(12) United States Patent (10) Patent No.: US 8,232,088 B2 Chen Et Al

US008232088B2

(12) United States Patent (10) Patent No.: US 8,232,088 B2 Chen et al. (45) Date of Patent: Jul. 31, 2012

(54) GENETICALLY ENGINEERED HERBICIDE (56) References Cited RESISTANCE FOR MANTAINING AXENIC CULTURES U.S. PATENT DOCUMENTS 5,910,626 A 6/1999 Haselkorn 7,285,701 B2 10/2007 Kakefuda (75) Inventors: Ofra Chen, Rehovot (IL); Shai 2007/0074303 A1 3/2007 McCutchen et al...... 800,278 Einbinder, Hofit (IL); Daniella Schatz, 2007/0178451 A1 8/2007 Deng et al. Givataim (IL); Doron Eisenstadt, Haifa (IL); Jonathan Gressel, Rehovot (IL) FOREIGN PATENT DOCUMENTS EP O244234 11, 1987 EP O519229 12/1992 (73) Assignee: Transalgae Ltd, Rehovot (IL) WO WO94/25583 11, 1994 WO WO97/02753 1, 1997 (*) Notice: Subject to any disclaimer, the term of this WO WO97,08325 3, 1997 patent is extended or adjusted under 35 WO WO97/28243 8, 1997 U.S.C. 154(b) by 375 days. OTHER PUBLICATIONS Michel, A. etal. 2004. Somatic mutation-mediated evolution of her (21) Appl. No.: 12/584.559 bicide resistance . . . Molec. Ecology 12:3229-3237. Windhoevel, U. et al. 1994. Expression of Erwinia uredovora Phytoene Desaturase in Synechochoccus . . . Plant Physiol. 104: (22) Filed: Sep. 8, 2009 119-125. (65) Prior Publication Data * cited by examiner US 201O/OO6881.6 A1 Mar. 18, 2010 Primary Examiner — Albert Navarro (74) Attorney, Agent, or Firm — Graeser Associates Related U.S. Application Data International Inc.; Dvorah Graeser (57) ABSTRACT (60) Provisional application No. 61/191,167, filed on Sep. This disclosure provides herbicide resistant algae and cyano 5, 2008. bacteria. This disclosure also provides a method to cultivate algae and cyanobacteria in axenic cultures without contami (51) Int. Cl. nating species. Moreover, this disclosure provides transgenic CI2N L/12 (2006.01) algal and cyanobacterial cells that are capable of high pro CI2N L/20 (2006.01) duction in high light intensities as typically applied in culti (52) U.S. Cl...... 435/252.1; 435/252.3 Vation. Furthermore, a novel transformation method is pro (58) Field of Classification Search ...... None vided for algal cells. See application file for complete search history. 16 Claims, 14 Drawing Sheets U.S. Patent Jul. 31, 2012 Sheet 1 of 14 US 8,232,088 B2

RCS Hsp70 PDS RbcS pro pro ter

fopA fopA fopB fopB pro PDS ter pro Bie ter

35s POS fopA fopB fopB pro ter pro Ble te

Ubiq PDS RbCS pro ter

Tub POS RbCS pro ter

Act POS RS pro ter

FIGURE 1. U.S. Patent Jul. 31, 2012 Sheet 2 of 14 US 8,232,088 B2

U.S. Patent Jul. 31, 2012 Sheet 3 of 14 US 8,232,088 B2

U.S. Patent Jul. 31, 2012 Sheet 4 of 14 US 8,232,088 B2

U.S. Patent Jul. 31, 2012 Sheet 5 of 14 US 8,232,088 B2

U.S. Patent Jul. 31, 2012 Sheet 6 of 14 US 8,232,088 B2

38: **** 88. s:

U.S. Patent Jul. 31, 2012 Sheet 7 of 14 US 8,232,088 B2

U.S. Patent Jul. 31, 2012 Sheet 8 of 14 US 8,232,088 B2

:33:

:x: {3::::::::::::::::::::::::::::: U.S. Patent Jul. 31, 2012 Sheet 9 of 14 US 8,232,088 B2

Synechococcus PCC 7942

E G. o d Vo g d v

c=0= Synechococcus -- Chlamydomonas pds + Synechococcus - - - Synechococcus + FC •oxes - Chalmydomonas pds +Synechococcus + FC

Figure 8B U.S. Patent Jul. 31, 2012 Sheet 10 of 14 US 8,232,088 B2

N E na

e O o 2 O

2OO 400 600 800 1OOO 1200 Time sec

Figure 9 U.S. Patent Jul. 31, 2012 Sheet 11 of 14 US 8,232,088 B2

2Sec Light intensity umole photons m?sec O 500 1000 1500 0 200 400 600 800 1000 1200

8.00E-09 - 8.00E-09 -- aa Wr 4.00E-09 moWT orpds44 pas 4.00E-09 -iewpd538 -900E-24 : -9.00E-24

-400E-09

8.00E-09 - 8,00E-09

4.00E-09 | --WT i mpds5 4,00E-09 auto WT -9.00E-24 appds22 -9.00E-24 -400E-09 |-

-400E-09 --w-wo-no 8.00E-09 i-o-o-o-

4.00E-09 | moWT i mis-pds40 -9.00E-24 -400E-09 |

Fig. 10A U.S. Patent Jul. 31, 2012 Sheet 12 of 14 US 8,232,088 B2

... Light intensity mole-photons m2 sect). Light-intensity, Imole-photons-m?Sect O 200 400 500 800 COO 1200 O 200 400 600 800 000 1200 : 6.00E-09 onwaraisew.....au,ionov wristorievousis starsaw:s 6,OOE-09 normourerrorl.------...------...-a-a-ria arm.

200E-09 wT 2.00E-09 | --WT nappds --pds38 s -2.00E-09 m mom -2.00E-09 e 3 -6.00E-09 -6.OOE-09 s – 6.00E-09 O 6.00E-09 T-arror-rearran.--a-ra-race.--

2.00-09 seasonannammam"r" g| 200E-09 -on-wi 3 weamin WTdid --pds22 o pass i OOE-09 2,00E-9 C :

ss -SOOE-09 -6.OOE-9 ;

s 6.00E-09 f

2.0E-09

-2.00E-09

OE-09

Figure 10B U.S. Patent Jul. 31, 2012 Sheet 13 of 14 US 8,232,088 B2

F CH 3 f\? O F/ O N o––.h A O O Cl O-CH-CH=CH,

Fig. 11A U.S. Patent Jul. 31, 2012 Sheet 14 of 14 US 8,232,088 B2

Om Nannochloropsis oculata

us Nannochloropsis like

-m Tetraselmis chufi

smo e o Tetrasennis Suecica

mOm Pavlova luther

- isochrysis

-- Phaeodactylum tricornutum a Synechococcus Butafenacil concentration (M)

Figure 11B US 8,232,088 B2 1. 2 GENETICALLY ENGINEERED HERBCDE gen IX (protogen IX) to protoporphyrin IX (proto IX). Two RESISTANCE FOR MAINTAINING AXENIC different nuclear genes, PPX1 and PPX2, encode plastid and CULTURES mitochondrial PPO isozymes, respectively. When susceptible plants are treated with PPO inhibitors, the substrate of PPO, PRIORITY protogen IX, accumulates and is exported from the organelles into the cytoplasm where herbicide-insensitive peroxidase This application claims priority of U.S. Provisional Patent like enzymes in the plasma membrane convert it to proto IX. No. 61/191,167 filed on Sep. 5, 2008. Proto IX accumulates in the cytoplasm and, in the presence of light, induces the formation of singlet oxygen that is damag SEQUENCE LISTING 10 ing to cell membranes. Herbicides that act by inhibiting protoporphyrinogen oxi This application contains sequence data provided on a dase are widely used to control weeds in a variety of crops. computer readable diskette and as a paper version. The paper The first weed to evolve resistance to PPO-inhibiting herbi version of the sequence data is identical to the data provided cides was Amaranthus tuberculatus, a problematic weed in on the diskette. 15 the midwestern United States that previously had evolved multiple resistances to herbicides inhibiting two other target FIELD OF THE INVENTION sites (Lermontova et. al., 1997; Watanabe et. al., 2001). Evaluation of a PPO inhibitor-resistant A. tuberculatus bio This invention relates to cultivation of algae and cyanobac type revealed that resistance was an incompletely dominant teria. More specifically this invention relates to methods to trait conferred by a single, nuclear gene. Three genes pre maintain axenic cultures. The invention relates to manage dicted to encode PPO were identified in A. tuberculatus. One ment of algal culture by means of genetic modification gene from the resistant biotype, designated PPX2L, con tained a codon deletion that was shown to conferresistance by BACKGROUND OF THE INVENTION complementation of a hemO mutant strain of Escherichia coli 25 grown in the presence and absence of the PPO inhibitor A major problem in the commercial cultivation of algae lactofen. PPX2L is predicted to encode both plastid- and and cyanobacteria in axenic culture in bioreactors or open or mitochondria-targeted PPO isoforms, allowing a mutation in closed ponds is that they can become contaminated by other, a single gene to conferresistance to two herbicide target sites. highly competitive but unwanted species of algae and cyano Unique aspects of the resistance mechanism include an amino bacteria, fungi and bacteria, as well as by rotifers and other 30 acid deletion, rather than a Substitution, and the dual-target Zooplankton that devour the desired species in the cultures. ing nature of the gene, which may explain why resistance to (Sheehanetal. 2004). Fluridone is the only USEPA-approved PPO inhibitors has been rare (Patzoldt et al., 2006; Gressel systemic herbicide that is commonly used for control of and Levy 2006; Tranel et al., 2007). aquatic weeds (but not algae) in large bodies of water. It is a Even if fluridone/flurochloridone and protox-inhibiting noncompetitive inhibitor of the enzyme phytoene desaturase 35 herbicides are known, their use in algal or cyanobacterial (PDS), which is one of the first dedicated enzymes of the plant culture has not been possible because the cultured photosyn carotenoid biosynthesis pathway. Under high light intensi thetic algae or cyanobacteria would also be killed. Moreover, ties, carotenoids stabilize the photosynthetic apparatus by there is an unsolved problem of contamination of algaculture quenching the excess excitation energy; therefore, inhibition ponds and bioreactors with unwanted species such as rotifers of phytoene desaturase decreases colored carotenoid concen 40 and other Zooplankton, which are not controlled by phytoene tration and causes photo-bleaching of green tissues (Böger desaturase or protox-inhibiting algae. This disclosure pro and Sandmann 1998). vides solution to each of these unsolved contamination prob The pds gene was cloned from the herbicide-susceptible as lems. well as from the recently-evolved, herbicide-resistant bio types of the water weed hydrilla Hydrilla verticillata (Lif) 45 SUMMARY OF THE INVENTION Royle. Three separate and independent single-point muta tions of the codon 304 encoding for Arg (Argo) in pds were To overcome these problems this invention provides algae identified in the resistance biotypes (Michel et. al., 2004: and cyanobacteria that are genetically-engineered with her Michel et al., 2004 Patent application WO/2004/007691). bicide resistance genes and cultured under elevated carbon The codon usage for Argo in the wild-type Hydrilla is CGT 50 dioxide conditions to allow control of specific algae and and single-point mutations yielding either Ser (AGT), Cys cyanobacteria species as well as Zooplankton. Application of (TGT), or His (CAT) substitutions were identified in the Small amounts of these herbicides singly or as a cocktail to the fluridone resistance biotypes of Hydrilla. The resistant bio cultured ponds will prevent the growth of unwanted algae, types had biomass and-B carotene accumulations of up to cyanobacteria, fungi and bacteria and their establishment in 72% and 77% of the content in untreated plants, respectively, 55 the ponds, and cultivation at elevated carbon dioxide levels while in the susceptible population, fluridone strongly inhib will control the rotifers and other Zooplankton ited biomass accumulation and B-carotene accumulation, Accordingly, the present invention relates to transgenic showing only 10% of the levels found in untreated plants algae and cyanobacteria that are capable of being cultivated in (Michel, et al. 2004). Many fungi and bacteria that synthesize ponds where wild type cells and unwanted species can easily carotenoids as a photoprotectant are sensitive to PDS inhibi 60 be controlled. tOrS. The present invention also relates transgenic algae and Protoporphyrinogen oxidase (PPO; protox) is the last com cyanobacteria that are capable of high production in artificial mon enzyme in the tetrapyrrole biosynthetic pathway that conditions, but which have impaired capability to compete in produces heme and chlorophyll (Beale & Weinstein, 1990). natural environments. In plants chlorophyll biosynthesis takes place exclusively in 65 The present invention further relates to herbicide resistance plastids, whereas heme is produced in both plastids and mito genes that are either co-transformed with other genes Such as chondria. In both organelles, PPO converts protoporphyrino genes encoding modified protein and starch synthesis, US 8,232,088 B2 3 4 reduced Rubisco, reduced antenna size or modified lipid bio FIG.9. Oxygen evolution curves of Chlamydomonas rein synthesis or the genes are constructed together on the same hardtii (WT) and pds (pdsI38, pds I44) transformants under plasmid and are transformed to the desired algae and cyano 1000 umol photons m°s'. Dark incubation for approxi bacteria. New genes can be also introduced in the background mately 12 min was applied, followed by ~8 min of illumina of transgenic algae that were transformed with the mentioned tion. Rates of dark oxygen consumption and net oxygen evo genes. lution were calculated and compared. The present invention also relates to a novel transformation FIG. 10 Enhanced photosynthesis of Chlamydomonas method for algae and cyanobacteria. reinhardtii pds transformants (pdsII5: pds I44; pds II22: pds I38; pds I40) versus wild-type (WT). Incubations lasted BRIEF DESCRIPTION OF THE FIGURES 10 approximately 10 minutes. A and B represent two different experiments conducted with the same strains. FIG.1. Schematic illustration of the constructs of the syn FIG. 11 A Chemical structure of butafenacil. B. thetic pds gene (SEQ ID NO: 1) under various promoters in Butafenacil dose response on wild type algae and cyanobac various expression vectors as used in this disclosure. teria. Strains were cultured at ODas -0.1 in 24 well plate and FIG. 2. Chlamydomonas cells were transformed with the 15 butafencil was applied at concentrations of 10'’M. After a synthetic pds (SEQ ID NO: 1) gene harboring the histidine week ODs of the cultures was measured. mutation (right panel) as well as control cells that were not DETAILED DESCRIPTION OF THE INVENTION transformed with DNA (left panel) and plated on SGII medium containing 107M flurochloridone. Growth of trans The present invention provides genetically modified algae formants was visible within two weeks. 100 of the clones and cyanobacteria that are resistant to one or more herbicides, were picked for further studies. whereby the transgenic strains can be cultivated in axenic FIG. 3. Nannochloropsis cells were transformed with the monoculture by controlling unwanted species with herbicide pSI 103-PDS construct (right panel) as well as control cells applications. The present invention further provides a method which were not transformed with DNA (left panel) plated on 25 to limit the establishment of the transgenic strains in natural artificial sea water (ASW)+1 uM flurochloridone. The resis ecosystems through their impaired photosynthetic activity in tant material is also cross resistant to the phytoene desaturase naturally occurring light conditions. inhibitors fluridone, picolinafen, and norflurazon. Moreover, the present invention provides a method to cul FIG. 4. PCR analysis to the Chlamydomonas bulk trans tivate the transgenic algae and/or cyanobacteria in monocul formants with pSI 103-PDS showing the insertion of the pds 30 ture by controlling unwanted species with herbicides and gene into the transformants (denoted by arrow). The numbers prevent growth of Zooplankton by use of high carbon dioxide represent the following: wild type (1), transformed 1 (2), concentrations. transformed 2 (3), positive control (the transformed plasmid) In one embodiment the Hydrilla pds-gene (Michel et al., (4), no template DNA (5), molecular weight markers (6). 2004) was synthesized de novo according to the appropriate More explanations are provided in the examples below. 35 codon usage of the desired algae/cyanobacteria. The de novo FIG. 5. PCR analysis of the Nannochloropsis oculata cells synthesized herbicide resistant pds gene is then cloned for that were transformed with pSI 103-PDS showing the inser algae under the control of rbcS2 and or fcpA/35S/ubiquitin/ tion of the pds gene into the transformants (denoted by tubulin promoters and 3'rbcS2/fcpA/fcpl3 terminators, in the arrow). plasmids pSI 103 and or pPHAT1 (Sizova et. al 2001: Lioud A. By electroporation: The numbers represent the follow 40 mila, et. al 2000) and for cyanobacteria under the constitutive ing: wild type (1), transformed 1 (2), transformed 3 (2), promoter of the rbcLS operon (Deng and Coleman 1999) in positive control (the transformed plasmid) (4), no template the plasmid pCB4 as well as into various expression vectors, DNA (5), and molecular weight marker (6). allowing various levels of expressions driven by different B. By microporation, showing the insertion of the pds gene promoters, including constitutive, inducible and log phase into the transformed cells. Pos—positive control; NTC no 45 temporal promoters. The pds transformants are selected for template control; WT wild type-DNA colonies that were the highest levels of the appropriate herbicide resistances not transformed with DNA and grew on the selection plates: with the least effects on growth in special situations. 1-19—transformed colonies. In another embodiment the Amaranthus tuberculatus ppo FIG. 6: Dose response for the Chlamydomonas pds trans gene (Patzoldt et. al., 2006) was synthesized de novo accord formants colonies. Wild type and pds transformed colonies 50 ing to the appropriate codon usage of the desired algae/cy (pds I35, pds II34, pds II 22, pds I44, pds I38, pds II28, pds anobacteria. The de novo synthesized herbicide resistant ppo II14, pds II5, pds I40) were inoculated at OD, so-0.1 and gene is then cloned for algae under the control of rbcS2 and or flurochloridone was applied at the concentrations of 0.1, 0.3 fepA/35S/ubiquitin/tubulin promoters and 3'rbcS2/fcpA/ and 0.5uM. Cultures were grown for a week before picture fepB terminators, in the plasmids pSI 103 and or pPHAT1 was taken. 55 (Sizova et. al 2001; Lioudmila, et. al 2000) and for cyanobac FIG. 7: Mixed culture of the alga Chlamydomonas rein teria under the constitutive promoter of the rbcLS operon hardtii and the cyanobacterium Synechococcus PCC 7942 as (Deng and Coleman 1999) in the plasmid pCB4 as well as into visualized under the microscope. various expression vectors, allowing various levels of expres FIGS. 8A and B: Contamination test of Chlamydomonas sions driven by different promoters, including constitutive, pds transformant II5 versus the cyanobacterium Synechococ 60 inducible and log phase temporal promoters. cus PCC 7942. Chlamydomonas transformants and the According to yet another embodiment, the pds gene is used cyanobacterium Synechococcus PCC7942 were inoculated as selectable marker with phytoene desaturase inhibiting her alone and in mixed culture in a ratio of 10:1 with and without bicides. flurochloridone. Aliquots were removed daily and counted According to still another embodiment the pds gene is used under the microscope. 8A represents the Chlamydomonas 65 as a selectable marker with phytoene desaturase herbicides pds transformants counts and 8B represents the cyanobacte for co-transformations with other genes needed in the algae rium Synechococcus PCC7942 counts. such as reduced RUBISCO, reduced antennae size, enhanced US 8,232,088 B2 5 6 fluorescence proteins, reduced or enhanced starch or other The invention is now described by non-limiting examples. products, deletion or formation or modified or enhanced lipid One of ordinary skill in the art would realize that various biosynthesis, or any other gene that may be desirable in the modifications can be made without departing from the spirit algae or cyanobacteria. The herbicide resistant gene is either of the invention. The examples below show that the process according to this invention is useful, novel, non obvious and co-transformed with other genes such as genes encoding it greatly simplifies the harvest and processing of microalgae modified protein and starch synthesis, reduced RUBISCO, and cyanobacteria. reduced antenna size or modified lipid or protein biosynthesis In the various embodiments, algae and cyanobacteria were or the genes are constructed together on the same plasmid and chosen from the following organisms: Phaeodactylum tricor are transformed to the desired algae and cyanobacteria. New nutum, Amphiprora hyaline, Amphora spp., Chaetoceros genes can also be introduced in the background of transgenic 10 muelleri, Navicula saprophila, Nitzschia sp., Nitzschia com algae that were transformed with the mentioned genes munis, Scenedesmus dimorphus, Scenedesmus obliquus, Tet According toyetanother embodiment the, ppogene is used raselmis suecica, Chlamydomonas reinhardtii, Chlorella vul as a selectable marker with protoporphyrinogen oxidase garis, Haematococcus pluvialis, Neochloris Oleoabundans, inhibiting herbicides. Synechococcus elongatus PCC6301, Botryococcus braunii, According to a further embodiment the ppo gene is used as 15 Gloeobacter violaceus PCC7421, Synechococcus PCC7002, a selectable marker with protoporphyrinogen oxidase inhib Synechococcus PCC7942, Synechocystis PCC6803, Thermo iting herbicides for co-transformations with other genes synechococcus elongatus BP-1, Nannochloropsis oculata, needed in the algae such as reduced RUBISCO, reduced Nannochloropsis salina, Nannochloropsis spp., Nannochlo antennae size, enhanced fluorescence proteins, reduced or ropsis gaditana, Isochrysis galbana, Aphanocapsa sp., Bot enhanced starch or other products, deletion or formation or ryococcus Sudeticus, Nannochloris spp., Pavlova spp., modified or enhanced lipid biosynthesis, or any other gene Euglena gracilis, Neochloris Oleoabundans, Nitzschia palea, that may be desirable in the algae or cyanobacteria. The Pleurochrysis carterae, Tetraselmis chui, Nannochloris spp. herbicide resistant gene is either co-transformed with other It is however, clear for one skilled in the art that this list is not genes Such as genes encoding modified protein and starch exclusive, but that various other genera and species can be synthesis, reduced RUBISCO, reduced antenna size or modi 25 used as well. fied lipid or protein biosynthesis or the genes are constructed together on the same plasmid and are transformed to the EXAMPLE 1. desired algae and cyanobacteria. New genes can also be intro duced in the background of transgenic algae that were trans Synthesis of Appropriate Flurochloridone and formed with the mentioned genes. 30 Fluridone-Resistant Phytoene Desaturase Genes According to one embodiment of this invention, cultivated algae and cyanobacteria species were rendered resistant to The pds gene was de novo synthesized according to the flurochloridone/fluridone by transformation with a resistant appropriate codon usage of the desired algae and the desired type phytoene desaturase (pds) gene under a constitutive pro cyanobacteria or according to general algae and general moter. Application of the herbicides flurochloridone/fluri 35 cyanobacterial codon usage. The synthetic genes harbor the done to the transgenic cultured algae and cyanobacteria histidine, cysteine or serine amino acid, corresponding to results in establishment of the desired algae and cyanobacte arginine-histidine in Hydrilla. ria without contamination by other algae and cyanobacteria, The phytoene desaturase gene harboring the histidine because they are killed by fluridone/flurochioridone. Under a mutation (SEQID NO: 1) was custom synthesized according preferred embodiment flurochloridone is preferable to fluri 40 to the Chlamydomonas codon usage by the GENEART AG, done, as lower concentrations could be used. Regensburg, Germany (http://www.geneart.com). The gene According to yet another embodiment of this invention, was synthesized with a BstBI restriction site on the 5' and cultivated algae and cyanobacteria species were rendered BamHI on the 3' for direct cloning into pSI 103 algae expres resistant to butafenacil or flumioxazin by transformation with sion vector. The cloning was conducted with algae originat resistant protoporphyrinogen oxidase (ppo) gene under a con 45 ing from a large taxonomical cross section of species (Table stitutive promoter. Application of the herbicidebutafenacil or 1). The algae included: Chlamydomonas reinhardtii, Pavlova flumioxazin to the transgenic cultured algae and cyanobacte lutheri, Isochrysis sp. CS-177, Nannochloropsis oculata ria results in establishment of the desired algae and cyanoac CS-179, Nannochloropsis like CS-246, Nannochloropsis teria without contamination by other algae and cyanobacteria, Salina CS-190, Tetraselmis suecica, Tetraselmis chui and because they are killed by butafenacil or flumioxazin. Nannochloris sp. as representatives of all algae species. TABLE 1. Phylogeny of some of algae used

Genus Family Order Phylum Sub-Kingdom Chlamydomonas Chlamydomonadaceae Volvocales Chlorophyta Viridaeplantae Nannochioris Coccomyxaceae Chlorococcales Chlorophyta Viridaeplantae Tetraseinis Chlorodendraceae Chlorodendrales Chlorophyta Viridaeplantae Phaeodactylum Phaeodactylaceae Naviculales Bacillariophyta Chromobiota Nannochloropsis Monodopsidaceae Eustigmatales Heterokontophyta Chromobiota Paviova Pavlovaceae Pavlovales Haptophyta Chromobiota Isochrysis Isochrysidaceae Isochrysidales Haptophyta Chromobiota

Phylogeny according to: http: www.algaebase.org.browseftaxonomy Note: Many genes that in higher plants and Chlorophyta are encoded in the nucleus are encoded on the chloroplastgenome (plastome) in the Chromobiota, redlineage algae (Grzebyk et al., 2003), US 8,232,088 B2 7 8 The Hydrilla phytoene desaturase gene is customized with rbsC promoters in pSI 103 which was excised by Xbal, BstBI the histidine mutation according to the codon usage of cyano followed by filling in and blunt ligation (FIG. 1: pSI 103-Act bacterium Synechococcus PCC7002 (SEQID NO:2) and the PDS). cloning is conducted with the following cyanobacterial spe cies: Synechococcus PCC7002, Synechococcus WH-7803, EXAMPLE 3 Thermosynechococcus elongatus BP-1. Resistance to phytoene desaturase inhibiting herbicides is Transformation of the Resistant Phytoene Desaturase also conferred by transformation with Hydrilla phytoene into Algae and Cyanobacteria desaturase with the serine mutation according to the codon usage of Chlamydomonas (SEQ ID NO:3), Hydrilla phy 10 Algae and cyanobacteria were transformed with the resis tant form of phytoene desaturase gene by various methods toene desaturase with the serine mutation according to the described below. Importantly, this is the first time micropo codon usage of the cyanobacterium Synechococcus PCC7002 ration transformation method is described and applied to (SEQ ID NO:4), Hydrilla phytoene desaturase with the cys transformation of algal or cyanobacterial cells. teine mutation according to the codon usage of Chlamydomo 15 I. Electroporation nas (SEQID NO:5), and Hydrilla phytoene desaturase with Fresh algal cultures were grown to mid exponential phase the cysteine mutation according to the codon usage of the (2-5*10 cells/ml) in artificial sea water (ASW)+F/2 cyanobacterium Synechococcus PCC7002 (SEQ ID NO:6). media. Cells were then harvested and washed twice with fresh media. After re-suspending the cells in /so of the EXAMPLE 2 original Volume, protoplasts were prepared by adding an equal volume of 4% hemicellulase (Sigma) and 2% Cloning the Resistant Phytoene Desaturase into an Driselase (Sigma) in ASW and were incubated at 37°C. Expression Vector for 4 hours. Protoplast formation was tested as a lack of Calcofluor white (Fluka) staining of cell walls. Proto The de novo synthesized pds gene SEQ ID NO:1 was 25 plasts were washed twice with ASW containing 0.6M cloned under the control of rbcS2 and orfcpA/35S/ubiquitin/ D-mannitol and 0.6M D-sorbitol and re-suspended in tubulin promoters and 3'rbcS2/fcpA/fcpl3 terminators, in the the same media, after which DNA was added (10 ug plasmids pSI 103 and orpFHAT1 (Sizova et al., 2001; Zaslay linear DNA for each 100 ul protoplasts). Protoplasts skaia et al., 2000). For cyanobacteria, the gene (SEQ ID were transferred to cold electroporation cuvettes and NO:2) is cloned under the constitutive promoter of the rbcLS 30 incubated on ice for 7 minutes then pulsed by the ECM operon (Deng and Coleman 1999) in the plasmid pCB4 as 830 electroporator (BTX Instrument Division, Harvard well as into various expression vectors, allowing various lev Apparatus, Inc., Holliston, Mass., USA). A variety of els of expressions driven by different promoters, including pulses were usually applied, ranging from 1000 to 1500 constitutive, inducible and log phase temporal promoters. volts, 10-20 ms each pulse. Each cuvette was pulsed 35 5-10 times. Immediately after pulsing the cuvettes were The synthetic pds gene with the histidine mutation was placedonice for 5 minutes and then the protoplasts were cloned using BamHI, BstBI restriction sites into the pSI 103 added to 250 ul of fresh growth media (without selec expression vector under the control of rbcS2 promoter (FIG. tion). After incubating the protoplasts for 24 hours in 1; pSI 103-PDS). low light, the cells were plated onto selective solid media The synthetic pds gene was also cloned under the ficpA 40 and incubated under normal growth conditions until promoter in pPhaT1 by blunt ligation. The pds was digested single colonies appeared. from pSI103 by BamHI and BstBI, the pPhaT1 was digested II. Microporation by BamHI followed by filling in and blunt ligation (FIG. 1: Fresh algal cultures were grown to mid exponential phase pPhaT-PDS). (2-5*10 cells/ml) in ASW+F/2 media. A 10 ml sample The synthetic pds gene was also cloned under the cauli 45 of each culture was harvested, washed twice with DPBS flower mosaic virus (CaMV)35s and 35S omega promoters in (Dulbecco's phosphate buffered saline, Gibco) and pPhaT1 by BamHI and EcoRI and replaced the ficpA pro resuspended in 250 ul of buffer R (supplied by Digital moter (FIG. 1: pPhaT1-35S-PDS). Bio, NanoEnTek Inc., Seoul, Korea, microporation The synthetic pds gene was also cloned under the ubiquitin apparatus and kit). After adding 8 Jug linear DNA to promoter in the pSI 103 expression vector. The maize ubiq 50 every 100 ulcells, the cells were pulsed. A variety of uitin promoter accession no. AY342393 was excised from the pulses was usually needed, depending on the type of pUB-AG vector by Xbal and replaced the Rbsc-Hsp70 pro cells, ranging from 700 to 1700 volts, 10-40 ms pulse moters in pSI 103 which was excised by Xbal, BstBI, fol length; each sample was pulsed 1-5 times. Immediately lowed by filling in and blunt ligation (FIG. 1: pSI 103-Ubiq after pulsing, the cells were transferred to 200 ul fresh 55 growth media (without selection). After incubating for PDS). 24 hours in low light, the cells were plated onto selective The synthetic pds gene was further cloned under the tubu Solid media and incubated under normal growth condi lin promoter (XM 001693945) in the pSI 103 expression tions until single colonies appeared. vector. The tubulin promoter was excised from the pKS III. Particle Bombardment aph7"-lox vector by SacI, EcoRI and replaced the hsp70 60 Fresh algal culture were grown to mid exponential phase rbsC-promoters in pSI 103 by digestion with NotI, BstBI fol (2-5*10 cells/ml) in ASW+F/2 media. 24 hours prior to lowed by filling in and blunt ligation (FIG. 1: pSI 103-Tub bombardment cells were harvested, washed twice with PDS). fresh ASW+F/2 and resuspended in /10 of the original The synthetic pds gene was also cloned under the actin cell volume in ASW--F/2. 0.5 ml of the cell suspension is promoter in the pSI 103 expression vector. The rice actin 65 spotted onto the center of a 55 mm Petridish containing promoter (accession no. EU 155408) was excised from the solidified ASW--F/2 media. Plates are left to dry under pUB-AG vector by HindIII, SmaI and replaced the hsp70 normal growth conditions. Bombardment was carried US 8,232,088 B2 9 10 out using a PDS 1000/He biolistic transformation sys between false positives and true resistant clones (FIG.3). This tem according to the manufacturers (BioRad Laborato material was used in Example 4. ries Inc., Hercules, Calif., USA) instructions using M10 Isochrysis galbana was transformed by the particle bom tungsten powder (BioRad Laboratories Inc.) for cells bardment technique (M10 tungsten powder, 1100 psi rupture larger than 2 microns in diameter, and tungsten powder 5 discs). After two weeks, algal colonies from both the trans comprised of particles smaller than 0.6 microns (FW06, formation and the mock were replated on ASW+107 M Canada Fujian Jinxin Powder Metallurgy Co., flurochloridone plates. This allowed differentiation between Markham, ON, Canada) for smaller cells. The tungsten false positives and true resistant clone. 10 stable resistant was coated with linear DNA. 1100 or 1350 psi rupture clones were isolated from the experiments by particle bom discs were used. All disposables were purchased from 10 bardment BioRad Laboratories Inc., (Hercules, Calif., USA). After bombardment the plates were incubated under EXAMPLE 4 normal growth conditions for 24 hours after which the cells were plated onto selective Solid media and incu Verification of the Presence of the Synthetic pds bated under normal growth conditions until single colo 15 nies appeared. Gene Transformed Algae and Cyanobacteria IV. Glass Beads Harboring the Resistant Phytoene Desaturase Cells (4x10) in 0.4 ml of growth medium containing 5% PEG6000 were transformed with DNA (1+5 mg) by the The transformants described in Example 3 were replated glass bead vortexing method (Kindle, 1990). The trans on fresh agar medium containing either 107M (Chlamy formation mixture was then transferred to 10 ml of non domonas and Isochrysis) or 10M (Nannochloropsis) of selective growth medium for recovery. The cells were flurochloridone and cells were allowed to generate to visible kept for at least 18 h at 25°C. in the light. Cells were colonies. After incubation for a week the most resistant colo collected by centrifugation and plated at a density of nies were chosen. To ascertain gene transformation PCR 13x10 cells per 80 mm plate. Transformants were 25 analysis was performed on wild type and flurochloridone selected on fresh SGII ((http://www.chlamy.org/ resistant transformants (FIG. 4). SG.html) agar plates containing 3x107M flurochlori Chlamydomonas genomic DNA was extracted according done. to the following protocol: An algal pellet of approximately The above described procedures were carried out on the 5-10 uL in size was resuspended in 50 uL of 10 mMNaEDTA following algae: Chlamydomonas reinhardtii, Pavlova luth 30 by vortexing, followed by incubation at 100° C. for 5 minutes eri, Isochrysis sp. CS-177, Nannochloropsis oculata CS-179, and mixing by vortex. Cells were centrifuged at 12000 g for 1 Nannochloropsis like CS-246, Nannochloropsis salina, Tet minute and resuspended in double distilled water (DDW). raselmis suecica, Tetraselmis chui, and Nannocloropsis sp. Polymerase chain reaction (PCR) analysis was performed as representatives of all algae species Cyanobacterial species on genomic DNA of wild type and flurochloridone resistant Synechococcus PCC7002, Synechococcus WH-7803, Ther 35 mosynechococcus elongatus BP-1 were used as representa Chlamydomonas colonies using the following primers: tives of all cyanobacterial species using a standard protocolas set out in (Golden, et al. 1987). Briefly, cells are harvested by centrifugation and resuspended in fresh growth medium pSI103-1362: AATGCAAGCAGTTCGCATGC (SEQ ID NO: 7) (ASW--F/2 for Synechococcus PCC7002 and Synechococcus 40 PDS rewerse: GGCGATGGTCAGGGTCTG (SEQ ID NO: 8) WH-7803; and BG-11 for Thermosynechococcus elongatus BP-1) at a concentration of 2-5x10 cells/ml. To one ml of this The PCR reaction medium was as follows: Genomic DNA cell solution the appropriate plasmid construct is added to a 21, primer PDS reverse 1 ul, primer pSI103-13621 ul, 12.5ul final concentration of 2-5 ug/ml. Cells were incubated in the PCR mix (RedTaq, Sigma), 8.5ul DDW and the program set dark for 8 hours followed by a 16 hlight incubation prior to 45 at 94° C. for 5', and then 35 cycles of 94° C. for 1', 62° C. for plating on fresh media plates containing flurochloridone or 1', 72° C. for 2.5". The PCR samples were separated on 1% fluridone to select for the colonies that grow at the highest agarose gel and viewed under UV light (FIG. 4). rates without affecting algal growth. Plates are incubated PCR analysis was performed on genomic DNA of wild under growth conditions adjusted to the preferences of each type and flurochloridone resistant Nannochloropsis colonies strain. Flurochloridone or fluridone resistant colonies were 50 (FIG. 5) with the following primers: visible after 7-10 days. This is modified for each organism according to its needs, based on modifications of standard protocols. PDS F short: CGTGGTGGCCGTGAACCTGA (SEO ID NO: 9) Chlamydomonas cells were transformed with the pSI 103 PDS R short: CGCTGTTGCGGAAGCTGGAG (SEO ID NO : 10) PDS construct, harboring the histidine mutation (correspond 55 ing to Hydrilla Arg304), using the glass beads transformation PCR content and program was set as follows: Genomic technique as described above and plated on SGII medium+ DNA 2 ul, primer PDS F short 1 ul, primer PDS R short 1 ul, 107M flurochloridone as is shown in FIG. 2. 12.5ul PCR mix (Sigma), 8.5ul DDW.94°C.5', and then 35 Nannochloropsis oculata CS179 cells were transformed cycles of 94° C. 30", 69° C. 30", 72° C. 30", PCR samples with the PSI 103-PDS construct using the ECM 830 elec 60 were separated on 1% agarose gel and viewed under UV light troporator (BTX Instrument Division, Harvard Apparatus, (FIG.5A) Similarly, the same construct was incorporated into Inc., Holliston, Mass., USA) as described above. After trans Nannocloropsis CS179 by microporation (FIG. 5B). formation algae were plated on ASW--F/2 media (http://ww A dose response experiment was generated for the wild w.marine.csiro.au/microalgae/methods/) containing 107M type Chlamydomonas and for its transformants. The wild flurochloridone. After two weeks, algal colonies both from 65 types and the transformed algae were plated in SGII medium the transformation and the mock were replated on ASW-- in 24 well plates with increasing concentrations of flurochlo 10M flurochloridone plates. This allowed differentiation ridone of 0.1 uM, 0.3 uM, 0.5 LM. Algae were plated without US 8,232,088 B2 11 12 the herbicide as well as a control (FIG. 6). The most resistant follow several abiotic parameters that potentially influence colonies were chosen for further analysis. the physiological state of the cultures. Light intensity tolerance (at a given cell density) is evalu EXAMPLE 5 ated. P/I (photosynthesis vs. irradiance) curves are used 5 to determine optimal light intensity per cell. Prevention of Algae and/or Cyanobacteria Performance at different CO levels (e.g. ambient, 1%; 5%; Contaminants 14%-100%). This is coupled with pH tolerance. Temperature tolerance. Each culture is tested to attain the To address the question of contaminants, the Chlamydomo optimal temperature. In addition, temperatures are nas pds transformants were mixed with the cyanobacterium 10 raised to the highest point possible without inhibiting Synechococcus PCC7942, which is known to overtake ponds. other culture activities. A Chlamydomonas pds transformant and the cyanobacterium Photosynthetic Activity: Oxygen Evolution Synechococcus PCC7942 were inoculated alone and in mixed Measurements of O. concentrations were performed using cultures with and without flurochloridone. An example of a a Clark type O, electrode (Pasco Scientific, Roseville, Calif.). mixed culture is shown in FIG. 7. The mixed culture was 15 Twenty mL of cell Suspension corresponding to 15ug chlo inoculated in a ratio of 10:1 Chlamydomonas pds transfor rophyll/mL were placed in an O. electrode chamber, at rel mants: Synechococcus PCC7942 wildtype, respectively. The evant temperature (22° C.). Cells were exposed to various cells were allowed to grow for one week in liquid medium, light intensities (i.e. 50,300 and 1000 umolphotons mis"). with daily removal of aliquots. Contaminants versus target Dark incubations were performed in air-tight vessels to fol Chlamydomonas-cells were counted under the microscope 20 low dark oxygen consumption. (FIG. 8). While the growth of the resistant pds Chlamydomo We compared a wild type culture of Chlamydomonas rein nas cells was unaffected by the flurochloridone addition hardtii with its pds transformants. Results are shown in FIG. (FIG. 8A), the growth of Synechococcus PCC7942 cells was 9, and indeed reveal that not only was the photosynthesis of completely inhibited, implying that this potential contami the transformants not inhibited but they actually exhibited nant is not able to outcompete the resistant Chlamydomonas 25 improved photosynthetic activity, implying an enhanced bio culture. mass production. The overall outcome from the analyses shown in FIGS. 9 EXAMPLE 6 and 10 implies that the selected transformants are both resis tant to the herbicide and they perform better than wild type in Prevention of Contaminants by the Use of Slow 30 terms of oxygen evolution. Taken together, these transgenic Released Herbicide, Embedded in the cultures are relevant candidates to be grown at large scale Plastic/Polyethylene of the Photobioreactor production systems as well as being used as a platform for future transformations. A hydrophobic herbicide/biocide such as flurochloridone Fluorescence Measurements or fluridone and/or butafenacil flumioxazin is/are applied 35 Electron transfer activity of photosystem II is measured by using a volatile organic solvent such as Xylene on the inner pulse modulated fluorescence (PAM) kinetics using PAM side of the polyethylene algae photobioreactor or pond liner, 101 (Walz, Effertlich, Germany). Light intensity (measured such that if it were fully released into the subsequent growth at the surface of the chamber) of the modulated measuring medium the concentration would reach a final concentration beam (at 1.6 kHz frequency) is 0.1 umol photons ms'. of 10 to 107M. Transgenically resistant algae or cyanobac 40 White actinic light is delivered by a projector lamp at teria versus wild-type are inoculated in the treated photo 50-1500 umolphotons mis' as required in different experi bioreactors after the solvent has evaporated. In commercial ments and is used to assess steady state fluorescence (F). production, the herbicides can be added during production of Maximum fluorescence (F) is measured with Saturating the polyethyelene. white light pulses of 4000 umol photons mis' for 1 s. At a Culture aliquots are removed daily and cell densities of 45 worse case scenario, a normal electron transfer activity is wild types and the transformed algae or cyanobacteria are expected from transformants in order to be considered as compared. While the growth of the resistant pds transformed relevant for up-scaling. An improved activity may imply a algae is unaffected by the addition of flurochloridone or flu culture that will perform better than the wildtype. The advan ridone and/or butafenacil or flumioxazin, the growth of the tage of the method is a quick analysis on a wide array of wild type culture is completely inhibited, implying that the 50 candidate transformants. incorporation of herbicide into the bioreactor lining during plastic manufacture provides advantage to the herbicide resis EXAMPLE 8 tant algae and cyanobacteria. Synthesis of Appropriate Butafenacil and Protox EXAMPLE 7 55 Resistant Protoporphyrinogen Oxidase Gene Greater Photosynthetic Efficiency of pds Transgenic The ppo gene was de novo synthesized according to the Algae in Dense Cultures at High Intensites appropriate codon usage of the desired algae and the desired cyanobacteria or according to general algae and general One of the important parameters indicating the welfare of 60 cyanobacterial codon usage. The ppo gene with the glycine a photoautotrophic culture is its photosynthetic efficiency. We deletion at position 210 according to the Amaranthus tuber used the following methodologies to show the photosynthetic culatus GenBank accession no. DQ386116 (SEQID NO:11) activity: Oxygen evolution—using Clark Type electrodes. was custom synthesized, according to the Chlamydomonas Variable fluorescence—using PAM (Pulse Amplitude Modu codon usage by the by the GENEART synthesis company lated Fluorometry) We also evaluate dark oxygen consump 65 (http://www.geneart.com/). The gene was synthesized with tion, in order to estimate net photosynthetic potential of the the BstBIEcoRI restriction site on the 5' and BamHI on the 3' algal culture. As part of the photosynthetic evaluation we for direct cloning into pSI 103 and pPhaT1 algae expression US 8,232,088 B2 13 14 vectors. Transformation is conducted for the following algae: centrations that have been shown to inhibit the wild-type Chlamydomonas reinhardtii, Pavlova lutheri, Isochrysis algae growth as is shown in FIG. 11. Cells are allowed to CS-177, Nannochloropsis oculata CS-179, Nannochloropsis generate to visible colonies. After incubation for a week the like CS-246, Nannochloropsis salina CS-190, Tetraselmis most resistant colonies are chosen. To ascertain gene trans suecica, Tetraselmis chui and Nannochloris sp. as represen tatives of all algae species (see Table 1). formation PCR analysis is preformed on wild type and Amaranthus tuberculatus protoporphyrinogen oxidase butafenacil or flumioxazin resistant colonies. gene according to the codon usage of the cyanobacterium A dose response curve is generated for the wild type alga Synechococcus PCC7002 (SEQID NO:12) is transformed in and for the transformants. The wild types and the transfor cyanobacteria Synechococcus PCC7002, Synechococcus mant algae are plated in their medium in 24 well plates with WH-7803. Thermosynechococcus elongatus BP-1 as repre 10 increasing concentrations of 0.1 uM, 0.3 uM, 0.5 LM sentatives of all cyanobacterial species. butafenacil or flumioxazin. Algae are plated without the her bicide as a control. Transformants bearing the gene that con EXAMPLE 9 fers resistance show ability to grow at higher concentrations than the wild type. The most resistant colonies are chosen for Cloning the Resistant Protoporphyrinogen Oxidase 15 further analysis. Gene into an Expression Vector EXAMPLE 12 The de novo synthesized ppo gene is cloned under the control of rbcS2 and or fcpA/35S/ubiquitin/tubulin promot Prevention of Algae/Cyanobacteria Contaminants ers and 3'rbcS2/fcpA/fcpb terminators, in the plasmids pSI 103 and or pPHAT1 (Sizova et. al 2001; Zaslayskaia et.al To address the question of contaminants, the transformed 2000). For cyanobacteria it was cloned under the constitutive algae are mixed with cyanobacteria Such as Synechococcus promoter of the rbcLS operon (Deng and Coleman 1999) in PCC7002 and Synechococcus WH7803, which are known to the plasmid pCB4 as well as into various expression vectors, overtake ponds. The transformant and the cyanobacteria are allowing various levels of expressions driven by different 25 cultured alone and in mixed cultures with and without promoters, including constitutive, inducible and log phase butafenacil or flumioxazin. The mixed culture is plated in a temporal promoters. ratio of 10:1 transformant: cyanobacteria respectively. The cells are allowed to grow for one week in liquid culture, with EXAMPLE 10 daily removal of aliquots. These aliquots are counted under 30 the microscope and the ratio of contaminants vs. algae is Transformation of the Resistant Protoporphyrinogen calculated. The mixed cultures (of transformants and con Oxidase Gene into Algae and Cyanobacteria taminants) containing the herbicide show decreasing num bers of contaminants, whereas in the mixed cultures without Constructs are transformed using various techniques as the herbicide the cyanobacteria outcompete the algae. described in Example 3. These procedures are carried out on 35 the following algae: Chlamydomonas reinhardtii, Pavlova EXAMPLE 13 lutheri, Isochrysis CS-177, Nannochloropsis oculata CS-179, Nannochloropsis like CS-246, Nannochloropsis Combination of Two Herbicide Types for Prevention salina, Tetraselmis suecica, Tetraselmis chui, Nannochloris of Algae/Cyanobacteria Contaminants sp. and as representatives of all algae species (Table 1). 40 Constructs are incorporated into the cyanobacteria Syn To address the question of contaminants, stacked pds and echococcus PCC7002, Synechococcus WH-7803, Thermo ppo transformed algae are mixed together with wild type synechococcus elongatus BP-1 as representatives of all Synechococcus 7002 cyanobacteria, which are known to cyanobacterial species, as representatives of all cyanobacte overtake ponds. The cells are allowed to grow together for 1 rial species using a standard protocol as set out in (Golden, et 45 day to 1 week in liquid culture, with daily removal of aliquots al. 1987). Briefly, cells are harvested by centrifugation and that are plated either to new liquid culture or on Petri dishes re-suspended in BG-11 medium at a concentration of 2-5x10 with and without the combination of flurochloridone or flu cells per ml. To one ml of this cell solution the appropriate ridone and butafenacil or flumioxazin. Contaminant cyano plasmid construct is added to a final concentration of bacteria vs. target algae are counted. Conditions are opti 2-5 ug/ml. Cells were incubated in the dark for 8 hours fol 50 mized for the competing organism, in order to Verify that the lowed by a 16 hlight incubation prior to plating on BG-11 transformed algae overcome outcompete the contamination plates containing butafenacil or flumioxazin to select for the under these conditions. colonies that grow at the highest rates without affecting algal growth. Plates are incubated under the standard growth con EXAMPLE 1.4 ditions (30°C., light intensity of 100 umolphotons mis"). 55 Butafenacil or flumioxazin resistant colonies were visible in Prevention of Zooplankton Grazing by High CO, 7-10 days. This is modified for each organism according to its Concentrations and Herbicide Application needs, based on modifications of standard protocols. To quantify CO effects on plankton Survivorship we incu EXAMPLE 11 60 bate 81 L vessels of the algae Pavlova lutheri, Isochrysis CS-177, Nannochloropsis oculata CS-179, Nannochloropsis Verification of the Presence of the Synthetic ppo like CS-246, Nannochloropsis salina CS-190, Tetraselmis Gene Transformed Algae and Cyanobacteria suecica, Tetraselmis chui and Nannochloris sp or cyanobac Harboring the Resistant Protoporphyrinogen Oxidase teria Synechococcus PCC7002, Synechococcus WH-7803, 65 Thermosynechococcus elongatus BP-1 with or without Zoop The transformants are replated on fresh agar medium con lankton (e.g. Arthenia sp.). The control and Zooplankton taining 10M or 107M ofbutafenacil or flumioxazin, con treated containers are bubbled with air, 1%. 5% and 14% CO US 8,232,088 B2 15 16 together with specific herbicides that are applied at the appro Grzebyk, D., O. Schofield, P. Falkowski, and J. Bernhard priate concentrations. Algal cell density and Zooplankton (2003) The Mesozoic radiation of eukaryotic algae: the counts are done on each treatment over a 10 day period. portable plastid hypothesis. J. Phycol. 39:259-267) Throughout the experiment pH is maintained at 7.0-8.0, which allows phytoplankton growth. Kindle, K. L., (1990). “High-frequency nuclear transforma There is a near 100% reduction of live Zooplankton in the tion of Chlamydomonas reinhardtii.' Proc. Natl. Acad. Sci. >5% CO and the herbicide treatments. Zooplankton are USA 87: 1228-1232. killed by the microtubule-inhibiting herbicides that do not Kurihara, H., A. Ishimatsu, et al. (2004). “Effects of elevated harm the wild type algae and the cyanobacteria Such as ben seawater CO concentration on the meiofauna.” Journal of efin, butralin, dinitramine, ethalfluralin, oryzalin, pen Marine Science and Technology: 17-22. dimethalin, trifluralin, amiprophos-methyl, butamiphos, 10 Lermontova, I., Kruse, E., Mock, H. P. & Grimm, B. (1997). dithiopyr, thiazopyr, propyZamide, tebutam and chlorthal “Cloning and characterization of a plastidal and a mito dimethyl. Algal density is significantly higher at 5 and 14% chondrial isoform of tobacco protoporphyrinogen IX oxi compared to ambient and 1% CO concentrations. While dase.” Proc. Natl. Acad. Sci. USA 94,8895-8900. Zooplankton reduced algal growth at low concentrations, in Lioudmila, A., Zaslayskaia, et al. (2000). “Transformation of high CO there are no differences between batches with and 15 the diatom phaeodactylum tricornutum (Bacillari without Zooplankton, indicating the inhibition of Zooplank ophyceae) with a variety of selectable marker and reporter ton activity. Zooplankton numbers remain low for 7 days after genes' J. Phycol. 36,379–386. termination of CO treatments, implying a significant, long Michel, A., R. S. Arias, et al. (2004). “Somatic mutation term impact. mediated evolution of herbicide resistance in the nonindig enous invasive plant hydrilla (Hydrilla verticillata).” REFERENCES Molecular Ecology 13(10): 3229-3237. Michel, A., Scheffler, B, E., et. al (2004). “Herbicide-resistant Adams, E. E. J. A. Caulfield, et al. (1998). “Impacts of plants, and polynucleotides and methods for providing reduced pH from ocean CO disposal: Sensitivity of Zoop same.” patent Application WO/2004/007691. lankton mortality to model parameters.” Waste Manage 25 Patzoldt, W. L., Hager, A.G., et. al (2006). A codon deletion ment 17(5-6): 375-380. confers resistance to herbicides inhibiting protoporphy Beale, S.I., Weinstein, J. D. (1990). “Biosynthesis of Heme rinogen oxidase.” PNAS 33: 12329-12334. and Chlorophylls.’ “in Tetrapyrrole Metabolism in Photo Sheehan, J., T. Dunahay, et al. (2004). A Look Back at the US synthetic Organisms, ed. Dailey, H. A. (McGraw-Hill, Department of Energy’s Aquatic Species Program: Biodie New York), 287-391. 30 sel from Algae: Close-Out Report, Island Press. Böger, P. and G. Sandmann (1998). “Carotenoid biosynthesis Sizova, I., Fuhrmann, M., et al. (2001). A Streptomyces rimo inhibitor herbicides—mode of action and resistance sus aphVIII gene coding for a new type phosphotransferase mechanisms.” Pesticide Outlook 9(6): 29-35. provides stable antibiotic resistance to Chlamydomonas Deng, M.D. and J. R. Coleman (1999). “Ethanol synthesis by reinhardtii. Gene 277: 221-229. genetic engineering in cyanobacteria. Appl Environ 35 Tranel, P. Hager, A., and Patzold, W. (2007) Herbicide Resis Microbiol 65(2): 523-8. tance Gene, Compositions and Methods. US patent Appli Golden, S. S., J. Brusslan, et al. (1987). "Genetic engineering cation, US 2007/0050863 A1 of the cyanobacterial chromosome.” Methods Enzymol Watanabe, N., Che, F. S., Iwano, M., Takayama, S. &Yoshida, 153: 215-31. S. (2001). “Construction of an Amaranthus hypochondria Gressel, J. and A. A. Levy (2006) Agriculture—the selector of 40 cus Bacterial Artificial Chromosome Library and Genomic improbable mutations. Proceedings of the National Acad Sequencing of Herbicide Target Genes' J. Biol. Chem. emy of Sciences USA 103: 12215-12216 276, 20474-20481.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 12

<21 Os SEQ ID NO 1 &211s LENGTH: 1743 &212s. TYPE: DNA <213> ORGANISM: Hydrilla sp 22 Os. FEATURE: <221s NAMEAKEY: misc feature <222s. LOCATION: (1) . . (1743) <223> OTHER INFORMATION: Hydrilla phytoene desaturase with the histidine mutation according to the codon usage of Chlamydomonas

<4 OOs SEQUENCE: 1 atgaccgtgg ccc.gcagcgt ggtggcc.gtg aacctgagcg gCagcctgca galaccgctac 60

ccc.gc.ca.gca gcagcgtgtc. citgct tcct g ggcaaggagt accgctgcaa ct ctatgctg 12O

ggcttctgcg gCagcggcaa gCtggcCttic gg.cgc.caacg cc ccct actic caagat.cgc.c 18O

gccaccalagc ccaa.gc.cgaa gCtgcgc.ccc ctgaaggtga actgcatgga ct tcc.cgc.gc 24 O

ccgga catcg acaac accqc caact tcct g gaggcc.gc.cg ccct gtc.ctic cagott cogc 3 OO

US 8,232,088 B2 27 28 - Continued cacgtggtga aaa.cccc.ccg Ctctgttgt at aaaaccgtgc ccgattgttga accctgtc.gc 1560 cc cct c caac gct citcc.cat tdaaggcttt tat ct cqc.cg gcgattatac Caaacaaaaa. 162O tat citcgc.ct C tatggaagg cqc.cgtgctic tictggcaaac totgtgcc.ca agc cattgtg 168O caagattgtt ct citcc ticgc ct citcgcgtg caaaaatcto cccaaac cct cac cattgcc 1740

<210s, SEQ ID NO 7 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: pSI103-13 62 primer

<4 OO > SEQUENCE: 7 aatgcaa.gca gttcgcatgc

<210s, SEQ ID NO 8 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (18 <223> OTHER INFORMATION: PDS reverse primer <4 OOs, SEQUENCE: 8 ggcgatggtc agggtctg 18

<210s, SEQ ID NO 9 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: PDS F short primer <4 OOs, SEQUENCE: 9 cgtggtggcc gtgaac Ctga

<210s, SEQ ID NO 10 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM; artificial 22 Os. FEATURE: <223> OTHER INFORMATION: chemically synthetized 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: PDS R short primer <4 OOs, SEQUENCE: 10 cgctgttgcg gaagctggag

<210s, SEQ ID NO 11 &211s LENGTH: 16O2 &212s. TYPE: DNA <213s ORGANISM: Amarathus tuberculatus 22 Os. FEATURE: <221 > NAMEAKEY: misc feature

US 8,232,088 B2 31 32 - Continued aaactcaaaa gtcatggcct cagtgttgacc Ctctittgaag ccgatagtc. c9ccggcggc 24 O aaactcaaaa ccgtgaaaaa agatggctitt atttgggatg aaggcgc.cala taccatgacc 3OO gaaagtgaag cc.gaagtgag tagt ct catt gatgatctgg gcctic cqcga aaaacaacaa 360 citcc cc atta gtcaaaataa acgctatatt gcc.cgcgatg gcc tocc cqt gct cotc.ccc 42O agtaatc.ccg cc.gc.cctic ct caccagtaat attct cagtg ccaaaagtaa act coaaatt 48O atgct cqaac cctittctic td gcdcaaac at aatgccaccq aacticagtga tigaacatgtg 54 O Caagaaagtg tdggcgaatt ttittgaacgc cattttggca aagaatttgt ggattatgtg 6OO attgat coct ttgttggc.cgg cacctgtggc gatcc ccaaa gtc.tcagtat gcatcat acc 660 titt.ccc.gaag ttggaat at taaaaacgc tittggcagtg tdtttgc.cgg cct cattcaa 72 O agtaccct co tdagtaaaaa agaaaaaggc ggcgaaaatg C cagt attaa aaaac ccc.gc 78O gtgcgcggca gttittagttt toaaggcggc atgcaaacco togtggatac catgtgtaaa 84 O caactic gg.cg aagatgaact caaacticcaa tdtgaagtgc ticagt ct cag titataat caa 9 OO aaaggcatt C C Cagtict cq9 caattggagt gtgagtagta tagtaataa taccagtgaa 96.O gatcaaagtt atgatgcc.gt ggtggtgacc gcc cc catt C gcaatgtgaa agaaatgaaa O2O attatgaaat ttggcaatcc ctittagt ct c gattittatto ccdaagtgac citatctg.ccc O8O cticagtgtga tigattaccgc ctittaaaaaa gataaagtga aacgcc.ccct cqaaggctitt 14 O gg.cgtgct cattcc.cagtaa agaacaac at aatggcct ca aaaccct cqg caccct ctitt 2OO agtag tatga tigttitcc.cga t cqcgcc.ccc agtgatatgt gtc.tc.tttac cacctttgttg 26 O ggcggcagtic gcaatcgcaa act cqccalat gcc agtaccg atgaact caa acaaattgttg 32O agtag tdatc. tccaacaact c ct cqgcacc gaagatgaac ccagttttgt gaatcatct c 38O ttittggagta atgcctitt co cotctatgc cataattatg attgttgtgct c cqcgc.catt 44 O gataaaatgg aaaaagat ct ccc.cggcttt ttt tatgc.cg gcaat cataa aggcggcct C SOO agtgtgggca aagc.catggc cagtggctgt aaa.gc.cgc.cg aacticgtgat tagttatctic 560 gatagt cata tittatgtgaa aatggatgala aaaaccgc.c 5.99

What is claimed is: 5. The method of claim 4, wherein the nucleotide sequence 1. A method to maintain a cyanobacterial or algal monoc 45 is operably linked to a promoter selected from a group con ulture free from unwanted species, said method comprising sisting of RbcS, fcpA, 35S, ubiquitin, tubulin and actin pro the steps of: a) Transforming a cyanobacterium or an alga moters. with a nucleotide sequence to express resistance against one 6. The method of claim 1, wherein the cyanobacterium is or more herbicides; b) Cultivating said cyanobacterium or transformed with the nucleotide sequence selected from the alga expressing resistance against one or more herbicides; 50 group consisting of SEQID NO:2, SEQID NO.4 and SEQID and c) adding one or more herbicides into the cultivation NO:6. medium; wherein said alga or said cyanobacterium is trans 7. The method of claim 6, wherein the nucleotide sequence formed with a nucleotide sequence encoding for a protein is operably linked to a promoter selected from a group con conferring resistance to said one or more herbicides, wherein sisting of RbcS, fcpA, 35S, ubiquitin, tubulin and actin pro said protein has a sequence encoded according to the nucle 55 moters. otide sequence selected from the group consisting of SEQID 8. The method of claim 1, wherein the herbicide is NOs 1-6, 11 and 12. butafenacil or flumioxazin. 2. The method of claim 1, wherein the herbicide is hydro 9. The method of claim 1, wherein the alga is transformed phobic and is applied using a volatile organic Solvent on an with the nucleotide sequence SEQID NO:11. inner side of a polyethylene algae photobioreactor or pond 60 10. The method of claim 1, wherein the sequence is oper ably linked to a promoter selected from a group consisting of liner. RbcS, fcpA, 35S, ubiquitin, tubulin and actin promoters. 3. The method of claim 1, wherein the herbicide is selected 11. The method of claim 1, wherein the cyanobacterium is from the group consisting of fluorochloridone and fluridone. transformed with the nucleotide sequence SEQID NO:12. 4. The method of claim 1, wherein the alga is transformed 65 12. The method of claim 11, wherein the sequence is oper with the nucleotide sequence selected from the group con ably linked to a promoter selected from a group consisting of sisting of SEQID NO: 1, SEQID NO:3 and SEQID NO:5. RbcS, fcpA, 35S, ubiquitin, tubulin and actin promoters. US 8,232,088 B2 33 34 13. The method of claim 1, further comprising providing a Pavlova lutheri, Isochrysis CS-177, Nanochloropsis CS-179, CO, concentration of the cultivation media of between 5% Nanochloropsis CS-246, Nanochloropsis salina CS-190, Tet and 100%. raselmis suecica, Tetraselmis chui and Nannochloris sp. 14. The method of claim 1, wherein the cyanobacterium is selected from the group consisting of Synechococcus 16. The method of claim 1, wherein the transformation is PCC7002, Synechococcus WH-7803, and Thermosynechoc performed through microporation. occus elongatus BP-1. 15. The method of claim 1, wherein the alga is selected from the group consisting of Chlamydomonas reinhardtii,