US 20100081177A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0081177 A1 Schatz et al. (43) Pub. Date: Apr. 1, 2010

(54) DECREASING RUBISCO CONTENT OF Publication Classification ALGAE AND CYANOBACTERIA (51) Int. Cl CULTIVATED IN HIGH CARBON DOXDE CI2P 7/64 (2006.01) (75) Inventors: Daniella Schatz, Givataim (IL); CI2P I/04 (2006.01) Jonathan Gressel, Rehovot (IL); CI2P I/00 (2006.01) Doron Eisenstadt, Haifa (IL); Shai CI2N I/2 (2006.01) Ufaz, Givat Ada (IL) CI2N 15/74 (2006.01) Correspondence Address: CI2N I/3 (2006.01) DODDS & ASSOCATES 1707 NSTREET NW (52) U.S. Cl...... 435/134:435/170; 435/41; 435/252.3: WASHINGTON, DC 20036 (US) 435/471; 435/257.2 (73) Assignee: TransAlgae Ltd, Rehovot (IL) (21) Appl. No.: 12/584,571 (57) ABSTRACT (22) Filed: Sep. 8, 2009 Algae and cyanobacteria are genetically engineered to have Related U.S. Application Data lower RUBISCO (ribulose-1,5-bisphosphate carboxylase/ oxygenase) content in order to grow more efficiently at (60) Provisional application No. 61/191,169, filed on Sep. elevated carbon dioxide levels while recycling industrial CO, 5, 2008, provisional application No. 61/191,453, filed emissions back to products, and so as not to be able to grow on Sep. 9, 2008. outside of cultivation.

38:8 3xxx. :33.33. 3:38

:::::::::: Patent Application Publication Apr. 1, 2010 Sheet 1 of 2 US 2010/0081177 A1

*::::::::

Patent Application Publication Apr. 1, 2010 Sheet 2 of 2 US 2010/0081177 A1

| 8 psi-rics AS

s s 8:33:3:$33:38

US 2010/0081177 A1 Apr. 1, 2010

DECREASINGRUBSCO CONTENT OF fructose-1,6-bisphosphate aldolase and spinach triose phos ALGAE AND CYANOBACTERA phate isomerase in cells of a cyanobacterium doubled their CULTIVATED IN HIGH CARBON DOXDE activities and greatly increased photosynthetic efficiency and biomass yields (Kang et al. 2005, Ma et al. 2007). 0006. However, one can only over-express enzymes to a PRIORITY limited extent, as the cell does not have unlimited capacity. Therefore, the existing methods have only a limited capacity 0001. This application claims priority of the U.S. Provi and there is a need to improve these methods to enhance the sional applications No. 61/191,169 filed on Sep. 5" 2008 and use of elevated carbon dioxide concentration in algal cultures. 61/191,453 filed on Sep. 9, 2008. SUMMARY OF THE INVENTION 0007. The instant invention provides a solution to this SEQUENCE LISTING existing problem by reducing the levels of other enzymes to “make room' for the over expressed, rate limiting enzymes 0002 This application contains sequence data provided on such as fructose-1,6-bisphosphate aldolase (ALD), chloro a computer readable diskette and as a paper version. The plast triosephosphate isomerase (TPI) or acetyl CoA car paper version of the sequence data is identical to the data boxylase (ACCase) that enhance sink capacity to utilize fixed provided on the diskette carbon dioxide. 0008 Ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO) is the key photosynthetic enzyme that catalyzes FIELD OF THE INVENTION the first step of CO, fixation. The chloroplast localized holoenzyme of plants and algae in Sub-kingdom Viridaeplan 0003. This invention relates to the field of genetically tae, Phylum Chlorophyta (heretofore referred to as green engineering algae and cyanobacteria to grow more efficiently algae) contain eight nuclear genome encoded Small subunits on industrial waste emissions of carbon dioxide and is appli and eight chloroplast genome encoded large subunits. In red cable for use with algae and cyanobacteria cultured in closed lineage algae (Sub-Kingdom Chromobiota, Phylum Hapto bioreactors and covered or open ponds for producing high phyta, Heterokonotophyta, Bacillariophyta and others (Table value products, as well as biofuels. It builds on integrating 1), all Sub-units are encoded in the chloroplast.

TABLE 1. Phylogeny of some of algae used

Genus Family Order Phylum Sub-Kingdom Chlamydomonas Chlamydomonadaceae Volvocales Chlorophyta Viridaeplantae Nannochioris Coccomyxaceae Chlorococcales Chlorophyta Viridaeplantae Tetraseinis Chlorodendraceae Chlorodendrales Chlorophyta Viridaeplantae Phaeodactylum Phaeodactylaceae Naviculales Bacillariophyta Chromobiota Nannochloropsis Monodopsidaceae Eustigmatales Heterokontophyta Chromobiota Paviova Pavlovaceae Pavlovales Haptophyta Chromobiota Isochrysis Isochrysidaceae Isochrysidales Haptophyta Chromobiota Phylogeny according to: http://www.algaebase.org/browseftaxonomy Note: Many genes that in higher plants and Chlorophyta are encoded in the nucleus are encoded on the chlo roplast genome (plastome) of Chromobiota, red lineage algae (Grzebyk, et al. (2003). principles of genetic engineering, photosynthetic physiology 0009. The present consensus is that even more RUBISCO and biochemistry, chemical engineering of bioreactors, and is needed for efficient photosynthesis, as demonstrated in the waste emission engineering. recent suggestion that elevated RUBISCO would enhance the rate of photosynthesis in algae commercially cultivated for BACKGROUND OF THE INVENTION biofuels (Huntley and Redalje 2007). Counter-intuitively, the inventors of this disclosure chose to “make room' for other 0004. A major breakthrough in the large scale cultivation enzymes by reducing concentration of the RUBISCO of algae and cyanobacteria to produce commercially useful enzyme, typically considered to be rate limiting for CO products was the discovery that many such species could be assimilation in photosynthetic cells; RUBISCO can comprise cultivated with flue gas (up to 80% CO) or even pure CO, up to 70% of the soluble protein in plant cells. whereas most other organisms (plants and animals) are “bio 0010 Photosynthesis produces the sugars needed for the chemically anaesthetized” at CO levels of 5% or higher, biosynthesis of the specific primary and secondary metabo slowing all metabolism. This opened the way for cultivating lites of interest in each case (biofuels, pigments, enzymes, such organisms on CO emissions to the environment (Mu pharmaceuticals, starch, etc.). RUBISCO is the first enzyme rakami and Ikenouchi 1997, Negoro, et al. 1993). in the dark reactions of photosynthesis, “fixing carbon diox 0005 Cyanobacteria have already begun to be genetically ide onto an organic molecule. The later reactions use NADPH engineered to utilize these elevated CO levels by over and ATP generated by the light reactions to reduce the fixed expressing genes encoding rate limiting enzymes of the "dark CO to carbohydrates. RUBISCO was the best enzyme evo reactions” (CO assimilating reactions that utilize NADPH lution could produce pre-antiquity, which was of little matter and ATP from the light reactions) of photosynthesis. Thus, for early in the evolution of earth, e.g. in the Archean era 3.5 example, engineering genes from rice encoding for cytosolic billion years ago when CO concentrations in the atmosphere US 2010/0081177 A1 Apr. 1, 2010

were thought to be at least 100 times more than at present especially adapted to thrive in cultivation with high CO (FIG. 1.4 in Falkowski and Raven, 1997), and the very low levels in the medium, allowing for the over-expression of affinity for CO to RUBISCO was of little consequence. As other, rate limiting enzymes of photosynthesis as well as oxygenous photosynthesis began to remove CO from the enzymes encoding for other desirable traits. Thus, these atmosphere and elevate atmospheric O, the levels of organisms are platforms for further engineering. RUBISCO became limiting, and evolution gradually 0015. In one embodiment the small subunit of RUBISCO increased the levels of RUBISCO in photosynthetic organ is subjected to RNAi suppression and in another it is sub isms to the present high levels. Presently, high concentrations jected to antisense. In yet another embodiment both large and of CO can be inexpensively provided to algae and cyanobac Small Subunits are suppressed by chloroplast transformation teria in culture from industrial combustion of fuels. This will of the rbcLS gene cluster under the control of a mutated lead to much of the RUBISCO being superfluous, and promoter replacing the endogenous promoter and genes. decreasing its content “makes way for over-expressing other 0016. In other embodiments DNA encoding other traits is enzymes needed for photosynthesis as well as releasing either engineered in tandem with the RUBISCO suppression resources for more soluble products. This would be one way simultaneously (co-transformation) or Subsequent to the of sequestering large amounts of carbon dioxide, presently engineering of partial RUBISCO suppression. In such imperative due to the purported relationships between embodiments algae or cyanobacteria with reduced RUBISCO elevated global carbon dioxide levels and global warming. levels are used as a platform for further engineering of other Even though the small subunit of RUBISCO is encoded by a desired traits, with greater efficiency of organism activity. family of genes, the gene products are interchangeable, with These include genes encoding enzymes Such as fructose-1,6- considerable consensus among them. bisphosphate aldolase (ALD), chloroplast triosephosphate 0011. According to this disclosure, reducing RUBISCO in isomerase (TPI) or acetyl CoA carboxylase (ACCase) that green algae can be done by using either antisense or RNAi enhance sink capacity to utilize fixed carbon dioxide. Con technology, both targeting the consensus sequences of the versely, other transgenic traits may be in the algae or cyano Small nuclear encoded subunit, which, in many cases, has bacteria prior to transformation for partial RUBISCO Sup been shown to control the biosynthesis of both subunits. pression. Obviously, total suppression is undesirable, as RUBISCO is 0017. According to one embodiment the alga or cyanobac needed for CO fixation. The level of suppression that is terium transformed to express reduced RUBISCO content is advantageous is a function of a. experimental determination also transformed to express pharmaceutical or industrial pro for each pond or bioreactor condition and concentration of teins, such as human insulin AAN394.51 or AY138590 or CO, introduced into the system; and b. the availability of the thermostable phytase, such as disclosed in U.S. Pat. No. CO to the organisms in the medium. Reducing RUBISCO in 6,720,174. Other desired proteins to be expressed in trans red lineage algae according to this disclosure, can be done by genic algae or cyanobacteria with reduced RUBISCO content knockout of one or both RUBISCO subunits in the chloroplast are storage proteins, such as 15 kDZein or BHL8. The trans by homologous recombination and transformation of the genic algae expressing reduced RUBISCO content may also same RUBISCO gene under a mutated promoter, which will be transformed to express altered oil or lipid contents. decrease the RUBISCO expression level. 0012 Many algae and especially cyanobacteria have A SHORT DESCRIPTION OF THE DRAWINGS atypical (for higher organisms) G:C contents and conse (0018 FIG. 1. Map of the plasmid pSI-PDS-rbcS RNAi quently atypical codon usages and DNA sequences. While containing the cassette designed to induce RNAi of C. rein there is a high consensus in amino acid sequences in hardtii RUBISCO small subunit. An inverted repeat of the RUBISCO subunits, it is far less at the nucleotide level, first 234 by of RbcS2 coding region encoding the RUBISCO requiring sequencing of the genes encoding RUBISCO Sub Small Subunit is cloned downstream to the pds gene confer units from each target organism before embarking on gener ring resistance to the herbicide fluorochloridone. The trans ating RNAi orantisense constructs and engineering them into gene is under the control of the HSP70-RbcS2 promoter and the cell thus reducing RUBISCO according to the codon RbcS2 terminator (taken from plI103, Sizova et al., 2001). usage of the target organism. 0019 FIG. 2. Map of the plasmid pSI-rbcS-AS containing 0013. One drawback to genetically engineering algae and the cassette designed to induce antisense of C. reinhardtii cyanobacteria for large scale cultivation is the risk of inad RUBISCO small subunit and the psal)-Ble cassette confer vertent “spills' into the environment. It is highly unlikely (i.e. ring resistance to the antibiotic Zeocin. The coding region of as near to impossible as a scientist can evaluate) that organ RbcS2 from C. reinhardtii encoding the RUBISCO small isms optimized to live and grow in an atmosphere of >5% Subunit is cloned in antisense orientation downstream to the CO, yet having a lower than normal RUBISCO content can HSP70-rbcS promoter. Survive for long in nature where the CO concentration is <0.5%, as the engineered organism has lost most of its ability DETAILED DESCRIPTION OF THE INVENTION to scavenge CO, from the environment. Thus, this risk from inadvertent transgenic release is negated, whether the organ 0020 Algae and cyanobacteria with biotechnological util ism is engineered just for lowered RUBISCO, or engineered ity are chosen from among the following, non-exclusive list with lowered RUBISCO and elevated other enzymes, of organisms. whether photosynthesis related, or related to other properties. 0014. The present invention relates to the use of algae or List of Species: cyanobacteria cultivated in ponds or bioreactors that have had 0021 Pavlova lutheri, Isochrysis CS-177, Nannochlorop their RUBISCO contents transgenically lowered by antisense sis oculata CS-179, Nannochloropsis like CS-246, Nan or RNAi or other transgenic technologies giving rise to simi nochloropsis salina CS-190, Tetraselmis suecica, Tetraselmis larly lowered RUBISCO contents. These novel organisms are chui and Nannochloris sp., Chlamydomonas reinhardtii as US 2010/0081177 A1 Apr. 1, 2010 representatives of all algae species. The phylogeny of the 0031. The methodology used in the various steps of algae is summarized in Table 1. Synechococcus PCC7002, enabling the invention is described here below: Synechococcus WH-7803, Thermosynechococcus elongaues 0032. Nucleic Acid Extraction Genomic DNA is isolated BP-1 are used as representatives of all cyanobactrial species. using either the Stratagene (La Jolla, Calif., USA) DNA puri 0022 Algae and cyanobacteria with partially suppressed fication kit or a combination of the QIAGEN (Valencia, RUBISCO are achieved by standard molecular biological Calif., USA) DNeasy plant mini kit and phenol chloroform procedures, as outlined in numerous texts and papers. First, extraction method (Davies et al. 1992). Total RNA is isolated consensus sequences of the large and Small Subunits of using either the QIAGENS Plant RNeasy Kit or the Trizol RUBISCO are used to “fish out the respective genes by low Reagent (Invitrogen, Carlsbad, Calif., USA). stringency PCR using a consensus sequences chosen to have 0033 RACE analysis The full length RbcS small and large the least number of nucleotide variants. Standard software is Subunits from algae or cyanobacteria with unknown genomic used to design degenerate primers according to these consen sequences are determined by 3' and 5' RACE and nested PCR Sus sequences. After fishing out fragments of the genes, larger using the First Choice RLM-RACE Kit (Ambion, Austin, segments of the genes are obtained using the RACE (rapid Tex., USA), as described by Liu and Gorovsky (1993). amplification of cDNA ends) technique. The resulting 0034. Transformation of Plasmid DNA sequences are used to design anti-sense and RNAi constructs 0035 Transformation of Chlamydomonas Algae cells in that are then inserted into respective cassettes and trans 0.4 mL of growth medium containing 5% PEG (polyethylene formed into the algae and cyanobacteria using techniques glycol MW6000) were transformed with the plasmid from readily available to those skilled in the art. Different cassettes examples 1 and 2 by the glass bead vortex method (Kindle, are used having different promoters such that a large variety 1990). The transformation mixture was then transferred to 50 of expression levels are achieved, so that RUBISCO will be mL of non-selective growth medium for recovery and incu reduced by varying amounts. A large number of transforma bated for at least 18 h at 25° C. in the light. Cells were tion events were generated for each algal species, and the best collected by centrifugation and plated at a density of 10 cells transformants chosen as described below. per Petri dish. Transformants were grown on fresh TAP or 0023 The growth rates of the transformants are measured SGII agar plates containing a selection agent for 7-10 days in under conditions of various levels of high CO (1%; 5%; 250 C. 14%; 100%) and those that appear best are rechecked in mini bioreactors and pilot Scale ponds to ascertain which have the Transformation of Marine Algae best yield, under a variety of environmental conditions and I. Electroporation CO concentrations. 0024. The best transformants of each organism can then be 0.036 Fresh algal cultures are grown to mid exponential used as platforms for inserting other genes into the algae or phase in artificial sea water (ASW)+f72 media. Cells are cyanobacteria to optimize the production of valuable com then harvested and washed twice with fresh media. After pounds. The algae come from a large taxonomical cross sec resuspending the cells in "/50 of the original Volume, tion of species (Table 1) protoplasts are prepared by adding an equal Volume of 0025. The general approach for green algae is as follows: 4% hemicellulase (Sigma) and 2% Driselase (Sigma) in 0026 1. Cloning of the algae RUBISCO small subunit ASW and are incubated at 37°C. for 4 hours. Protoplast (rbcS) cDNA in antisense (AS) orientation under the formation is tested by Calcofluor white (Fluka) staining. control of a constitutive promoter such as the rbcS pro Protoplasts are washed twice with ASW containing moter and 3'rbcS terminator, downstream to a selectable 0.6MD-mannitol (Sigma) and 0.6MD-sorbitol (Sigma) marker. The selectable marker can be Sh ble, which and resuspended in the same media, after which DNA is confers resistance to the antibiotic Zeocine, the pds added (10 uglinear DNA for each 100 ul protoplasts). gene, which confers resistance to fluridone and fluoro Protoplasts are transferred to cold electroporation chloridone. cuvettes and incubated on ice for 7 minutes, then pulsed 0027 2. Generation of an RNAi cassette (as described in a BTX ECM830 (Harvard Apparatus, Holliston, in detail in Schroda, 2006) of the algae rbcS gene com Mass., USA) electroporation apparatus. A variety of prising a 300 by cDNA/cDNA inverted repeat under the pulses is usually applied, ranging from 1000 to 1500 control of a constitutive promoter downstream to a volts, 10-20 ms each pulse. Each cuvette is pulsed 5-10 selectable marker described above. times. Immediately after pulsing the cuvettes are placed 0028. The general approach for red lineage marine algae on ice for 5 minutes and then the protoplasts are added to species (Sub-kingdom Chromobiota, Table 1), is to replace 250 ul of fresh growth media (without selection). After the chloroplast RUBISCO small or large subunit with a DNA incubating the protoplasts for 24 hours in low light, 25° construct containing the same RUBISCO subunit gene con C. the cells are plated onto selective solid media and trolled by a mutated promoter, use antisense or with a chlo incubated under normal growth conditions until single roplast expression vector, and directly transform the chloro colonies appear. plasts, as has been done with Chlamydomonas (Franklin and Mayfield, 2004) II. Microporation 0029. The general approach for cyanobacteria is as fol 0037. A fresh algal culture is grown to mid exponential lows: phase in ASW--f/2 media. A 10 mL sample of the culture 0030) Cloning of the RUBISCO small subunit (rbcS) or is harvested, washed twice with Dulbecco's phosphate large Subunit (rbcL) gene from a cyanobacteria species under buffered saline (DPBS, Gibco) and resuspended in 250 the control of mutated promoter and replacing the respective ul of buffer R (supplied by Digital Bio, Seoul, Korea, the endogenous gene with the cloned cassette using homologous producer of the microporation apparatus and kit). After recombination, as described in Clerico et al. (2007). adding 8 ug linear DNA to every 100 ulcells, the cells US 2010/0081177 A1 Apr. 1, 2010

are pulsed. A variety of pulses is usually needed, Victoria, Australia) and SYBR Green I for monitoring depending on the type of cells, ranging from 700 to 1700 dsDNA synthesis. For all PCR reactions the following stan volts, 10-40 ms pulse length; each sample is pulsed 1-5 dard thermal profile is used: 50° C. for 2 min: 95°C. for 15 times. Immediately after pulsing the cells are transferred min; 40 cycles of 95°C. for 15 sec and 60° C. for 1 min. In to 200 ul fresh growth media (without selection). After order to compare data from different cDNA samples, C. incubating for 24 hours in low light, 25°C., the cells are (threshold cycle) values for all genes are normalized to the C. plated onto selective solid media and incubated under values of Ubiquitin, or 16S rDNA for algae and cyanobacte normal growth conditions until single colonies appear. ria, respectively, which are used as internal references in all experiments. All primers are designed using the Primer III. Particle Bombardment Express 2.0 software (Applied Biosystems, Foster City, Calif., USA). The sequences of sense and antisense designed 0038 A fresh algal culture is grown to mid exponential primers correspond to two consecutive exons of the studied phase in ASW--f/2 media. 24 hours prior to bombard genes, excluding any genomic DNA amplification. The real ment cells are harvested, washed twice with fresh ASW-- time PCR data is analyzed using the comparative CT-method f72 and re-suspended in /10 of the original cell volume in with appropriate validation experiments performed before ASW+f/2.0.5 mL of each cell suspension is spotted onto hand (Applied Biosystems. User Bulletin #2, http://home. the center of a 55 mm Petri dish containing 1.5% agar appliedbiosystems.com/). All experiments are repeated at solidified ASW--f/2 media. Plates are left to dry under least three times with cDNA templates prepared from three normal growth conditions. Bombardment is carried out independent colonies of algae or cyanobacteria and every using a BioRad PDS1000/He system according to the reaction is set up in triplicates. manufacturers (BioRad) instructions, using M10 tung sten powder for cells larger than 2 microns in diameter, 0041) Protein extraction 1 to 10 mL cells at 5x10 cell/mL and tungsten powder comprised of particles Smaller than are harvested and resuspended in 500 ul extraction buffer (50 0.6 microns (FW06, Canada Fujian Jinxin Powder Met mM Tris pH=7.0; 1 mM EDTA; 100 mMNaCl: 0.5% NP-40; allurgy Co., Markham, ON, Canada) for smaller cells. and protease inhibitor (Sigma cathi P9599). Then 100 ul of The tungsten is coated with linear DNA. 1100 or 1350 glass beads (425-600 um, Sigma) are added and cells are psi rupture discs are used. All disposables are Supplied broken in a bead beater (MP FastPrep-24, MP Biomedicals, by BioRad. After bombardment the plates are incubated Solon, Ohio, USA) for 20 sec. The tube content is centrifuged under normal growth conditions for 24 hours followed for 15 min, 13000xg, at 4°C. The supernatant is removed to by transferring the cells onto selective solid media and new vial. incubated under normal growth conditions until single 0042 Protein separation by PAGE and western analysis colonies appear. For chloroplast transformation, this Extracted proteins are separated on a 4-20% gradient SDS method is carried out in the same way, but the resulting PAGE (Gene Bio-Application Ltd., Kfar Hanagid, Israel, at transformants are screened for the presence of the trans 160V for 1 hr. They were then either stained by Coomassie gene in the chloroplast. (Sigma) or blotted onto PVDF (Millipore, Billerica, Mass., USA) membranes for 1 hat 100 volts in the transfer buffer (25 mM Tris, 192 mM glycine and 20% methanol). The proteins Transformation of Cyanobacteria are detected with the RbcL RUBISCO large subunit, form I 0039. For transformation to Synechococcus PCC7002, and form II antibody (Agrisera, Vännäs, Sweden) diluted to a cells are cultured in 100 mL of BG-11+Turks Island Salts ratio of 1:10000 in antibody incubation buffer (5% skim milk, liquid medium (http://www.crbip-pasteur.fr/fiches/ficheme Difico). An alkaline phosphatase conjugated anti-rabbit anti dium.jsp?id=548) at 28°C. under white fluorescent light and body (Millipore, Billerica, Mass., USA), at 1:10000 dilution cultured to mid exponential growth phase. To 1.0 mL of cell in the same buffer was used as a secondary antibody. Detec suspension containing 2x10 cells, 0.5-1.0 ug of donor DNA tion was carried out using the standard alkaline phosphatase (in 10 mM Tris/1 mM EDTA, pH 8.0) is added, and the detection procedure (Blake et al., 1984). mixture is incubated in the dark at 26° C. overnight. After 0043. Physiological Assessment To assess physiological incubation for a further 6 h in the light, the transformants are properties of genetically modified algae compared with their selected on BG-11+Turks Island Salts 1.5% agar plates con relevant wild type strains and other algal candidates we per taining a selection agent until single colonies appear. form a set of procedures that enable us to evaluate each strain. There is no prior art known to us of previously transforming Initially, each genetically modified strain is checked for the the following species: Pavlova lutheri, Isochrysis CS-177, modified trait, (reduced RUBISCO content). A screening pro Nannochloropsis oculata CS-179, Nannochloropsis like cess is established where colonies of transgenic algae or CS-246, Nannochloropsis salina CS-190, Tetraselmis cyanobacteria are allowed to grow on Solid media Supple suecica, Tetraselmis Chui and Nannochloris sp. nor has mented with selection reagent (an antibiotic or herbicide) to microporation been used previously for transforming algae check if the desired trait has been established. Next, the cyanobacteria or higher plants. fastest growing colonies are picked and transferred to liquid 0040. RNA extraction, cDNA synthesis and quantitative medium for further physiological evaluation. RT-PCR analysis Total RNA is isolated using either the This includes: QIAGENS Plant RNeasy Kit or the Trizol Reagent (Invitro 0044) 1. Growth rate gen, Carlsbad, Calif., USA). cDNA is synthesized using 3 ug 0.045 2. Photosynthetic activity at ambient and high total RNA as a template using Superscript kit (Invitrogen, carbon dioxide concentrations Carlsbad, Calif., USA) according to the manufacturer's 0046 3. Respiration activity instructions. Real-time quantitative PCR reactions are pre 0047. 4. Tolerance to a-biotic parameters formed in an optical 96-well plate using the ABIPRISM 7300 (0.048 5. Lipid content Sequence Detection System (Applied Biosystems, Scoresby, 0049. 6. Protein content US 2010/0081177 A1 Apr. 1, 2010

An overall report is generated for each strain that is used to mL are placed in the O electrode chamber, at relevant tem estimate the feasibility of using the strain. perature. Cells are exposed to various light intensities and 0050 Growth Rate Growth rates are measured using one regimes (e.g. flashing light). Incubations in darkness are per or more of the following techniques: formed in these air-tight vessels to follow oxygen consump 0051 Direct cell count tion in the dark. 0.052 Optical density at a relevant wavelength (e.g. 730 0065. Fluorescence measurements Electron transfer activ nm) ity of photosystem II is measured by pulse modulated fluo 0053 Pigment/Chlorophyll concentration (where this rescence (PAM) kinetics using PAM-101 (Walz, Effertlich, method is applicable) Germany). Light intensity (measured at the Surface of the 0054 Percentage of packed volume chamber) of the modulated measuring beam (at 1.6 kHz fre 0055 Photosynthetic Activity One of the important quency) is 0.1 umol photons m°s'. White actinic light is parameters indicating the welfare of a photoautotrophic cul delivered at 50-1500 umol photons mis' as required in ture is its photosynthetic capability. To measure this, one or different experiments and is used to assess steady state fluo more of several methodologies are applied: rescence (F). Maximum fluorescence (F) is measured with 0056. Oxygen evolution using ClarkType electrodes. saturating white light pulses of 4000 umolphotons mis' for 0057 Variable fluorescence using PAM (Pulse 1 S. Amplitude Modulated fluorometry) 0066. Additional Experiments 0058 Oxygen consumption in darkness is also evaluated 0067 Light intensity tolerance (at a given cell density) in order to estimate net photosynthetic potential of the algal is evaluated. P/I (photosynthesis vs. irradiance) curves culture. As part of the photosynthetic evaluation several abi are used to determine optimal light intensity per cell. otic parameters that potentially influence the physiological Four mL of cell Suspension containing 15 Jug chloro state of a culture are followed. phyll/mL are placed in the O electrode chamber, at 0059 Light intensity tolerance (at a given cell density) relevant temperatures and various light intensities. Oxy is evaluated. P/I (photosynthesis vs. irradiance) curves gen evolution rates are measured at each light intensity. are used to determine optimal light intensity per cell. 0068 Performance at different CO levels (e.g. ambi 0060 Performance at different CO levels (e.g. ambi ent; 1%; 5%; 14%; 100%). Growth rate estimations and ent; 1%; 5%; 14%; 100%). This is coupled with pH photosynthetic activity (methodology described above) tolerance. are evaluated when cultures are maintained at different 0061 Temperature tolerance. Each culture is tested at CO levels. optimal temp. In addition, temperatures are raised tem 0069. Temperature tolerance. Each culture is tested at peratures to the highest points possible without inhibit optimal temp. In addition, we attempt to raise tempera ing other culture activities. tures to the highest point possible without inhibiting 0062 Growth conditions Cells of eukaryotic marine cul other culture activities. tures and transformants thereofare grown on artificial seawa The invention is now described by means of various non ter medium (Goyet, 1989) supplemented with f/2 (Guillard, limiting examples using the above methods: 1962). Marine cultures are grown at 18-20°C. with a 16/8 h light/dark period. Fresh water cultures (e.g. the diploid wild Example 1 type Chlamydomonas reinhardtii) and transformants thereof Generation of C. reinhardtii Expressing RNAi of are grown photoautotrophically on liquid medium, using RbcS2B Gene Under the Control of the HSP70 mineral medium as previously described (Harris, 1989), with rbcS2 Promoter the addition of 5 mMNaHCO, with continuous shaking and illumination at 22° C. Marine cyanobactertial cultures and (0070 For generation of RNAi of rbcS2 (ACCESSION transformants thereof are grown in BG 11 medium BG 11 NO: X04472), a 774 by fragment (SEQ ID NO:1) corre (Stanier et al., 1971) supplemented with Turks Island Salts sponding to forward and reverse orientation of nucleotides 1 and with 20 mM HEPES-NaOH buffer pH 7.8 (http://www. to 234 of rbcS2 gene separated by 246 by spacer region crbip-pasteur.fr/fiches/fichemedium.jsp?id=548). Cyanobac comprised from the 3' intron of the rbcS2 gene (REGION: terial cultures are grown at 25°C. where relevant under con 1947.2184), was custom synthesized by DNA2.0 Inc, (Menlo tinuous white light, with constant CO-air bubbling. Park, Calif., USA). The 774 by region (SEQOD NO: 1) was 0063 Growth Rate Estimation Cells are harvested in the then cloned into BamHI restriction site in plasmid pSI-PDS logarithmic growth phase and re-suspended in fresh growth downstream to the pds gene, generating the plasmid pSI-PDS media. Cultures are brought to a cell density corresponding to rbcS RNAi (FIG. 1). ~3 ug/mL chlorophylla. Light intensity is optimized for each 0071. The plasmid was transformed to C. reinhardtii culture and temperature is maintained at growth temperature CW15 strain (CC-400) and transfromants were selected on +1° C. Where required, cells are concentrated by centrifuga SGII medium supplemented with 3x107M fluorochloridone tion (3000 g, 5 min) and re-suspended in fresh media. A (FCD). FCD resistant colonies were transferred to liquid time-series sampling procedure is followed where a Sub media for DNA and protein extraction. Tetraselmis suecica, sample of each culture is collected and the number of cells per Tetraselmis chui and Nannochloris spare transformed with mL is estimated. As well as direct counting, optical density at the above cassette using to the transformation methods different wavelengths, percentage of packed Volume and described above. Total proteins are separated on 4-20% gra chlorophyll concentrations are also measured. dient SDS-PAGE (Geba, Israel) and stained with Coomassie 0064 Photosynthetic Activity: Oxygen evolution Mea blue or transferred to PVDF membranes (Millipore, Billerica, Surements of O. concentrations are performed using a Clark Mass., USA) for western blot analysis using the anti RbcL type O electrode (Pasco Scientific, Roseville, Calif., USA). RUBISCO large subunit, form I and form II antibody (Agris Twenty mL of cell Suspension containing 15ug chlorophyll/ era, Vannas, Sweden). US 2010/0081177 A1 Apr. 1, 2010

0072 Colonies with reduced RUBISCO levels are further with a spectinomycin resistance gene cassette comprising analyzed as described in examples 5 to 7. rbcL promoter, bacterial AAD gene (SEQID NO:7) and rbcL terminator as described in Takahashi, (1991). This construct Example 2 is then transformed to the algae chloroplast DNA using par ticle bombardment as described in the methods part, and Generation of C. reinhardtii Expressing the rbcS2 according to Spectinomycin resistant colonies are then Gene in Antisense Orientation Under the Control of selected and analyzed using PCR on genomic DNA to con the HSP70-rbcS2 Promoter firm the homologous recombination. Positive colonies are 0073 For the generation of plasmids containing the C. then selected for further analysis as described in Examples reinhardtii rbcS2 gene in antisense orientation under the con 5-7. trol of the HSP70-rbcS2 promoter (FIG. 2), the 579 by frag ment of the C. reinhardtii rbcS2 gene was PCR amplified with Example 5 primers BstBI-rbcS2B: GCTTCGAATCAACGAGCGC Demonstration that Transformed Algae and Cyano CTCCATTTAC (SEQ ID NO:2), and XhoI-rbcS2 AS bacteria have Optimal Photosynthesis at Elevated GCCTCGAGATGGCCGCCGTCATTGCCAA (SEQ ID NO:3) containing the BstBI and XhoI sites at their 5' and 3' CO, regions, respectively, and was cloned into pGEM-T vector 0077 Cultures of reduced RUBISCO-content transfor (Promega, Madison, Wis., USA). The BstBI-XhoI fragment mants of algae and cyanobacteria are compared to those of was then introduced into the BstBI/XhoI sites of plasmid their respective wild type. While the latter reveal maximal pSI-PDS rbcS RNAi, replacing the pds-rbcS RNAi cassette photosynthesis rates at concentrations of 0.03-1% CO, trans (Example 1). A psal D-Ble fragment (comprising the Ble formed algal and cyanobacterial cells exhibit maximal pho selectable marker (SEQ ID NO: 4) under the control of the tosynthesis rates at CO concentrations above 4%. The psalD promoter (SEQ ID NO:5), excised from pGenD-Ble) increased CO concentrations compensated for reduced was further ligated into the plasmid usingNotI restriction site. RUBISCO contents. The resulting pSI-rbcS-AS plasmid was then transformed to C. reinhardtii CW 15 (CC-400) and transformants were Example 6 selected on TAP medium supplemented with 5ug/mL Zeocin. Approximately 100 Zeocin resistant colonies were trans Demonstration that Transformed Algal and Cyano ferred to liquid media for protein extraction and rbcS level bacterial Strains Cannot Compete with Wild Type analysis. Cultures at Ambient CO Concentrations 0.074 Tetraselmis suecica, Tetraselmis Chui and Nan 0078. The algal and cyanobacterial transformants nochloris spare transformed with the above cassette using to described above function best under bioreactor and/or pond the transformation methods described above. Colonies with conditions at high CO concentrations. An additional benefit reduced RUBISCO levels are further analyzed as described in arising from this condition is that these strains cannot cope examples 5 to 7. with natural occurring conditions such as ambient CO con centration. Being currently at 0.03% in the atmosphere, CO, Example 3 becomes a major limiting factor for the transformants cul Generation of Cyanobacterial Transformants with tured with ambient carbon dioxide levels. In order to demon Reduced Rubisco Expression Levels strate such growth limitation reduced-RUBISCO-content transformants are co-cultured with wild-type cells at ambient 0075. In order to reduce expression level of rbcL in the CO concentrations. A time-sequence sampling protocol is cyanobacterium Synechococcus PCC7002, the native rbcL followed and cells are collected from the growth vessels. promoter is replaced with a mutated one. The rbcL region Cells are then transferred to plates for colony isolation, then (SEQID NO: 6) is synthesized with random mutations in the replicas are made of each colony. One plate contains normal promoter region (nucleotides 1165-1638 in SEQ ID NO: 6) growth media while its duplicate contained a selection factor and a spectinomycin resistance cassette upstream of the pro (e.g. antibiotics/herbicides). This enables the differentiation moter. Resulting fragments are then cloned into pGEM-T between wild-type cells and transformants, allowing follow (Promega, Madison, Wis., USA) to create a library of plas ing wild-type cells outcompeting reduced RUBISCO content mids containing a myriad of mutated promoters. The result transformants co-cultivated under ambient carbon dioxide. ing library is transformed into Synechococcus PCC7002, and following homologous recombination (that occurs naturally Example 7 in cyanobacteria) clones are screened for transformants with reduced RUBISCO content. Demonstration that Transformed Algal and Cyano bacterial Strains have Increased Levels of Photosyn Example 4 thesis when Sink-Enhancing Genes are Transformed into These Strains Chloroplast Transformation of Red Lineage Algae 0079 Reduced-RUBISCO-content transgenic algae and 0076. To reduce rbcS expression level of red lineage cyanobacteria are further transformed with sink-enhancing marine algae, the sequence of the algae chloroplast DNA is genes. As was previously demonstrated by Miyagawa et al., obtained using 454 sequencing (CD Genomics, Shirley, N.Y., (2001), overexpression of cyanobacteria fructose-1,6-/se USA). Then, a DNA fragment containing the rbcS gene and doheptulose-1.7-bisphosphatase (FBP/SBPase) (SEQ ID its flanking regions is obtained by PCR on DNA isolated from NO:8) in tobacco enhances photosynthesis and growth, is the marine algae. The rbcS coding sequence is then cloned used. The reduced-RUBISCO-contentxFBP/SBPase trans under a mutated rbcL promoter and rbcL terminator together formants are compared with the reduced-RUBISCO-content US 2010/0081177 A1 Apr. 1, 2010

transformants alone under conditions of 14% CO. Oxygen I0088 Grzebyk, D., Schofield O. Falkowski P., and J. evolution is followed as an indication for photoautotrophic Bernhard (2003) The Mesozoic radiation of eukaryotic assimilation, and higher oxygen production rates are algae: the portable plastid hypothesis.JPhycol 39:259-267 observed with the reduced-RUBISCO-contentxFBP/SBPase I0089 Harris, E. (1989). The Chlamydomonas Source transformants. This implies higher Ci assimilation rates, and book: a Comprehensive Guide to Biology and Laboratory therefore Suggests enhanced energy harvesting even at when Use, Academic Press. RUBISCO levels are reduced. 0090 Helman, Y., Tchernov, D., Reinhold, L., Shibata, M., Ogawa, T., Schwarz, R., Ohad, I. and Kaplan, A. (2003) Genes encoding A-type flavoproteins are essential for pho Growth Rate Estimation toreduction of O in cyanobacteria. Curr Biol 13: 230-235 0080 Cultures of Reduced-RUBISCO-Content (RRC) 0091 Huntley M. E. and Redalje, D. G. (2007). CO, miti gation and renewable oil from photosynthetic microbes: A transformants of green algae (Tetraselmis suecica, Tetrasel new appraisal, Mitig. Adapt. Strateg. Glob. Change 12, mischui, Nannochloris sp. and Chlamydomonas reinhardtii) 573-608. are compared to those of their respective wild type. Wild type 0092 Kang RJ, Shi DJ, Cong W, Ma W M, Cai Z L, cells reveala Saturation-curve-like pattern where growth rates Ouyang F. (2005) Effects of co-expression of two higher increase with increasing CO concentrations. At ambient CO plants genes ALD and TPI in Anabaena sp. PCC7120 on concentrations, reduced-RUBISCO-content cells exhibit photosynthetic CO fixation. Enzym Microb Tech 36: 600 reduced growth rates. Their doubling times are reduced (at 604. ambient CO) but increased with increasing CO concentra (0093 Kindle KL (1990) High-frequency nuclear transfor tions. mation of Chlamydomonas reinhardtii. PNAS 87: 1228. (0094) Liu X, and Gorovsky MA (1993) Mapping the 5' Photosynthetic Activity: and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM Oxygen Evolution and PAM Fluorescence RACE). Nucl Acids Res 21: 4954-4960. (0095) Lumbreras V. Stevens D. and, Purton S (1998) Effi I0081. Again, cultures of Reduced-RUBISCO-Content cient foreign gene expression in Chlamydomonas rein transformants of green algae (Tetraselmis suecica, Tetrasel hardtii mediated by an endogenous intron. Plant J 14: mischui, Nannochloris sp and Chlamydomonas reinhardtii) 441-447. are compared to those of their respective wildtype. Wild-type (0096 Ma, V M, Wei, L. Wang, Q, Shi, D and Chen, H. cells reveal a typical P/I saturation curve. In contrast, (2007) Increased activity of the non-regulated enzymes reduced-RUBISCO-content cells exhibit a slight decrease in fructose-1,6-bisphosphate aldolase and triosephosphate optimal light intensity, i.e. Saturation and inhibition occurs at isomerase in Anabaenasp strain PCC 7120 increases pho lower light intensities. When CO levels are raised to 14% or tosynthetic yield, J Appl Phycol 19:207-213. more, P/I curves of reduced-RUBISCO-content cells return (0097 Miyagawa, Y. Tamoi, M. and Shigeoka. S. (2001) to normal parameters. The increase of CO concentrations Overexpression of a cyanobacterial fructose-1,6-/sedohep compensates for the reduced RUBISCO content. tulose-1.7 bisphosphatase in tobacco enhances photosyn thesis and growth. Nature 19:965-969. Lipid and Protein Contents (0098. Murakami M. and Ikenouchi M. (1997) The biologi cal CO fixation and utilization project by RITE (2)— I0082 Finally, we test reduced-RUBISCO-content trans Screening and breeding of microalgae with high capability formants for lipid and protein content, and compare them to in fixing CO. Energy Conyers Mgmt. 38: S493-S497. those of wildtype cells. Lipid and protein content are lower in 0099 Negoro, M. Hamansaki, A., Ikuta, Y Makita, T, the transformants than in wild type cells at ambient CO Hirayama, K. and Suzuki, S. (1993) Carbon dioxide fixa concentrations. However, when CO levels are increased to tion by microalgae photosynthesis using actual flue gas 14% or more, lipid and protein contents exceed those of wild discharged from a boiler, 39: 643-653. type cells. 0100 PrentkiP and Krisch HM (1984) Invitro insertional mutagenesis with a selectable DNA fragment. Gene 29: REFERENCES 303-313 0101 Schroda M. (2006) RNA silencing in Chlamydomo nas: mechanisms and tools. Curr Genet. 49: 69-84 0083 Blake MS, Johnston KH, Russell-Jones G J and 0102 Sizova, I, Fuhrmann, M, and Hegemann, P. (2001)A Gotschlich E.C. (1984) A rapid, sensitive method for detec Streptomyces rimosus aphVIII gene coding for a new type tion of alkaline phosphatase-conjugated anti-antibody on phosphotransferase provides stable antibiotic resistance to Western blots. Anal Biochem 136:175-9. Chlamydomonas reinhardtii. Gene 277: 221-229. I0084 Clerico EM, Ditty J L. Golden SS (2007) Special (0103 Stanier, RY, Kunisawa, R. Mandel, M and Cohen ized techniques for site-directed mutagenesis in cyanobac Bazire, G. (1971) Purification and properties of unicellular teria. Methods Mol Biol 362: 155-171. blue-green algae (order Chroococcales). Bacteriol. Rev. I0085. Deng MD, Coleman J R (1999) Ethanol synthesis 35; 171-205. by genetic engineering in cyanobacteria. Appl Environ 0.104 Y. Takahashi, M. Goldschmidt-Clermont, S.-Y. Microbiol 65:523-528 Soen, L. G. Franzenland J.-D. Rochaix. (1991) Directed chloroplast transformation in Chiamydomonas reinhardtii: I0086 Falkowski, P G and Raven JA (1997) Aquatic Pho insertional inactivation of the psaC gene encoding the iron tosynthesis. Blackwell Science. Malden, Mass. 373, 705 sulfur protein destabilizes photosystem I. EMBO J. 10: 509. 2O33-2040. I0087 Franklin SE and Mayfield SP (2004) Prospects for 0105 Wyman, M. Gregolry, RPF, and Carr, N G. (1985) molecular farming in the green alga Chlamydomonas rein Novel role for phycoerythrin in a marine cyanobacterium, hardtii. Curr Opin Plant Biol. 7:159-165. Synechochoccus strain DC2. Science 230: 818-820. US 2010/0081177 A1 Apr. 1, 2010

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 8

<210s, SEQ ID NO 1 &211s LENGTH: 774 &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (774) <223> OTHER INFORMATION: RNAi cassette for Chlamydomonas reinhardtii RbCS2 gene, encodes for ribulose-1,5-bisphosphate carboxylase/ oxygenase (RUBISCO) Small subunit 2:

<4 OOs, SEQUENCE: 1 ggat.ccticta gag toactica aCatcttaala atggcc.gc.cg t cattgccaa gtcct cogtic 6 O tcc.gcggc.cg tdgc.ccgc.cc ggc.ccgct Co agcgt.gc.gc.c c catggcc.gc gctgaag.ccc 12 O gcc.gtcaagg cc.gc.ccc.cgt ggctgcc.ccg gct caggc.ca accagatgat ggtctggacc 18O ccgg to aaca acaagatgtt cgagacct tc tcc tacctgc c cc ccct gag cgacgagcag 24 O atcgcc.gc.cc aggtogacta cattgtaagt Ctggcgaga.g cc.cgacgggt C Cactgtggc 3OO actgggittag Cttittggcac acgggtccac tgtggcactg gttagcttgg Caccgggaca 360 gcgc ct at Ct c accgcgggg aactgacgca taccc.ctgct cgtgctt cag cacggaaaag caagggggcc aattic catct ttggtggttc tgttgcgctgg tgactgaacc tottctocot cc catttic cc gtgcgc.ccgc agctgtacta aatgtagt cq acct gcgg cgatctgctic 54 O gtc.gct Cagg gagggcaggt aggagalaggt citcgaac atc ttgttgttga ccggggtc.ca gacCatcatC tittggc ct gag.ccggggc agccacgggg gcggccttga cgg.cgggctt 660

Cagcgcggcc atgggg.cgca cgctggagcg gcc acggcc.g cggaga.cgga 72 O ggacttggca atgacggcgg c cattittaag atgttgagtg actictagagg at CC 774

<210s, SEQ ID NO 2 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (29) <223> OTHER INFORMATION: primer BstBI-rbcS2B <4 OOs, SEQUENCE: 2 gctt.cgaatc aacgagcgc.c to catttac 29

<210s, SEQ ID NO 3 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (28) <223> OTHER INFORMATION: primer Xho1-rbs S2 AS <4 OOs, SEQUENCE: 3

US 2010/0081177 A1 Apr. 1, 2010

- Continued titcgacgacg talagaccgt gag cctgcgc ctggagtacc cctacgacgt gcc.ggactac 1860 gcgggctacc Cttacgacgt CCC catt at gcc.ggttcct accc.gtacga tigtgc.ccgac 1920 tacgcc.gc.cc agtaa 1935

1. A method to over produce homologous or heterologous 15. The method of claim 14, wherein the enzyme is compounds in cyanobacteria or algae cells, said method com selected from the group consisting of fructose-1,6-bisphos prising the steps of: phate aldolase, choloplast triosephosphate isomerase and a) Reducing amount of RUBISCO protein in the cells by acetyl CoA carboxylase. 16. The method of claim 9, wherein the proteins are storage genetically transforming the cells; proteins. b) Transforming the cells with a gene of interest under 17. The method of claim 16, wherein the protein is 15Kd control of constitutive or inducible promoter to express Zein or BHL8. production of the compound; and 18. The method of claim 1, wherein the gene of interest is c) Cultivating the transgenic cell line in elevated carbon encoding of production of oils or lipids. dioxide concentrations. 19. The method of claim 18, wherein the gene of interest 2. The method of claim 1, wherein reducing the amount of encodes acetylCo-carboxylase. RUBISCO is achieved by transforming the cells with a trans 20. A method to cultivate algae and cyanobacteria under formation vector comprising rbcS or rbcL encoding poly high CO concentration, wherein the algae and cyanobacteria nucleotides in an antisense or in an RNAi-construct under a are genetically modified to express low amounts of constitutive promoter. RUBISCO protein. 3. The method of claim 2, wherein the transformation 21. A method to prevent establishment of transgenic algal vector also comprises a polynucleotide sequence encoding or cyanobacterial cells in the natural environment by down regulating the amount of RUBISCO protein in the cells by the gene of interest. genetic modification, whereby the cells become incapable to 4. The method of claim 1, wherein the cyanobacteria is grow in ambient carbon dioxide concentrations. selected from the group consisting Synechococcus PCC7002, 22. A transgenic alga or cyanobacterium, transformed with Synechococcus WH-7803, and Thermosynechococcus elon a vector comprising rbcS or rbcL encoding polynucleotides in gatus BP-1. an antisense or an RNAi-construct under a constitutive pro 5. The method of claim 4, wherein the cells are transformed moter, whereby the transgenic alga or cyanobacterium by electroporation, microporation or by particle bombard expresses reduced content of RUBISCO protein. ment. 23. The transgenic alga or cyanobacterium of claim 22, 6. (canceled) wherein the alga or cyanobacterium also transformed to express a gene of interest. 7. (canceled) 24. The transgenic alga or cyanobacterium of claim 23, 8. (canceled) wherein the gene of interest and the antisense or RNAi con 9. The method of claim 1, wherein the gene of interest struct are transformed in tandem. encodes proteins. 25. The method of claim 1, wherein the alga is selected 10. The method of claim 9, wherein the proteins are phar from the group consisting of Chlamydomon reinhardtii, Pav maceutical proteins or industrial proteins. lova lutheri, Isochrysis CS-177, Nanochloropsis CS-179, 11. The method of claim 10, wherein the protein is human Nanochloropsis CS-24 Nanochloropsis salina CS-190, Tet insulin. raselmis suecica, Tetraselmis chui and Nannochloris Sp 26. The method of claim 25, wherein the cells are trans 12. The method of claim 10, wherein the protein is ther formed by electroporation, microporation or by particle bom mostable phytase. bardment. 13. The method of claim 9, wherein the proteins enhance 27. The method of claim 26, wherein the RNAi-construct algal or cyanobacterial growth. comprises SEQID NO: 1. 14. The method of claim 13, wherein the proteins are rate limiting enzymes of photosynthesis. c c c c c