). Combinations of 3 to 5 of the top 55 Serial dilutions of purified spores from C. bifermentans, C. 5 media types capture diversity, and some other can be chosen sporogenes, and C. butyricum cultures were prepared and to target specific species of interest. Colony forming units can measured by plating on BBA media and incubating overnight be calculated for a given species using the 16S data, and could at 37 C to determine CFU/ml. FIG. 10 shows the linear be used to determine whether a sufficient level of a given correspondence across different spore producing bacteria organism is present. The spore complement from Donor F as 60 across several logs demonstrating the DPA assay as means to determined in this experiment includes these 52 species as assess spore content. determined by 16S sequencing (Table 12). See FIG.10: Linear range of DPA assay compared to CFU To screen human donors for the presence of a diversity of counts/ml spore forming bacteria and/or for specific spore-forming bac The discrepancy for complex spore populations between teria, fecal samples were prepared using germinants and 65 spore counts measured by germinable spore CFU and by DPA selective plating conditions and colonies were picked (e.g. has important implications for determining the potency of an see Examples 13 and 14) and analyzed for 16S diversity as ethanol treated spore preparation for clinical use. Table AC US 9,011,834 B1 65 66 shows spore content data from 3 different ethanol treated and 14) with samples derived from two independent donors spore preparations used to Successfully treat 3 patients Suf (FIG. 11). The spore-germinant mixture was serially diluted fering from recurrent C. difficile infection. The spore content and plated on different plate media including BBA, Sweet B, of each spore preparation is characterized using the two Sweet B+lysozyme (2 ug/ml), M2GSC and M2GSC+ described methods. lysozyme (2 ug/ml) as previously described (e.g. see Examples 13 and 14) to determine spore germination. Colony TABLE AC forming units were tallied and titers were determined using standard techniques by one skilled in the art. As FIG. 11 Spore quantitation for ethanol treated spore preparations shows, maximum colony forming units are derived from using Spore CFU (SCFU) assay and DPA assay 10 BHI-OXgalI treatment. This germination treatment also SCFU3O DPASEq/30 Ratio greatly increases the diversity as measured by the number of Preparation capsules capsules SCFUDPA OTUs identified when samples were submitted for 16S Preparation 1 4.0 x 105 6.8 x 107 5.9 x 10-3 sequencing (e.g. see Examples 11 and 12) compared to plat Preparation 2 2.1 x 107 9.2 x 108 O.O23 ing without a germination step (FIG. 12). As shown in FIG. Preparation 3 6.9 x 109 9.6 x 109 0.72 15 11: Different germinant treatments have variable effects on CFU counts from donor A (upper left) and donor B (lower right). The Y-Axes are spore CFU per ml. As shown in FIG. What is immediately apparent is that spore content varies 12: Germinates greatly increase the diversity of cultured greatly per 30 capsules. As measured by germinable SCFU, spore forming OTUs. spore content varies by greater than 10,000-fold. As measured To test the effect of heat activation to promote germination, by DPA, spore content varies by greater than 100-fold. In the ethanol treated fecal samples were treated for 15 minat room absence of the DPA assay, it would be difficult to set a mini temperature, 55 C, 65 C, 75 C or 85 C from three different mum dose for administration to a patient. For instance, with donors and germinated subsequently with BHIS+OxgalI for out data from the DPA assay, one would conclude that a 1 hr at 37C then plated on BBA media (FIG. 13) as previously minimum effective dose of spores is 4x10 or less using the 25 described (e.g. see Examples 13 and 14). Pretreatment at SCFU assay (e.g. Preparation 1, TableAC). If that SCFU dose room temperature produced equal if not more spores than the was used to normalize dosing in a clinical setting, however, elevated temperatures in all three donors. The temperature of then the actual spore doses given to patients would be much germinating was also examined by incubating samples at lower for other ethanol treated spore preparations as mea room temperature or 37 C for 1 hr in anaerobic conditions sured as by the DPA assay (Table AD). 30 before plating on BBA. No difference in the number of CFUs was observed between the two conditions. Lysozyme addi TABLEAD tion to the plates (2 ug/ml) was also tested on a single donor DPA doses in Table AC when normalized to sample by the testing of various activation temperature fol 4 x 10'SCFU per dose lowed by an incubation in the presence or absence of 35 lysozyme. The addition of lysozyme had a small effect when SCFU3O DPASEq/30 Fraction of Pre plated on Sweet B or M2GSC media but less so than treatment Preparation capsules capsules paration 1 Dose with BHIS oxgalI without lysozyme for 1 hr (FIG. 14). Preparation 1 4.0 x 105 6.8 x 107 1.O As shown in FIG. 13: Heat Activation as a germination Preparation 2 4.0 x 105 1.8 x 107 O.26 treatment with BHIS+oxgalI. As shown in FIG. 14: Effect of Preparation 3 4.0 x 105 5.6 x 105 O.OO82 40 lysozyme slightly enhances germination. Germination time was also tested by treating a 10% sus It becomes clear from the variability of SCFU and DPA pension of a single donor ethanol treated feces (e.g. see counts across various donations that using SCFU as the mea Example 15) incubated in either BHIS, taurocholate, oxgalI. Sure of potency would lead to significant underdosing in or germix for 0, 15, 30, or 60 minutes and subsequently plated certain cases. For instance, setting a dose specification of 45 on BHIS, EYA, or BBA media (e.g. see Examples 13 and 14). 4x10 SCFU (the apparent effective dose from donor Prepa 60 minutes resulted in the most CFU units across all various ration 1) for product Preparation 3 would lead to a potential combinations germinates and plate media tested. underdosing of more than 100-fold. This can be rectified only by setting potency specifications based on the DPA assay, Example 23 which better reflects total spore counts in an ethanol treated 50 spore preparation. The unexpected finding of this work is that Demonstrating Efficacy of Germinable and the DPA assay is uniquely Suited to set potency and determine Sporulatable Fractions of Ethanol Treated Spores dosing for an ethanol treated spore preparation. To define methods for characterization and purification, Example 22 55 and to improve (e.g., such as by modulating the diversity of the compositions) the active spore forming ecology derived Demonstration of Enhanced Growth with a from fecal donations, the ethanol treated spore population (as Germinant described in Example 15) was further fractionated. A 'ger minable fraction' was derived by treating the ethanol-treated To enhance the ethanol treated spores germination capa 60 spore preparation with oxgal, plating to various solid media, bility and demonstrate spore viability, spores from three dif and then, after 2 days or 7 days of growth, Scraping all the ferent donors were germinated by various treatments and bacterial growth from the plates into 5 mL of PBS per plate to plated on various media. Germination with BHIS/oxgalI generate a bacterial Suspension. A 'sporulatable fraction” (BHIS ox), Ca-DPA, rumen fluid (RF), simulated gastric fluid was derived as above except that the cells were allowed to (SGF), mucin medium (Muc), fetal bovine serum (FBS), or 65 grow on Solid media for 2 days or 7 days (the time was thioglycollate (Thi) for 1 hour at 37C in anaerobic conditions extended to allow sporulation, as is typical in sporulation was performed as described previously (e.g. see Examples 13 protocols), and the resulting bacterial Suspension was treated US 9,011,834 B1 67 68 with 50% ethanol to derive a population of “sporulatable' Example 24 spores, or species that were capable of forming spores. In preparing these fractions, fecal material from donor A was Donor Pooling Efficacy in Prophylaxis Mouse used to generate an ethanol treated spore preparation as pre viously described in Example 15; then spore content was 5 To test the efficacy and dosing of pooled donor samples the determined by DPA assay and CFU/ml grown on various C. difficile prophylaxis mouse model (e.g., see Example 16) is media (FIG. 15) as previously described (see Example 21). used with donations mixed from two or more donor samples as previously described. Weight loss and mortality with the See FIG. 15: Spores initially present in ethanol treated spore mixed spore product versus the spore product derived from a preparation as measured by DPA and CFU/ml grown on single donor at the various dosing is determine whether the specified media. 10 two treatment schemes are equivalent or one is significantly To characterize the fraction that is sporulatable, the 2 day better than the other. and 7 day “germinable' fractions were assessed for CFU and Dosing of the spore product derived from a single or mul DPA content before and after ethanol treatment to generate a tiple donors is between 1E4 to 1E10 CFU/ml. The spore spore fraction. Bacterial Suspensions were treated with etha product is mixed from product derived from any number of nol, germinated with OxgalI, and plated on the same types of 15 donors ranging from 1-10 at either equal concentrations or media that the “germinable' fraction was grown on. DPA data different known concentrations. showed that growth on plates for 2 and 7 days produced the Additionally, this method can be used to expand the spore same amount of total spores. Colonies on the several types of fraction for production purposes. For production purposes, an media were picked for 16S sequence analysis to identify the enriched spore fraction (e.g.—a purified and EtOH treated spore forming bacteria present (Table 13). fraction of a fecal sample) is preserved in multiple aliquots to A 2 day “germinable' fraction and a 7 day “sporulatable' form a bank of viable spore-forming organisms. An aliquot of fraction were used as a treatment in the mouse prophylaxis this bank is then recovered by germinant treatment followed assay as described (e.g. see Example 16). As a control, a 10% by cultivation in a medium, and under conditions, that are fecal Suspension prepared from a donor (Donor B) was also broadly permissive for spore-forming organisms and encour administered to mice to model fecal microbiota transplant 25 age sporulation. After a Suitable amplification time, the (FMT). Weight loss and mortality of the various test and amplified bacteria including spores are harvested, and this preparation is solvent or heat-treated to isolate the spore control arms of the study are plotted in FIG. 17 and summa fraction. This fraction may be further purified away from rized in Table 15 which also contains the dosing information. non-spore forms and culture constituents. The process of The data clearly shows both the “germinable' and “sporulat amplification, spore isolation and optional purification may able' fractions are efficacious in providing protection against 30 be repeated at increasing scales to generate large quantities C. difficile challenge in a prophylaxis mouse model (e.g. see for further use. When enough germinable/sporulatable mate Example 16). The efficacy of these fractions further demon rial has been accumulated by amplification, it may be further strates that the species present are responsible for the efficacy purified, concentrated or diluted, and/or preserved to a state of the spore fraction, as the fractionation further dilutes any Suitable for further use, e.g.—clinical dosing. potential contaminant from the original spore preparation. 35 Features may be incorporated into the above process to See FIG. 16: Titer of “germinable' fraction after 2 days make it suitable for further utility, especially for product (left) and Sporulatable fraction (right) by DPA and CFU/ml. applications such as clinical use. The production of the initial The “sporulatable' fraction made following 7 days of growth spore fraction may be conducted under controlled conditions was measured as previously described using germination and (cGMPs) and validated to remove non-spore organisms to a growth assays or DPA content as previously described (see 40 high degree. The germination may be conducted using Example 21). reagents that are more standardizable than natural products The species present in the “germinable' and “sporulatable' Such as oxgal, e.g.—Synthetic mixtures of bile salts. Ampli fractions were determined by full length 16S sequencing of fication may be done using media with components that are colony picks and by 16S NGS sequencing of the fractions preferred for clinical safety, e.g.—Sourced from qualified animals, or non-animal sourced. Conditions may be arranged themselves. The colony pick data indicate Clostridium spe 45 So as to ensure consistent compositions of sporulated organ cies are very abundant in both fractions, while the NGS data isms, are less prone to contamination, and are more amenable reveal other spore forming organisms that are typically found to scale-up, e.g.—closed stirred fermenters with feedback in ethanol treated spore preparations are present. control loops. Sporulated organisms from the process may be Results are shown in the following: See Table 13. Species isolated using procedures that alone or combined stringently identified as “germinable' and “sporulatable” by colony 50 eliminate non-spores and other process residuals, e.g.—sol picking approach. See Table YYY. Species identified as “ger vent treatment, aqueous two-phase extraction, and/or 60° C. minable' using 16S-V4 NGS approach. See Table ZZZ. Spe long-time heat treatment. Preservation may involve addition cies identified as “sporulatable” using 16s-V4 NGS of excipients and/or adjustment of conditions to enable con approach. See FIG. 17: Mouse prophylaxis model demon version to a preferred dosage form amenable to long-term strates “germinable' and “sporulatable' preparations are pro 55 shelf storage, e.g.—addition of trehalose, followed by lyo tective against C. difficile challenge. Each plot tracks the philization or spray drying, further blending of the powder change in the individual mouse's weight relative to day -1 with microcrystalline cellulose, and encapsulation in a gela over the course of the experiment. The number of deaths over tin capsule to form an orally dosable product. the course of the experiment is indicated at the top of the chart and demonstrated by a line termination prior to day 6. The top 60 Example 25 panels (from left to right) are the vehicle control arm, the fecal Suspension arm, and the untreated naive control arm, while Engraftment, Augmentation and Reduction of the bottom panels are the ethanol treated, gradient purified Pathogen Carriage in Patients Treated with Spore spore preparation; the ethanol treated, gradient purified, 'ger Compositions minable' preparation, and ethanol treated, gradient purified, 65 “sporulatable' preparation. SeeTable 15: Results of the pro Complementary genomic and microbiological methods phylaxis mouse model and dosing information were used to characterize the composition of the microbiota US 9,011,834 B1 69 70 from Patient 1, 2, 3, 4, and 5, 6,7,8,9, and 10 at pretreatment patient pretreatment (purple) harbored a microbiome that was (pretreatment) and on up to 4 weeks post-treatment. significantly reduced in total diversity as compared to the To determine the OTUs that engraft from treatment with an ethanol treated spore treatment (red) and patient post treat ethanol treated spore preparation in the patients and how their ment at days 5 (blue), 14 (orange), and 25 (green). microbiome changed in response, the microbiome was char See FIG. 19: Patient microbial ecology is shifted by treat acterized by 16S-V4 sequencing prior to treatment (pretreat ment with an ethanol treated spore treatment from a dysbiotic ment) with an ethanol treated spore preparation and up to 25 state to a state of health. Principle Coordinates Analysis based days after receiving treatment. As example, the treatment of on the total diversity and structure of the microbiome (Bray patient 1 with an ethanol treated spore preparation led to the Curtis Beta-Diversity) of the patient pre- and post-treatment engraftment of OTUS from the spore treatment and augmen 10 delineates that the engraftment of OTUs from the spore treat tation in the microbiome of the patient (FIG. 18 and FIG. 19). ment and the augmentation of the patient microbial ecology By day 25 following treatment, the total microbial carriage leads to a microbial ecology that is distinct from both the was dominated by species of the following taxonomic groups: pretreatment microbiome and the ecology of the ethanol Bacteroides, Sutterella, Ruminococcus, Blautia, Eubacte treated spore treatment (Table 16). rium, Gemmiger/Faecalibacterium, and the non-sporeform 15 See FIG. 20: Augmentation of Bacteroides species in ing Lactobacillus (see Table 16 and Table 2 for specific patients. Comparing the number of Bacteroides fragilis OTUs). The first two genera represent OTUs that do not form groups species per cfu/g of feces pre-treatment and in week 4 spores while the latter taxonomic groups represent OTUs that post treatment reveals an increase of 4 logs or greater. The are believed to form spores. ability of 16S-V4 OTU identification to assign an OTU as a Patient treatment with the ethanol treated spore preparation specific species depends in part on the resolution of the 16S leads to the establishment of a microbial ecology that has V4 region of the 16S gene for a particular species or group of greater diversity than prior to treatment (FIG. 18). Genomic species. Both the density of available reference 16S based microbiome characterization confirmed engraftment of sequences for different regions of the tree as well as the a range of OTUs that were absent in the patient pretreatment inherent variability in the 16S gene between different species (Table 16). These OTUS comprised both bacterial species that 25 will determine the definitiveness of ataxonomic annotation to were capable and not capable of forming spores, and OTUS a given sequence read. Given the topological nature of a that represent multiple phylogenetic clades. Organisms phylogenetic tree and that the tree represents hierarchical absent in Patient 1 pre-treatment either engraft directly from relationships of OTUs to one another based on their sequence the ethanol treated spore fraction or are augmented by the similarity and an underlying evolutionary model, taxonomic creation of a gut environment favoring a healthy, diverse 30 annotations of a read can be rolled up to a higher level using microbiota. Furthermore, Bacteroides fragilis group species a clade-based assignment procedure (Table 1). Using this were increased by 4 and 6 logs in patients 1 and 2 (FIG. 20). approach, clades are defined based on the topology of a phy OTUS that comprise an augmented ecology are not present logenetic tree that is constructed from full-length 16S in the patient prior to treatment and/or exist at extremely low sequences using maximum likelihood or other phylogenetic frequencies Such that they do not comprise a significant frac 35 models familiar to individuals with ordinary skill in the art of tion of the total microbial carriage and are not detectable by phylogenetics. Clades are constructed to ensure that all OTUs genomic and/or microbiological assay methods. OTUS that in a given clade are: (i) within a specified number of bootstrap are members of the engrafting and augmented ecologies were Supported nodes from one another (generally, 1-5 bootstraps), identified by characterizing the OTUs that increase in their and (ii) within a 5% genetic similarity. OTUs that are within relative abundance post treatment and that respectively are: 40 the same clade can be distinguished as genetically and phy (i) present in the ethanol treated spore preparation and absent logenetically distinct from OTUs in a different clade based on in the patient pretreatment, or (ii) absent in the ethanol treated 16S-V4 sequence data. OTUs falling within the same clade spore preparation, but increase in their relative abundance are evolutionarily closely related and may or may not be through time post treatment with the preparation due to the distinguishable from one another using 16S-V4 sequence formation of favorable growth conditions by the treatment. 45 data. The power of clade based analysis is that members of the Notably, the latter OTUs can grow from low frequency res same clade, due to their evolutionary relatedness, play similar ervoirs in the patient, or be introduced from exogenous functional roles in a microbial ecology Such as that found in sources such as diet. OTUs that comprise a “core” augmented the human gut. Compositions Substituting one species with or engrafted ecology can be defined by the percentage of total another from the same clade are likely to have conserved patients in which they are observed to engraft and/or aug 50 ecological function and therefore are useful in the present ment; the greater this percentage the more likely they are to be invention. part of a core ecology responsible for catalyzing a shift away Stool samples were aliquoted and resuspended 10x vol/wt from a dysbiotic ecology. The dominant OTUS in an ecology in either 100% ethanol (for genomic characterization) or PBS can be identified using several methods including but not containing 15% glycerol (for isolation of microbes) and then limited to defining the OTUs that have the greatest relative 55 stored at -80° C. until needed for use. For genomic 16S abundance in either the augmented or engrafted ecologies and sequence analysis colonies picked from plate isolates had defining a total relative abundance threshold. As example, the their full-length 16S sequence characterized as described in dominant OTUs in the augmented ecology of Patient-1 were Examples 11 and 12, and primary stool samples were pre identified by defining the OTUs with the greatest relative pared targeting the 16S-V4 region using the method for het abundance, which together comprise 60% of the microbial 60 erogeneous samples in Example 10. carriage in this patient's augmented ecology. Notably, 16S sequences of isolates of a given OTU are See FIG. 18: Microbial diversity measured in the ethanol phylogenetically placed within their respective clades despite treated spore treatment sample and patient pre- and post that the actual taxonomic assignment of species and genus treatment samples. Total microbial diversity is defined using may suggest they are taxonomically distinct from other mem the Chaol Alpha-Diversity Index and is measured at different 65 bers of the clades in which they fall. Discrepancies between genomic sampling depths to confirm adequate sequence cov taxonomic names given to an OTU is based on microbiologi erage to assay the microbiome in the target samples. The cal characteristics versus genetic sequencing are known to US 9,011,834 B1 71 72 exist from the literature. The OTUs footnoted in this table are ture 12820. Strikingly, prior to treatment, fewer than 0.008% known to be discrepant between the different methods for of the 16S-V4 reads from Patient 1 mapped to the genus assigning a taxonomic name. Bacteroides strongly suggesting that Bacteroides species Engraftment of OTUs from the ethanol treated spore prepa were absent or that viable Bacteroides were reduced to an ration treatment into the patient as well as the resulting aug extremely minor component of the patient’s gut microbiome. mentation of the resident microbiome led to a significant Post treatment, 42% of the 16S-V4 reads could be assigned decrease in and elimination of the carriage of pathogenic to the genus Bacteroides within 5 days of treatment and by species other than C. difficile in the patient. 16S-V4 sequenc Day 25 post treatment 59.48% of the patients gut microbiome ing of primary stool samples demonstrated that at pretreat was comprised of Bacteroides. These results were confirmed ment, 20% of reads were from the genus Klebsiella and an 10 microbiologically by the absence of detectable Bacteroides in additional 19% were assigned to the genus Fusobacterium. the pretreatment sample plated on two different Bacteroides These striking data are evidence of a profoundly dysbiotic selective media: Bacteroides Bile Esculin (BBE) agar which microbiota associated with recurrent C. difficile infection and is selective for Bacteroides fragilis group species Living chronic antibiotic use. In healthy individuals, Klebsiella is a ston, S. J. et al J. Clin. Microbiol (1978). 7: 448-453 and resident of the human microbiome in only about 2% of sub 15 Polyamine Free Arabinose (PFA) agar Noacket al. J. Nutr. jects based on an analysis of HMP database (www.hmpdac (1998) 128: 1385-1391; modified by replacing glucose with c.org), and the mean relative abundance of Klebsiella is only arabinose. The highly selective BBE agar had a limit of about 0.09% in the stool of these people. It’s surprising pres detection of <2x10 cfu/g, while the limit of detection for ence at 20% relative abundance in Patient 1 before treatment Bacteroides on PFAagar was approximately 2x107 cfu/g due is an indicator of a proinflammatory gut environment to the growth of multiple non-Bacteroides species in the enabling a "pathobiont' to overgrow and outcompete the pretreatment sample on that medium. Colony counts of commensal organisms normally found in the gut. Similarly, Bacteroides species on Day 25 were up to 2x10" cfu/g, the dramatic overgrowth of Fusobacterium indicates a pro consistent with the 16S-V4 sequencing, demonstrating a pro foundly dysbiotic gut microbiota. One species of Fusobacte found reconstitution of the gut microbiota in Patient 1 (Table rium, F. nucleatum (an OTU phylogenetically indistinguish 25 20). able from Fusobacterium sp. 3 1 33 based on 16S-V4), has The significant abundance of Bacteroides in Patient 1 on been termed “an emerging gut pathogen' based on its asso Day 25 (and as early as Day 5 as shown by 16S-V4 sequenc ciation with IBD, Crohn's disease, and colorectal cancer in ing) is remarkable. Viable Bacteroides fragilis group species humans and its demonstrated causative role in the develop were not present in the ethanol treated spore population based ment of colorectal cancer in animal models Allen-Vercoe, 30 on microbiological plating (limit of detection of 10 cfu/ml). Gut Microbes (2011) 2:294-8. Importantly, neither Kleb Thus, administration of the ethanol treated spore population siella nor Fusobacterium was detected in the 16S-V4 reads by to Patient 1 resulted not only in the engraftment of spore Day 25 (Table 18). forming species, but also the restoration of high levels of To further characterize the colonization of the gut by Kleb non-spore forming species commonly found in healthy indi siella and other Enterobacteriaceae and to speciate these 35 viduals through the creation of a niche that allowed for the organisms, pretreatment and Day 25 fecal samples stored at repopulation of Bacteroides species. These organisms were -80C as PBS-glycerol suspensions were plated on a variety most likely either present at extremely low abundance in the of selective media including MacConkey lactose media (se GI tract of Patient 1, or present in a reservoir in the GI tract lective for gram negative enterobacteria) and Simmons Cit from which they could rebound to high titer. Those species rate Inositol media (selective for Klebsiella spp) Van Cregten 40 may also be reinoculated via oral uptake from food following et al., J. Clin. Microbiol. (1984) 20:936-41. Enterobacteria treatment. We term this healthy repopulation of the gut with identified in the patient samples included K. pneumoniae, OTUs that are not present in the ethanol treated spore popu Klebsiella sp. Co. 9935 and E. coli. Strikingly, each Klebsiella lation “Augmentation.” Augmentation is an important phe species was reduced by 2-4 logs whereas E. coli, a normal nomenon in that it shows the ability to use an ethanol treated commensal organism present in a healthy microbiota, was 45 spore ecology to restore a healthy microbiota by seeding a reduced by less than 1 log (Table 19). This decrease in Kleb diverse array or commensal organisms beyond the actual siella spp. carriage is consistent across multiple patients component organisms in the ethanol treated spore population (Table 19). Four separate patients were evaluated for the itself: specifically the spore treatment itself and the engraft presence of Klebsiella spp. pre treatment and 4 weeks post ment of OTUs from the spore composition create a niche that treatment. Klebsiella spp. were detected by growth on selec 50 enables the outgrowth of OTUs required to shift a dysbiotic tive Simmons Citrate Inositol media as previously described. microbiome to a microbial ecology that is associated with Serial dilution and plating, followed by determining cfu/mL health. The diversity of Bacteroides species and their titers of morphologically distinct species and 16S full length approximate relative abundance in the gut of Patient 1 is sequence identification of representatives of those distinct shown in Table 21, comprising at least 8 different species. morphological classes, allowed calculation of titers of spe 55 See FIG. 21: Species Engrafting versus Species Augment cific species. ing in patients microbiomes after treatment with an ethanol The genus Bacteroides is an important member of the treated spore population. Relative abundance of species that gastrointestinal microbiota; 100% of stool samples from the engrafted or augmented as described were determined based Human Microbiome Project contain at least one species of on the number of 16S sequence reads. Each plot is from a Bacteroides with total relative abundance in these samples 60 different patient treated with the ethanol-treated spore popu ranging from 0.96% to 93.92% with a median relative abun lation for recurrent C. difficile. dance of 52.67% (www.hmpdacc.org reference data set The impact of ethanol treated spore population treatment HMSMCP). Bacteroides in the gut has been associated with on carriage of imipenem resistant Enterobacteriaceae was amino acid fermentation and degradation of complex assessed by plating pretreatment and Day 28 clinical samples polysaccharides. Its presence in the gut is enhanced by diets 65 from Patients 2, 4 and 5 on MacConkey lactose plus 1 ug/mL rich in animal-derived products as found in the typical west of imipenem. Resistant organisms were scored by morphol ern diet David, L. A. et al. Nature (2013) doi:10.1038/na ogy, enumerated and DNA was submitted for full length 16S US 9,011,834 B1 73 74 rDNA sequencing as described above. Isolates were identi and incubated for 24 to 48 hat 37°C. in an anaerobic chamber fied as Morganella morganii, Providencia rettgeri and Pro with a gas mixture ofH:CON of 10:10:80. Single colonies teus pennerii. Each of these are gut commensal organisms; overgrowth can lead to bacteremia and/or urinary tract infec were then picked and used to inoculate 250 ml to 1 L of tions requiring aggressive antibiotic treatment and, in some Wilkins-Chalgren broth, Brain-Heart Infusion broth, cases, hospitalization Kim, B-N, et al Scan J. Inf Dis (2003) M2GSC broth or other growth media, and grown to mid to 35: 98-103; Lee, I-K and Liu, J-W J. Microbiol Immunol late exponential phase or into the stationary phase of growth. Infect (2006) 39: 328-334; O'Hara et al. Clin Microbiol Rev Alternatively, the single colonies may be used to inoculate a (2000) 13: 534. The titer of organisms at pretreatment and Day 28 by patient is shown in Table 22. Importantly, admin 10 pilot culture of 10 ml, which were then used to inoculate a istration of the ethanol treated spore preparation resulted in large Volume culture. The growth media and the growth phase greater than 100-fold reduction in 4 of 5 cases of Enterobac at harvest were selected to enhance cell titer, sporulation (if teriaceae carriage with multiple imipenem resistant organ desired) and phenotypes that might be associated desired in isms (Table 22). vitro or in vivo. Optionally, Cultures were grown static or In addition to speciation and enumeration, multiple iso 15 lates of each organism from Patient 4 were grown overnight in shaking, depending which yielded maximal cell titer. The 96-well trays containing a 2-fold dilution series of imipenem cultures were then concentrated 10 fold or more by centrifu in order to quantitatively determine the minimum inhibitory gation at 5000 rpm for 20 min, and resuspended in sterile concentration (MIC) of antibiotic. Growth of organisms was phosphate buffered saline (PBS) plus 15% glycerol. 1 ml detected by light scattering at 600 nm on a SpectraMax M5e aliquots were transferred into 1.8 ml cryovials which were plate reader. In the clinical setting, these species are consid ered resistant to imipenem if they have an MIC of 1 ug/mL or then frozen on dry ice and stored at -80 C. The identity of a greater. M. morganii isolates from pretreatment samples from given cell bank was confirmed by PCR amplification of the Patient D had MICs of 2-4 ug/mL and P. pennerii isolates had 16S rDNA gene, followed by Sanger direct cycle sequencing, MICs of 4-8 ug/mL. Thus the ethanol treated spore popula 25 and comparison to a curated rNA database to determine a tion administered to Patient 4 caused the clearance of 2 imi taxonomic ID. Each bank was confirmed to yield colonies of penem resistant organisms (Table 16). a single morphology upon streaking to Brucella blood agar or Example 26 M2GSC agar. When more than one morphology was 30 observed, colonies were confirmed to be the expected species Enrichment and Purification of Bacteria by PCR and sequencing analysis of the 16S rDNA gene. Variant colony morphologies can be observed within pure To purify individual bacterial strains, dilution plates were selected in which the density enables distinct separation of cultures, and in a variety of bacteria the mechanisms of vary single colonies. Colonies were picked with a sterile imple 35 ing colony morphologies have been well described (van der ment (either a sterile loop or toothpick) and re-streaked to Woude, Clinical Microbiology Reviews, 17:518, 2004), BBA or other Solid media. Plates were incubated at 37°C. for including in Clostridium species (Wadsworth-KTL Anaero 3-7 days. One or more well-isolated single colonies of the bic Bacteriology Manual, 6th Ed. Jousimie-Somer, et al major morphology type were re-streaked. This process was repeated at least three times until a single, stable colony 40 2002). For obligate anaerobes, RCBs were confirmed to lack morphology is observed. The isolated microbe was then cul aerobic colony forming units at a limit of detection of 10 tured anaerobically in liquid media for 24 hours or longer to cfu/ml. obtain a pure culture of 10°-10' cfu/ml. Liquid growth medium might include Brain Heart Infusion-based medium Example 28 (Atlas, Handbook of Microbiological Media, 4th ed, ASM 45 Press, 2010) supplemented with yeast extract, hemin, cys Titer Determination teine, and carbohydrates (for example, maltose, cellobiose, soluble starch) or other media described previously (e.g. see The number of viable cells per ml was determined on the example 14). The culture was centrifuged at 10,000xg for 5 freshly harvested, washed and concentrated culture by plating min to pellet the bacteria, the spent culture media was 50 serial dilutions of the RCB to Brucella blood agar or other removed, and the bacteria were resuspended in sterile PBS. solid media, and varied from 10° to 10" cfu/ml. The impact of Sterile 75% glycerol was added to a final concentration of freezing on viability was determined by titering the banks 20%. An aliquot of glycerol stock was titered by serial dilu after one or two freeze-thaw cycles on dry ice or at -80°C., tion and plating. The remainder of the stock was frozen on dry followed by thawing in an anaerobic chamber at room tem ice for 10-15 min and then placed at -80C for long term 55 perature. Some strains displayed a 1-3 log drop in viable Storage. cfu/ml after the 1st and/or 2nd freeze thaw, while the viability of others were unaffected. Example 27 Example 29 Cell Bank Preparation 60 Preparation of Bacterial Compositions Cell banks (RCBs) of bacterial strains were prepared as follows. Bacterial strains were struck from -80° C. frozen Individual strains were typically thawed on ice and com glycerol stocks to Brucella blood agar with Heminor Vitamin bined in an anaerobic chamber to create mixtures, followed K (Atlas, Handbook of Microbiological Media, 4th ed, ASM 65 by a second freeze at -80° C. to preserve the mixed samples. Press, 2010), M2GSC (Atlas, Handbook of Microbiological When making combinations of strains for in vitro or in vivo Media, 4th ed, ASM Press, 2010) or other solid growth media assays, the cfu in the final mixture was estimated based on the US 9,011,834 B1 75 76 second freeze-thaw titer of the individual strains. For experi which a given network is observed across Subject samples, ments in rodents, strains may be combined at equal counts in and the size of a given network to be considered a Keystone order to deliver between 1e4 and le10 per strain. Addition node are defined by the 50th, 70th, 80th, or 90th percentiles of ally, some bacteria may not grow to Sufficient titer to yield cell the distribution of these variables. Optionally, the required banks that allowed the production of compositions where all thresholds are defined by the value for a given variable that is bacteria were present at le10. significantly different from the mean or median value for a given variable using standard parametric or non-parametric Example 30 measures of statistical significance. In another embodiment a Keystone node is defined as one that occurs in a sample 10 phenotype of interest such as but not limited to “health' and Identification of Keystone OTUs and Functions simultaneously does not occur in a sample phenotype that is not of interest such as but not limited to “disease. Optionally, The human body is an ecosystem in which the microbiota, a Keystone Node is defined as one that is shown to be signifi 15 cantly different from what is observed using permuted test and the microbiome, play a significant role in the basic datasets to measure significance. healthy function of human systems (e.g. metabolic, immuno logical, and neurological). The microbiota and resulting microbiome comprise an ecology of microorganisms that co-exist within single subjects interacting with one another Example 31 and their host (i.e., the mammalian Subject) to form a dynamic Identifying the Core Ecology from the Ethanol unit with inherent biodiversity and functional characteristics. Treated Spore Preparation Within these networks of interacting microbes (i.e. ecolo gies), particular members can contribute more significantly 25 Ten different ethanol treated spore preparations were made than others; as such these members are also found in many from 6 different donors (as described in Example 15). The different ecologies, and the loss of these microbes from the spore preparations were used to treat 10 patients, each Suffer ecology can have a significant impact on the functional capa ing from recurrent C. difficile infection. Patients were identi bilities of the specific ecology. Robert Paine coined the con 30 fied using the inclusion/exclusion criteria described in cept “Keystone Species” in 1969 (see Paine RT. 1969. A note Example 18, and donors were identified using the criteria on trophic complexity and community stability. The Ameri described in Example 1. None of the patients experienced a can Naturalist 103: 91-93.) to describe the existence of such relapse of C. difficile in the 4 weeks of follow up after treat lynchpin species that are integral to a given ecosystem regard 35 ment, whereas the literature would predict that 70-80% of less of their abundance in the ecological community. Paine Subjects would experience a relapse following cessation of originally describe the role of the starfish Pisaster ochraceus antibiotic Van Nood, et al., NEJM (2013). Thus, the ethanol in marine systems and since the concept has been experimen treated spore preparations derived from multiple different tally validated in numerous ecosystems. 40 donors and donations showed remarkable clinical efficacy. Keystone OTUs and/or Functions are computationally-de To define the Core Ecology underlying the remarkable rived by analysis of network ecologies elucidated from a clinical efficacy of the ethanol treated spore preparation, the defined set of samples that share a specific phenotype. Key following analysis was carried out. The OTU composition of the spore preparation was determined by 16S-V4 rDNA stone OTUs and/or Functions are defined as all Nodes within 45 a defined set of networks that meet two or more of the fol sequencing and computational assignment of OTUS per lowing criteria. Using Criterion 1, the node is frequently Example 12. A requirement to detect at least ten sequence observed in networks, and the networks in which the node is reads in the ethanol treated spore preparation was set as a observed are found in a large number of individual subjects: conservative threshold to define only OTUs that were highly the frequency of occurrence of these Nodes in networks and 50 unlikely to arise from errors during amplification or sequenc the pervasiveness of the networks in individuals indicates ing. Methods routinely employed by those familiar to the art these Nodes perform an important biological function in of genomic-based microbiome characterization use a read many individuals. Using Criterion 2, the node is frequently relative abundance threshold of 0.005% (see e.g. Bokulich, A. observed in networks, and each the networks in which the et al. 2013. Quality-filtering vastly improves diversity esti node is observed contain a large number of Nodes—these 55 mates from Illumina amplicon sequencing. Nature Methods Nodes are thus 'super-connectors', meaning that they form a 10: 57-59), which would equate to 22 reads given the nucleus of a majority of networks and as such have high sequencing depth obtained for the samples analyzed in this biological significance with respect to their functional con example, as cut-off which is substantially lower than the 20 tributions to a given ecology. Using Criterion 3, the node is reads used in this analysis. All taxonomic and clade assign found in networks containing a large number of Nodes (i.e. 60 ments were made for each OTU as described in Examples 12. they are large networks), and the networks in which the node The resulting list of OTUS, clade assignments, and frequency is found occur in a large number of Subjects; these networks of detection in the spore preparations are shown in Table GB. are potentially of high interest as it is unlikely that large OTUS that engraft in a treated patients and the percentage of networks occurring in many individuals would occur by patients in which they engraft are denoted, as are the clades, chance alone strongly suggesting biological relevance. 65 spore forming status, and Keystone OTU status. Starred Optionally, the required thresholds for the frequency at which OTUs occur in a80% of the ethanol preps and engraft in a node is observed in network ecologies, the frequency at >50% of the treated patients. US 9,011,834 B1 77 TABLE GB OTUs detected by a minimum often 16S-V4 sequence reads in at least a one ethanol treated spore preparation (pan microbiome). % of % of Spore Patients Preps with OTU Spore Keystone OTU Clade OTU Engrafts Former OTU Prevoieila maculosa clade 104 10% O% N N Prevoteila copri clade 168 20% O% N N Bacteroides Caccae clade 170 30% O% N Y Bifidobacterium sp. TM 7* clade 172 90% 60% N N Bifidobacterium gallicum clade 172 70% 20% N N Bifidobacterium dentium clade 172 SO% O% N N Lactobacilius Casei clade 198 20% 10% N N Actinomyces Odontolyticits clade 212 20% 30% N N Cliostridium coicanis clade 223 10% 10% Y N Clostridiales sp SS3 4* clade 246 100% 70% Y N Clost ridium sporogenes clade 252 40% 40% Y N Clostridium butyricum clade 252 20% 20% Y N Clostridium disporicum clade 253 40% 30% Y N Clostridium hyiemonae clade 260 100% SO% Y N Cliostridium Scindens clade 260 10% 60% Y N Coprococci is comes clade 262 90% 80% Y Y Lachnospiraceae bacterium 1 4 clade 262 90% 80% Y Y 56FAA* Raiminococci is torques clade 262 30% 70% Y Y Parabacteroides nerdae clade 286 30% 20% N Y Bifidobacterium bifidum clade 293 10% O% N N Johnsonella ignava clade 298 10% 10% N N Bialitia glitcerasea clade 309 100% 80% Y N Blautia sp M25* clade 309 100% 70% Y Y Lachnospiraceae bacterium 6 1 clade 309 100% 60% Y N 63FAA* Etibacterium cellulosolvens clade 309 10% 30% Y Y Lactobacillus fermenium clade 313 10% O% N N Sarcina ventriculi clade 353 10% 10% Y N Cliostridium bartiettii clade 354 90% 70% Y N Clostridium bifermenians clade 354 70% 70% Y N Clostridium mayombei clade 354 SO% SO% Y N Dorea longicatena clade 360 100% 60% Y Y Lachnospiraceae bacterium 9 1 clade 360 100% 30% Y N 43BFAA Lachnospiraceae bacterium 2 1 clade 360 80% 80% Y N 58FAA* Lachnospiraceae bacterium 2 1 clade 360 SO% SO% Y N 46FAA Lactobacilius peroiens clade 373 O% O% N N Bacteroides dor'ei clade 378 60% SO% N Y Eubacterium biforme clade 385 O% O% Y N Peptoniphilus sp. gpac077 clade 389 O% 20% N N Coprococciis Caius clade 393 100% 70% Y Y Eubacterium hai clade 396 90% 60% Y Y Anaerosporobacter mobilis clade 396 40% 60% Y N Bacteroidespectinophilus clade 396 O% 60% Y N Lactobacilius hominis clade 398 O% O% N N Lactococci is lactis clade 401 40% 40% N N Ruminococcus champanellensis clade 406 80% SO% Y N Raiminococci is callidus clade 406 O% 10% Y N Clostridium clostridioforme clade 408 100% 60% Y Y Eubacterium had run clade 408 100% 90% Y Y Clostridium symbiosum clade 408 30% SO% Y Y Anaerostipes caccae clade 408 O% SO% Y N Parasutterelia excrementihominis clade 432 O% O% N N Stitterelia Stercoricanis clade 432 O% O% N N Eubacterium reciaie clade 444 100% 80% Y Y Lachnobacterium bovis clade 444 100% 80% Y N Desulfovibrio desulfuricans clade 445 O% O% N Y Eubacterium sp. oral clone JS001* clade 476 80% 70% Y N Faecalibacterium prausnitzii clade 478 100% 60% Y Y Subdoigranulum variabile clade 478 100% 80% Y Y Coprobacilius sp D7* clade 481 90% 60% Y N Cliostridium cocleatum clade 481 60% 20% Y N Clostridium spiroforme clade 481 40% SO% Y N Eubacterium ramitius clade 482 80% 60% Y N Flavonifactor plautii clade 494 70% 60% Y Y Pseudofiavonifactor capiliosits clade 494 60% 60% Y Y Raiminococcaceae bacterium D16 clade 494 30% SO% Y Y Acetivibrio cellulolyticus* clade 495 70% 80% Y N US 9,011,834 B1 79 80 TABLE GB-continued OTUs detected by a minimum often 16S-V4 sequence reads in at least a one ethanol treated spore preparation (pan microbiome). % of % of Spore Patients Preps with OTU Spore Keystone OTU Clade OTU Engrafts Former OTU Cliostridium Stercorarium clade 495 40% SO% Y N Enterococci is dutrans clade 497 10% 10% N N Enterococci is faecium clade 497 10% 10% N N Dialister invisits clade 506 SO% 10% N N Etibacterium inostin clade 512 20% O% Y N Raiminococci is fiavefaciens clade 516 60% 60% Y N Etibacterium ventriostin clade 519 30% 60% Y Y Biophila wadsworthia clade 521 90% O% N Y Lachnospira pectinoschiza clade 522 40% 60% Y N Etibacterium eigens clade 522 30% SO% Y Y Caioneia morbi clade 534 20% O% N N Clostridium sporosphaeroides clade 537 100% 80% Y N Ruminococcus bronii clade 537 60% 30% Y Y Clost ridium lepium clade 537 40% 70% Y Y Clostridium sp. YIT 12069 clade 537 40% 60% Y N Cliostridium viride clade 540 10% 10% Y N Megamonas fitnifornis clade 542 SO% O% N N Eubacterium ruminantium clade 543 80% 90% Y N Coprococciis entiactus clade 543 20% 20% Y N Collinseila aerofaciens clade 553 SO% 10% Y Y Alkaliphilus metairedigenes clade 554 40% 10% Y N Thiricibacter sanguinis clade 555 80% 40% Y N Phascolarctobacterium faecium clade 556 20% O% N N Cliostridiaies bacterium oral clone clade 558 80% SO% N N P4PA: Lutiispora thermophila clade 564 100% O% Y N Coriobacteriaceae bacterium JC110 clade 566 70% O% N N Eggerthella sp. 1356FAA clade 566 70% 30% N N Adlercreutzia equoifaciens clade 566 40% O% N N Gordonibacter pameiaeae clade 566 30% O% N Y Slackia isoflavoniconvertens clade 566 10% O% N N Eubacterium desmoians clade 572 90% 70% Y N Papillibacter cinnamivorans clade 572 90% 80% Y N Cliostridium coinum clade 576 30% 30% Y N Akkermansia maiciniphila clade 583 60% 10% N Y Clost ridiales bacterium oral taxon clade 584 80% SO% N N F32 Prochiorococcus marinus clade 592 30% O% N N Meihanobrevibacterwoinii clade 595 30% O% N N Bacteroides fragilis clade 65 20% 30% N Y Lactobacilius delbruecki clade 72 10% O% N N Escherichia coi clade 92 SO% O% N Y Clostridium sp. D5 clade 96 80% 60% Y N Streptococci is thermophilus clade 98 90% 20% N Y Streptococcus sp. CM6 clade 98 20% 10% N N Streptococci is sp. oral clone clade 98 10% O% N N ASCEOS Next, it was reasoned that for an OTU to be considered a 50 ogy that are highly likely to catalyze the shift from a dysbiotic member of the Core Ecology of the spore preparation, that disease ecology to a healthy microbiome. OTU must be shown to engraft in a patient. Engraftment is A third lens was applied to further refine insights into the important for two reasons. First, engraftment is a sine qua non Core Ecology of the spore preparation. Computational of the mechanism to reshape the microbiome and eliminate C. difficile colonization. OTUs that engraft with higher fre- 55 based, network analysis has enabled the description of micro quency are highly likely to be a component of the Core bial ecologies that are present in the microbiota of a broad Ecology of the spore preparation. Second, OTUs detected by population of healthy individuals. These network ecologies sequencing the spore preparation (as in Table GB) may are comprised of multiple OTUs, some of which are defined include non-viable spores or other contaminant DNA mol as Keystone OTUs. Keystone OTUs are computationally ecules not associated with spores. The requirement that an 60 defined as described in Example 30. Keystone OTUs form a OTU must be shown to engraft in the patient eliminates OTUs foundation to the microbially ecologies in that they are found that represent non-viable spores or contaminating sequences. and as Such are central to the function of network ecologies in Table GB also identifies all OTUs detected in the spore prepa healthy subjects. Keystone OTUs associated with microbial ration that also were shown to engraft in at least one patient ecologies associated with healthy Subjects are often are miss post-treatment. OTUS that are present in a large percentage of 65 ing or exist at reduced levels in Subjects with disease. Key the ethanol spore preparations analyzed and that engraft in a stone OTUS may exist in low, moderate, or high abundance in large number of patients represent a subset of the Core Ecol subjects. Table GB further notes which of the OTUs in the US 9,011,834 B1 81 82 spore preparation are Keystone OTUS exclusively associated TABLE GC-continued with individuals that are healthy and do not harbor disease. There are several important findings from this data. A Top 20 OTUS ranked by CES relatively small number of species, 16 in total, are detected in Spore Keystone all of the spore preparations from 6 donors and 10 donations. OTU Clade CES Former OTU This is surprising because the HMP database (www.hmpdac Cliostridium bartietti clade 354 4.0 Y N c.org) describes the enormous variability of commensal spe Etibacterium desmoians clade 572 4.0 Y N cies across healthy individuals. The presence of a small num Clostridium clostridioforme clade 408 3.2 Y Y ber of consistent OTUs lends support to the concept of a Core Dorea longicatena clade 360 3.2 Y Y Ecology. The engraftment data further Supports this conclu 10 Faecalibacterium prailsnitzi clade 478 3.2 Y Y Eubacterium hai clade 396 3.2 Y Y Sion. A regression analysis shows a significant correlation Clostridium lepium clade 537 3.2 Y Y between frequency of detection in a spore preparation and Lachnospiraceae bacterium clade 309 3.0 Y N frequency of engraftment in a donor: R=0.43 (p<0.001). 6 163FAA There is no a priori requirement that an OTU detected fre quently in the spore preparation will or should engraft. For 15 instance, Lutispora thermophila, a spore former found in all ten spore preparations, did not engraft in any of the patients. Example 32 Bilophila wadsworthia, a gram negative anaerobe, is present in 9 of 10 donations, yet it does not engraft in any patient, Defining Efficacious Subsets of the Core Ecology indicating that it is likely a non-viable contaminant in the ethanol treated spore preparation. Finally, it is worth noting The number of organisms in the human gastrointestinal the high preponderance of previously defined Keystone tract, as well as the diversity between healthy individuals, is OTUs among the most frequent OTUs in the spore prepara indicative of the functional redundancy of a healthy gut tions. microbiome ecology (see The Human Microbiome Consor These three factors—prevalence in the spore preparation, 25 tia. 2012. Structure, function and diversity of the healthy frequency of engraftment, and designation as a Keystone human microbiome. Nature 486: 207-214). This redundancy OTUs—enabled the creation of a "Core Ecology Score” makes it highly likely that subsets of the Core Ecology (CES) to rank individual OTUs. CES was defined as follows: describe therapeutically beneficial components of the ethanol 40% weighting for presence of OTU in spore preparation treated spore preparation and that Such Subsets may them multiplier of 1 for presence in 1-3 spore preparations 30 selves be useful compositions for the treatment of C. difficile multiplier of 2.5 for presence in 4-8 spore preparations infection given the ecologies functional characteristics. multiplier of 5 for presences in a 9 spore preparations Using the CES, individual OTUs can be prioritized for evalu 40% weighting for engraftment in a patient ation as an efficacious Subset of the Core Ecology. multiplier of 1 for engraftment in 1-4 patients Another aspect of functional redundancy is that evolution multiplier of 2.5 for engraftment in 5-6 patients 35 multiplier of 5 for engraftment in a 7 patients arily related organisms (i.e. those close to one another on the 20% weighting to Keystone OTUS phylogenetic tree, e.g. those grouped into a single clade) will multiplier of 1 for a Keystone OTU also be effective substitutes in the Core Ecology or a subset multiplier of 0 for a non-Keystone OTU thereof for treating C. difficile. Using this guide, the CES has a maximum possible score of 40 To one skilled in the art, the selection of appropriate OTU 5 and a minimum possible score of 0.8. As an example, an subsets for testing in vitro (e.g. see Example 33 below) or in OTU found in 8 of the 10 spore preparations that engrafted in vivo (e.g. see Examples 16 or 17) is straightforward. Subsets 3 patients and was a Keystone OTU would be assigned the may be selected by picking any 2,3,4,5,6,7,8,9, 10, or more follow CES: than 10 OTUs from Table GB, with a particular emphasis on 45 those with higher CES, such as the OTUs described in Table GC. In addition, using the clade relationships defined in Table GC ranks the top 20 OTUs by CES with the further Example 12 and Table 1 above, related OTUs can be selected requirement that an OTU must be shown to engraft to be a as substitutes for OTUs with acceptable CES values. These considered an element of a core ecology. organisms can be cultured anaerobically in vitro using the 50 appropriate media (selected from those described in Example TABLE GC 14 above), and then combined in a desired ratio. A typical experiment in the mouse C. difficile model utilizes at least 10 Top 20 OTUS ranked by CES and preferably at least 10, 10, 10, 10, 10 or more than 10 Spore Keystone colony forming units of a each microbe in the composition. OTU Clade CES Former OTU 55 Variations in the culture yields may sometimes mean that Eubacterium had run clade 408 4.2 Y Y organisms are combined in unequal ratios, e.g. 1:10, 1:100, Eubacterium reciaie clade 444 4.2 Y Y 1:1,000, 1:10,000, 1:100,000, or greater than 1:100,000. Subdoigranulum variabile clade 478 4.2 Y Y What is important in these compositions is that each strain be Blautia sp M25 clade 309 4.2 Y Y Coprococciis Caius clade 393 4.2 Y Y provided in a minimum amount So that the strain's contribu Lachnospiraceae bacterium clade 262 4.2 Y Y 60 tion to the efficacy of the Core Ecology subset can be mea 14 56FAA Sured. Using the principles and instructions described here, it Coprococci is comes clade 262 4.2 Y Y is straightforward for one of skill in the art to make clade Bialitia glitcerasea clade 309 4.0 Y N based substitutions to test the efficacy of subsets of the Core Lachnobacterium bovis clade 444 4.0 Y N Clostridium sporosphaeroides clade 537 4.0 Y N Ecology. Table GB describes the clades for each OTU Clostridiales sp SS3 4 clade 246 4.0 Y N 65 detected in a spore preparation and Table 1 describes the Papillibacter cinnamivorans clade 572 4.0 Y N OTUs that can be used for substitutions based on clade rela tionships. US 9,011,834 B1 83 84 Example 33 hunched, piloerection, or lethargic), Respiration (0-2 pts based on normal, rapid or shallow, with abdominal breath Testing Subsets of the Core Ecology in the Mouse ing), Clinical Signs (0-2 points based on normal, wet tail, Model cold-to-the-touch, or isolation from other animals). In addition to compiling the cumulative mortality for each Several subsets of the Core Ecology were tested in the C. arm, the average minimum relative weight is calculated as the difficile mouse model. The negative control was phosphate mean of each mouse's minimum weight relative to Day -1 buffered saline and the positive control was a 10% human and the average maximum clinical score is calculated as the fecal suspension. The subsets are described in Table GD. mean of each mouse's maximum combined clinical score 10 with a score of 4 assigned in the case of death. The results are TABLE GD reported in Table GE. Subsets of the Core Ecology tested in the C. difficile mouse model TABLE GE 15 Substitute For OTU in Table 1 Results of bacterial compositions tested in a C. difficile Subset OTU (Clade) mouse model. Subset 1 Collinseila aerofaciens none (Clade 553) Avg. Avg. Cliostridium tertium C. Sporogenes (Clade 252) Cumulative Minimum Maximum Clostridium disporicum none (Clade 253) Mortality Relative Clinical Score Cliostridium innocuum Clostridium sp. HGF2 Group Dose (%) Weight (Death = 4) (Clade 351) Clostridium mayombei none (Clade 354) Vehicle 40 O.87 2.8 Clostridium butyricum none (Clade 252) Control Coprococci is comes none (Clade 262) Feces 5.8e8 cfu O O.99 O Clostridium hylemonae none (Clade 260) Control total Cliostridium boiteae E. hadrum (Clade 408) 25 Subset 1 1e8 cfu? OTU O O.98 O Clostridium symbiosum C. clostridioforme (Clade 408) Subset 2 1e8 cfu? OTU 10 O.84 2.1 Cliostridium orbiscindens R. bacterium D16 (Clade 494) Subset 3 1e8 cfu? OTU 10 O.84 2.2 Lachnospiraceae C. Scindens (Clade 260) Subset 4 1e8 cfu? OTU O O.87 2 bacterium 5157FAA Subset 5 1e8 cfu? OTU 2O O.91 1.7 Subset 6 1 e8 cfu? OTU 40 O.82 2.8 Bialitia producia Blautia sp M25 (Clade 309) Subset 7 1e8 cfu? OTU O O.90 1 Raiminococcus gnavuts D. longicatena (Clade 360) 30 Ruminococcus bromii none (Clade 537) Subset 2 Collinseila aerofaciens none (Clade 553) Clostridium butyricum none (Clade 252) Clostridium hylemonae none (Clade 260) Example 34 Bialitia producia Blautia sp M25 (Clade 309) Subset 3 Collinseila aerofaciens none (Clade 553) Cliostridium innocuum Clostridium sp. HGF2 35 Defining Subsets of the Core Ecology in the In Vitro (Clade 351) C. difficile Inhibition Assay Coprococci is comes none (Clade 262) Ruminococcus bromii none (Clade 537) Vials of -80° C. glycerol stock banks were thawed and Subset 4 Clostridium butyricum none (Clade 252) Clostridium hylemonae none (Clade 260) diluted to le8 CFU/mL. Selected strains and their clade Bialitia producia Blautia sp M25 (Clade 309) 40 assignment are given in Table GF. Each strain was then Subset 5 Clostridium butyricum none (Clade 252) diluted 10x (to a final concentration of 1e7 CFU/mL of each Clostridium hylemonae none (Clade 260) strain) into 200 uL of PBS+15% glycerol in the wells of a Subset 6 Blautia producta Blautia sp M25 (Clade 309) Clostridium butyricum none (Clade 252) 96-well plate. Plates were then frozen at -80° C. When Subset 7 Cliostridium orbiscindens R. bacterium D16 (Clade 494) needed for the assay, plates were removed from -80° C. and Lachnospiraceae C. Scindens (Clade 260) 45 thawed at room temperature under anaerobic conditions bacterium 5157FAA when testing in a in vitro C. difficile inhibition assay Eubacterium reciaie none (Clade 444) (CivSim). An overnight culture of Clostridium difficile is grown under Two cages offive mice each were tested for each arm of the anaerobic conditions in SweetB-Fosin or other suitable experiment. All mice received an antibiotic cocktail consist 50 media for the growth of C. difficile. SweetB-Fos.In is a com ing of 10% glucose, kanamycin (0.5 mg/ml), gentamicin plex media composed of brain heart infusion, yeast extract, (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 cysteine, cellobiose, maltose, soluble starch, and fructooli mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) gosaccharides/inulin, and hemin, and is buffered with MOPs. and Vancomycin (0.056 mg/ml) in their drinking water on After 24 hr of growth the culture is diluted 100,000 fold into days -14 through -5 and a dose of 10 mg/kg. Clindamycin by 55 a complex media such as SweetB-Foslin which is suitable for oral gavage on day-3. On day-1, they received either the test the growth of a wide variety of anaerobic bacterial species. articles or control articles via oral gavage. On day 0 they were The diluted C. difficile mixture is then aliquoted to wells of a challenged by administration of approximately 4.5 log 10 cfu 96-well plate (180 uL to each well). 20 u, of a subset Core of C. difficile (ATCC 43255) via oral gavage. Mortality was Ecology is then added to each well at a final concentration of assessed every day from day 0 to day 6 and the weight and 60 le6 CFU/mL of each species. Alternatively the assay can be Subsequent weight change of the animal was assessed with tested each species at different initial concentrations (1e9 weight loss being associated with C. difficile infection. Mor CFU/mL, 1e8 CFU/mL, 1e7 CFU/mL, 1e5 CFU/mL, 1e4 tality and reduced weight loss of the test article compared to CFU/mL, 1e3 CFU/mL, 1e2 CFU/mL). Control wells only the empty vehicle was used to assess the Success of the test inoculated with C. difficile are included for a comparison to article. Additionally, a C. difficile symptom scoring was per 65 the growth of C. difficile without inhibition. Additional wells formed each day from day -1 through day 6. Symptom scor are used for controls that either inhibit or do not inhibit the ing was based on Appearance (0-2 pts based on normal, growth of C. difficile. One example of a positive control that US 9,011,834 B1 85 86 inhibits growth is a combination of Blautia producta, cling conditions are 95°C. for 15 minutes followed by 45 Clostridium bifermentans and Escherichia coli. One example cycles of 95° C. for 5 seconds, 60° C. for 30 seconds, and of a control that shows reduced inhibition of C. difficile fluorescent readings of the FAM channel. Alternatively, the qPCR is performed with other standard methods known to growth is a combination of Bacteroides thetaiotaomicron, those skilled in the art. Bacteroides ovatus and Bacteroides vulgatus. Plates are The Cd value for each well on the FAM channel is deter wrapped with parafilm and incubated for 24hr at 37°C. under mined by the CFX ManagerTM 3.0 software. The logo (cfu/ anaerobic conditions. After 24 hr the wells containing C. mL) of C. difficile each experimental sample is calculated by difficile alone are serially diluted and plated to determine titer. inputting a given sample's Cd value into a linear regression The 96-well plate is then frozen at -80C before quantifying model generated from the standard curve comparing the Cd C. difficile by qPCR assay. 10 values of the standard curve wells to the known logo (cfu/ A standard curve is generated from a well on each assay mL) of those samples. The log inhibition is calculated for plate containing only pathogenic C. difficile grown in each sample by Subtracting the logo (cfu/mL) of C. difficile in SweetB+FosIn media and quantified by selective spot plat the sample from the logo (cfu/mL) of C. difficile in the sample ing. Serial dilutions of the culture are performed in sterile on each assay plate used for the generation of the standard phosphate-buffered saline. Genomic DNA is extracted from 15 curve that has no additional bacteria added. The mean log the standard curve samples along with the other wells. inhibition is calculated for all replicates for each composition. Genomic DNA is extracted from 5ul of each sample using A histogram of the range and standard deviation of each a dilution, freeze/thaw, and heatlysis protocol. 5ull of thawed composition is plotted. Ranges or standard deviations of the samples is added to 45 uL of UltraPure water (Life Technolo log inhibitions that are distinct from the overall distribution gies, Carlsbad, Calif.) and mixed by pipetting. The plates with are examined as possible outliers. If the removal of a single diluted samples are frozen at -20° C. until use for qPCR log inhibition datum from one of the binary pairs that is which includes a heated lysis step prior to amplification. identified in the histograms would bring the range or standard Alternatively the genomic DNA is isolated using the Mo Bio deviation in line with those from the majority of the samples, Powersoil(R)-htp 96 Well Soil DNA. Isolation Kit (Mo Bio that datum is removed as an outlier, and the mean log inhibi Laboratories, Carlsbad, Calif.), Mo Bio Powersoil.R DNA 25 tion is recalculated. Isolation Kit (Mo Bio Laboratories, Carlsbad, Calif.), or the The pooled variance of all samples evaluated in the assay is QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, Calif.) estimated as the average of the sample variances weighted by according to the manufacturers instructions. the sample's degrees of freedom. The pooled standard erroris The qPCR reaction mixture contains 1x Sso Advanced then calculated as the square root of the pooled variance Universal Probes Supermix, 900 nM of Wr-tcdB-F primer 30 divided by the square root of the number of samples. Confi (AGCAGTTGAATATAGTGGTTTAGTTAGAGTTG, IDT, dence intervals for the null hypothesis are determined by Coralville, Iowa), 900 nM of Wr-tcdB-R primer (CAT multiplying the pooled Standard error to the Z score corre GCTTTTTTAGTTTCTGGATTGAA, IDT, Coralville, sponding to a given percentage threshold. Mean log inhibi Iowa), 250 nM of Wr-tcdB-P probe (6FAM-CATCCAGTCT tions outside the confidence interval are considered to be CAATTGTATATGTTTCTCCA-MGB, Life Technologies, 35 inhibitory if positive or stimulatory if negative with the per Grand Island, N.Y.), and Molecular Biology Grade Water cent confidence corresponding to the interval used. Ternary (Mo Bio Laboratories, Carlsbad, Calif.) to 18 ul (Primers combinations with mean log inhibition greater than 0.312 are adapted from: Wroblewski, D. et al., Rapid Molecular Char reported as ++++ (>99% confidence interval (C.I.) of the null acterization of Clostridium difficile and Assessment of Popu hypothesis), those with mean log inhibition between 0.221 lations of C. difficile in Stool Specimens, Journal of Clinical 40 and 0.312 as +++ (95%-C.I.<99%), those with mean log Microbiology 47:2142-2148 (2009)). This reaction mixture inhibition between 0.171 and 0.221 as ++ (90% Re OTU1 Clade1 OTU2 Clade2 OTU3 Clade3 Sults Clostridium clade Blautia clade Eubacterium rectale clade +++ bolteae 4.08 producta 309 444 -- Clostridium clade Clostridium clade Blautia producta clade +++ bolteae 4.08 symbiosum 4.08 309 -- Clostridium clade Clostridium clade Eubacterium rectale clade - bolteae 4.08 symbiosum 4.08 444 Clostridium clade Clostridium clade Faecalibacterium clade - bolteae 4.08 symbiosum 4.08 prausnitzii 478 Clostridium clade Clostridium clade Lachnospiraceae clade bolteae 4.08 symbiosum 478 bacterium 5 1 260 US 9,011,834 B1 87 TABLE GF-continued OTUs and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay Re OTU1 Clade1 OTU2 Clade2 OTU3 Clade3 Sults Clostridium clade Faecalibacterium clade Blautia producta clade ------bolteae 4.08 prausnitzii 478 309 -- Clostridium clade Faecalibacterium clade Eubacterium rectale clade bolteae 4.08 prausnitzii 478 444 Clostridium clade Faecalibacterium clade Lachnospiraceae clade ------bolteae 4.08 prausnitzii 478 bacterium 5 1 260 -- 57FAA Clostridium clade Lachnospiraceae clade Blautia producta clade ------bolteae 4.08 bacterium 51 260 309 -- 57FAA Clostridium clade Lachnospiraceae clade Eubacterium rectale clade + bolteae 4.08 bacterium 51 260 444 57FAA Clostridium clade Blautia producta clade Eubacterium rectale clade +++ symbiosum 4.08 309 444 -- Clostridium clade Faecalibacterium clade Blautia producta clade ------symbiosum 4.08 prausnitzii 478 309 -- Clostridium clade Faecalibacterium clade Eubacterium rectale clade symbiosum 4.08 prausnitzii 478 444 Clostridium clade Faecalibacterium clade Lachnospiraceae clade - symbiosum 4.08 prausnitzii 478 bacterium 5 1 260 57FAA Clostridium clade Lachnospiraceae clade Blautia producta clade ------symbiosum 4.08 bacterium 51 260 309 -- 57FAA Clostridium clade Lachnospiraceae clade Eubacterium rectale clade symbiosum 4.08 bacterium 51 260 444 57FAA Collinsella clade Blautia producta clade Eubacterium rectale clade +++ aerofaciens 553 309 444 -- Collinsella clade Clostridium clade Blautia producta clade ------aerofaciens 553 boteae 408 309 -- Collinsella clade Clostridium clade Clostridium clade ------aerofaciens 553 boteae 408 symbiosum 408 -- Collinsella clade Clostridium clade Eubacterium rectale clade +++ aerofaciens 553 boteae 408 444 -- Collinsella clade Clostridium clade Faecalibacterium clade ------aerofaciens 553 boteae 408 prausnitzii 478 -- Collinsella clade Clostridium clade Lachnospiraceae clade ------aerofaciens 553 boteae 408 bacterium 5 1 260 -- 57FAA Collinsella clade Clostridium clade Blautia producta clade ------aerofaciens 553 symbiosum 408 309 -- Collinsella clade Clostridium clade Eubacterium rectalei clade aerofaciens 553 symbiosum 408 444 Collinsella clade Clostridium clade Faecalibacterium Clade aerofaciens 553 symbiosum 408 prausnitzii 478 Collinsella clade Clostridium clade Lachnospiraceae clade - aerofaciens 553 symbiosum 408 bacterium 5 1 260 57FAA Collinsella clade Coprococcus clade Blautia producta clade ------aerofaciens 553 COGS 262 309 -- Collinsella clade Coprococcus clade Clostridium bolteae clade +++ aerofaciens 553 COGS 262 408 -- Collinsella clade Coprococcus clade Clostridium clade ------aerofaciens 553 COGS 262 symbiosum 408 Collinsella clade Coprococcus clade Eubacterium rectalei clade +++ aerofaciens 553 COGS 262 444 Collinsella clade Coprococcus clade Faecalibacterium clade ------aerofaciens 553 COGS 262 prausnitzii 478 -- Collinsella clade Coprococcus clade Lachnospiraceae clade ------aerofaciens 553 COGS 262 bacterium 5 1 260 57FAA Collinsella clade Faecalibacterium clade Blautia producta clade ------aerofaciens 553 prausnitzii 478 309 -- Collinsella clade Faecalibacterium clade Eubacterium rectale clade +++ aerofaciens 553 prausnitzii 478 444 Collinsella clade Faecalibacterium clade Lachnospiraceae clade ------aerofaciens 553 prausnitzii 478 bacterium 5 1 260 57FAA Collinsella clade Lachnospiraceae clade Blautia producta clade ------aerofaciens 553 bacterium 51 260 309 -- US 9,011,834 B1 89 90 TABLE GF-continued OTUs and their clade assignments tested in ternary combinations with results in the in vitro inhibition assay Re OTU1 Clade1 OTU2 Clade2 OTU3 Clade3 Sults Collinsella clade Lachnospiraceae clade Eubacterium rectale clade ------aerofaciens 553 bacterium 51 260 444 -- 57FAA Coprococcus clade Blautia producta clade Eubacterium rectale clade ------COGS 262 309 444 -- Coprococcus clade Clostridium clade Blautia producta Clade ------COGS 262 bolteae 408 309 -- Coprococcus clade Clostridium clade Clostridium Clade COGS 262 bolteae 408 symbiosum 408 Coprococcus clade Clostridium clade Eubacterium rectale clade. -- COGS 262 bolteae 408 444 Coprococcus clade Clostridium clade Faecalibacterium Clade ------COGS 262 bolteae 408 prausnitzii 478 Coprococcus clade Clostridium clade Lachnospiraceae Clade ------COGS 262 bolteae 408 bacterium 5 1 260 57FAA Coprococcus clade Clostridium clade Blautia producta clade ------COGS 262 symbiosum 408 309 -- Coprococcus clade Clostridium clade Eubacterium rectale clade --- COGS 262 symbiosum 408 444 Coprococcus clade Clostridium clade Faecalibacterium Clade COGS 262 symbiosum 408 prausnitzii 478 Coprococcus clade Clostridium clade Lachnospiraceae Clade COGS 262 symbiosum 408 bacterium 5 1 260 57FAA Coprococcus clade Faecalibacterium clade Blautia producta Clade ------COGS 262 prausnitzii 478 309 -- Coprococcus clade Faecalibacterium clade Eubacterium rectale clade - COGS 262 prausnitzii 478 444 Coprococcus clade Faecalibacterium clade Lachnospiraceae Clade COGS 262 prausnitzii 478 bacterium 5 1 260 57FAA Coprococcus clade Lachnospiraceae clade Blautia producta Clade ------COGS 262 bacterium 51 260 309 -- 57FAA Coprococcus clade Lachnospiraceae clade Eubacterium rectale Clade COGS 262 bacterium 51 260 444 57FAA Faecali- clade Blautia producta clade Eubacterium rectale clade ------bacterium 478 309 444 -- prausnitzii Faecali- clade Lachnospiraceae clade Blautia producta clade ------bacterium 478 bacterium 51 260 309 -- prausnitzii 57FAA Faecali- clade Lachnospiraceae clade Eubacterium rectale Clade bacterium 478 bacterium 51 260 444 prausnitzii 57FAA Lachno- clade Blautia producta clade Eubacterium rectale Clade ------spiraceae 260 309 444 -- bacterium 5 157FAA 50 The CivSim shows that many ternary combinations inhibit Ecology derived from the ethanol treated spore fraction C. difficile. 39 of 56 combinations show inhibition with a shown to be efficacious in treating C. difficile in humans. confidence interval >80%; 36 of 56 with a C.I.D.90%; 36 of 56 with a C.I.>95%; 29 of 56 with a C.I. of >99%. Non-limiting Example AAZA but exemplary ternary combinations include those with mean 55 log reduction greater than 0.171, e.g. any combination shown Bacterial Compositions Populating the Gut in a in Table 6 with a score of ++++, such as Colinsella aerofa ciens, Coprococcus comes, and Blautia producta. Equally Mouse Model important, the CivSim assay describes ternary combinations that do not effectively inhibit C. difficile. 5 of 56 combinations Two bacterial compositions were evaluated in a mouse promote growth with >80% confidence; 2 of 56 promote 60 model to demonstrate the ability to populate the gastrointes growth with >90% confidence; 1 of 56, Coprococcus comes, tinal tract. Bacteria were grown as described in ***Example Clostridium symbiosum and Eubacterium rectale, promote 14. Compositions were pre-made under anaerobic conditions growth with >95% confidence. 12 of 56 combinations are and suspended in PBS+15% glycerol and stored at >-70° C. neutral in the assay, meaning they neither promote nor inhibit prior to C. difficile growth to the limit of measurement. 65 Groups of mice (10 females/group; 5 per cage) were pre It is straightforward for one of skill in the art to use the treated on Days -14 to -5 with an antibiotic cocktail consist CivSim method to determine efficacious subsets of the Core ing of 10% glucose, kanamycin (0.5 mg/ml), gentamicin US 9,011,834 B1 91 92 (0.044 mg/ml), colistin (1062.5 U/ml), metronidazole (0.269 TABLE ZA-continued mg/ml), ciprofloxacin (0.156 mg/ml), ampicillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drinking water. On Microbial compositions administered via oral Day-3 they received 10 mg/kg. Clindamycin by oral gavage. gavage on Day -1 On Day -1, they were dosed with a microbial compositions 5 by oral gavage in a volume of 0.2 mL (Table ZA). Microbial compositions comprised approximately equal numbers of OTU Clade each OTU and were dosed at approximately 1x10, 1x10 and 1x107 per OTU for each composition (e.g. microbial compo Ruminococcus bromii clade 537 sition 1, comprising 15 Strains, was dosed at approximately 10 Bialitia producta clade 309 1.5x10', 1.5x10, and 1.5x10 total CFU). Fecal samples Cliostridium boiteae clade 408 were collected from each cage on Day -1 (approximately 1 Cliostridium innocuum clade 351 hour before dosing) and on Days 2,3 and 4 post-dosing. Feces Clostridium mayombei clade 354 were stored frozen prior to processing and sequencing. 15 Weight gain of mice treated with either microbial composi Cliostridium tertium clade 252 tions was similar to that of naive, control mice. Raiminococcus gnavus clade 360 Microbial Clostridium disporicum clade 253 In parallel, groups of animals treated with the same micro bial compositions on Day -1 were challenged on Day 0 with Composition 2 Cliostridium orbiscindens clade 494 approximately 10" spores of Clostridium difficile (ATCC Clostridium symbiosum clade 408 43255) via oral gavage. Mortality for C. difficile challenged Collinseila aerofaciens clade 553 animals was assessed every day from Day 0 to Day 6 and the Eubacterium reciaie clade 444 weight and Subsequent weight change of the animal was Lachnospiraceae bacterium clade 260 assessed with weight loss being associated with C. difficile 25 5 157FAA infection. Mortality and reduced weight loss of the testarticle Bialitia producta clade 309 compared to the empty vehicle was used to assess the Success of the test article. Cliostridium innocuum clade 351 Clostridium mayombei clade 354 TABLE ZA 30 Microbial compositions administered via oral gavage on Day -1 35 Fecal samples were processed by isolating and sequencing OTU Clade DNA according to ***Example 11 and 12. The OTU assign ment of fecal samples from Days -1, 2, 3 and 4 was deter Microbial Clostridium butyricum clade 252 mined by analyzing 16S-V4 sequence reads and assigning Composition 1 Clostridium disporicum clade 253 Clostridium hyiemonae clade 260 40 OTUs as described in ***Example 11. Clades were assigned Cliostridium orbiscindens clade 494 as described in ***Example 11. Total read counts were deter Clostridium symbiosum clade 408 mined for each OTU or each clade by summing the results Collinseila aerofaciens clade 553 from cages of the same experimental group. Samples with 10 Coprococci is comes clade 262 45 or fewer sequence reads for a given OTU or clade were Lachnospiraceae clade 260 considered to be below background and were not included in bacterium 5157FAA the summation process. Results are shown by OTU (Table TAB) and by clade (Table TAC). TABLE TAB Population of OTUs on Days 2, 3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU 1 x 10 per OTU 1 x 10" per OTU Microbial comp1 -1 2 3 4 -1 2 3 4 -1 2 3 4 Cl butyricum O 106 51 32 O 10 O 34 195 O O O Cl disporicum 10 1746 1190 887 O 1746 769 1011 201 11175 1531 1152 Cl hylemonae O 258 258 84 O 2O3 164 77 O 26S 214 90 Corbiscindens O 188 1.92 471 O 188 138 276 O 221 174 341 Cl Symbiosum O 485 482 486 O 444 379 447 O 562 427 775 Co aerofaciens O O O O O O O O O O O O C comes O O O O O O O O O O O O L. bacterium 5 O 341 336 3.54 O 351 182 356 O 256 240 300 157FAA R bromii O O O O O O O O O O O B producta g O O O O O O O O O O O Cl bolteae O O O O O O O O O O O US 9,011,834 B1 93 94 TABLE TAB-continued Population of OTUs on Days 2,3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU 1 x 108 per OTU 1 x 107 per OTU Cl innocuum O O O O O O O O O O O O Cl mayombei O O O O O O O O O O O O Cl tertium O O O O O O O O O O O O Rignavus O O O O O O O O O O O O Microbial -1 2 3 4 -1 2 3 4 - 1 2 3 4 comp 2 Cl disporicum 29 11810 10948. 14672 O 11349 13978 3942 O 1 1995 700S 6268 Corbiscindens O S10 408 764 O 332 S4S 544 O 31 O 319 432 Cl Symbiosum O 559 508 375 O 66S 494 450 O 396 639 650 Co aerofaciens O O O O O O 1172 O O O 247 O Erectale O O O O O O O 12 O O O 261 L. bacterium 5 O 972 801 S96 O 86O 962 844 O 636 1901 1239 157FAA B producta O O O O O O O O O O O O Cl innocuum O O O O O O O O O O O O Cl mayombei O O O O O O O O O O O O TABLE TAC Population of Clades on Days 2, 3 and 4 following dosing with Microbial Compositions 1 x 10 per OTU | x 108 per OTU 1 x 107 per OTU Microbial -1 2 3 4 1 2 3 4 1 2 3 4 comp1 clade 252 O 444 252 87 O 198 122 125 209 394 231 88 clade 253 10 1746 1190 887 O 1746 769 1011 201 1117 51531 1152 clade 260 O 599 594 438 O 554 346 433 O 521 454 390 clade 262 O 14 151 51 O O O O O 12 21 57 clade 309 O 11093 9750 4023 O 99.91 5208 5145, 19 9311 6369 4951 clade 351 O 9064 10647 7751 O 6528 7259 8213 O 8903 1.0049 8701 clade 354 O O O O O O O 31, 173 O O O clade 360 0 14300 10220 11036 O 12553 12989 6889 O 93O8 13483 9292 clade 408 13 8892 12985 12101 23 3952 7260 10652 43 4079 8581. 14929 clade 494 O 226 227 565 0 188 184 411 O 221 200 351 clade 537 O O 68 225 O O O O O O O 55 clade 553 O O O O O O O O O O O O Microbial -1 2 3 4 -1 2 3 4 -1 2 3 4 comp 2 clade 253 29 11810 10948. 14672 O 11349 13978 3942 O 11995 700S 6268 clade 260 O 112S 1312 854 O 1049 1295 12SO O 792 2121 1637 clade 309 S4 12S13 13731 7849 O 11610 12004 126721 O 7407 14111 10858 clade 351 O 7651 9939 S936 O 849S 9724 92O7 O 600S 9833 76SS clade 354 149 O 127 429 O O O 39 12 O O O clade 408 18 2242 4989 10480 12 1688 5580 3789 O 1068. 1561 6281 clade 444 41 O 49 202 0 18 O 12 O 14 82 1578 clade 494 O S10 46S 1054 O 332 S6S 596 O 31 O 319 476 clade 553 O O O O O O 1172 O O O 247 O Upon examining the OTU data in Table TAB, several pat- 50 ship between transient population by Co. aerofaciens fol terns emerge. First, there are a group of OTUs with no lowed by E. rectale in these groups of mice. A striking obser sequence reads on Day -1 that show Subsequent and large vation is that the observed number of OTU sequence reads is numbers of sequence reads on Days 2, 3, or 4; this group not highly dose dependent. Overall, the data is consistent with includes Cl. butyricum, Cl. hylemonae, Cl. Orbiscindens, Cl. ss model whereby OTUs populate rapidly following oral symbiosum, and L. bacterium 5 1 57FAA. Cl. disporicum administration. is comparable to this group as it has sequence reads on Day -1 The clade-based analysis in Table TAC was performed to that are very close to background (10 and 29 in compositions more thoroughly evaluate the population of the GI tract. 1 and 2, respectively), which Subsequently increase by as Clade-based analysis obscures some of the details afforded much as 1000-fold on Days 2, 3 or 4. Second, there are OTUs by an OTU analysis. For instance, Cl, tertium and Cl, butyri Such as Co. aerofaciens, C. comes, R. bromii, B. producta, Cl. cum are members of the same clade and thus a clade-based bolteae, Cl. mayombei, Cl. innocuum, Cl. tertium and R. analysis cannot distinguish the dynamics of these individual gnavus which are not detectable at the OTU level in either the OTUS. However, clade-based analysis has the compensatory Day -1 sample or in Subsequent samples. In composition 2, benefit that it is sensitive to measuring population changes Co. aerofaciens is detected transiently on Day 2 in the 1x10' 65 that can be missed by an OTU-based analysis. The ability of and 1x10" dose groups; E. rectale in the same experimental 16S-V4 OTU identification to assign an OTU as a specific groups is detected on Day 3, Suggesting a possible relation species depends in part on the resolving power of the 16S-V4 US 9,011,834 B1 95 96 region for a particular species or group of species. Both the and domination by bacteria Such as Enterobacteriaceae and density of available reference 16S sequences for different Enterococcaceae. Destruction of the normal flora by antibi regions of the tree as well as the inherent variability in the 16S otic administration, however, disinhibition antibiotic-resis gene between different species will determine the definitive tant members of these bacterial families, leading to their ness of a taxonomic annotation. So in some cases, the popu 5 expansion to very high densities (Ubeda et al Journal of lation of a species can be followed using clade-based assign Clinical Investigation 2010). High-density colonization by ments when OTU based-detection is insensitive in a complex these organisms can be calamitous for the Susceptible patient, population. For instance, the clade-based analysis in Table 2B resulting in bacteremia and sepsis (Taur et al. Clinical Infec Supports the case that R. bromii, B. producta, Cl. innocuum, tious Disease, 2012). and R. gnavus were able to populate since each OTU is a sole 10 To test prophylactic use and treatment of a bacterial com member of a clade in the microbial compositions and position test article e.g. spore population, a VRE infection sequence reads went from undetectable on Day -1 to well mouse model is used as previously described (Ubeda et al. above background on Days 2, 3 or 4.16S V4 sequencing and Infectious Immunity 2013, Ubeda et al. Journal of clinical clade-based analysis could not determine whether Cl. tertium investigation, 2010). Briefly, experiments are done with or Cl. bolteae populated due to the fact that other members of 15 7-week-old C57BL/6J female mice purchased from Jackson their clades (Cl. butyricum and Cl. Symbiosum, respectively) Laboratory, housed with irradiated food, and provided with were present and shown to populate at the OTU level in the acidified water. Mice are individually housed to avoid con mice. tamination between mice due to coprophagia. For experimen In the mice challenged in parallel with C. difficile, animals tal infections with VRE, mice are treated withampicillin (0.5 were significantly protected as shown in Table TAD. Mice g/liter) in their drinking water, which is changed every 3 days. gavaged with vehicle (phosphate buffered saline) experi In the treatment model, on day 1, mice are infected by enced 100% mortality while microbial compositions 1 and 2 means of oral gavage with 10 CFU of the Vancomycin protected at all dose levels with between 0 and 10% mortality resistant Enterococcus faecium strain purchased from ATCC by Day 6, the last day of the experiment. In addition, weight (ATCC 700221). One day after infection (day 1), antibiotic loss in animals treated with microbial compositions 1 and 2 25 treatment is stopped and VRE levels are determined at differ was minimal compared to animals receiving the vehicle gav ent time points by plating serial dilutions of fecal pellets on age. These data confirm that population of the gastrointestinal Enterococcosel agar plates (Difico) with Vancomycin (8 tract with microbial compositions confers a clinical benefit by ug/ml; Sigma). VRE colonies are identified by appearance restoring a state of dysbiosis so that animals can resist infec and confirmed by Gram staining or other methods previously tion by a pathogen. 30 described (e.g. see example 1, 2 and 3). In addition, as previ ously described (Ubeda et al Journal of Clinical Investigation TABLE TAD 2010), PCR of the van A gene, which confers resistance to Vancomycin, confirms the presence of VRE in infected mice. Mortality by experimental group in mice challenged The test article e.g. bacterial composition, or ethanol treated, with 10' C. dificile spores on Day 0 35 gradient purified spore preparation (as described herein), Group Dose (CFU per OTU) Deaths (% mortality) fecal suspension, or antibiotic treatment is delivered in PBS on days 1-3 while the negative control contains only PBS and Vehicle control NA 10 (100%) is also delivered on days 1-3 by oral gavage. Fresh fecal stool Microbial 109 1 (10%) composition 1 108 1 (10%) pellets are obtained daily for the duration of the experiment 107 0 (0%) 40 from days -7 to day 10. The samples are immediately frozen Microbial 109 0 (0%) and stored at -80° C. DNA was extracted using standard composition 2 108 1 (10%) techniques and analyzed with 16S or comparable methods 107 1 (10%) (e.g. see example 2 and 3). In the colonization model, amplicillin is administered as 45 described above for day -7 to day 1, treatment with the test Example 36 article or vehicle control is administered on day 0-2 and the VRE resistant bacteria at 10 CFU are administered on day Prophylactic Use and Treatment in a Mouse Model 14. Fecal samples are taken throughout the experiment daily of Vancomycin Resistant Enterococcus (VRE) from -7 to day 21 and submitted for 16S sequencing as Colonization 50 previously described (e.g. see examples 2 and 3). In both models titers of VRE in feces are used to evaluate The emergence and spread of highly antibiotic-resistant the Success of the test article Versus the negative control. bacteria represent a major clinical challenge (Snitkin et al Furthermore, microbiota composition is assessed for the abil Science Translational Medicine, 2012). In recent years, the ity of the test article to induce a healthy microbiome. numbers of infections caused by organisms such as methicil 55 lin-resistant Staphylococcus aureus, carbapenem-resistant Example 37 Enterobacteriaceae, Vancomycin-resistant Enterococcus (VRE), and Clostridium difficile have increased markedly, Prophylactic Use and Treatment of a Mouse Model and many of these strains are acquiring resistance to the few of Carbapenem Resistant Klebsiella (CRKB) remaining active antibiotics. Most infections produced by 60 Colonization highly antibiotic-resistant bacteria are acquired during hos pitalizations, and preventing patient-to-patient transmission The emergence of Klebsiella pneumoniae strains with of these pathogens is one of the major challenges confronting decreased Susceptibility to carbapenems is a significant threat hospitals and clinics. Most highly antibiotic-resistant bacte to hospitalized patients. Resistance to carbapenems in these rial Strains belong to genera that colonize mucosal Surfaces, 65 organisms is most frequently mediated by K. pneumoniae usually at low densities. The highly complex microbiota that carbapenemase (KPC), a class A beta-lactamase that also normally colonizes mucosal Surfaces inhibits expansion of confers resistance to broad-spectrum cephalosporins and US 9,011,834 B1 97 98 commercially available beta-lactam/beta-lactamase inhibitor Mice are treated with subcutaneous clindamycin to reduce combinations (Queenan et al. Clinical Microbiology Review, the normal intestinal flora 1 day before receiving 10 CFU of 2007). KPC-producing K. pneumoniae (KPC-Kp) strains KPC-Kp VA-367 by oral gavage, and the mice continued to often harbor resistance determinants against several other receive Subcutaneous clindamycin every other day for 7 days. classes of antimicrobials, including aminoglycosides and 5 Concurrently, for 7 days after oral gavage with KPC-Kp, mice fluoroquinolones, resulting in truly multidrug-resistant received oral gavage of normal saline (control group), or the (MDR) organisms (Hirsch et al., Journal of Antimicrobial bacterial composition as specified. An additional dose of Chemotherapy, 2009). Considering the limited antimicrobial Subcutaneous clindamycin was administered 20 days after the options, infections caused by KPC-Kp pose a tremendous administration of KPC-Kp VA-367 to assess whether low therapeutic challenge and are associated with poor clinical 10 levels of carbapenem-resistant K. pneumoniae were present OutCOmeS that could be augmented by the elimination of the anaerobic A treatment protocol in a mouse model as previously microflora. Stool samples were collected at baseline and at 3, described (e.g. Perez et al. Antimicrobial Agents Chemo 6, 8, 11, 16, and 21 days after KPC-Kp VA-367 was given by therapy, 2011) is used to evaluate the testarticle e.g. bacterial gavage. The bacterial composition will be examined by the composition for treating carbapenem resistant Klebsiella and 15 reduction of CRKB in feces. reducing carriage in the GI tract. Female CF1 mice (Harlan Unless otherwise indicated, all numbers expressing quan Sprague-Dawley, Indianapolis, Ind.) are used and are indi tities of ingredients, reaction conditions, and so forth used in vidually housed and weighed between 25 and 30 g. the specification, including claims, are to be understood as The thoroughly characterized strain of K. pneumoniae, being modified in all instances by the term “about.” Accord VA-367 (8, 9, 25) is used in this study. This clinical isolate is ingly, unless otherwise indicated to the contrary, the numeri genetically related to the KPC-Kp strain circulating in the cal parameters are approximations and may vary depending Eastern United States. Characterization of the resistance upon the desired properties sought to be obtained. At the very mechanisms in K. pneumoniae VA-367 with PCR and DNA least, and not as an attempt to limit the application of the sequence analysis revealed the presence of blacs, doctrine of equivalents to the scope of the claims, each blaze, blast-11, and blast-12 as Well as qnrB19 and 25 numerical parameter should be construed in light of the num aac(6')-Ib. Additionally, PCR and DNA sequencing revealed ber of significant digits and ordinary rounding approaches. disruptions in the coding sequences of the following outer Unless otherwise indicated, the term “at least preceding a membrane protein genes: ompK35, ompK36, and ompK37. series of elements is to be understood to refer to every element Antibiotic susceptibility testing (AST) was performed with in the series. the agar dilution method and interpreted according to current 30 While the invention has been particularly shown and recommendations from the Clinical and Laboratory Stan described with reference to a preferred embodiment and vari dards Institute (CLSI). A modified Hodge test was performed, ous alternate embodiments, it will be understood by persons according to a method described previously (e.g. see Ander skilled in the relevant art that various changes in form and son et al., Journal of Clinical Microbiology, 2007) with ertap details can be made therein without departing from the spirit enem, meropenem, and imipenem. Tigecycline and poly 35 and scope of the invention. myxin E were evaluated by Etest susceptibility assays (AB All references, issued patents and patent applications cited bioMerieux, Solna, Sweden). Results for tigecycline were within the body of the instant specification are hereby incor interpreted as suggested by the U.S. Food and Drug Admin porated by reference in their entirety, for all purposes. istration (FDA) and according to CLSI recommendations (criteria for Pseudomonas) for polymyxin E. 40 Additional Tables Mice (10 per group) are assigned to either a testarticle e.g. bacterial composition, ethanol treated, spore preparation (e.g. Table 1: List of Operational Taxonomic Units (OTU) see example 6), antibiotic clindamycin, piperacillin-taZobac with Taxonomic Assignments Made to Genus, tam, tigecycline, ertapenem, cefepime, ciprofloxacin, or Species, and Phylogenetic Clade combination thereof or control group receiving only the 45 vehicle. They are administered the test article daily from day Clade membership of bacterial OTUs is based on 16S -10 to day 0. On day 0, 10 CFU of KPC-Kp VA-367 diluted sequence data. Clades are defined based on the topology of a in 0.5 ml phosphate-buffered saline (PBS) was administered phylogenetic tree that is constructed from full-length 16S by oral gavage using a stainless-steel feeding tube (Perfek sequences using maximum likelihood methods familiar to tum; Popper & Sons, New Hyde Park, N.Y.). Stool samples 50 individuals with ordinary skill in the art of phylogenetics. were collected 1, 4, 6, and 11 days after the administration of Clades are constructed to ensure that all OTUs in a given KPC-Kp in order to measure the concentration of carbap clade are: (i) within a specified number of bootstrap Sup enem-resistant K. pneumoniae. Stool samples (100 mg ported nodes from one another, and (ii) within 5% genetic diluted in 800 ml of PBS) are plated onto MacConkey agar similarity. OTUs that are within the same clade can be distin with and without 0.5ug/ml of imipenem, and the number of 55 guished as genetically and phylogenetically distinct from CFU per gram of stool was determined. Alternatively other OTUs in a different clade based on 16S-V4 sequence data, methods may be used to measure the levels of carbapenem while OTUs falling within the same clade are closely related. resistant K. pneumoniae e.g. per, antigentesting, as one who's OTUs falling within the same clade are evolutionarily closely skilled in the art could perform. related and may or may not be distinguishable from one Stool samples were collected after 5 days of treatment to 60 another using 16S-V4 sequence data. Members of the same assess the effects of the antibiotics on the stool microflora and clade, due to their evolutionary relatedness, play similar func to measure antibiotic levels in stool. To assess the effects on tional roles in a microbial ecology Such as that found in the the microflora, fresh stool samples as previously described human gut. Compositions Substituting one species with (e.g. see examples 2 and 3). Additional experiments are per another from the same clade are likely to have conserved formed to examine whether the administration the testarticle 65 ecological function and therefore are useful in the present e.g. bacterial composition resulted in the elimination or per invention. All OTUs are denoted as to their putative capacity sistence of colonization with KPC-Kp VA-367. to form spores and whether they area Pathogen or Pathobiont US 9,011,834 B1 99 100 (see Definitions for description of “Pathobiont'). NIAID Pri- to exist as a pathogen is unknown are denoted as N. The ority Pathogens are denoted as Category-A, Category-B, SEQ ID Number denotes the identifier of the OTU in the or Category-C, and Opportunistic Pathogens are denoted as Sequence Listing File and Public DB Accession denotes the OP. OTUs that are not pathogenic or for which their ability identifier of the OTU in a public sequence repository. SEQID Public DB Spore Pathogen OTU Number Accession Clade Former Status Eubacterium saburreum 856 ABS25414 clade 178 Y N Eubacterium sp. oral clone IR009 866 AY349376 clade 178 Y N Lachnospiraceae bacterium ICM62 1061 HO6164O1 clade 178 Y N Lachnospiraceae bacterium 1062 HQ616384 clade 178 Y N MSX33 Lachnospiraceae bacterium 1063 ADDSO1000069 clade 178 Y N oral taxon 107 Alicyclobacilius acidocaidarius 122 NR 074721 clade 179 Y N Cliostridium barati 555 NR 029229 clade 223 Y N Cliostridium coilicanis 576 FJ95.7863 clade 223 Y N Clostridium paraputrificum 611 ABS36771 clade 223 Y N Cliostridium sardiniense 621 NR 041006 clade 223 Y N Eubacterium budayi 837 NR 024682 clade 223 Y N Eubacterium moniliforme 851 HF558373 clade 223 Y N Eubacterium multiforme 852 NR 024683 clade 223 Y N Eubacterium nitritogenes 853 NR 024684 clade 223 Y N Anoxybacilius flavithermus 173 NR 074667 clade 238 Y N Bacilius aerophilus 196 NR 042339 clade 238 Y N Bacilius aestuarii 197 GQ980243 clade 238 Y N Bacilius amyloiiquefaciens 199 NR 075005 clade 238 Y N Bacilius anthracis 200 AAENO1000020 clade 238 Y Category-A Bacilius atrophaeus 201 NR 075016 clade 238 Y OP Bacilius badius 202 NR 036893 clade 238 Y OP Bacilius cereus 2O3 ABDO1OOOO15 clade 238 Y OP Bacilius circuians 204 AB271747 clade 238 Y OP Bacilius firmus 207 NR 025842 clade 238 Y OP Bacilius flexus 208 NR 024691 clade 238 Y OP Bacilius fordii 209 NR 025786 clade 238 Y OP Bacilius halnapalus 211 NR 026144 clade 238 Y OP Bacilius herbersteinensis 213 NR 042286 clade 238 Y OP Bacilius idriensis 215 NR 043268 clade 238 Y OP Bacilius lenius 216 NR 040792 clade 238 Y OP Bacilius licheniformis 217 NC OO6270 clade 238 Y OP Bacilius negaterium 218 GU2S2124 clade 238 Y OP Bacilius neaisonii 219 NR 044546 clade 238 Y OP Bacilius niabensis 220 NR 043334 clade 238 Y OP Bacilius niacini 221 NR 024695 clade 238 Y OP Bacilius pocheonensis 222 NR 041377 clade 238 Y OP Bacilius pumilus 223 NR 074977 clade 238 Y OP Bacilius Safensis 224 JQ624766 clade 238 Y OP Bacilius simplex 225 NR 042136 clade 238 Y OP Bacilius Sonorensis 226 NR 025130 clade 238 Y OP Bacilius Sp. 10403.023 227 CAETO100.0089 clade 238 Y OP MM10403.188 Bacilius sp. 2 A57 CT2 230 ACWDO1000095 clade 238 Y OP Bacilius sp. 2008724.126 228 GU2S2108 clade 238 Y OP Bacilius sp. 2008724139 229 GU2S2111 clade 238 Y OP Bacilius sp. 716A1A 231 FN397518 clade 238 Y OP Bacilius sp. AP8 233 JX101689 clade 238 Y OP Bacillus sp. B27(2008) 234 EU362173 clade 238 Y OP Bacilius sp. BT1B CT2 235 ACWCO100.0034 clade 238 Y OP Bacilius sp. GB1.1 236 FT897765 clade 238 Y OP Bacilius sp. GB9 237 FT897766 clade 238 Y OP Bacilius sp. HU19.1 238 FT897769 clade 238 Y OP Bacilius Sp. HU29 239 FJ897771 clade 238 Y OP Bacilius sp. HU33.1 240 FT897772 clade 238 Y OP Bacilius sp. JC6 241 JF8248OO clade 238 Y OP Bacilius sp. oral taxon F79 248 HMO99654 clade 238 Y OP Bacilius sp. SRC DSF1 243 GU797283 clade 238 Y OP Bacilius sp. SRC DSF10 242 GU797292 clade 238 Y OP Bacilius sp. SRC DSF2 244 GU797284 clade 238 Y P Bacilius sp. SRC DSF6 245 GU797288 clade 238 Y OP Bacilius sp. tc09 249 HQ844242 clade 238 Y OP Bacilius sp. zh168 2SO FJ851424 clade 238 Y OP Bacilius sphaericits 251 DQ286318 clade 238 Y OP Bacilius sporothermodurans 252 NR 026010 clade 238 Y OP Bacilius subtiis 253 EU627588 clade 238 Y OP Bacilius thermoamylovorans 254 NR 029151 clade 238 Y OP Bacilius thuringiensis 255 NC O08600 clade 238 Y OP Bacilius weihenStephanensis 256 NR 074926 clade 238 Y OP Geobacillus kaustophilus 933 NR 074989 clade 238 Y N Geobacilius Stearothermophilus 936 NR 040794 clade 238 Y N US 9,011,834 B1 101 102 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Geobacilius thermodenitrificans 938 NR 074976 clade 238 Y N Geobacilius thermoglucosidasius 939 NR 043022 clade 238 Y N Lysinibacilius sphaericits 1193 NR 074883 clade 238 Y N Clostridiales sp. SS3 4 543 AY305316 clade 246 Y N Clostridium beijerinckii 557 NR 074,434 clade 252 Y N Cliostridium bointinum 560 NC 01.0723 clade 252 Y Category-A Clostridium butyricum 561 ABDTO1000017 clade 252 Y N Cliostridium chauvoei 568 EU106372 clade 252 Y N Clost ridium favososportin 582 X76749 clade 252 Y N Clostridium histolyticum 592 HF558362 clade 252 Y N Cliostridium isatidis 597 NR 026347 clade 252 Y N Cliostridium inosum 602 FR870444 clade 252 Y N Clostridium sartagoforme 622 NR 026490 clade 252 Y N Clostridium septicum 624 NR 026020 clade 252 Y N Clostridium sp. 7. 2 43FAA 626 ACDKO1000101 clade 252 Y N Clost ridium sporogenes 645 ABKWO2OOOOO3 clade 252 Y N Cliostridium tertium 653 Y18174 clade 252 Y N Cliostridium carnis 564 NR 044716 clade 253 Y N Cliostridium ceiatum S6S X77844 clade 253 Y N Clostridium disporicum 579 NR 026491 clade 253 Y N Clost ridium gasigenes 585 NR 024945 clade 253 Y N Clostridium quinii 616 NR 026149 clade 253 Y N Clostridium hyiemonae 593 ABO23973 clade 260 Y N Cliostridium scindens 623 AF262238 clade 260 Y N Lachnospiraceae bacterium 1054 ACTRO1000020 clade 260 Y N 5 157FAA Clostridium glycyrrhizinilyticum 588 AB233O29 clade 262 Y N Cliostridium nexile 6O7 X73443 clade 262 Y N Coprococci is comes 674 ABVRO1000038 clade 262 Y N Lachnospiraceae bacterium 1048 ACTMO1000065 clade 262 Y N 1157FAA Lachnospiraceae bacterium 1049 ACTNO1000028 clade 262 Y N 14 56FAA Lachnospiraceae bacterium 1057 ACWQ01000079 clade 262 Y N 8 157FAA Ruminococcus iaciaris 1663 ABOUO2000049 clade 262 Y N Raiminococci is torques 1670 AAVPO2OOOOO2 clade 262 Y N Paenibacilius ialitus 1397 NR 040882 clade 270 Y N Paenibacilius polymyxa 1399 NR 037006 clade 270 Y N Paenibacillus sp. HGF5 1402 AEXSO1000095 clade 270 Y N Paenibacillus sp. HGF7 1403 AFDHO1000147 clade 270 Y N Eubacterium sp. oral clone JIO12 868 AY3493.79 clade 298 Y N Alicyclobacilius contaminans 124 NR 041475 clade 301 Y N Alicyclobacilius herbarius 126 NR 024.753 clade 301 Y N Alicyclobacilius pomorum 127 NR 024801 clade 301 Y N Bialitia coccoides 373 ABS71656 clade 309 Y N Bialitia glucerasea 3.74 ABS88O23 clade 309 Y N Bialitia glucerasei 375 AB439724 clade 309 Y N Biatitia hansenii 376 ABYUO2OOOO37 clade 309 Y N Biatitia initi 378 AB691576 clade 309 Y N Bialitia producia 379 AB600998 clade 309 Y N Biatitia Schinki 380 NR 026312 clade 309 Y N Blautia sp. M25 381 HM626178 clade 309 Y N Biatitia Stercoris 382 HM626177 clade 309 Y N Bialitia welerae 383 EFO36467 clade 309 Y N Bryantella formatexigens 439 ACCLO2000018 clade 309 Y N Cliostridium coccoides 573 EFO25906 clade 309 Y N Eubacterium ceilutioSolvens 839 AY178842 clade 309 Y N Lachnospiraceae bacterium 1056 ACTVO1000014 clade 309 Y N 6 163FAA Ruminococcus hansenii 1662 M59114 clade 309 Y N Ruminococcus obeum 1664 AY169419 clade 309 Y N Ruminococcus sp. 5 139BFAA 1666 AC1101 OOO172 clade 309 Y N Raiminococci is sp. K. 1 1669 AB2222O8 clade 309 Y N Syntrophococci is sticromatians 1911 NR 036869 clade 309 Y N Bacilius alcalophilus 198 X76436 clade 327 Y N Bacilius clausii 205 FN397477 clade 327 Y OP Bacilius gelatini 210 NR 025595 clade 327 Y OP Bacilius halodurans 212 AY144582 clade 327 Y OP Bacilius sp. oral taxon F26 246 HMO99642 clade 327 Y OP Cliostridium innocuum 595 M23732 clade 351 Y N Clostridium sp. HGF2 628 AENWO1000022 clade 351 Y N Clostridium perfingens 612 ABDWO1000023 clade 353 Y Category-B Sarcina ventrictii 1687 NR 026146 clade 353 Y N Cliostridium bartietti 556 ABEZO2OOOO12 clade 354 Y N Clostridium bifermenians 558 X73437 clade 354 Y N US 9,011,834 B1 103 104 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Clostridium ghonii 586 ABS42933 clade 354 Y N Clostridium glycolicum 587 FJ384385 clade 354 Y N Clostridium mayombei 60S FR733682 clade 354 Y N Cliostridium sordei 625 AB448946 clade 354 Y N Clostridium sp. MT4 E 635 FJ 159523 clade 354 Y N Eubacterium tennie 872 M591.18 clade 354 Y N Clostridium argentinense 553 NR 029232 clade 355 Y N Clostridium sp. JC122 630 CAEVO1OOO127 clade 355 Y N Clostridium sp. NMBHI 1 636 JNO93130 clade 355 Y N Cliostridium subterminaie 650 NR 041795 clade 355 Y N Clostridium sulfidigenes 651 NR 044161 clade 355 Y N Dorea formicigenerans 773 AAXAO2OOOOO6 clade 360 Y N Dorea longicatena 774 A132842 clade 360 Y N Lachnospiraceae bacterium 1050 ADLBO1000035 clade 360 Y N 21 46FAA Lachnospiraceae bacterium 1051 ACTOO1000052 clade 360 Y N 2 158FAA Lachnospiraceae bacterium 1053 ADCRO1000030 clade 360 Y N 4 137FAA Lachnospiraceae bacterium 1058 ACTXO1000023 clade 360 Y N 91 43BFAA Raiminococcus gnavuts 1661 X94967 clade 360 Y N Ruminococcus sp. ID8 1668 AY960S64 clade 360 Y N Bialitia hydrogenotrophica 377 ACBZO1000217 clade 368 Y N Lactonifactor longovifornis 1147 DQ100449 clade 368 Y N Robinsoniella peoriensis 1633 AF44S258 clade 368 Y N Eubacterium infirmum 849 U13039 clade 384 Y N Eubacterium sp. WAL 14571 864 F687606 clade 384 Y N Erysipelotrichaceae bacterium 823 ACZWO1000054 clade 385 Y N 5 254FAA Eubacterium biforme 835 ABYTO1OOOOO2 clade 385 Y N Eubacterium cylindroides 842 FP929O41 clade 385 Y N Eubacterium doichum 844 L34682 clade 385 Y N Eubacterium sp. 31 31 861 ACTLO 1000045 clade 385 Y N Eubacterium tortuosum 873 NR 044648 clade 385 Y N Buileidia extrucia 441 ADFRO1000011 clade 388 Y N Soiobacterium moorei 1739 AECQ01000039 clade 388 Y N Coprococciis Caius 673 EU266552 clade 393 Y N Lachnospiraceae bacterium 1064 HMO99641 clade 393 Y N oral taxon F15 Cliostridium cochlearium 574 NR 044717 clade 395 Y N Cliostridium maienominatium 604 FR749893 clade 395 Y N Cliostridium tetani 654 NC OO4557 clade 395 Y N Acetivibrio ethanolgigners 6 FR749897 clade 396 Y N Anaerosporobacter mobilis 161 NR 042953 clade 396 Y N Bacteroidespectinophilus 288 ABVQ0100.0036 clade 396 Y N Cliostridium aminovaiericum 551 NR 029245 clade 396 Y N Clostridium phytofermenians 613 NR 074652 clade 396 Y N Eubacterium hai 848 L34621 clade 396 Y N Eubacterium xylanophilum 875 L34628 clade 396 Y N Ruminococcus calidus 1658 NR 029160 clade 406 Y N Raiminococci is champanellensis 1659 FP929052 clade 406 Y N Ruminococcus sp. 18P13 166S AJS15913 clade 406 Y N Ruminococcus sp. 9SE51 1667 FM954974 clade 406 Y N Anaerostipes caccae 162 ABAXO3OOOO23 clade 408 Y N Anaerostipes sp. 3 2 56FAA 163 ACWBO1000002 clade 408 Y N Cliostridiaies bacterium 541 ABQRO1000074 clade 408 Y N 1747FAA Clostridiales sp. SM41 542 FP929060 clade 408 Y N Clostridiales sp. SSC 2 544 FP929061 clade 408 Y N Cliostridium aerotoierans S46 X761.63 clade 408 Y N Cliostridium aidenense 547 NR 043680 clade 408 Y N Clostridium algidiyyianolyticum 550 NR 028726 clade 408 Y N Clostridium amygdalinum 552 AY353957 clade 408 Y N Clost ridium asparagiforme 554 ACCJO1000522 clade 408 Y N Cliostridium boiteae 559 ABCCO2OOOO39 clade 408 Y N Cliostridium celerecrescens 566 JQ246092 clade 408 Y N Cliostridium citroniae 569 ADLO1OOOOS9 clade 408 Y N Clostridium clostridiiformes 571 M59089 clade 408 Y N Clostridium clostridioforme 572 NR 044715 clade 408 Y N Clostridium hathewayi 590 AY552788 clade 408 Y N Cliostridium indois 594 AFO28351 clade 408 Y N Cliostridium iavaiense 600 EF564277 clade 408 Y N Clostridium saccharolyticum 620 CPOO2109 clade 408 Y N Clostridium sp. M62 1 633 ACFXO2000046 clade 408 Y N Clostridium sp. SS2 1 638 ABGCO3OOOO41 clade 408 Y N US 9,011,834 B1 105 106 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Clostridium sphenoides 643 X73449 clade 408 Y N Clostridium symbiosum 652 ADLQ01000114 clade 408 Y N Clostridium xvianolyticum 658 NR 037O68 clade 408 Y N Eubacterium hadrum 847 FR749933 clade 408 Y N Lachnospiraceae bacterium 1052 ACTPO1OOO124 clade 408 Y N 3 157FAA CT1 Lachnospiraceae bacterium 1OSS ACTSO1OOOO81 clade 408 Y N 5 1 63FAA Lachnospiraceae bacterium A4 1059 DQ789118 clade 408 Y N Lachnospiraceae bacterium 1060 EU728771 clade 408 Y N DJF VP30 Lachnospiraceae genomosp. C1 106S AY2786.18 clade 408 Y N Clostridium difficile 578 NC 013315 clade 409 Y OP Eubacterium sp. AS15b 862 HQ616364 clade 428 Y N Eubacterium sp. OBRC9 863 HQ616354 clade 428 Y N Eubacterium sp. oral clone OH3A 871 AY947497 clade 428 Y N Eubacterium yuri 876 AEESO1 OOOO73 clade 428 Y N Clostridium acetobutyllicum 545 NR 074511 clade 430 Y N Clostridium algidicarnis 549 NR 041746 clade 430 Y N Cliostridium cadaveris S62 ABS42932 clade 430 Y N Cliostridium carboxidivorans 563 FR733710 clade 430 Y N Cliostridium esteriheticum 580 NR 042153 clade 430 Y N Clostridium fallax 581 NR 044714 clade 430 Y N Clostridium feisineum 583 AF2705O2 clade 430 Y N Clostridium frigidicarnis 584 NR 024919 clade 430 Y N Clostridium kluyveri 598 NR 0741.65 clade 430 Y N Clostridium magnum 603 X77835 clade 430 Y N Clostridium putrefaciens 615 NR 024995 clade 430 Y N Clostridium sp. HPB 46 629 AY862516 clade 430 Y N Clostridium tyrobutyricum 656 NR 044718 clade 430 Y N Sutterella parvirubra 1899 AB3OO989 clade 432 Y N Acetanaerobacterium elongatum 4 NR 042930 clade 439 Y N Cliostridium ceiliuliosi 567 NR 044624 clade 439 Y N Ethanoligenens harbinense 832 AY675965 clade 439 Y N Eubacterium reciaie 856 FP929O42 clade 444 Y N Eubacterium sp. oral clone GIO38 865 AY349374 clade 444 Y N Lachnobacterium bovis 1O4S GU324.407 clade 444 Y N Roseburia Cecicola 1634 GU233441 clade 444 Y N Roseburia faecalis 1635 AY804149 clade 444 Y N Roseburia faecis 1636 AY305310 clade 444 Y N Roseburia hominis 1637 A270482 clade 444 Y N Roseburia intestina is 1638 FP929OSO clade 444 Y N Roseburia intinivorans 1639 A270473 clade 444 Y N Brevibacilius brevis 410 NR 041524 clade 448 Y N Brevibacilius laterosporus 414 NR 037005 clade 448 Y N Bacilius coaglians 206 DQ297928 clade 451 Y OP Sporolactobacilius inulinus 1752 NR 040962 clade 451 Y N Kochiria palustris 1041 EU333884 clade 453 Y N Nocardia farcinica 1353 NC OO6361 clade 455 Y N Bacilius sp. oral taxon F28 247 HMO996SO clade 456 Y OP Catenibacterium mitsuokai 495 ABO3O224 clade 469 Y N Clostridium sp. TM 40 640 AB249652 clade 469 Y N Coprobacilius cateniformis 670 ABO3O218 clade 469 Y N Coprobacilius sp. 29 1 671 ADKXO1000057 clade 469 Y N Cliostridium recium 618 NR 029271 clade 470 Y N Eubacterium nodalium 854 U13O41 clade 476 Y N Etibacterium Saphentin 859 NR 026.031 clade 476 Y N Eubacterium sp. oral clone JHO12 867 AY349373 clade 476 Y N Eubacterium sp. oral clone JS001 870 AY3493.78 clade 476 Y N Faecalibacterium prausnitzii 880 ACOPO2OOOO11 clade 478 Y N Gemmiger formicilis 932 GUS 62446 clade 478 Y N Subdoigranulum variabile 1896 AJS18869 clade 478 Y N Cliostridiaceae bacterium JC13 532 JF824.807 clade 479 Y N Clostridium sp. MLGO55 634 AF30443S clade 479 Y N Erysipelotrichaceae bacterium 822 ACTJO1000113 clade 479 Y N 3 153 Cliostridium cocleatum 575 NR 026495 clade 481 Y N Cliostridium ranosum 617 M23731 clade 481 Y N Clostridium saccharogumia 619 DQ100445 clade 481 Y N Clostridium spiroforme 644 X73441 clade 481 Y N Coprobacilius sp. D7 672 ACDTO1000199 clade 481 Y N Cliostridiales bacterium SY8519 535 AB477431 clade 482 Y N Clostridium sp. SY8519 639 APO12212 clade 482 Y N Eubacterium ramitius 855 AJO11522 clade 482 Y N Erysipeiothrix inopinata 819 NR 025594 clade 485 Y N Erysipeiothrix rhusiopathiae 820 ACLKO1000021 clade 485 Y N US 9,011,834 B1 107 108 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Erysipeiothrix tonsillarum 821 NR 040871 clade 485 Y N Holdemania filiformis 1004 Y11466 clade 485 Y N Mollicutes bacterium pACH93 1258 AY297808 clade 485 Y N Coxieia burnetii 736 CPOOO890 clade 486 Y Category-B Cliostridium hiranonis 591 ABO23970 clade 487 Y N Clostridium irregulare 596 NR 029249 clade 487 Y N Cliostridium orbiscindens 609 Y18187 clade 494 Y N Clostridium sp. NML 04A032 637 EU815224 clade 494 Y N Flavonifactor plautii 886 AY724678 clade 494 Y N Pseudoflavonifactor capiliosus 1591 AY136666 clade 494 Y N Ruminococcaceae bacterium D16 1655 ADDXO1000083 clade 494 Y N Acetivibrio cellulolyticus 5 NR 025917 clade 495 Y N Cliostridium aidrichii 548 NR 026099 clade 495 Y N Clostridium clarifiavum 570 NR 041235 clade 495 Y N Cliostridium Stercorarium 647 NR 025 100 clade 495 Y N Cliostridium straminisolvens 649 NR 024829 clade 495 Y N Cliostridium thermocelium 655 NR 074629 clade 495 Y N Fusobacterium nucleatum 901 ADVKO1000034 clade 497 Y N Eubacterium barkeri 834 NR 044661 clade 512 Y N Eubacterium caiianderi 838 NR 026330 clade 512 Y N Eubacterium inosum 850 CPOO2273 clade 512 Y N Anaerotruncus coihominis 164 ABGDO2000021 clade 516 Y N Clostridium methylpentosum 606 ACECO1000059 clade 516 Y N Clostridium sp. YIT 12070 642 AB4912O8 clade 516 Y N Hydrogenoanaerobacterium 1005 NR 044.425 clade 516 Y N SaccharovOrans Ruminococcus aibus 1656 AY4456OO clade 516 Y N Raiminococci is fiavefaciens 1660 NR 025931 clade 516 Y N Clostridium haemolyticum 589 NR 024749 clade 517 Y N Clostridium novyi 608 NR 074343 clade 517 Y N Clostridium sp. LMG 16094 632 X95274 clade 517 Y N Eubacterium ventriosum 874 L34421 clade 519 Y N Bacteroides galactiironicus 280 DQ497994 clade 522 Y N Eubacterium eligens 845 CPOO1104 clade 522 Y N Lachnospira multipara 1046 FR733699 clade 522 Y N Lachnospira pectinoschiza 1047 L14675 clade 522 Y N Lactobacilius rogosae 1114 GU269544 clade 522 Y N Bacilius horii 214 NR 036860 clade 527 Y OP Bacilius sp. 9 3AIA 232 FN397519 clade 527 Y OP Eubacterium brachy 836 U13038 clade 533 Y N Filifactor alocis 881 CPOO2390 clade 533 Y N Filifactor villosus 882 NR 041928 clade 533 Y N Clostridium leptum 6O1 AJ3OS238 clade 537 Y N Clostridium sp. YIT 12069 641 AB4912O7 clade 537 Y N Clost ridium sporosphaeroides 646 NR 044835 clade 537 Y N Etibacterium coprostanoigenes 841 HMO37995 clade 537 Y N Ruminococcus bromii 1657 EU266549 clade 537 Y N Eubacterium Siraeum 860 ABCAO3000054 clade 538 Y N Cliostridium viride 657 NR 026.204 clade 540 Y N Oscillibacter sp. G2 1386 HM626173 clade 540 Y N Oscillibacter valericigenes 1387 NR 074793 clade 540 Y N Oscillospira guilliermondii 1388 ABO40495 clade 540 Y N Butyrivibrio crossotus 455 ABWNO1000012 clade 543 Y N Clostridium sp. L2 50 631 AAYWO2000018 clade 543 Y N Coprococciis elitacius 675 EFO31543 clade 543 Y N Coprococcus sp. ART55 1 676 AY3SO746 clade 543 Y N Eubacterium ruminantium 857 NR 024661 clade 543 Y N Collinseila aerofaciens 659 AAVNO2OOOOO7 clade 553 Y N Alkaliphilus metailinedigenes 137 AY137848 clade 554 Y N Alkaliphilus oremlandii 138 NR 043674 clade 554 Y N Cliostridium Stickiandi 648 LO4167 clade 554 Y N Turicibacter sanguinis 1965 AF349724 clade 555 Y N Fulvimonas sp. NML 060897 892 EF589680 clade 557 Y N Desulfitobacterium frappieri 753 AJ276701 clade 560 Y N Desulfitobacterium hafniense 754 NR 074996 clade 560 Y N Desulfotomaculum nigrificans 756 NR 044832 clade 560 Y N Lutiispora thermophile 1191 NR 041236 clade 564 Y N Brachyspira pilosicoli 405 NR 075069 clade 565 Y N Eggerihelia lenia 778 AF292375 clade 566 Y N Streptomyces albus 1888 A697941 clade 566 Y N Chlamydiales bacterium NS11 SOS JN606074 clade 567 Y N Anaerofustis stercorihominis 159 ABILO2OOOOOS clade 570 Y N Butyricicocci is pullicaecorum 453 HEHA93440 clade 572 Y N Eubacterium desmoians 843 NR 044644 clade 572 Y N Papillibacter cinnamivorans 1415 NR 025O25 clade 572 Y N Sporobacter termitidis 1751 NR 044972 clade 572 Y N US 9,011,834 B1 109 110 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Deferribacteres sp. oral clone 744 AY349371 clade 575 Y N JVOO6 Cliostridium coinum 577 NR 026151 clade 576 Y N Clostridium lactatifermenians 599 NR 025651 clade 576 Y N Clostridium piliforme 614 D14639 clade 576 Y N Saccharomonospora viridis 1671 XS4286 clade 579 Y N Thermobifida fisca 1921 NC 007333 clade 579 Y N Leptospira licerasiae 1164 EF612284 clade 585 Y OP Moorelia thermoacetica 1259 NR 075001 clade 590 Y N Thermoanaerobacter 1920 CPOOO924 clade 590 Y N pseudeihanolicits Flexistipes sinusarabici 888 NR 074881 clade 591 Y N Gioeobacter violaceus 942 NR 074282 clade 596 Y N Eubacterium sp. oral clone JN088 869 AY349377 clade 90 Y N Cliostridium oroticum 610 FR749922 clade 96 Y N Clostridium sp. D5 627 ADBGO1000142 clade 96 Y N Eubacterium contorium 840 FR749946 clade 96 Y N Etibacterium fissicatena 846 FR74993S clade 96 Y N Corynebacterium coyleae 692 X96497 clade 100 N N Corynebacterium mucifaciens 711 NR 0263.96 clade 100 N N Corynebacterium 733 AM397636 clade 100 N N itreicelerivorans Corynebacterium appendicis 684 NR 028951 clade 102 N N Corynebacterium genitalium 698 ACLO1 OOOO31 clade 102 N N Corynebacterium glauctim 699 NR 028971 clade 102 N N Corynebacterium imitans 703 AF537597 clade 102 N N Corynebacterium riegelii 719 EU848548 clade 102 N N Corynebacterium sp. 723 HE575405 clade 102 N N L 2012475 Corynebacterium sp. NML 724 GU2384.09 clade 102 N N 93 0481 Corynebacterium sundsvallense 728 YO9655 clade 102 N N Corynebacterium tuscaniae 730 AY677186 clade 102 N N Prevoteia naciosa 1504 AGEKO1000035 clade 104 N N Prevoteia or is 1513 ADDVO1000091 clade 104 N N Prevoteiia Saivae 1517 AB108826 clade 104 N N Prevotella sp. ICM55 1521 HQ616399 clade 104 N N Prevoteila sp. oral clone AA020 1528 AYOO5057 clade 104 N N Prevoteila sp. oral clone GIO32 1538 AY349396 clade 104 N N Prevoteila sp. oral taxon G70 1558 GU4321.79 clade 104 N N Prevoteila corporis 1491 L164.65 clade 105 N N Bacteroides sp. 4 136 312 ACTCO1000133 clade 110 N N Bacteroides sp. AR20 31S AF139524 clade 110 N N Bacteroides sp. D20 319 ACPTO1OOOOS2 clade 110 N N Bacteroides sp. F 4 322 AB470322 clade 110 N N Bacteroides uniformis 329 ABOSO110 clade 110 N N Prevoteia nanceiensis S10 JN867228 clade 127 N N Prevoteila sp. oral taxon 299 548 ACWZO1000026 clade 127 N N Prevoteila bergensis 485 ACKSO1000100 clade 128 N N Prevoteia buccais 489 N867261 clade 129 N N Prevoteia timonensis 564 ADEFO1000012 clade 129 N N Prevoteia orais S12 AEPEO1 OOOO21 clade 130 N N Prevotella sp. SEQ072 525 JN867238 clade 130 N N LeticonoStoc Carnostin 177 NR 040811 clade 135 N N Leticonostoc gasicomitatin 179 FN822744 clade 135 N N Leticonostoc inhae 180 NR 025.204 clade 135 N N Leuconostockinchi 181 NR 075O14 clade 135 N N Edwardsielia tarda 777 CPOO2154 clade 139 N N Photorhabdus asymbiotica 466 Z76752 clade 139 N N Psychrobacter arcticus 607 CPOOOO82 clade 141 N N Psychrobacter cibarius 608 HQ698586 clade 141 N N Psychrobacter cryohaiolentis 609 CPOOO323 clade 141 N N Psychrobacter faecalis 610 HQ698566 clade 141 N N Psychrobacter nivimaris 611 HQ698587 clade 141 N N Psychrobacter pulmonis 612 HQ698.582 clade 141 N N Pseudomonas aeruginosa 592 AABQ07000001 clade 154 N N Pseudomonas sp. 2. 1 26 600 ACWUO1000257 clade 154 N N Corynebacterium confusum 691 Y15886 clade 158 N N Corynebacterium propinquin 712 NR 037038 clade 158 N N Corynebacterium 713 X84258 clade 158 N N pseudodiphtheriticum Bartonella baciliiformis 338 NC 008783 clade 159 N N Bartonella grahamii 339 CPOO1562 clade 159 N N Bartoneia henseiae 340 NCOO5956 clade 159 N N Bartonelia quintana 341 BX8977OO clade 159 N N Bartoneia tanniae 342 EF672728 clade 159 N N US 9,011,834 B1 111 112 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Bartoneia washoensis 343 FTT19017 clade 159 Bruceiia abortus 430 ACBJO1000075 clade 159 N Category-B Bruceiia canis 431 NR 044652 clade 159 N Category-B Bruceiia ceti 432 ACJDO1000006 clade 159 N Category-B Bruceiia neitensis 433 AEOO9462 clade 159 N Category-B Bruceiia microti 434 NR 042549 clade 159 N Category-B Bruceiia ovis 435 NC OO9504 clade 159 N Category-B Brucella sp. 83 13 436 ACBQ01000040 clade 159 N Category-B Brucella sp. B01 437 EU0532O7 clade 159 N Category-B Bruceiia Suis 438 ACBKO100.0034 clade 159 N Category-B Ochrobactrum anthropi 360 NC 009667 clade 159 N N Ochrobactrum intermedium 361 ACQAO1000001 clade 159 N N Ochrobactrum 362 DQ365921 clade 159 N N pseudintermedium Prevoteila genomosp. C2 496 AY278625 clade 164 N N Prevoteia multisaccharivorax SO9 AFJEO1OOOO16 clade 164 N N Prevoteia sp. oral clone 543 AY55.0997 clade 164 N N IDR CEC OO55 Prevoteia sp. oral taxon 292 547 GQ422735 clade 164 N N Prevoteia sp. oral taxon 300 549 GU409549 clade 164 N N Prevoteia marshii SOS AEEIO1OOOO70 clade 166 N N Prevoteia sp. oral clone IKO53 544 AY3494O1 clade 166 N N Prevoteia sp. oral taxon 781 554 GQ422744 clade 166 N N Prevoteia sterCorea S62 AB244774 clade 166 N N Prevoteia brevis 487 NR 041954 clade 167 N N Prevoteia ruminicoia S16 CPOO2006 clade 167 N N Prevoteila sp. sp24 S60 ABOO3384 clade 167 N N Prevoteila sp. sp34 561 ABOO338S clade 167 N N Prevoteia aibensis 483 NR 025300 clade168 N N Prevoteila copri 490 ACBXO2000014 clade 168 N N Prevoteia ottiorum S14 L164.72 clade 168 N N Prevoteia sp. B142 S18 AJS81354 clade 168 N N Prevoteia sp. oral clone 546 AY207 OSO clade 168 N N P4 PB 83 P2 Prevoteia sp. oral taxon G60 557 GU4321.33 clade 168 N N Prevoteia annii 484 ABS47670 clade 169 N N Bacteroides caccae 268 EU1366.86 clade 170 N N Bacteroides finegoidii 277 AB222699 clade 170 N N Bacteroides intestinais 283 ABLO2OOOOO6 clade 171 N N Bacteroides sp. XB44A 326 AM23O649 clade 171 N N Bifidobacteriaceae genomosp. C1 345 AY278612 clade 172 N N Bifidobacterium adolescentis 346 AAXDO2000018 clade 172 N N Bifidobacterium angulatum 347 ABYSO2000004 clade 172 N N Bifidobacterium animalis 348 CPOO1606 clade 172 N N Bifidobacterium breve 350 CPOO2743 clade 172 N N Bifidobacterium catenulatum 351 ABXYO1000019 clade 172 N N Bifidobacterium dentium 352 CPOO1750 clade 172 N OP Bifidobacterium gallicum 353 ABXBO3OOOOO4 clade 172 N N Bifidobacterium infantis 354 AY151398 clade 172 N N Bifidobacterium 355 AB491757 clade 172 N N kashiwanohense Bifidobacterium longum 356 ABQQ01000041 clade 172 N N Bifidobacterium 357 ABXXO2000002 clade 172 N N pseudocatentiatin Bifidobacterium pseudolongtim 358 NR 043442 clade 172 N N Bifidobacterium scardovii 359 AJ307OOS clade 172 N N Bifidobacterium sp. HM2 360 AB425276 clade 172 N N Bifidobacterium sp. HMLN12 361 JFS19685 clade 172 N N Bifidobacterium sp. M45 362 HM626176 clade 172 N N Bifidobacterium sp. MSX5B 363 HQ616382 clade 172 N N Bifidobacterium sp. TM 7 364 AB218972 clade 172 N N Bifidobacterium thermophilum 365 DQ340557 clade 172 N N LeticonoStoc Citretin 1178 AM157444 clade 175 N N Leticonostoc lactis 1182 NR 040823 clade 175 N N Alicyclobacilius acidoterrestris 123 NR 040844 clade 179 N N Alicyclobacilius 125 NR 024754 clade 179 N N cycloheptanicus Acinetobacter battmannii 27 ACYQ01000014 clade 181 N N Acinetobacter Caicoaceticus 28 AM157426 clade 181 N N Acinetobacter genomosp. C1 29 AY278.636 clade 181 N N Acinetobacter haemolyticus 30 ADMTO1000017 clade 181 N N Acinetobacter johnsonii 31 ACPLO1000162 clade 181 N N Acinetobacteriinii 32 ACPMO1000135 clade 181 N N Acinetobacter twofi 33 ACPNO1000204 clade 181 N N Acinetobacter parvus 34 AIEBO1OOO124 clade 181 N N Acinetobacterschindleri 36 NR 025412 clade181 N N US 9,011,834 B1 113 114 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Acinetobacter sp. 56A1 37 GQ178049 clade 181 N N Acinetobacter sp. CIP 101934 38 JQ638573 clade 181 N N Acinetobacter sp. CIP 102143 39 JQ638578 clade 181 N N Acinetobacter sp. M16 22 41 HM366447 clade 181 N N Acinetobacter sp. RUH2624 42 ACQFO1000094 clade 181 N N Acinetobacter sp. SH024 43 ADCHO100.0068 clade 181 N N Lactobacilitisiensenii 092 ACQD01000066 clade 182 N N Alcaligenes faecalis 119 AB68O368 clade 183 N N Alcaligenes sp. CO14 120 DQ643040 clade 183 N N Alcaligenes sp. S3 121 HQ262549 clade 183 N N Oigella ureolytica 366 NR 041998 clade 183 N N Oigella urethralis 367 NR 041753 clade 183 N N Eikeneia corrodens 784 ACEAO1000028 clade 185 N N Kingeila denitrificans O19 AEWVO1000047 clade 185 N N Kingeila genomosp. P1 oral O2O DOOO3616 clade 185 N N come MB2 O20 Kingeila kingae O21 AFHSO1000073 clade 185 N N Kingeila oralis O22 ACJWO2000005 clade 185 N N Kingeila sp. oral clone ID059 O23 AY349381 clade 185 N N Neisseria elongata 330 ADBFO1000003 clade 185 N N Neisseria genomosp. P2 oral 332 DOOO3630 clade 185 N N clone MBS P15 Neisseria sp. oral clone JC012 345 AY349388 clade 185 N N Neisseria sp. SMC A9199 342 FTT63637 clade 185 N N Simonsieia matelieri 731 ADCYO1OOO105 clade 185 N N Corynebacterium 700 ABYPO1000081 clade 193 N N glucuronolytictim Corynebacterium 716 FJ 185225 clade 193 N N pyruviciproducers Rothia aeria 1649 DQ673320 clade 194 N N Rothia dentocariosa 1650 ADDWO1000024 clade 194 N N Rothia sp. oral taxon 188 1653 GU470892 clade 194 N N Corynebacterium accolens 681 ACGDO1000048 clade 195 N N Corynebacterium macginleyi 707 AB359393 clade 195 N N Corynebacterium pseudogenitalium 714 ABYQ01000237 clade 195 N N Corynebacterium 729 ACVPO1000009 clade 195 N N tubercutioStearicum Lactobacilius casei 1074 CPOOO423 clade 198 N N Lactobacilius paracasei 1106 ABQVO1000067 clade 198 N N Lactobacilius zeae 1143 NR 037122 clade 198 N N Prevoteia denia is 1492 ABS47678 clade 205 N N Prevoteila sp. oral clone ASCG10 1529 AY923148 clade 206 N N Prevoteila sp. oral clone HF050 1541 AY349399 clade 206 N N Prevoteila sp. oral clone ID019 1542 AY3494OO clade 206 N N Prevoteila sp. oral clone IK062 1545 AY3494O2 clade 206 N N Prevoteila genomosp. P9 oral 1499 DQ003633 clade 207 N N clone MB7 G16 Prevoteila sp. oral clone AU069 1531 AYOOSO62 clade 207 N N Prevoteila sp. oral clone CY006 1532 AYOOSO63 clade 207 N N Prevoteila sp. oral clone FLO19 1534 AY349392 clade 207 N N Actinomyces genomosp. C1 S6 AY27861 O clade 212 N N Actinomyces genomosp. C2 57 AY278611 clade 212 N N Actinomyces genomosp. P1 S8 DOOO3632 clade 212 N N oral clone MB6 003 Actinomyces georgiae S9 GUS 61319 clade 212 N N Actinomyces israeli 60 AF47927O clade 212 N N Actinomyces massiliensis 61 ABS45934 clade 212 N N Actinomyces meyeri 62 GUS 61321 clade 212 N N Actinomyces Odontolyticits 66 ACYTO1OOO123 clade 212 N N Actinomyces orihominis 68 AJS751.86 clade 212 N N Actinomyces sp. CCUG 37290 71 AU234058 clade 212 N N Actinomyces sp. ICM34 75 HQ616391 clade 212 N N Actinomyces sp. ICM41 76 HQ616392 clade 212 N N Actinomyces sp. ICM47 77 HQ616395 clade 212 N N Actinomyces sp. ICM54 78 HQ616398 clade 212 N N Actinomyces sp. oral clone IP081 87 AY349366 clade 212 N N Actinomyces sp. oral taxon 178 91 AEUHO1000060 clade 212 N N Actinomyces sp. oral taxon 180 92 AEPPO1000041 clade 212 N N Actinomyces sp. TeS 80 GUS 61315 clade 212 N N Haematobacter sp. BC14248 968 GU396991 clade 213 N N Paracoccus denitrificans 1424 CPOOO490 clade 213 N N Paracoccus marchisi 1425 NR 044922 clade 213 N N Grimonia hoisae 967 ADAQ01000013 clade 216 N N Shewanelia puttrefaciens 1723 CPOO2457 clade 216 N N Afipia genomosp. 4 111 EU 117385 clade 217 N N US 9,011,834 B1 115 116 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Rhodopseudomonas palustris 1626 CPOOO3O1 clade 217 N N Methyliobacterium extorquens 1223 NC 01.0172 clade 218 N N Methyliobacterium podarium 1224 AY468.363 clade 218 N N Methyliobacterium radiotolerans 122S GU294320 clade 218 N N Methyliobacterium sp. 1Sub 1226 AY468371 clade 218 N N Methyliobacterium sp. MM4 1227 AY468370 clade 218 N N Achromobacter denitrificans 18 NR 042021 clade 224 N N Achromobacter piechaudii 19 ADMSO1000149 clade 224 N N Achromobacter xylosoxidans 20 ACRCO1000072 clade 224 N N Bordeteila bronchiseptica 384 NR 025949 clade 224 N OP Bordeteia hoinnesii 385 AB6831.87 clade 224 N OP Bordeteila parapertissis 386 NR 025950 clade 224 N OP Bordeteila pertissis 387 BX640418 clade 224 N OP Microbacterium chocolatum 1230 NR 037045 clade 225 N N Microbacterium flavescens 1231 EU714363 clade 225 N N Microbacterium iacticum 1233 EU714351 clade 225 N N Microbacterium oieivorans 1234 EU714381 clade 225 N N Microbacterium oxydans 1235 EU714348 clade 225 N N Microbacterium paraOxydans 1236 AJ491806 clade 225 N N Microbacterium phyllosphaerae 1237 EU714359 clade 225 N N Microbacterium Schleiferi 1238 NR 044936 clade 225 N N Microbacterium sp. 768 1239 EU714378 clade 225 N N Microbacterium sp. oral strain 1240 AF287752 clade 225 N N C24KA Microbacterium testaceum 1241 EU71436S clade 225 N N Corynebacterium atypictim 686 NR 025540 clade 229 N N Corynebacterium mastitidis 708 AB359395 clade 229 N N Corynebacterium sp. NML 72S GU2384.11 clade 229 N N 97 O186 Mycobacterium elephantis 1275 AF3.85898 clade 237 N OP Mycobacterium paraterrae 1288 EU919229 clade 237 N OP Mycobacteriumphlei 1289 GU142920 clade 237 N OP Mycobacterium sp. 1776 1293 EU703152 clade 237 N N Mycobacterium sp. 1781 1294 EU703147 clade 237 N N Mycobacterium sp. AQ1GA4 1297 HM210417 clade 237 N N Mycobacterium sp. GN 10546 1299 FJ497243 clade 237 N N Mycobacterium sp. GN 10827 1300 FJ497247 clade 237 N N Mycobacterium sp. GN 11124 1301 F652846 clade 237 N N Mycobacterium sp. GN 918.8 1302 FJ497240 clade 237 N N Mycobacterium sp. GR 2007 210 1303 FJ555.538 clade 237 N N Anoxybacilius contaminans 172 NR 029006 clade 238 N N Bacilius aeolitis 195 NR 025557 clade 238 N N Brevibacterium frigoritolerans 422 NR 042639 clade 238 N N Geobacilius sp. E263 934 DQ647387 clade 238 N N Geobacillus sp. WCH70 935 CPOO1638 clade 238 N N Geobacilius thermocatentiaius 937 NR 043020 clade 238 N N Geobacilius thermoleovorans 940 NR 074931 clade 238 N N Lysinibacilius fusiformis 192 FN397522 clade 238 N N Pianonicrobium koreense 468 NR 025O11 clade 238 N N Sporosarcina newyorkensis 754 AFPZO1000142 clade 238 N N Sporosarcina sp. 2681 7SS GU994081 clade 238 N N Ureibacilius composti 968 NR 043746 clade 238 N N Ureibacilius Suwonensis 969 NR 043232 clade 238 N N Ureibacilius terrents 970 NR 025394 clade 238 N N Ureibacilius thermophilus 971 NR 043747 clade 238 N N Ureibacilius thermosphaericus 972 NR 040961 clade 238 N N Prevoteia micans 507 AGWKO1000061 clade 239 N N Prevoteila sp. oral clone DAO58 533 AYOO5065 clade 239 N N Prevotella sp. SEQ053 S23 JN867222 clade 239 N N Treponema Socranski 937 NR 024868 clade 240 N OP Treponema sp. 6:H:D15A 4 938 AYOOSO83 clade 240 N N Treponema sp. oral taxon 265 953 GU4088SO clade 240 N N Treponema sp. oral taxon G85 958 GU432215 clade 240 N N Porphyromonas endodontalis 472 ACNNO 1000021 clade 241 N N Porphyromonas sp. oral clone 478 AYOOSO68 clade 241 N N BB134 Porphyromonas sp. oral clone 479 AYOOSO69 clade 241 N N FO16 Porphyromonas sp. oral clone 480 AY2O7054 clade 241 N N P2PB 52 P1 Porphyromonas sp. oral clone 481 AY2O7.057 clade 241 N N P4GB 1OOP2 Acidovorax sp. 98 63833 26 AY2S806S clade 245 N N Comamonadaceae bacterium 663 JN5853.35 clade 245 N N NMLOOO13S US 9,011,834 B1 117 118 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Comamonadaceae bacterium 664 JNS85331 clade 245 N N NML790751 Comamonadaceae bacterium 665 JN585332 clade 245 N N NM L910O3S Comamonadaceae bacterium 666 JNS85333 clade 245 N N NM L910O36 Comamonas sp. NSP5 668 ABO76850 clade 245 N N Delfia acidovorans 748 CPOOO884 clade 245 N N Xenophilus aeroiatus 2018 JNS85329 clade 245 N N Oribacterium sp. oral taxon 078 1380 ACIQ02000009 clade 246 N N Oribacterium sp. oral taxon 102 1381 GQ422713 clade 246 N N Weisseiia cibaria 2007 NR 036924 clade 247 N N Weissella confusa 2008 NR 040816 clade 247 N N Weisseia heienica 2009 AB680902 clade 247 N N Weisseila kandieri 2010 NR 044659 clade 247 N N Weisseiia koreensis 2011 NR 075058 clade 247 N N Weissella paramesenteroides 2012 ACKUO1000017 clade 247 N N Weissella sp. KLDS 7.0701 2013 EU600924 clade 247 N N Mobiluncus curtisii 1251. AEPZO1 OOOO13 clade 249 N N Enhydrobacter aerosaccus 785 ACYIO 1000081 clade 256 N N Moraxeia Osiloensis 1262 JN17S341 clade 256 N N Moraxella sp. GM2 1264 F837191 clade 256 N N Brevibacterium casei 42O JF951998 clade 257 N N Brevibacterium epidermidis 421 NR 029262 clade 257 N N Brevibacterium sanguinis 426 NR 028O16 clade 257 N N Brevibacterium sp. H15 427 AB177640 clade 257 N N Acinetobacter radioresistens 35 ACVRO1000010 clade 261 N N Lactobacilius aimentarius O68 NR 044701 clade 263 N N Lactobacilius farciminis O82 NR 044707 clade 263 N N Lactobacilius kimchii O97 NR O25045 clade 263 N N Lactobacilius nodensis 101 NR 041629 clade 263 N N Lactobacilius tucceti 138 NR 042194 clade 263 N N Pseudomonas mendocina 595 AAULO1000021 clade 265 N N Pseudomonas pseudoalcaligenes 598 NR 037000 clade 265 N N Pseudomonas sp. NP522b 602 EU723211 clade 265 N N Pseudomonas Stutzeri 603 AM905854 clade 265 N N Paenibacilius barcinonensis 390 NR 042272 clade 270 N N Paenibacilius barengoitzi 391 NR 042756 clade 270 N N Paenibacilius chibensis 392 NR 040885 clade 270 N N Paenibacilius cooki 393 NR 025372 clade 270 N N Paenibacilius durus 394 NR 037017 clade 270 N N Paenibacilius glucanolyticus 395 D78470 clade 270 N N Paenibacilius iactis 396 NR 025739 clade 270 N N Paenibacilius pabuli 398 NR 040853 clade 270 N N Paenibacilius popilliae 400 NR 040888 clade 270 N N Paenibacillus sp. CIP 101062 401 HM212646 clade 270 N N Paenibacilius sp. JC66 404 JF824.808 clade 270 N N Paenibacilius sp. R 27413 40S HES86333 clade 270 N N Paenibacilius sp. R 27422 406 HES86.338 clade 270 N N Paenibacilius timonensis 408 NR 042844 clade 270 N N Rothia mucilaginosa 651 ACVOO1000020 clade 271 N N Rothia nasimurium 652 NR 025310 clade 271 N N Prevoteila sp. oral taxon 302 550 ACZKO1000043 clade 280 N N Prevoteila sp. oral taxon F68 SS6 HMO99652 clade 280 N N Prevoteia tannerae S63 ACIJO2OOOO18 clade 280 N N Prevoteiaceae bacterium 566 AY207061 clade 280 N N P4P 62 P1 Porphyromonas asaccharolytica 471 AENOO1000048 clade 281 N N Porphyromonas gingivais 473 AEO15924 clade 281 N N Porphyromonas macacae 475 NR 025908 clade 281 N N Porphyromonas sp. UQD 301 477 EUO12301 clade 281 N N Porphyromonas uenonis 482 ACLRO1000152 clade 281 N N Leptotrichia buccalis 16S CPOO1685 clade 282 N N Leptotrichia hofstadii 168 ACVBO2000032 clade 282 N N Leptotrichia sp. oral clone HE012 173 AY349386 clade 282 N N Leptotrichia sp. oral taxon 223 176 GU408547 clade 282 N N Bacteroides fitivus 278 AFBNO1000029 clade 285 N N Bacteroides helicogenes 281 CPOO2352 clade 285 N N Parabacteroides johnsonii 419 ABYHO1000014 clade 286 N N Parabacteroides merdae 420 EU136685 clade 286 N N Treponema denticola 926 ADECO1000002 clade 288 N OP Treponema genomosp. P5 oral 929 DOOO3624 clade 288 N N clone MB3 P23 Treponema pittidum 935 AJS43428 ade 288 N OP Treponema sp. oral clone 942 AY2O7055 ade 288 N N US 9,011,834 B1 119 120 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Treponema sp. oral taxon 247 1949 GU408748 clade 288 N N Treponema sp. oral taxon 250 1950 GU408776 clade 288 N N Treponema sp. oral taxon 251 1951 GU408781 clade 288 N N Anaerococciis hydrogenais 144 ABXAO1000039 clade 289 N N Anaerococcus sp. 84.04299 148 HMS873.18 clade 289 N N Anaerococci is sp. gpac215 1S6 AM176540 clade 289 N N Anaerococcits vaginalis 158 ACXUO1000016 clade 289 N N Propionibacterium acidipropionici 1569 NC O19395 clade 290 N N Propionibacterium avidium 1571 AJOO3OSS clade 290 N N Propionibacterium granulosum 1573 FJT85716 clade 290 N N Propionibacterium jensenii 1574 NR 042269 clade 290 N N Propionibacterium propionicum 1575 NR 025.277 clade 290 N N Propionibacterium sp. H456 1577 AB177643 clade 290 N N Propionibacterium thoenii 1581 NR 042270 clade 290 N N Bifidobacterium bifidum 349 ABQPO1000027 clade 293 N N Leticonostoc mesenteroides 1183 ACKVO1000113 clade 295 N N Leticonostoc pseudomesenteroides 1184 NR 040814 clade 295 N N Johnsonella ignava 1016 X871S2 clade 298 N N Propionibacterium acnes 1570 ADJMO1000010 clade 299 N N Propionibacterium sp. 434 HC2 1576 AFILO1 OOOO3S clade 299 N N Propionibacterium sp. LG 1578 AY354921 clade 299 N N Propionibacterium sp. S555a 1579 AB264622 clade 299 N N Alicyclobacillus sp. CCUG 53.762 128 HE613268 clade 301 N N Actinomyces cardiffensis S3 GU470888 clade 303 N N Actinomyces finkei 55 HQ906497 clade 303 N N Actinomyces sp. HKU31 74 HQ335393 clade 303 N N Actinomyces sp. oral taxon C55 94 HMO99646 clade 303 N N Kerstersia gyiornim 1018 NR 025669 clade 307 N N Pigmentiphaga daeguiensis 1467 JN585327 clade 307 N N Aeromonas allosaccharophila 104 S39232 clade 308 N N Aeromonas enteropelogenes 1 OS X71121 clade 308 N N Aeromonas hydrophila 106 NC O08570 clade 308 N N Aeromonasiandaei 107 X60413 clade 308 N N Aeromonas Salmonicida 108 NC 009348 clade 308 N N Aeromonastroia 109 X60415 clade 308 N N Aeromonas Veronii 110 NR 044845 clade 3O8 N N Marvinbryantia formatexigens 196 AJSOS973 clade 309 N N Rhodobacter sp. oral taxon C30 62O HMO9964.8 clade 310 N N Rhodobacter sphaeroides 621 CPOOO144 clade 310 N N Lactobacilius aniri O71 ACLLO1000037 clade 313 N N Lactobacilius coieohominis O76 ACOHO1000030 clade 313 N N Lactobacilius fermentum O83 CPOO2O33 clade 313 N N Lactobacilius gastrict is O8S AICNO1OOOO60 clade 313 N N Lactobacilius mucosae O99 FR693800 clade 313 N N Lactobacilius oris O3 AEKLO1000077 clade 313 N N Lactobacilius pontis 11 HM21842O clade 313 N N Lactobacilius rentieri 12 ACGWO2OOOO12 clade 313 N N Lactobacilius sp. KLDS 1.0707 27 EU600911 clade 313 N N Lactobacilius sp. KLDS 1.0709 28 EU6OO913 clade 313 N N Lactobacilius sp. KLDS 1.0711 29 EU6OO915 clade 313 N N Lactobacilius sp. KLDS 1.0713 31 EU600917 clade 313 N N Lactobacilius sp. KLDS 1.0716 32 EU600921 clade 313 N N Lactobacilius sp. KLDS 1.0718 33 EU6OO922 clade 313 N N Lactobacilius sp. oral taxon 052 37 GQ422710 clade 313 N N Lactobacilius vaginalis 40 ACGVO1000168 clade 313 N N Brevibacterium aurantiacum 419 NR 044854 clade 314 N N Brevibacterium inens 423 AJ315491 clade 314 N N Lactobacilius peniosits O8 JN813103 clade 315 N N Lactobacilius plantarum 10 ACGZO2000033 clade 315 N N Lactobacilius sp. KLDS 1.0702 23 EU6OO906 clade 315 N N Lactobacilius sp. KLDS 1.0703 24 EU600907 clade 315 N N Lactobacilius sp. KLDS 1.0704 2S EU600908 clade 315 N N Lactobacilius sp. KLDS 1.0705 26 EU600909 clade 315 N N Agrobacterium radiobacter 1S CPOOO628 clade 316 N N Agrobacterium timefaciens 16 AJ389893 clade 316 N N Corynebacterium 685 EF463OSS clade 317 N N argentoratense Corynebacterium diphtheriae 693 NC OO2935 ade 317 N OP Corynebacterium 715 NR 037070 ade 317 N N pseudotuberculosis Corynebacterium renale 717 NR 037069 clade 317 N N Corynebacterium ulcerans 731 NR 074,467 clade 317 N N Aurantimonas coralicida 191 AYO65627 clade 318 N N Aireimonas aitamirensis 192 FN658986 clade 318 N N Lactobacilius acidipiscis 1066 NR 024718 clade 320 N N Lactobacilius Saivarius 1117 AEBAO1000145 clade 320 N N US 9,011,834 B1 121 122 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Lactobacilius sp. KLDS 1.0719 1134 EU600923 clade 320 N N Lactobacilius butchneri 1073 ACGHO1000101 clade 321 N N Lactobacilius genomosp. C1 1086 AY278619 clade 321 N N Lactobacilius genomosp. C2 1087 AY27862O clade 321 N N Lactobacilius hilgardii 1089 ACGPO1000200 clade 321 N N Lactobacilius kefiri 1096 NR 042230 clade 321 N N Lactobacilius parabuchneri 1105 NR 041294 clade 321 N N Lactobacilius parakefiri 1107 NR 029039 clade 321 N N Lactobacilius curvatus 1079 NR 042437 clade 322 N N Lactobacilius Sakei 1116 DQ989236 clade 322 N N Aneurinibacilius aneurinilyticus 167 AB101592 clade 323 N N Aneurinibacilius danicus 168 NR 028657 clade 323 N N Anetirinibacilius migilantis 169 NR 036799 clade 323 N N Aneurinibacilius terranovensis 170 NR 042271 clade 323 N N Staphylococcusatiretts 757 CPOO2643 clade 325 N Category-B Staphylococcusatiricularis 758 JQ624774 clade 325 N N Staphylococci is capitis 759 ACFRO1000029 clade 325 N N Staphylococci is caprae 760 ACRHO1000033 clade 325 N N Staphylococci is carnostis 761 NR O75 003 clade 325 N N Staphylococcus cohnii 762 JN1753.75 clade 325 N N Staphylococcus condimenti 763 NR 029345 clade 325 N N Staphylococci is epidermidis 764 ACHEO1000056 clade 325 N N Staphylococci is equtorum 765 NR 027520 clade 325 N N Staphylococciis haemolyticus 767 NC 0071.68 clade 325 N N Staphylococcus hominis 768 AM157418 clade 325 N N Staphylococci is lugdunensis 769 AEQAO1000024 clade 325 N N Staphylococci is pastetiri 770 FJ 189773 clade 325 N N Staphylococci is pseudintermedius 771 CPOO2439 clade 325 N N Staphylococci is saccharolyticus 772 NR 029158 clade 325 N N Staphylococci is saprophyticus 773 NC 007350 clade 325 N N Staphylococci is sp. clone bottae7 777 AF467424 clade 325 N N Staphylococcus sp. H292 775 AB177642 clade 325 N N Staphylococcus sp. H780 776 AB177644 clade 325 N N Staphylococcus succinus 778 NR 028667 clade 325 N N Staphylococciis warneri 780 ACPZO1000009 clade 325 N N Staphylococci is xylost is 781 AY39SO16 clade 325 N N Cardiobacterium hominis 490 ACKYO100.0036 clade 326 N N Cardiobacterium vaivarum 491 NR 028847 clade 326 N N Pseudomonas fittorescens 593 AY622220 clade 326 N N Pseudomonas gessardi 594 FJ943496 clade 326 N N Pseudomonas monteii 596 NR 024910 clade 326 N N Pseudomonas poae 597 GU188951 clade 326 N N Pseudomonas puttida 599 AFO94741 clade 326 N N Pseudomonas sp. G1229 601 DQ910482 clade 326 N N Pseudomonastoiaasi 604 AF320988 clade 326 N N Pseudomonas viridifiava 605 NR 042764 clade 326 N N Listeria gravi 185 ACCRO2OOOOO3 clade 328 N OP Listeria innoctia 186 JF96.7625 clade 328 N N Listeria ivanovii 187 X56151 clade 328 N N Listeria monocytogenes 188 CPOO2003 clade 328 N Category-B Listeria weishineri 189 AM2631.98 clade 328 N OP Capnocytophaga sp. oral clone 484 AY923149 clade 333 N N ASCEHOS Capnocytophaga splitigena 489 ABZVO1000054 clade 333 N N Leptotrichia genomosp. Cl 166 AY278621 clade 334 N N Leptotrichia Shahi 169 AYO29806 clade 334 N N Leptotrichia sp. 170 AF189244 clade 334 N N neutropenicPatient Leptotrichia sp. oral clone GTO18 171 AY349384 clade 334 N N Leptotrichia sp. oral clone GTO20 172 AY349385 clade 334 N N Bacteroides sp. 203 296 ACROO1000064 clade 335 N N Bacteroides sp. 3 119 307 ADCJO1 OOOO62 clade 335 N N Bacteroides sp. 3 2 5 311 ACIBO1 OOOO79 clade 335 N N Parabacteroides distasonis 416 CPOOO140 clade 335 N N Parabacteroides goldsteinii 417 AY974O70 clade 335 N N Parabacteroides gordonii 418 AB470344 clade 335 N N Parabacteroides sp. D13 421 ACPWO 1000017 clade 335 N N Capnocytophaga genomosp. C1 477 AY278613 clade 336 N N Capnocytophaga ochracea 480 AEOHO1000054 clade 336 N N Capnocytophaga sp. GEJ8 481 GUS 61335 clade 336 N N Capnocytophaga sp. oral strain 486 AYOOSO77 clade 336 N N A47ROY Capnocytophaga sp. S1b 482 U42009 clade 336 N N Paraprevoteila clara 1426 AFFYO100.0068 clade 336 N N Bacteroides heparinolyticus 282 JN867284 clade 338 N N Prevoteila heparinolytica 1500 GQ422742 clade 338 N N US 9,011,834 B1 123 124 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Treponema genomosp. P4 oral 1928 DOOO3618 clade 339 N N clone MB2 G19 Treponema genomosp. P6 oral 1930 DOOO3625 clade 339 N N clone MB4 G11 Treponema sp. oral taxon 254 1952 GU408803 clade 339 N N Treponema sp. oral taxon 508 1956 GU413616 clade 339 N N Treponema sp. oral taxon 518 1957 GU413640 clade 339 N N Chlamydia muridarum SO2 AEOO2160 clade 341 N OP Chlamydia trachomatis SO4 U68443 clade 341 N OP Chlamydia psittaci 503 NR 036864 clade 342 N Category-B Chlamydophila pneumoniae 509 NC 002179 clade 342 N OP Chlamydophila psittaci 510 D85712 clade 342 N OP Anaerococci is Octavius 146 NR 026360 clade 343 N N Anaerococcus sp. 8405254 149 HMS87319 clade 343 N N Anaerococcus sp. 9401487 150 HMS87322 clade 343 N N Anaerococcus sp. 9403502 151 HMS873.25 clade 343 N N Gardnerella vaginalis 923. CPOO1849 clade 344 N N Campylobacter lari 466 CPOOO932 clade 346 N OP Anaerobiospirilium 142 NR 026O75 clade 347 N N Sticciniciproducers Anaerobiospirilium thomasii 143 A420985 clade 347 N N Ruminobacter amylophilus 1654 NR 026450 clade 347 N N Sticcinatimonas hippei 1897 AEVOO1000027 clade 347 N N Actinomyces europaeus 54 NR 0263.63 clade 348 N N Actinomyces sp. oral clone GU009 82 AY349.361 clade 348 N N Moraxeiia caiarrhais 1260 CPOO2OOS clade 349 N N Moraxeia incoini 1261 FR822735 clade 349 N N Moraxella sp. 16285 1263 JF682466 clade 349 N N Psychrobactersp. 13983 1613 HM212668 clade 349 N N Actinobacilium massiae 49 AF487679 clade 350 N N Actinobaculum Schaaiii 50 AY957507 clade 350 N N Actinobaculum sp. BMH 101342 51 AY282578 clade 350 N N Actinobaculum sp. P2P 19 P1 52 AY2O7066 clade 350 N N Actinomyces sp. oral clone 10076 84 AY349363 clade 350 N N Actinomyces sp. oral taxon 848 93 ACUYO1000072 clade 350 N N Actinomyces netiii 6S X71862 clade 352 N N Mobiluncus mutieris 252 ACKWO1000035 clade 352 N N Biastomonas natatoria 372 NR 040824 clade 356 N N Novosphingobium aromaticivorans 357 AAAVO3OOOOO8 clade 356 N N Sphingomonas sp. oral clone FIO12 745 AY3494.11 clade 356 N N Sphingopyxis alaskensis 749 CPOOO356 clade 356 N N Oxalobacter formigenes 389 ACDQ01000020 clade 357 N N Veillonella atypica 974 AEDSO1000059 clade 358 N N Veillonella dispar 975 ACIKO2OOOO21 clade 358 N N Veillonella genomosp. P1 oral 976 DOOO3631 clade 358 N N clone MBS P17 Veillonella parvula 978 ADFUO1000009 clade 358 N N Veillonella sp. 3 1. 44 979 ADCVO1000019 clade 358 N N Veillonella sp. 6 1 27 980 ADCWO1000016 clade 358 N N Veillonella sp. ACP1 981 HQ616359 clade 358 N N Veillonella sp. AS16 982 HQ616365 clade 358 N N Veillonella sp. BS32b 983 HQ616368 clade 358 N N Veillonella sp. ICM51 a 984 HQ616396 clade 358 N N Veillonella sp. MSA12 985 HQ616381 clade 358 N N Veillonella sp. NVG 100cf 986 EF108443 clade 358 N N Veillonella sp. OK11 987 JN695650 clade 358 N N Veillonella sp. oral clone ASCGO1 990 AY923.144 clade 358 N N Veillonella sp. oral clone ASCG02 991 AY95.3257 clade 358 N N Veillonella sp. oral clone OH1A 992 AY947495 clade 358 N N Veillonella sp. oral taxon 158 993 ABNUO1000007 clade 358 N N Kochiria marina 040 GQ260086 clade 365 N N Kocuria rhizophila O42 AYO3O315 clade 365 N N Kochiria rosea O43 X87756 clade 365 N N Kochiria varians O44 AFS42O74 clade 365 N N Cliostridiaceae bacterium END 2 531 EF451053 clade 368 N N Micrococci is antarcticus 242 NR 025285 clade 371 N N Micrococcus luteus 243 NR 075062 clade 371 N N Micrococcus liviae 244 NR 026.200 clade 371 N N Micrococcus sp. 185 245 EU714334 clade 371 N N Lactobacilius brevis O72 EU194349 clade 372 N N Lactobacilius parabrevis 104 NR 042456 clade 372 N N Pediococcus acidiactici 436 ACXBO1000026 clade 372 N N Pediococcuspentosaceus 437 NR 075052 clade 372 N N Lactobacilius dextrinicus O81 NR 036861 clade 373 N N Lactobacilius peroiens 109 NR 029360 clade 373 N N Lactobacilius rhamnostis 113 ABWJO1000068 clade 373 N N US 9,011,834 B1 125 126 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Lactobacilius Saniviri 1118 AB6O2S69 clade 373 N N Lactobacilius sp. BT6 1121 HQ616370 clade 373 N N Mycobacterium mageritense 1282 FR798914 clade 374 N OP Mycobacterium neoaurum 1286 AF268445 clade 374 N OP Mycobacterium smegmatis 1291 CPOOO480 clade 374 N OP Mycobacterium sp. HE5 1304 AJO12738 clade 374 N N Dysgonomonasgadei 775 ADLVO1OOOOO1 clade 377 N N Dysgonomonas mossi 776 ADLWO1OOOO23 clade 377 N N Porphyromonas levi 1474 NR 025907 clade 377 N N Porphyromonas somerae 1476 ABS476.67 clade 377 N N Bacteroides barnesiae 267 NR 041446 clade 378 N N Bacteroides coprocola 272 ABIYO2OOOOSO clade 378 N N Bacteroides coprophilus 273 ACBWO1OOOO12 clade 378 N N Bacteroides doei 274 ABWZO1000093 clade 378 N N Bacteroides massiliensis 284 AB2OO226 clade 378 N N Bacteroides plebeius 289 AB2OO218 clade 378 N N Bacteroides sp. 3 133FAA 309 ACPSO1 OOOO85 clade 378 N N Bacteroides sp. 31 40A 310 ACRTO1000136 clade 378 N N Bacteroides sp. 4 3 47FAA 313 ACDRO2000029 clade 378 N N Bacteroides sp. 9 142FAA 314 ACAAO1000096 clade 378 N N Bacteroides sp. NB 8 323 AB11756S clade 378 N N Bacteroides vulgatus 331 CPOOO139 clade 378 N N Bacteroides ovatus 287 ACWHO1OOOO36 clade 38 N N Bacteroides sp. 1130 294 ADCLO1000128 clade 38 N N Bacteroides sp. 21 22 297 ACPQ01000117 clade 38 N N Bacteroides sp. 2 24 299 ABZZO1000168 clade 38 N N Bacteroides sp. 3 1. 23 308 ACRSO1 OOOO81 clade 38 N N Bacteroides sp. D1 318 ACABO2000030 clade 38 N N Bacteroides sp. D2 321 ACGAO1000077 clade 38 N N Bacteroides sp. D22 320 ADCKO1000151 clade 38 N N Bacteroides xvianisolvens 332 ADKPO1000087 clade 38 N N Treponema lecithinolyticum 1931 NR 026247 clade 380 N OP Treponema parvin 1933 AF3O2937 clade 380 N OP Treponema sp. oral clone JUO25 1940 AY3494.17 clade 380 N N Treponema sp. oral taxon 270 1954 GQ422733 clade 380 N N Parascardovia denticoiens 1428 ADEBO1000020 clade 381 N N Scardovia inopinata 1688 ABO29087 clade 381 N N Scardovia wiggsiae 1689 AY278626 clade 381 N N Cliostridiaies bacterium 9400853 533 HM58732O clade 384 N N Mogibacterium diversum 1254 NR 027191 clade 384 N N Mogibacterium neglectin 1255 NR 0272O3 clade 384 N N Mogibacterium pumilum 1256 NR 028.608 clade 384 N N Mogibacterium timidium 1257 Z36296 clade 384 N N Borrelia burgdorferi 389 ABGIO1000001 clade 386 N OP Borrelia garinii 392 ABVO1 OOOOO1 clade 386 N OP Borrelia sp. NE49 397 AJ224142 clade 386 N OP Caidinonas manganoxidans 457 NR 04O787 clade 387 N N Comamonadaceae bacterium 667 HMO99651 clade 387 N N oral taxon F47 Lautropia mirabilis 1149 AEQPO1000026 clade 387 N N Lautropia sp. oral clone AP009 11SO AYOOSO3O clade 387 N N Peptoniphilus asaccharolyticus 1441 D14145 clade 389 N N Peptoniphilus duerdenii 1442 EUS2629O clade 389 N N Peptoniphilus harei 1443 NR 026358 clade 389 N N Peptoniphilus indolicus 1444 AY153431 clade 389 N N Peptoniphilus lacrimalis 1446 ADDOO1000050 clade 389 N N Peptoniphilus sp. gpac O77 1450 AM176527 clade 389 N N Peptoniphilus sp. JC140 1447 JF8248O3 clade 389 N N Peptoniphilus sp. oral taxon 386 1452 ADCSO1000031 clade 389 N N Peptoniphilus sp. oral taxon 836 1453 AEAAO1000090 clade 389 N N Peptostreptococcaceae 1454 N837.495 clade 389 N N bacterium ph1 Dialister pneumosinies 765 HM596.297 clade 390 N N Dialister sp. oral taxon 502 767 GQ422739 clade 390 N N Cupriavidus metallidurans 741, GU23O889 clade 391 N N Herbaspirillum seropedicae 1001 CPOO2O39 clade 391 N N Herbaspirillum sp. JC206 10O2 JN657219 clade 391 N N Janthinobacterium sp. SY12 1015 EF455530 clade 391 N N Massilia sp. CCUG 43427A 1197 FR773,700 clade 391 N N Ralstonia picketti 1615 NC O10682 clade 391 N N Ralstonia sp. 5. 7 47FAA 1616 ACUFO1000076 clade 391 N N Franciselia novicida 889 ABSSO1000002 clade 392 N N Francisella philomiragia 890 AY928.394 clade 392 N N Franciselia initiatensis 891 ABAZO1000O82 clade 392 N Category-A ignatzschineria indica 1009 HQ823562 clade 392 N N ignatzschineria sp. NML 95 0260 1010 HQ823.559 clade 392 N N US 9,011,834 B1 127 128 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Streptococci is mutans 814 APO106SS clade 394 N N Lactobacilitisgasseri O84 ACOZO1000018 clade 398 N N Lactobacilius hominis O90 FR681902 clade 398 N N Lactobacilius iners O91 AEKO1OOOOO2 clade 398 N N Lactobacilius johnsonii O93 AEO171.98 clade 398 N N Lactobacilius senioris 119 AB6O2S70 clade 398 N N Lactobacilius sp. oral clone HT002 135 AY349.382 clade 398 N N Weisseia beninensis 2006 EU439435 clade 398 N N Sphingomonas echinoides 744 NR 024700 clade 399 N N Sphingomonas sp. oral taxon A09 747 HMO99639 clade 399 N N Sphingomonas sp. oral taxon F71 748 HMO99645 clade 399 N N Zymomonas mobilis 2032 NR 074274 clade 399 N N Arcanobacterium haemolyticum 174 NR 025347 clade 400 N N Arcanobacterium pyogenes 175 GU585578 clade 400 N N Trieperella pyogenes 962 NR 044858 clade 400 N N Lactococci is garvieae 144 AFO 61005 clade 401 N N Lactococci is lactis 145 CPOO236S clade 401 N N Brevibacterium mchreineri 424 ADNUO1000076 clade 402 N N Brevibacterium paucivorans 425 EUO86796 clade 402 N N Brevibacterium sp. JC43 428 JF824.806 clade 402 N N Seienomonas artemidis 692 HMS96274 clade 403 N N Selenomonas sp. FOBRC9 704 HQ616378 clade 403 N N Selenomonas sp. oral taxon 137 715 AENVO1OOOOO7 clade 403 N N Desmospora activa 751 AM940019 clade 404 N N Desmospora sp. 8437 752 AFHTO1000143 clade 404 N N Paenibacilius sp. oral taxon F45 407 HMO99647 clade 404 N N Corynebacterium ammoniagenes 682 ADNSO1000011 clade 405 N N Corynebacterium aurimucosum 687 ACLHO1000041 clade 405 N N Corynebacterium bovis 688 AFS37590 clade 405 N N Corynebacterium canis 689 GQ871934 clade 405 N N Corynebacterium casei 690 NR 025101 clade 405 N N Corynebacterium durum 694 Z97O69 clade 405 N N Corynebacterium efficiens 695 ACLIO1 OOO121 clade 405 N N Corynebacterium falsenii 696 Y13024 clade 405 N N Corynebacterium flavescens 697 NR 037040 clade 405 N N Corynebacterium glutamicum 701 BAOOOO36 clade 405 N N Corynebacterium jeikeium 704 ACYWO1OOOOO1 clade 405 N OP Corynebacterium kroppenstedtii 705 NR 026380 clade 405 N N Corynebacterium lipophiloflavum 706 ACHJO1000075 clade 405 N N Corynebacterium matriuchotii 709 ACSHO2OOOOO3 clade 405 N N Corynebacterium minutissimum 710 X82O64 clade 405 N N Corynebacterium resistens 718 ADGNO1000058 clade 405 N N Corynebacterium simulans 720 AFS37604 clade 405 N N Corynebacterium singulare 721 NR 026394 clade 405 N N Corynebacterium sp. 1 ex sheep 722 Y13427 clade 405 N N Corynebacterium sp. NML 726 GU238413 clade 405 N N 99 OO18 Corynebacterium striatum 727 ACGEO1000001 clade 405 N OP Corynebacterium urealyticum 732 X81913 clade 405 N OP Corynebacterium variabile 734 NR 025314 clade 405 N N Aerococci is sanguinicola 98 AY837833 clade 407 N N Aerococci is tirinae 99 CPOO2512 clade 407 N N Aerococci is tirinaeequi 100 NR 043443 clade 407 N N Aerococcus viridians 101 ADNTO1000041 clade 407 N N Fusobacterium naviforme 898 HO223106 clade 408 N N Moryella indoligenes 1268 AF527773 clade 408 N N Selenomonas genomosp. P5 1697 AY34.1820 clade 410 N N Selenomonas sp. oral clone 10048 1710 AY3494.08 clade 410 N N Selenomonas splitigena 1717 ACKPO2000033 clade 410 N N Hyphomicrobium sulfonivorans 1007 AY468372 clade 411 N N Methylocella silvestris 1228 NR 074237 clade 411 N N Legionella pneumophila 1153 NC OO2942 clade 412 N OP Lactobacilius coryniformis 1077 NR 044705 clade 413 N N Arthrobacter agilis 178 NR 026198 clade 414 N N Arthrobacter ariaitensis 179 NR 074608 clade 414 N N Arthrobacter beigerei 180 NR 025612 clade 414 N N Arthrobacter globiformis 181 NR 0261.87 clade 414 N N Arthrobacter nicotianae 182 NR 026190 clade 414 N N Mycobacterium abscessus 1269 AGQUO1000002 clade 418 N OP Mycobacterium chelonae 1273 ABS4861O clade 418 N OP Bacteroides saianitronis 291 CPOO2530 clade 419 N N Paraprevoteia xylaniphila 1427 AFBRO1000011 clade 419 N N Barnesieia intestinihominis 336 AB370251 clade 420 N N Barnesieia viscericola 337 NR 041508 clade 420 N N Parabacteroides sp. NS31 3 1422 JNO29805 clade 420 N N Porphyromonadaceae 147O EF184292 clade 420 N N US 9,011,834 B1 129 130 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status bacterium NML 06.0648 Tannerella forsythia 913 CPOO3191 clade 420 N N Tannerella sp. 6 1 58FAA CT1 914 ACWXO100.0068 clade 420 N N Mycoplasma amphoriforme 311 AYS31656 clade 421 N N Mycoplasma genitalium 317 L43967 clade 421 N N Mycoplasma pneumoniae 322 NC OOO912 clade 421 N N Mycoplasma penetrans 321 NC 004.432 clade 422 N N Ureaplasma parvum 966 AEOO2127 clade 422 N N Ureaplasma trealytictim 967 AAYNO1000002 clade 422 N N Treponema genomosp. P1 927 AY341822 clade 425 N N Treponema sp. oral taxon 228 943 GU40858O clade 425 N N Treponema sp. oral taxon 230 944 GU408.603 clade 425 N N Treponema sp. oral taxon 231 945 GU408631 clade 425 N N Treponema sp. oral taxon 232 946 GU408.646 clade 425 N N Treponema sp. oral taxon 235 947 GU408673 clade 425 N N Treponema sp. ovine footrot 959 AJO10951 clade 425 N N Treponema vincentii 960 ACYHO100.0036 clade 425 N OP Burkhoideriales bacterium 1147 452 ADCOO1000.066 clade 432 N OP Parasutterelia excrementihominis 429 AFBPO1000029 clade 432 N N Parasutterelia Secunda 430 AB491209 clade 432 N N Sutterelia morbirenis 898 A.J832129 clade 432 N N Stitterelia sanguinus 900 AJ748647 clade 432 N N Sutterella sp. YIT 12072 901 AB491210 clade 432 N N Sutterelia Stercoricanis 902 NR 025600 clade 432 N N Sutterelia wadsworthensis 903 ADMFO1000048 clade 432 N N Propionibacterium feudenreichii 572 NR 036972 clade 433 N N Propionibacterium sp. oral 580 GQ422728 clade 433 N N taxon 192 Tessaracoccus sp. oral taxon FO4 917 HMO99640 clade 433 N N Peptoniphilus ivorii 44S YO7840 clade 434 N N Peptoniphilus sp. gpac007 448 AM176517 clade 434 N N Peptoniphilus sp. gpac018A 449 AM176519 clade 434 N N Peptoniphilus sp. gpac148 451 AM176535 clade 434 N N Flexispira rappini 887 AY1264.79 clade 436 N N Helicobacter biis 993 ACDNO1000023 clade 436 N N Helicobacter cinaedi 995 ABQTO1000054 clade 436 N N Helicobacter sp. None 998 U44756 clade 436 N N Brevundimonas sub vibrioides 429 CPOO2102 clade 438 N N Hyphomonas neptunit in 1008 NR 074092 clade 438 N N Phenyiobacterium zucineum 146S AY628697 clade 438 N N Streptococci is downei 1793 AEKNO1000002 clade 441 N N Streptococcus sp. SHV515 1848 YO76O1 clade 441 N N Acinetobacter sp. CIP 53.82 40 JQ638584 clade 443 N N Halomonas elongata 990 NR 074782 clade 443 N N Halomonasjohnsoniae 991 FR775979 clade 443 N N Butyrivibriofibrisolvens 456 U41172 clade 444 N N Roseburia sp. 11 SE37 1640 FM954975 clade 444 N N Roseburia sp. 11 SE38 1641 FM954976 clade 444 N N Shuttleworthia satelies 1728 ACIPO2OOOOO4 clade 444 N N Shuttleworthia sp. MSX8B 1729 HQ616383 clade 444 N N Shuttleworthia sp. oral taxon G69 173O GU432167 clade 444 N N Bdellovibrio sp. MPA 344 AY294215 clade 445 N N Destifobulbus sp. oral clone 755 AYOO5036 clade 445 N N CHO31 Desulfovibrio desulfuricans 757 DQ092636 clade 445 N N Desulfovibrio fairfieldensis 758 U42221 clade 445 N N Desulfovibrio piger 759 AF1921.52 clade 445 N N Desulfovibrio sp. 3 1 syn3 760 ADDRO1000239 clade 445 N N Geobacter hemidjiensis 941 CPOO1124 clade 445 N N Brachybacterium alimentarium 401 NR O26269 clade 446 N N Brachybacterium conglomeratum 402 ABS37169 clade 446 N N Brachybacterium tyrofermenians 403 NR 026272 clade 446 N N Dernabacter hominis 749 FJ263375 clade 446 N N Aneurinibacilius thermoaerophilus 171 NR 029303 clade 448 N N Brevibacilius agri 409 NR 040983 clade 448 N N Brevibacilius centrosporus 411 NR 043414 clade 448 N N Brevibacilius choshinensis 412 NR 040980 clade 448 N N Brevibacilius invocatus 413 NR 041836 clade 448 N N Brevibacilius parabrevis 415 NR 04O981 clade 448 N N Brevibacilius reuszeri 416 NR 04O982 clade 448 N N Brevibacilius sp. phR 417 JN837488 clade 448 N N Brevibacilius thermoruber 418 NR 026514 clade 448 N N Lactobacilius murinus 1100 NR 042231 clade 449 N N Lactobacilius Oeni 1102 NR 043095 clade 449 N N Lactobacilius ruminis 1115 ACGSO2000043 clade 449 N N Lactobacilius vini 1141 NR 042196 clade 449 N N US 9,011,834 B1 131 132 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Gemella haemolysans 924 ACDZO2OOOO12 clade 450 N N Gemeia morbilliorum 925 NR 025904 clade 450 N N Gemeia morbilliorum 926 ACRXO1000010 clade 450 N N Gemeila sanguinis 927 ACRYO1000057 clade 450 N N Gemella sp. oral clone ASCE02 929 AY923.133 clade 450 N N Gemella sp. oral clone ASCF04 930 AY923.139 clade 450 N N Gemella sp. oral clone ASCF12 931 AY923143 clade 450 N N Gemella sp. WAL 1945J 928 EU427463 clade 450 N N Sporolactobacilius nakayamae 1753 NR 042247 clade 451 N N Giuconacetobacter entani 945 NR 028909 clade 452 N N Gluconacetobacter europaeus 946 NR 026513 clade 452 N N Giuconacetobacter hansenii 947 NR 026133 clade 452 N N Giuconacetobacter oboediens 949 NR 041295 clade 452 N N Gluconacetobacter xylinus 950 NR 074338 clade 452 N N Attritibacter ignavus 193 FNSS4542 clade 453 N N Dermacoccus sp. Ellin185 750 AEIQ01000090 clade 453 N N Janibacterinosus 1013 NR 026362 clade 453 N N Janibacter meionis 1014 EFO63716 clade 453 N N Acetobacter aceti 7 NR 026121 clade 454 N N Acetobacter fabarum 8 NR 042678 clade 454 N N Acetobacteriovaniensis 9 NR 040832 clade 454 N N Acetobacter maiorum 10 NR 025513 clade 454 N N Acetobacter orientais 11 NR 028625 clade 454 N N Acetobacter pasteuriants 12 NR 026107 clade 454 N N Acetobacter pomorum 13 NR 042112 clade 454 N N Acetobacter Syzygii 14 NR 040868 clade 454 N N Acetobacter tropicalis 15 NR 036881 clade 454 N N Gluconacetobacter azotoCaptains 943 NR 028767 clade 454 N N Gluconacetobacter diazotrophicus 944 NR 074292 clade 454 N N Gluconacetobacteriohannae 948 NR 024959 clade 454 N N Nocardia brasiliensis 1351 AIHVO1000038 clade 455 N N Nocardia cyriacigeorgica 1352 HQ0094.86 clade 455 N N Nocardia puris 1354 NR 028994 clade 455 N N Nocardia sp. 01 Je O25 1355 GU574059 clade 455 N N Rhodococci is equi 1623 ADNWO1000058 clade 455 N N Oceanobacilius caeni 1358 NR 041533 clade 456 N N Oceanobacilius sp. Ndiop 1359 CAERO1000083 clade 456 N N Ornithinibacilius bavariensis 1384 NR 044923 clade 456 N N Ornithinibacilius sp. 7 10AIA 1385 FN397526 clade 456 N N Virgibacilius proomi 2005 NR 025308 clade 456 N N Corynebacterium amycolatum 683 ABZUO1000033 clade 457 N OP Corynebacterium hansenii 702 AM946639 clade 457 N N Corynebacterium xerosis 735 FN179330 clade 457 N OP Staphylococcaceae bacterium 756 AY841362 clade 458 N N NML 92 OO17 Staphylococcus fieuretti 766 NR 041326 clade 458 N N Staphylococci is Sciuri 774 NR 025520 clade 458 N N Staphylococciis vitatinus 779 NR 024670 clade 458 N N Stenotrophomonas maliophia 782 AAVZO1000005 clade 459 N N Stenotrophomonas sp. FG 6 783 EFO17810 clade 459 N N Mycobacterium africanum 270 AF480605 clade 460 N OP Mycobacterium alsiensis 271 AU938169 clade 460 N OP Mycobacterium avium 272 CPOOO479 clade 460 N OP Mycobacterium colombiense 274 AMO62764 clade 460 N OP Mycobacterium gordonae 276 GU142930 clade 460 N OP Mycobacterium intracellulare 277 GQ153276 clade 460 N OP Mycobacterium kansasii 278 AF480601 clade 460 N OP Mycobacterium lacus 279 NR 025 175 clade 460 N OP Mycobacterium leprae 280 FM211.192 clade 460 N OP Mycobacterium lepromatosis 281 EU2O3590 clade 460 N OP Mycobacterium mantenii 283 FJO42897 clade 460 N OP Mycobacterium marinum 284 NC 01.0612 clade 460 N OP Mycobacterium microti 285 NR 025234 clade 460 N OP Mycobacterium 287 ADNVO1000350 clade 460 N OP parascrofiliacetim Mycobacterium Seoulense 290 DQ536403 clade 460 N OP Mycobacterium sp. 1761 292 EU703150 clade 460 N N Mycobacterium sp. 1791 295 EU703148 clade 460 N N Mycobacterium sp. 1797 296 EU703149 clade 460 N N Mycobacterium sp. 298 HQ174245 clade 460 N N B1007.09.02O6 Mycobacterium sp. 305 HM627011 clade 460 N N NLAOO1 OOO736 Mycobacterium sp. W 306 DQ437715 ade 460 N N Mycobacterium tuberculosis 307 CPOO1658 ade 460 N Category-C Mycobacterium ulcerans 308 ABS4872S ade 460 N OP US 9,011,834 B1 133 134 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Mycobacterium vulneris 1309 EU834OSS clade 460 N OP Xanthomonas Campestris 2016 EF101975 clade 461 N N Xanthomonas sp. kmd 489 2017 EU7231.84 clade 461 N N Dietzia natronoimnaea 769 GQ870426 clade 462 N N Dietzia sp. BBDP51 770 DQ337512 clade 462 N N Dietzia sp. CA149 771 GQ870422 clade 462 N N Dietzia timorensis 772 GQ870424 clade 462 N N Gordonia bronchiais 951 NR 027594 clade 463 N N Gordonia polyisoprenivorans 952 DQ385,609 clade 463 N N Gordonia sp. KTR9 953 DQ068383 clade 463 N N Gordonia Spitti 954 FJS36304 clade 463 N N Gordonia terrae 955 GQ848239 clade 463 N N Leptotrichia goodfellowii 1167 ADAD010.00110 clade 465 N N Leptotrichia sp. oral clone 1174 AY349387 clade 465 N N IKO)40 Leptotrichia sp. oral clone 1175 AY207053 clade 465 N N P2PB 51 P1 Bacteroidales genomosp. P7 264 DQ003623 clade 466 N N oral clone MB3 P19 Butyricimonas virosa 454 AB443949 clade 466 N N Odoribacterianeus 1363 AB4908OS clade 466 N N Odoribacter splanchinicus 1364 CPOO2S44 clade 466 N N Capnocytophaga gingivais 478 ACLQ01000011 clade 467 N N Capnocytophaga granulosa 479 X97248 clade 467 N N Capnocytophaga sp. oral clone 483 AYOOSO74 clade 467 N N AHO15 Capnocytophaga sp. oral strain S3 487 AYOO5073 clade 467 N N Capnocytophaga sp. oral taxon 338 488 AEXXO1000050 clade 467 N N Capnocytophaga caninorsus 476 CPOO2113 clade 468 N N Capnocytophaga sp. oral clone 485 AY3493.68 clade 468 N N IDO62 Lactobacilius catenaformis 1075 M23729 clade 469 N N Lactobacilius vitatinus 1142 NR 041305 clade 469 N N Cetobacterium Somerae SO1 AJ438155 clade 470 N N Fusobacterium gonidiaformans 896 ACETO1000043 clade 470 N N Fusobacterium mortiferum 897 ACDB0200.0034 clade 470 N N Fusobacterium necrogenes 899 XSS408 clade 470 N N Fusobacterium necrophorum 900 AM905356 clade 470 N N Fusobacterium sp. 12 1 B 905 AGWJO1OOOO70 clade 470 N N Fusobacterium sp. 3 15R 911 ACDDO 1000078 clade 470 N N Fusobacterium sp. D12 918 ACDGO2OOOO36 clade 470 N N Fusobacterium ulcerans 921 ACDHO1000090 clade 470 N N Fusobacterium varium 922 ACIEO1 OOOOO9 clade 470 N N Mycoplasma arthritidis 1312 NC 011025 clade 473 N N Mycoplasma faticium 1314 NR 024983 clade 473 N N Mycoplasma hominis 1318 AF443616 clade 473 N N Mycoplasma orale 1319 AY796060 clade 473 N N Mycoplasma salivarium 1324 M24661 clade 473 N N Mitsuokella ialaludinii 1247 NR 028840 clade 474 N N Mitsuokeia multacida 1248 ABWKO2000005 clade 474 N N Mitsuokella sp. oral taxon 521 1249 GU413658 clade 474 N N Mitsuokella sp. oral taxon G68 12SO GU432166 clade 474 N N Selenomonas genomosp. C1 1695 AY278627 clade 474 N N Selenomonas genomosp. P8 1700 DQ003628 clade 474 N N oral clone MBS P06 Selenomonas riminantium 1703 NR 075026 clade 474 N N Veiiioneliaceae bacterium oral 1994 GU4O2916 clade 474 N N taxon 131 Alioscardovia omnicoiens 139 NR 042583 clade 475 N N Alloscardovia sp. OB7196 140 AB42SO70 clade 475 N N Bifidobacterium urinalis 366 A.J278695 clade 475 N N Prevoteia loescheii SO3 JN867231 clade 48 N N Prevoteila sp. oral clone ASCG12 530 DQ272511 clade 48 N N Prevoteila sp. oral clone GUO27 S40 AY349398 clade 48 N N Prevoteila sp. oral taxon 472 553 ACZSO1OOO106 clade 48 N N Selenomonas dianae 693 GQ422719 clade 480 N N Selenomonas fitteggei 694 AF2878O3 clade 480 N N Selenomonas genomosp. C2 696 AY278628 clade 480 N N Selenomonas genomosp. P6 698 DQ003636 clade 480 N N oral clone MB3041 Selenomonas genomosp. P7 699 DQ003627 clade 480 N N oral clone MBS CO8 Selenomonas infelix 701 AF2878O2 clade 480 N N Selenomonas noxia 702 GU470909 clade 480 N N Selenomonas sp. oral clone FT050 70S AY349403 clade 480 N N Selenomonas sp. oral clone GIO64 706 AY3494.04 clade 480 N N US 9,011,834 B1 135 136 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Selenomonas sp. oral clone GTO10 707 AY3494.OS clade 480 N N Selenomonas sp. oral clone HU051 708 AY3494O6 clade 480 N N Selenomonas sp. oral clone IK004 709 AY3494O7 clade 480 N N Selenomonas sp. oral clone JIO21 711 AY3494.09 clade 480 N N Selenomonas sp. oral clone JSO31 712 AY3494.10 clade 480 N N Selenomonas sp. oral clone OH4A 713 AY947498 clade 480 N N Selenomonas sp. oral clone 714 AY207052 clade 480 N N P2PA 80 P4 Selenomonas sp. oral taxon 149 716 AEEJO1 OOOOO7 clade 480 N N Veiiioneliaceae bacterium oral 995 GU470897 clade 480 N N taxon 155 AgrococcuSienensis 117 NR 026275 clade 484 N N Microbacterium gubbeenense 232 NR O25098 clade 484 N N Pseudoclavibacter sp. Timone 590 FJ375951 clade 484 N N Tropheryma whippiei 961 BX2S1412 clade 484 N N Zimmermannella bifida 2O31 ABO12592 clade 484 N N Legionelia hackeiae 151 M36O28 clade 486 N OP Legionelia longbeachae 152 M36O29 clade 486 N OP Legionella sp. D3923 154 JN380999 clade 486 N OP Legionella sp. D4088 1SS JN381 012 clade 486 N OP Legionella sp. H63 1S6 JF831047 clade 486 N OP Legionella sp. NML 93L054 157 GUO627O6 clade 486 N OP Legionelia Steelei 158 HQ3982O2 clade 486 N OP Taiiockia micdadei 91S M36032 clade 486 N N Helicobacter pullorum 996 ABQUO1000097 clade 489 N N Acetobacteraceae bacterium 16 AGEZO1000040 clade 490 N N AT 5844 Roseomonas cervicais 643 ADVLO1000363 clade 490 N N Roseomonas inticosa 644 NR 028857 clade 490 N N Roseomonas sp. NML94 0193 645 AF533357 clade 490 N N Roseomonas sp. NML97 0121 646 AFS33359 clade 490 N N Roseomonas sp. NML98 0009 647 AFS33358 clade 490 N N Roseomonas sp. NML98 O157 648 AFS33360 clade 490 N N Rickettsia akari 627 CPOOO847 clade 492 N OP Rickettsia Conorii 628 AEOO8647 clade 492 N OP Rickettsia prowazeki 629 M21789 clade 492 N Category-B Rickettsia rickettsii 630 NC 010263 clade 492 N OP Rickettsia Siovaca 631 L36224 clade 492 N OP Rickettsia typhi 632 AEO171.97 clade 492 N OP Anaeroglobits geminati is 160 AGCJO1000054 clade 493 N N Megasphaera genomosp. C1 2O1 AY278622 clade 493 N N Megasphaera micronticifornis 203 AECSO1000020 clade 493 N N Clost ridiales genomosp. S40 CPOO1850 clade 495 N N BWAB3 Tsukamtirella pattrometabola 963 X80628 clade 496 N N Tsukamurella tyrosinosolvens 964 AB478958 clade 496 N N Abiotrophia para adiacens 2 ABO22027 clade 497 N N Carnobacterium divergens 492 NR 044706 clade 497 N N Carnobacterium 493 NC 019425 clade 497 N N maitaromaticum Enterococci is a vitin 800 AF133S35 clade 497 N N Enterococciis Caccae 8O1 AY94382O clade 497 N N Enterococci is cassellifiavits 802 AEWTO1000047 clade 497 N N Enterococci is durans 803 A2763S4 clade 497 N N Enterococci is faecalis 804 AEO1683O clade 497 N N Enterococci is faecium 805 AM157434 clade 497 N N Enterococci is gallinarum 806 AB269767 clade 497 N N Enterococci is gilvis 807 AYO33814 clade 497 N N Enterococci is hawaiiensis 808 AY321377 clade 497 N N Enterococcus hirae 809 AFO 61011 clade 497 N N Enterococci is italicits 81O AEPVO1000109 clade 497 N N Enterococcus mindtii 811 NR 024906 clade 497 N N Enterococci is rafinostis 812 FN600541 clade 497 N N Enterococcus sp. BV2CASA2 813 JN809766 clade 497 N N Enterococcus sp. CCRI 16620 814 GU457263 clade 497 N N Enterococcus sp. F95 815 FJ463817 clade 497 N N Enterococcus sp. RfL6 81.6 A133478 clade 497 N N Enterococcus thailandicus 817 AY321376 clade 497 N N Fusobacterium canifelinum 893 AY162222 clade 497 N N Fusobacterium genomosp. C1 894 AY278616 clade 497 N N Fusobacterium genomosp. C2 895 AY2786.17 clade 497 N N Fusobacterium periodonticum 902 ACTYO1 OOOOO2 clade 497 N N Fusobacterium sp. 1141 FAA 906 ADGGO1000053 clade 497 N N Fusobacterium sp. 113 2 904 ACUOO1000052 clade 497 N N Fusobacterium sp. 2 1 31 907 ACDCO2000018 clade 497 N N Fusobacterium sp. 3 1. 27 908 ADGFO1000045 clade 497 N N US 9,011,834 B1 137 138 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Fusobacterium sp. 3 133 909 ACQEO 1000178 clade 497 N N Fusobacterium sp. 3 136A2 910 ACPUO1000044 clade 497 N N Fusobacterium sp. AC18 912 HQ616357 clade 497 N N Fusobacterium sp. ACB2 913 HQ616358 clade 497 N N Fusobacterium sp. AS2 914 HQ616361 clade 497 N N Fusobacterium sp. CM1 915 HQ616371 clade 497 N N Fusobacterium sp. CM21 916 HQ616375 clade 497 N N Fusobacterium sp. CM22 917 HQ616376 clade 497 N N Fusobacterium sp. oral clone 919 AY923141 clade 497 N N ASCFO6 Fusobacterium sp. oral clone 920 AY95.3256 clade 497 N N ASCF11 Granticateia adiacens 959 ACKZO1000002 clade 497 N N Granticatella elegans 960 AB2S2689 clade 497 N N Granticatella paradiacens 961 AY879298 clade 497 N N Granticatella sp. oral clone 963 AY923.126 clade 497 N N ASCO2 Granticatella sp. oral clone 964 DQ341469 clade 497 N N ASCAOS Granticatella sp. oral clone 965 AY95.3251 clade 497 N N ASCBO9 Granticatella sp. oral clone 966 AY923.146 clade 497 N N ASCGOS Tetragenococciis halophilus 1918 NR 075O20 clade 497 N N Tetragenococci is koreensis 1919 NR 043113 clade 497 N N Vagococcits fiti vialis 1973 NR 026489 clade 497 N N Chryseobacterium anthropi S14 AM982.793 clade 498 N N Chryseobacterium gleum 515 ACKQ02000003 clade 498 N N Chryseobacterium hominis 516 NR 042517 clade 498 N N Treponema refingens 1936 AF426101 clade 499 N OP Treponema sp. oral clone JUO31 1941 AY349416 clade 499 N N Treponema sp. oral taxon 239 1948 GU408738 clade 499 N N Treponema sp. oral taxon 271 1955 GU408871 clade 499 N N Alistipes finegoidii 129 NR 043064 clade 500 N N Alistipes onderdonki 131 NR 043318 clade 500 N N Alistipes puttredinis 132 ABFKO2000017 clade 500 N N Alistipes shahi 133 FP929O32 clade 500 N N Alistipes sp. HGB5 134 AENZO1000O82 clade 500 N N Alistipes sp. JC50 135 JF824.804 clade 500 N N Alistipes sp. RMA 9912 136 GQ140629 clade 500 N N Mycoplasma agaiaciae 1310 AFO10477 clade 501 N N Mycoplasma bovoculi 1313 NR 025987 clade 501 N N Mycoplasma fermenians 1315 CPOO2458 clade 501 N N Mycoplasmafiocchiare 1316 X62699 clade 501 N N Mycoplasma ovipneumoniae 1320 NR 025989 clade 501 N N Arcobacter buizieri 176 AEPTO1 OOOO71 clade 502 N N Arcobacter cryaerophilus 177 NR 025.905 clade 502 N N Campylobacter curvus 461 NC OO9715 clade 502 N OP Campylobacter rectus 467 ACFUO1000050 clade 502 N OP Campylobacter Showae 468 ACVQ01000030 clade 502 N OP Campylobacter sp. FOBRC14 469 HQ616379 clade 502 N OP Campylobacter sp. FOBRC15 470 HQ616380 clade 502 N OP Campylobacter sp. oral clone 471 AYOOSO38 clade 502 N OP BB120 Campylobacter splitorum 472 NR 044839 clade 502 N OP Bacteroides tireolyticus 330 GQ167666 clade 504 N N Campylobacter gracilis 463 ACYGO1000026 clade 504 N OP Campylobacter hominis 464 NC OO9714 clade 504 N OP Dialister invisits 762 ACIMO2OOOOO1 clade 506 N N Dialister micraerophilus 763 AFBBO1000028 clade 506 N N Dialister microaerophilus 764 AENTO1000008 clade 506 N N Dialister propioniclifaciens 766 NR 043231 clade 506 N N Dialister succinatiphilus 768 AB370249 clade 506 N N Megasphaera eisdenii 1200 AYO38996 clade 506 N N Megasphaera genomosp. 1202 ADGPO1000010 clade 506 N N type 1 Megasphaera sp. BLPYG 07 1204 HM990964 clade 506 N N Megasphaera sp. UPII 1996 1205 AFIO1OOOO40 clade 506 N N Chronobacterium violiaceum 513 NC 005085 clade 507 N N Laribacter hongkongensis 1148 CPOO1154 clade 507 N N Methylophilus sp. ECd5 1229 AY436794 clade 507 N N Finegoidia magna 883 ACHMO2000001 clade 509 N N Parvinonas micra 1431 AB729O72 clade 509 N N Parvimonas sp. oral taxon 110 1432 AFI101 OOOOO2 clade 509 N N Peptostreptococci is microS 1456 AM176538 clade 509 N N US 9,011,834 B1 139 140 -continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Peptostreptococci is sp. oral 1460 AY349390 clade 509 N N clone FJO23 Peptostreptococci is sp. 1458 AY2O7059 clade 509 N N P4P 31 P3 Helicobacter pylori 997 CPOOOO12 clade 510 N OP Anaplasma marginale 165 ABORO1000019 clade 511 N N Anaplasma phagocytophilum 166 NC 007797 clade 511 N N Ehrlichia chafeensis 783 AAIFO1 OOOO3S clade 511 N OP Neorickettsia risticii 1349 CPOO1431 clade 511 N N Neorickettsia Sennetsu 1350 NC 007798 clade 511 N N Pseudoramibacter alactolyticus 1606 ABO36759 clade 512 N N Veillonella montpellierensis 1977 AF473836 clade 513 N N Veillonella sp. oral clone 1988 AY923.118 clade 513 N N ASCAO8 Veillonella sp. oral clone ASCB03 1989 AY923.122 clade 513 N N Inquilinus inostis 1012 NR 029046 ade 514 N N Sphingomonas sp. oral clone 1746 AY34.9412 clade 514 N N FZO16 Anaerococci is lactolyticits 145 ABYOO 1000217 clade 515 N N Anaerococcits prevotii 147 CPOO1708 clade 515 N N Anaerococci is sp. gpac104 152 AM176528 clade 515 N N Anaerococci is sp. gpac126 153 AM176530 clade 515 N N Anaerococci is sp. gpac155 154 AM176536 clade 515 N N Anaerococci is sp. gpac199 1SS AM176539 clade 515 N N Anaerococci is tetradius 157 ACGCO1OOO107 clade 515 N N Bacteroides coaglians 271 ABS47639 clade 515 N N Cliostridiaies bacterium 9403326 534 HMS87324 clade 515 N N Clostridiales bacterium ph2 539 JN837487 clade 515 N N Peptostreptococci is sp. 9Succ1 1457 X90471 clade 515 N N Peptostreptococci is sp. oral 1459 AB17SO72 clade 515 N N clone AP24 Tissierelia praeactita 1924 NR 044860 clade 515 N N Helicobacter Canadensis 994 ABQSO1000108 ade 518 N N Peptostreptococcus 1455 AY326462 clade 520 N N anaerobius Peptostreptococci is Stomatis 1461 ADGQ01000048 clade 520 N N Biophila wadsworthia 367 ADCPO1000166 clade 521 N N Desulfovibrio vulgaris 761 NR 074897 clade 521 N N Actinomyces nasicola 64 AJSO845S clade 523 N N Cellulosimicrobium funkei SOO AYSO1364 clade 523 N N Lactococci is raffinolactis 1146 NR 044359 clade 524 N N Bacteroidales genomosp. P1 258 AY341819 clade 529 N N Bacteroidales genomosp. P2 259 DQ003613 clade 529 N N oral clone MB1 G13 Bacteroidales genomosp. P3 260 DQ003615 clade 529 N N oral clone MB1G34 Bacteroidales genomosp. P4 261 DQ003617 clade 529 N N oral clone MB2 G17 Bacteroidales genomosp. P5 262 DQ003619 clade 529 N N oral clone MB2 P04 Bacteroidales genomosp. P6 263 DQ003634 clade 529 N N oral clone MB3 C19 Bacteroidales genomosp. P8 265 DQ003626 clade 529 N N oral clone MB4 G15 Bacteroideies bacterium oral 333 HMO99638 clade 530 N N taxon D27 Bacteroideies bacterium oral 334 HMO99643 clade 530 N N taxon F31 Bacteroideies bacterium oral 335 HMO99649 clade 530 N N taxon F44 Flavobacterium sp. NF2 1 88S F195988 clade 530 N N Myroides odoratimimus 1326 NR 042354 clade 530 N N Myroides sp. MY15 1327 GU253339 clade 530 N N Chlamydiales bacterium NS16 507 JN606O76 clade 531 N N Chlamydophila pecorum SO8 D883.17 clade 531 N OP Parachlamydia sp. UWE25 1423 BX908798 clade 531 N N Fusobacterium russi 903 NR 044687 clade 532 N N Streptobacilius moniiformis 1784 NR 027615 clade 532 N N Eubacteriaceae bacterium 833 AY2O7O60 clade 533 N N P4P 50 P4 Abiotrophia defective 1 ACINO2OOOO16 ade 534 N N Abiotrophia sp. oral clone 3 AY2O7063 clade 534 N N P4PA 155 P1 Caionella genomosp. P1 oral 496 DOOO3629 clade 534 N N clone MBS P12