Activation of Parkin
Ching (Jean) Luo
Department of Biochemistry
McGill University, Montréal
April 2019
A thesis submitted to McGill University in partial fulfillment of the requirements of the degree
of Master of Science.
© Jean Luo 2019 Table of Contents
Table of Contents
Abstract ...... 4
Résumé ...... 5
Acknowledgements ...... 7
List of Abbreviations ...... 8
List of Figures ...... 10
List of Tables ...... 11
1. Introduction ...... 12
1.1 Parkinson’s Disease ...... 12
1.2 Genetics of Parkinson’s Disease ...... 14
1.3 Ubiquitin-Proteasome Pathway ...... 15
1.4 Parkin ...... 18
1.5 Activation of parkin by PINK1 ...... 21
1.6 Activating Element ...... 23
1.7 Links between parkin/PINK1 mutations and Parkinson’s disease ...... 27
1.8 Parkin substrates and PICK1 ...... 28
1.9 Research objectives ...... 31
2. Materials and Methods ...... 33
2.1 Parkin construct ...... 33
2 2.2 Mutant constructs of parkin ...... 33
2.3 Transformation of parkin constructs into Escherichia coli BL21 strain...... 35
2.4 Expression and purification of parkin ...... 35
2.5 Expression and purification of GST ...... 36
2.6 Expression and purification of GST-PICK1 ...... 36
2.7 SDS-PAGE ...... 37
2.8 Phosphorylation of human parkin by PINK1 ...... 37
2.9 Autoubiquitination assay ...... 38
2.10 In vitro binding assay ...... 38
3. Results ...... 39
3.1 The ACT element is conserved in invertebrates ...... 39
3.2 Purification of ACT mutants of parkin ...... 39
3.3 Autoubiquitination assay ...... 41
3.4 In vitro binding assay for PICK1 and parkin ...... 49
4. Discussion/Conclusion ...... 56
References ...... 60
3 Abstract
Parkinson’s disease is the second most common neurodegenerative disease, and 10% of the cases can be genetically inherited. Mutations in PARK2 gene, which encodes for parkin, are responsible for most cases of autosomal-recessive juvenile parkinsonism (AR-JP). Parkin is an
E3 ubiquitin ligase, which promotes the ubiquitination of specific substrate proteins, and it is activated by PINK1 in order to participate in mitophagy. Parkin is basally autoinhibited, where its E2 binding site and catalytic cysteine are occluded; however, when parkin is bound to phosphorylated ubiquitin (pUb), the released Ubl domain becomes phosphorylated and binds to
RING0 domain, releasing the catalytic cysteine on RING2. Recently, an activating element
(ACT) has been suggested to participate in the activation of parkin by competing with RING2 for its binding site on RING0, promoting the release of RING2. The first topic of this thesis investigates the effect of each conserved ACT residue on parkin activation through auto- ubiquitination assays. The autoubiquitination assays suggest that the ACT element may enhance the activity of parkin, but it is not essential for its activity. The second topic examines the interaction between parkin and protein-interacting with C-kinase I (PICK1). PICK1 is a substrate of parkin, but unlike most polyubiquitinated substrates, PICK1 becomes monoubiquitinated by parkin, and monoubiquitinated PICK1 inhibits parkin. Its unique inhibitory effect on parkin makes it a potential target as the reduction of PICK1 may enhance parkin’s protective function.
PICK1 was previously reported to bind to the C-terminus of parkin through its PDZ domain, but it was recently reported to bind to RING1 through its BAR domain. The latest findings in the domain rearrangement of parkin at different stages of activation suggested that phosphorylated parkin may result in stronger binding between PICK1 and parkin. However, the GST-pull down assays showed no binding between phosphorylated parkin and PICK1, suggesting that phosphorylated parkin does not enhance the interaction between parkin and PICK1.
4 Résumé
La maladie de Parkinson est la deuxième maladie neurodégénérative la plus courante dont 10 % des cas peuvent être héréditaires. Les mutations du gène PARK2, qui code pour l’enzyme parkine, sont responsables de la plupart des cas de parkinsonisme juvénile récessif autosomique (AR-JP).
La parkine est une ubiquitine ligase E3, qui favorise l'ubiquitination de protéines de substrat spécifiques, et elle est activée par PINK1 afin de participer à la mitophagie. La parkine est autoinhibée basalement, où son site de liaison E2 et la cystéine catalytique sont occlus; cependant, lorsque la parkine est liée à l'ubiquitine phosphorylée (pUb), le domaine Ubl libéré devient phosphorylé et se lie au domaine RING0, libérant la cystéine catalytique sur RING2. Récemment, l'élément activateur (ACT) a été identifié comme participant à l'activation de la parkine en rivalisant avec RING2 pour son site de fixation sur RING0, ce qui favorise la libération de RING2.
Le premier sujet de cette thèse porte sur l'effet de chaque résidu d'ACT conservé sur l'activation des parkines par des tests d'auto-ubiquitination. Les essais d'autoubiquitination suggèrent que l'élément ACT peut améliorer l'activité du parkin, mais qu'il n'est pas essentiel pour son activité.
Le deuxième sujet présenté dans cette thèse examine l'interaction entre la parkine et l'interaction des protéines avec la C-kinase I (PICK1). Le PICK1 est un substrat de parkine, mais contrairement
à la plupart des substrats qui sont polyubiquitinés, le PICK1 devient monoubiquitiné par parkine et le PICK1 monoubiquitiné inhibe la parkine. Son effet inhibiteur unique sur la parkine est en fait une cible potentielle car la réduction du PICK1 peut renforcer la fonction protectrice de la parkine.
Le PICK1 se fixait auparavant au terminal C du parkin par l'intermédiaire de son domaine PDZ, mais on a récemment signalé qu'il se fixait à RING1 par l'intermédiaire de son domaine BAR.
Cette recherche utilise des essais in vitro pour étudier la liaison entre le parkin et le PICK1 afin d'étudier plus en profondeur les sites de liaison exacts. Cependant, aucune liaison n'a été observée
5 entre parkin et PICK1, ce qui suggère que différentes approches devraient être adoptées pour
étudier leurs interactions.
6 Acknowledgements
I would like to express my deep gratitude to Dr. Kalle Gehring, my principal investigator, for accepting me into this laboratory and for his patient guidance and constructive critiques of this research work.
I would also like to thank Dr. Guennadi Kozlov for his continuous encouragement, mentoring and numerous intellectually stimulating discussions about experimental designs. I am genuinely grateful to Dr. Kathy Wong for the guidance she provided me with in the laboratory and her invaluable help with the essential molecular biology techniques that are transferrable to other fields of scientific research.
My grateful thanks are also extended to George Sung for easing my transition into the parkin project and teaching me invaluable skills that were further used in this project. I would also like to extend my thanks to Dr. Véronique Sauvé for brainstorming with me about the project.
I would like to thank my research advisory committee member, Dr. Albert Berghuis and
Dr. Thomas Durcan for the constructive advice they offered during my research.
I am extremely grateful to my fellow lab members, especially Zhidian Zhang, Cordelia
Cho, Kristy Mualim, Rayan Fakih, Seby Chen, Meng Yang, and Valeria Shkuratova for making the lab a pleasant work environment.
Finally, I wish to thank my family for their continuous support and encouragement throughout my graduate studies.
7 List of Abbreviations
ACT – Activating element of parkin ATP – Adenosine triphosphate BAR – Bin/Amphiphysin/Rvs domain
BRcat – Benign-catalytic domain (also known as IBR domain) DTT – Dithiothreitol E1 – Ubiquitin-activating enzyme E2 – Ubiquitin-conjugating enzyme E3 – Ubiquitin ligase GST – Glutathione S-transferase HDX-MS – Hydrogen-deuterium exchange mass spectrometry HECT – Homologous to the E6-AP carboxyl terminus HEPES - 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid IBR – In-Between-RING domain LB – Luria Broth PD – Parkinson’s Disease PDB – Protein data bank PDZ – PSD-95/Discs-large/Zona Occludens-1 domain PICK1 – Protein-interacting with C-kinase I PINK1 – PTEN-induced putative kinase 1 pParkin – Phosphorylated parkin pUb – phosphorylated ubiquitin
Rcat – Required-for-catalysis domain REP – Repressor element of parkin RBR – RING-between-RING RING – Really interesting new gene SDS-PAGE – Sodium dodecyl sulphate polyacrylamide gel electrophoresis TCEP – Tris(2-carboxyethyl)phosphine Tris – Tris(hydroxymethyl)aminomethane Ubl – Ubiquitin-like domain Ub-VS – Ubiquitin vinyl sulfone UPD – Unique parkin domain (also known as RING0 domain)
8 UPS – Ubiquitin proteasome system WT – Wild-type
9 List of Figures
Figure 1: Global prevalence of Parkinson's disease by age and sex, 2016...... 13
Figure 2: Comparison of RING, HECT, and RBR-type E3 ligases in UPS...... 18
Figure 3: Domain architecture of parkin...... 19
Figure 4: Structure of Autoinhibited Parkin (PDB: 4K95)...... 20
Figure 5: Domain rearrangement for parkin activation...... 23
Figure 6: Structure of phosphorylated parkin...... 24
Figure 7: Sequence alignment for Ubl-RING0 linker...... 25
Figure 8: Ub-VS charging assay for ACT mutants...... 26
Figure 9: Model of sequential domain rearrangement, including ACT element, for parkin activation...... 27
Figure 10: Domain architecture of PICK1...... 29
Figure 11: PDZ-binding motif is buried in the parkin core...... 30
Figure 12: Sequence alignment around the Ubl-RING0 linker region of parkin...... 39
Figure 13: Size-exclusion chromatogram of R104A...... 40
Figure 14: SDS-PAGE for Parkin R104A...... 41
Figure 15: Parkin phosphorylation by PINK1...... 42
Figure 16: Autoubiquitination assay of phosphorylated ACT mutants...... 43
Figure 17: Parkin phosphorylation by PINK1 for modified autoubiquitination assay...... 44
Figure 18: Modified Autoubiquitination Assay...... 44
Figure 19: Time point determination for optimizing autoubiquitination assay...... 45
Figure 20: Parkin phosphorylation by PINK1 after time-point determination...... 46
Figure 21: Autoubiquitination assay with additional time points...... 46
Figure 22: Quantification of non-ubiquitinated pParkin vs. reaction time...... 47
10 Figure 23: Quantification of non-ubiquitinated pParkin after five minutes of autoubiquitination activity...... 48
Figure 24: Size-exclusion chromatogram for GST-PICK1...... 49
Figure 25: SDS-PAGE for GST-PICK1 Purification...... 50
Figure 26: GST-Pulldown assay for parkin and GST-PICK1 interaction...... 51
Figure 27: GST-Pulldown assay after protocol modifications...... 51
Figure 28: Parkin phosphorylation by PINK1, in preparation for GST-pulldown assay...... 52
Figure 29: Modified GST-pulldown assay (with phosphorylated parkin and His-CNNM.) ...... 53
Figure 30: GST-Pulldown assay...... 54
List of Tables
Table 1: Primers for mutagenesis ...... 34
11 1. Introduction
1.1 Parkinson’s Disease
Parkinson’s Disease (PD) was first described as an “involuntary tremulous
motion, with lessened muscular power, in parts not in action and even when supported;
with a propensity to bend the trunk forwards, and to pass from a walking to a running
pace: the senses and intellects being uninjured,” in An essay on the shaking palsy
published by James Parkinson in 1817 (Parkinson, 2002). The disease was thus named
after Parkinson by Jean-Martin Charcot, the father of neurology (Charcot, 1875). In 1912,
Frederic Heinrich Lewy described that neuronal inclusion bodies, which were later called
Lewy bodies, were a major characteristic of PD and mainly consisted of α-synuclein, a
presynaptic nerve terminal protein often mutated in PD patients (Lewy, 1912;
Polymeropoulos et al., 1997; Spillantini et al., 1997). In 1919, Constantin Tretiakoff
described the presence of Lewy bodies in the substantia nigra pars compacta in PD
patients (Tretiakoff, 1919). A major role of substantia nigra pars compacta is to supply
the striatum with dopamine, maintaining the high level of dopamine in the striatum;
however, the dopamine levels in the striatum of PD patients were found to be
significantly lower (Fahn, 2015; Singer et al., 2010) These discoveries led to the
development of D,L-dopa and L-dopa as treatments for PD, and more broadly,
consolidated our current knowledge of the neuropathology of PD, highlighting the death
of dopaminergic neurons in the substantia nigra pars compacta and the formation of
Lewy bodies in the central and peripheral nervous system as the hallmark of PD (Lees et
al., 2015; Seidel et al., 2015).
The major signs and symptoms of PD were resting tremor, bradykinesia, postural
instability, rigid muscles, and impaired posture and balance (Jankovic, 2008;
12 Polymeropoulos et al., 1997). Yet, judgements solely based on these symptoms may lead to false diagnosis as most of these symptoms could be associated with other diseases that mimic PD (Ali et al., 2015). Hence, the only way thus far to provide an accurate diagnosis of PD is through directly observing the degeneration of the substantia nigra pars compacta and the accumulation of Lewy bodies; however, this method can only be performed post mortem (Ali et al., 2015).
Parkinson’s disease is the second most common neurodegenerative disorder of aging and the most common movement disorder (Mhyre et al., 2012). In 2016, PD affected 6.1 million of the global population and caused approximately 200,000 deaths worldwide (Dorsey et al., 2018). PD is an age-related disease; as illustrated in Figure 1, while it is uncommon before 50 years of age, its prevalence increased with age thereafter and peaked between 85 years and 89 years and decreased after that age (Dorsey et al.,
2018). Parkinson’s disease thus became a global issue with the rapidly growing aging population.
Figure 1: Global prevalence of Parkinson's disease by age and sex, 2016. Prevalence is expressed as the percentage of the population that is affected by the disease. Shading indicates 95% uncertainty intervals (Dorsey et al., 2018).
13 Parkinson’s disease is currently the fastest growing neurological disorder as the
global burden of PD has doubled from 1990 to 2016 and is predicted to double again in
the coming generation, emphasizing the urgent need to prevent and accurately diagnose
PD (Dorsey et al., 2018; GBD 2015 Neurological Disorders Collaborator Group, 2017).
1.2 Genetics of Parkinson’s Disease
Parkinson’s disease is classified into sporadic and familial forms; although
familial PD only represents 10% of PD cases, studying the genes involved in familial PD
can provide insights on the molecular mechanisms leading to neurodegeneration (Spatola
et al., 2014). Familial PD can be categorized into autosomal dominant and autosomal
recessive forms (Spatola et al., 2014).
The most common cause of autosomal dominant PD is the mutations in the
leucine-rich repeat kinase 2 (LRRK2) gene, which encodes the ubiquitous, multidomain
LRRK2 protein that consists of three central catalytic domains with GTPase and kinase
activities surrounded by a series of domains for potential protein-protein interactions
(Cookson, 2010; Spatola et al., 2014). LRRK2 has been found to be associated with
various cellular functions and signalling pathways including mitochondrial function,
vesicle trafficking, retromer complex modulation, and autophagy (Bravo-San Pedro et al.,
2013; Inestrosa et al., 2010; MacLeod et al., 2013; Mortiboys et al., 2010). The second
most common cause of autosomal dominant PD is the mutations in the SNCA gene,
which encodes for α-synuclein, which normally co-localizes with synaptophysin and
regulates the pool of synaptic vesicles (Böttner et al., 2015; Spatola et al., 2014).
However, aggregated α-synuclein may affect neurite morphology, autophagy, vesicle
transport, and axonal degeneration in CNS neurons (Koch et al., 2015). In addition to
14 LRRK2 and SNCA, vacuolar protein sorting 35 (VPS35) was also found to be associated
with autosomal dominant form of PD; VPS35 sorts cellular cargo within the endocytic
system (Harrison et al., 2014). Mutations in VPS35 represent about 0.1% of the PD
population (Kumar et al., 2012).
The most common cause of autosomal recessive PD is the mutations in the
PARK2 gene, which was initially identified in a Japanese autosomal recessive juvenile
Parkinsonism (AR-JP) patient in 1998 (Cookson, 2010; Kitada et al., 1998; Spatola et al.,
2014). PARK2 encodes for parkin, an E3 ubiquitin ligase, and it is estimated that up to
50% of familial PD cases are due to parkin mutations (Imai et al., 2000; Shimura et al.,
2000; Spatola et al., 2014; Zhang et al., 2000). In addition to PARK2, mutations in
PTEN-induced putative kinase 1 (PINK1) and Daisuke-Junko 1 (DJ-1) can also result in
autosomal recessive PD; PINK1 is a mitochondrially targeted serine/threonine kinase that
regulates multiple aspects of mitochondrial biology, and DJ-1 is involved in aldehyde
detoxification (Matsuda et al., 2017; Valente et al., 2004). Other rare forms of autosomal
recessive PD include mutations in ATP13A2, PLA2G6, FBOX7, and DNAJC6 (Spatola
et al., 2014).
1.3 Ubiquitin-Proteasome Pathway
PARK2, the gene that is responsible for most autosomal recessive PD cases,
encodes Parkin, an E3 ubiquitin ligase (Imai et al., 2000; Shimura et al., 2000; Spatola et
al., 2014; Zhang et al., 2000). E3 ubiquitin ligases play a critical role in the ubiquitin-
proteasome system (UPS) for protein degradation as they catalyze the transfer of
ubiquitin onto the substrate (Hershko et al., 1983).
More than 80% of intracellular proteins are degraded through the UPS, which
includes two major steps: the covalent attachment of polyubiquitin chains on the target
15 protein and the degradation of the polyubiquitin-tagged protein by the 26S proteasome
(Ding et al., 2008; Wang et al., 2006). Ubiquitin is a highly conserved, 76-residue protein that is found in all eukaryotes (Nandi et al., 2006). Ubiquitin are selectively attached to the target protein substrates as a branch via an isopeptide bond between the ubiquitin C- terminal glycine and an internal lysine on the protein substrate (Wang et al., 2006). Once the first ubiquitin is attached to the substrate, additional ubiquitin moieties can be sequentially added to the initial ubiquitin to form a polyubiquitin chain, which serves as a signal for a downstream proteasome in the UPS (Wang et al., 2006).
Ubiquitin has seven lysine residues (K6, K11, K27, K29, K33, K48, and K63), which serve as potential sites for bond formation with the next ubiquitin, allowing various types of ubiquitin chains to form (Xu et al., 2008). Any of the seven lysine residues on ubiquitin are able to form homogeneous chains, where the same lysine is used for the bond between each subsequent ubiquitin; in some cases, heterogeneous ubiquitin chains, which have different ubiquitin-ubiquitin linkages, can also form and target proteins for proteasomal degradation (Kravtsova-Ivantsiv et al., 2012). Other types of ubiquitin chains, such as linear chains and chains on non-lysine residues, have also been reported to be involved in proteasomal degradation (Kravtsova-Ivantsiv et al., 2012).
The conjugation of ubiquitin to the substrate is composed of three steps (Haas et al., 1982; Hershko et al., 1983). Firstly, the ubiquitin-activating enzyme (E1) activates ubiquitin through linking ubiquitin’s C-terminal glycine residue to a cysteine residue on
E1, forming a thioester covalent bond in the presence of ATP (Haas et al., 1982; Hershko et al., 1983). Secondly, the activated ubiquitin is transferred to the ubiquitin-conjugating enzyme (E2) through the formation of another thioester bond with a cysteine residue of the E2 enzyme (Haas et al., 1982; Hershko et al., 1983). Thirdly, the ubiquitin ligase (E3)
16 accepts ubiquitin from E2 and catalyzes the addition of ubiquitin to the lysine residue of the target proteins (Haas et al., 1982; Hershko et al., 1983). A large variety of E3 ligases are expressed in mammals, whereas only two E1 and around thirty E2 have been reported, indicating that the specificity of ubiquitination is mainly determined through E3
(Jin et al., 2007; Pickart, 2001).
Different classes of E3 ubiquitin ligases have been identified, including homologous to E6-AP carboxyl terminus (HECT) and Really Interesting New Gene
(RING). RING-type E3 ubiquitin ligases mediate direct ubiquitin transfer from E2 to the target substrate through the binding of E2 to the RING domain of E3, whereas HECT- type E3 ubiquitin ligases mediate ubiquitin transfer to the target substrate through an E3- ubiquitin intermediate, where the ubiquitin is linked to a cysteine in the E3 through a thioester bond, before further transferring the ubiquitin to the target substrate (Metzger et al., 2012). Approximately 50 different HECT-type E3’s and hundreds of RING-type E3’s exist in humans (Ding et al., 2008; Huibregtse et al., 1995; Scheffner et al., 1994).
Parkin is a hybrid of RING and HECT-type E3 ligase, which is thus termed
RING-Between RING-RING (RBR) type E3 ligase (Ferrús et al., 2002; Wenzel et al.,
2011). Parkin binds E2 through RING domain, but the ubiquitin transfer occurred through the formation of a thioester ubiquitin-E3 intermediate, which is a characteristic of HECT-type E3 ligases (Wenzel et al., 2011). The ubiquitination mechanisms for different E3 ligases are shown in Figure 2.
17
Figure 2: Comparison of RING, HECT, and RBR-type E3 ligases in UPS. Ubiquitin is activated by E1 in the presence of ATP and conjugated to E2 through a transthiolation reaction. Three types of E3 ligases are shown: RING, HECT, and RBR. (Top) RING E3 ligases interacts with E2~ubiquitin complexes through its RING domain. (Bottom) HECT E3 ligases interact with E2~ubiquitin complex through its N-terminal lobe and transfer the ubiquitin on the E2~ubiquitin complex onto its C-terminal lobe through another transthiolation reaction, forming a HECT~ubiquitin intermediate that is poised for the subsequent ubiquitin transfer to the substrate. (Middle) RBR E3 ligases interact with E2~ubiquitin in a similar manner as RING E3 ligases; however, the ubiquitin transfer mechanism resembles HECT E3 ligases as the RING2 domain of RBR E3 ligases catalyzes a transthiolation reaction to form a thiolester bond between ubiquitin and the catalytic cysteine of the RING2 domain. Figure adapted from (Spratt et al., 2014).
1.4 Parkin
Parkin, the gene product of PARK2, is a 465 residue multi-domain protein that
exhibits E3 ubiquitin ligase activities (Imai et al., 2000; Shimura et al., 2000; Zhang et
al., 2000). In addition to its role in the ubiquitin proteasome system, parkin also plays a
critical role in mitophagy, the autophagy of damaged mitochondria; parkin is shown to
act downstream of PINK1 in a common pathway that controls mitophagy (Clark et al.,
2006; Durcan et al., 2015; Yang et al., 2006). The interaction between parkin and PINK1
will be discussed in detail in the next section.
18 The domain architecture of parkin is shown in Figure 3. Parkin has five distinct domains: an N-terminal ubiquitin-like (Ubl) domain followed by a unique parkin-specific domain RING0, and two C-terminal RING domains separated by an In-Between-RING (IBR) domain (Beasley et al., 2007; Hristova et al., 2009; Morett et al., 1999). The nomenclature for the domains varies across the literature. The RING0 domain is referred to as UPD by some groups. The IBR domain is called the benign-catalytic domain (BRcat) domain by others and the C-terminal RING2 domain is sometimes called required-for- catalysis (Rcat) domain.
Figure 3: Domain architecture of parkin. Parkin consists of an N-terminal Ubl domain connected through linkers to four Zn2+- binding domains: RING0, RING1, IBR, and RING2. The yellow region, spanning residues 378 to 410, represents the Repressor element of parkin (REP) linker. Figure taken from (Trempe et al., 2013). Reprinted with permission from American Association for the Advancement of Science.
The N-terminal ubiquitin-like (Ubl) domain shares 65% homology with ubiquitin, and more interestingly, the Ubl domain can be phosphorylated on the same serine residue
(Serine 65) as ubiquitin; the Ubl domain has been reported to be essential for the ligase activity of parkin since deletion or mutation of the Ubl domain would results in impaired
E3 ligase activity (Henn et al., 2005; Hristova et al., 2009; Shiba-Fukushima et al., 2012;
Shimura et al., 2001). The C-terminus of parkin features a RING-In Between RING-
RING motif, consisting of three domains: RING1 domain, IBR domain, and RING2 domain (Figure 3). Each of these RING domains in parkin is expected to bind two zinc ions using a C3HC4 motif, which has a general amino acid sequence of Cys-X2-Cys-X(9-
39)-Cys-X(l-3)-His-X(2-3)-Cys-X2-Cys-X(4-48)-Cys-X2-Cys, where X can be any amino acid
(Borden et al., 1996). An additional zinc finger-like domain, RING0, was reported in
19 2009; thus, the C-terminal fragment of parkin, spanning residues 141 to 465, was termed
R0RBR (Hristova et al., 2009). In addition, the linker region between IBR and RING2, spanning residues 378 to 410, represents the Repressor Element of Parkin (REP) linker, which contains a two-turn helix (Trempe et al., 2013). The structure of autoinhibited parkin and its corresponding domains are shown in Figure 4.
Figure 4: Structure of Autoinhibited Parkin (PDB: 4K95). Zinc ions are shown as gray spheres. Figure taken from (Trempe et al., 2013). Reprinted with permission from American Association for the Advancement of Science. In order for parkin to perform its E3 ligase activity, its E2~ubiquitin binding site and catalytic cysteine must be accessible to facilitate the E2~ubiquitin binding and ubiquitin transfer. However, like all RBR E3 ligases identified to date, parkin is tightly regulated, keeping parkin autoinhibited under basal conditions (Spratt et al., 2014;
Trempe et al., 2013; Walden et al., 2018).
The E2~ubiquitin binding site of parkin is predicted to be on the same face of the
RING1 domain that interacts with Ubl and REP linker (Trempe et al., 2013). The
20 catalytic cysteine (Cys 431) is located in the RING2 domain (Trempe et al., 2013). In
parkin’s autoinhibited state, three major issues arose. First, the E2~ubiquitin binding site
on RING1 is sterically hindered by the Ubl domain and REP linker (Chaugule et al.,
2011). Second, the catalytic Cys 431 is occluded by the RING0-RING2 interactions,
rendering these two critical sites inaccessible (Kumar et al., 2012; Riley et al., 2013;
Sauve et al., 2015; Trempe et al., 2013; Wauer et al., 2013). Third, based on the
E2~parkin model constructed by Trempe and colleagues, the active-site cysteine in the
E2 and parkin are ~50 Å apart so that parkin must undergo a conformational change to
mediate the transfer of ubiquitin (Trempe et al., 2013).
1.5 Activation of parkin by PINK1
PTEN-induced putative kinase 1 (PINK1) plays a major role in the activation of
parkin, which allows parkin to undergo a conformational change from the basal
autoinhibited state to its activated state. As mentioned earlier, PINK1 is a mitochondrially
targeted serine/threonine kinase that regulates multiple aspects of mitochondrial biology,
and mutations in PINK1 also lead to autosomal recessive PD (Valente et al., 2004).
Under basal conditions, PINK1 is imported into mitochondria as it contains a
mitochondrial targeting signal, and the constitutive cleavage by mitochondrial proteases,
such as the mitochondrial processing peptidase (MPP), elevates the turnover rate of
PINK1, resulting in a low level of PINK1 (Greene et al., 2012; Okatsu et al., 2015).
However, when the electrochemical potential across the inner mitochondrial membrane is
disrupted, PINK1 becomes stabilized at the outer mitochondrial membrane, allowing the
selective recruitment of parkin to depolarized mitochondria as well as parkin activation
(Greene et al., 2012; Narendra et al., 2010; Sha et al., 2010).
21 The recruitment and activation of parkin by PINK involve two key steps: the recruitment of parkin to the mitochondrial membrane through parkin binding with phosphorylated ubiquitin molecules and the phosphorylation of parkin on the Ubl domain. Under oxidative stress, PINK1 that are stabilized on the mitochondrial membrane phosphorylates Ser 65 on ubiquitin molecules near the outer mitochondria membrane, and these phosphorylated ubiquitin molecules (pUb) act as receptors that recruit parkin to the mitochondria; pUb binds to the RING1-IBR region of parkin
(Kondapalli et al., 2012; Kumar et al., 2017; Sauve et al., 2015; Wauer et al., 2015). The binding with pUb releases the Ubl domain, allowing the Ubl domain to be phosphorylated by PINK1 (Caulfield et al., 2014). The phosphorylated Ubl domain then binds RING0, leading to steric clashes that result in the release of RING2 and the adjacent REP linker (Gladkova et al., 2018; Sauve et al., 2018). As both the Ubl and REP linker are detached from RING1, the E2~ubiquitin binding site is now accessible to
E2~ubiquitin enzyme conjugate; moreover, while RING2 is still tethered to the IBR domain, its catalytic cysteine is no longer occluded by RING0 and is free to dock with the E2~ubiquitin, allowing further catalysis of ubiquitin transfer from E2 to RING2
(Gladkova et al., 2018). The domain rearrangement in different state of parkin is shown in Figure 5.
22
Figure 5: Domain rearrangement for parkin activation. The binding of pUb to parkin releases the Ubl domain, which is further phosphorylated by PINK1. The binding of the pUbl domain to RING0 results in the release of the REP linker and the RING2, exposing its catalytic cysteine. Figure taken from (Sauve et al., 2018). Reprinted with permission from Springer Nature.
1.6 Activating Element
A recent study by Gladkova and colleagues reported an additional region of
parkin that also plays a role in its activation; this region is termed the Activating (ACT)
element (Gladkova et al., 2018). The ACT element is located in the linker region between
the Ubl domain and RING0; this linker has not been studied previously since this linker
region is disordered in full-length parkin and has been removed for structural studies.
However, in their crystal structure of pUb-bound phosphorylated parkin, clear electron
density was observed at the RING2-binding site of RING0, and this electron density
corresponds to the ACT element (Gladkova et al., 2018). The structure of pUb-bound
phosphorylated parkin is shown in Figure 6.
23
Figure 6: Structure of phosphorylated parkin. The ACT element is shown in light green. Note that UPD is also known as RING0. Figure taken from (Gladkova et al., 2018). Reprinted with permission from Springer Nature.
Sequence alignment was performed on the linker region between Ubl and RING0,
and two sequences were found to be highly conserved between different species (Figure
7). The ACT element, spanning residues 101-109, corresponds to the first highly
conserved region (Gladkova et al., 2018).
24
Figure 7: Sequence alignment for Ubl-RING0 linker. Two highly conserved regions were shown in the sequence alignment, and the ACT element corresponds to the first conserved region. Note that UPD is also known as RING0. Figure taken from (Gladkova et al., 2018). Reprinted with permission from Springer Nature.
These two conserved regions were then tested for their importance on the
activation of parkin through ubiquitin-vinyl (Ub-VS) sulfone charging assays. Ub-VS
charging assays is an activity-based probe for HECT E3 ligases, where the C-terminal of
ubiquitin is chemically modified to covalently label the catalytic cysteine (Byrne et al.,
2017). If the catalytic cysteine in RING2 on phosphorylated parkin is exposed, Ub-VS
molecules would be able to covalently attach to the catalytic cysteine, resulting in a
phosphorylated parkin-UbVS complex of a higher molecular weight as compared to
phosphorylated parkin. The exposure of the catalytic cysteine on parkin is an indication
of active parkin. In the Ub-VS charging assay that Gladkova and colleagues performed,
they tested the Ub-VS charging on three different parkin constructs: Δ101-109, Δ116-
123, and R104A. The first two constructs were obtained by deleting the first and second
highly conserved sequences in the linker between Ubl and RING0, respectively, and the
third construct was derived from a mutation found in patients who have AR-JP, which is
R104W (Chaudhary et al., 2006). The Ub-VS charging assay is shown in Figure 8.
25 Figure 8: Ub-VS charging assay for ACT mutants. Δ101-109 corresponds to ACT element. Figure taken from (Gladkova et al., 2018). Reprinted with permission from Springer Nature.
From the Ub-VS charging assay, it was observed that while the deletion of the second conserved region did not affect the activity of parkin, the deletion of ACT element showed no Ub-VS charging even after 60 minutes of incubation, suggesting that
ACT element is likely to play an important role in the activation of parkin (Gladkova et al., 2018). Moreover, the R104A mutant also showed a decrease in Ub-VS charging as compared to WT parkin, suggesting that R104 may be an important residue in the ACT that facilitates parkin activation.
Hydrogen-deuterium exchange mass spectrometry (HDX-MS) and limited proteolysis were also used by Gladkova and colleagues to study the ACT element
(Gladkova et al., 2018). HDX-MS is a technique based on the fact that the exposure of a protein to D2O induces a rapid amide hydrogen to deuterium exchange in disordered regions that lack stable hydrogen-bonding; in short, tightly folded regions are more protect from HDX, resulting in slow isotope exchange (Konermann et al., 2011). In the
HDX-MS experiment for parkin, it was surprising that when the pUb-bound parkin was phosphorylated, the ACT element became protected from the isotope exchange
(Gladkova et al., 2018). Limited proteolysis was also performed for autoinhibited parkin and phosphorylated parkin; while the first cleavage site for autoinhibited parkin was in
26 the linker region between Ubl and RING0, the first cleavage site for phosphorylated
parkin changed to the IBR-RING2 linker (Gladkova et al., 2018). The results from all the
previously described experiments for ACT element strongly suggested that the ACT
element becomes ordered in activated parkin and plays an important role for parkin
activation; the proposed mechanism involving the ACT element is shown in Figure 9.
Figure 9: Model of sequential domain rearrangement, including ACT element, for parkin activation. UPD is also known as RING0. Figure taken from (Gladkova et al., 2018). Reprinted with permission from Springer Nature.
1.7 Links between parkin/PINK1 mutations and Parkinson’s disease
Both parkin and PINK1 play a critical role in mitophagy, where damaged
mitochondria are targeted for degradation by lysosomes, suggesting that mitochondrial
stress and the accumulation of damaged mitochondria may contribute to PD (Newman et
al., 2018). Immune response has recently been shown to be linked to PD pathology. A
recent study by Sliter and colleagues demonstrated that in the absence of parkin or
PINK1, acute or chronic mitochondrial stress will lead to the activation of the DNA-
sensing cGAS-STING pathway and an inflammatory phenotype, providing a connection
27 between inflammation and PD pathology (Sliter et al., 2018). In addition, parkin and
PINK1 are also involved in the biogenesis of mitochondrial-derived vesicles (MDVs) and
mitochondrial antigen presentation, which could be involved in the inflammatory
phenotypes observed (Matheoud et al., 2016). MDVs contain specific cargo proteins and
are targeted to lysosomes for degradation in a manner independent of the canonical
mitophagy pathway, suggesting that parkin and PINK1 participate in early stages of
mitochondrial quality control by selectively extracting damaged components via MDVs,
and it is only when this pathway has been overwhelmed will the mitochondria become
irreversibly damaged and targeted for mitophagy (McLelland et al., 2014).
1.8 Parkin substrates and PICK1
Fully activated parkin will ubiquitinate various substrates, such as mitochondrial
proteins TOM20, TOM70, and VDACs (Bingol et al., 2014; Sarraf et al., 2013). In recent
proteomic studies, an extremely large number of parkin substrates have been identified;
this could suggest that parkin is a promiscuous E3 ligase where its specificity is conferred
by the presence of pUb on substrates rather than the identity of the substrates (Bingol et
al., 2014; Cunningham et al., 2015; Durcan et al., 2015; Sarraf et al., 2013). While a great
number of parkin substrates are polyubiquitinated and sent for proteasomal degradation
or involved in the mitophagy pathway, certain parkin substrates undergo different
ubiquitin modification. Among these alternative ubiquitination modifications,
monoubiquitination is worth noting since various substrates that are monoubiquitinated
by parkin have been reported to play a role in receptor trafficking (Fallon et al., 2006).
Protein-interacting with C-kinase I (PICK1) is a parkin substrate that is
monoubiquitinated instead of polyubiquitinated (Joch et al., 2007). Intriguingly,
28 monoubiquitinated PICK1 has been reported to potently inhibit the E3 ligase of parkin; the potential to enhance the protective effect of parkin through reducing PICK1 thus made PICK1 an important protein to investigate (He et al., 2018). PICK1 is highly expressed in the brain (Cao et al., 2007). PICK1 contains a PSD-95/Discs-large/Zona
Occludens-1 (PDZ) domain and a Bin/Amphiphysin/Rvs (BAR) domain as shown in
Figure 10 (He et al., 2018).
Figure 10: Domain architecture of PICK1. PICK1 consists of a PDZ domain and a BAR domain. Figure taken from (He et al., 2018).
In 2005, Joch and colleagues reported that PICK1 directly binds to parkin through its PDZ domain (Joch et al., 2007). In general, PDZ domains bind to the C-termini of proteins; two types of PDZ-binding motifs have been identified; class I PDZ domains are specific for the tripeptide sequence (S/T)ΧΦ, and class II PDZ domains bind the sequences ΦΧΦ , where Φ represents any hydrophobic amino acids (Songyang et al.,
1997). The last three amino acids on the C-terminal end of parkin (-FDV) was observed to conform to be a class II motif, and the direct binding between the PDZ-binding motif of parkin and the PICK1 PDZ domain was confirmed by Joch and colleagues (Joch et al.,
2007). However, recent studies showed that the PDZ-binding motif on parkin is buried in the core in the autoinhibited state of parkin (Figure 11A) (Trempe et al., 2013). In 2018,
Sauvé and colleagues performed HDX-MS on parkin to address the effect of parkin activation on its structure (Sauvé et al., 2018). RING2 peptide, a peptide that contained
29 residues 454-465 of parkin, included the PDZ-binding motif that spans from residues 463 to 465. RING2 peptide showed a large HDX change only when parkin has been activated
(Figure 11B), suggesting that the PDZ-binding motif is not accessible to solvent until parkin becomes activated by PINK1 (Sauvé et al., 2018).
Figure 11: PDZ-binding motif is buried in the parkin core. A) The PDZ-binding motif (-FDV) on the C-terminus of parkin, marked in red, is shown to be buried in the core of autoinhibited parkin. PDB:4K7D, (Trempe et al., 2013). B) Hydrogen-deuterium exchange result for RING2 peptide. RING2 peptide contains residues 454-465 from parkin, which include the PDZ-binding motif (463-465) (Sauvé et al., 2018).
30 In 2018, He and colleagues conducted an in vitro binding assay with LDAA
mutant and proposed that instead of the PDZ domain, it was the BAR domain of PICK1
that directly binds parkin (He et al., 2018). LDAA mutant contains two point mutations
on the BAR domain: L225A and D354A, and it has been confirmed that LDAA mutant
completely abolishes the PICK1-parkin interaction (He et al., 2018). The in vitro binding
assay demonstrated that while the WT parkin was binding to PICK1, the LDAA did not
show any binding to PICK1, suggesting that parkin binds PICK1 through its BAR
domain (He et al., 2018). They further observed the binding site of BAR domain on
parkin is located on RING1 and suggested that PICK1 may compete with UbcH7 for
binding the RING1 domain (He et al., 2018). However, since the region around the
UbcH7-binding site is sterically hindered by the REP linker, it is unlikely that the BAR
domain on PICK1 binds near the binding site of UbcH7 on RING1 when parkin is
autoinhibited.
Since activated parkin has recently been reported to release the REP linker from
RING1 as well as the C-terminus of parkin from RING0, it is essential to re-investigate
the interaction between PICK1 and activated parkin. The release of autoinhibitory
elements in activated parkin may enhance the parkin-PICK1 interaction and facilitate the
study that examines the binding sites in parkin and PICK1.
1.9 Research objectives
Since the ACT element is a novel region that has only been recently reported to
participate in the activation of parkin, the first aim of this study is to investigate the ACT
element in detail in order to understand its role in the activation cascade as well as the
residues in the ACT element that are involved for the activation of parkin. The ACT
31 element is investigated through mutating its conserved residues to disrupt potential molecular interactions it may form. As parkin was reported to demonstrate its activity through autoubiquitination, the activities of these ACT mutants were assessed via autoubiquitination assays.
Secondly, the previous studies that reported the interaction between parkin and
PICK1 were conducted before the discovery of the complex domain rearrangement that parkin exhibit throughout its activation cascade. The large conformational changes throughout different stages of parkin activation suggest that parkin binding to PICK1 could be affected by parkin activation, as the two putative PICK1 binding sites on parkin are both sterically hindered in its autoinhibited state. Thus, in addition to determining the exact binding sites of parkin and PICK1 in their interaction, it is also important to investigate whether the binding between parkin and PICK1 is regulated by the activation of parkin.
32 2. Materials and Methods
2.1 Parkin construct
The full-length human parkin construct was ordered from Bio Basic. The sequence of
full-length human parkin was codon-optimized for expression in Escherichia coli. The
gene was cloned into the BamHI and XhoI restriction sites of the pGEX-6PI plasmid.
2.2 Mutant constructs of parkin
The mutant constructs of full-length human parkin were prepared using the QuikChange
Lightning Multi Site-Directed Mutagenesis Kit, provided by Agilent. Mutagenesis was
carried out following the protocol provided by the kit. Primers that were designed to
introduce point mutations or deletion in the ACT element were ordered from BioCorp
DNA Inc. The sequence of each primer is shown in Table 1.
33
Table 1: Primers for mutagenesis
Mutation Primer sequence
R104A 5’ - GTGAACCGCAGTCTCTGACAGCTGTTGACCTGTCTTCCTCTGT-3’
L102K 5’ - GTGAACGTGAACCGCAGTCTAAAACACGTGTTGACCTGTCTTC - 3’
T103A 5’ - ΑCGTGAACCGCAGTCTCTGGCACGTGTTGACCTGTCTTCC - 3’
5’ - AACCGCAGTCTCTGACACGTAAAGACCTGTCTTCCTCTGTTCTG - 3’ V105K
5’ - GCAGTCTCTGACACGTGTTGCCCTGTCTTCCTCTGTTCTGC - 3’ D106A
5’ - CAGTCTCTGACACGTGTTGACAAGTCTTCCTCTGTTCTGCCGG - 3’ L107K
5’ - GGTTGTGAACGTGAACCGCAGTCTGTTCTGCCGGGTGACTCC - 3’ Δ101-106
5’ - AGCGTGTACAGCCGGGTAACCTGCGTGTTCAGTGTTCCAC - 3’ K161N
Minipreps were performed using the QIAprep Spin Miniprep Kit, provided by QIAGEN.
The mutagenesis products were validated through Sanger sequencing, performed by
McGill University and Génome Québec Innovation Centre.
34 2.3 Transformation of parkin constructs into Escherichia coli BL21 strain.
Parkin was expressed in Escherichia coli BL21 strain. Approximately 100 ng of purified
and validated plasmids were added to 15 μL of BL21 E. coli cells. The cells were kept on
ice for 15 minutes, heat shocked at 42°C for 45 seconds, and placed on ice for 2 minutes.
50 μL of LB was added to the reaction, and the reaction is completely plated on LB agar
plates containing 0.1 mg/mL of ampicillin.
2.4 Expression and purification of parkin
The transformed E. coli cells were grown in LB broth containing 100 mg/L ampicillin.
The cells were incubated in the 37°C shaker until an optical density of 0.600 ~ 0.800 was
reached at 600 nm, and protein synthesis was induced by the addition of 25 μM IPTG and
500 μM zinc chloride in order to provide sufficient zinc to ensure the proper folding of
the zinc finger domains of parkin. The cell cultures were then incubated in the shaker at
16°C for 16 hours. The cells were harvested by centrifugation at 4500 rpm in 4°C, and
the pellets were resuspended in 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM DTT, and
0.4% Tween 20. For every 2 liters of culture, one tablet of cOmplete™ Protease Inhibitor
Cocktail, provided by Roche, 4 mg of lysozyme, and 50 μL of DNase were added. The
cells were lysed through sonication for 10 seconds, 5 times, with a delay of 50 seconds
between pulses. Sonication of cells were performed using Sonic Dismembrator Model
500, provided by Fisher Scientific. After the centrifugation of lysate at 45,000 rpm at 4°C
for 45 minutes, the supernatant was applied to 3 mL of Pierce Flutathione agarose resin,
provided by Thermo Scientific, in a gravity column. The column was washed with 10
column volume of binding buffer, containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl,
and 2 mM DTT. Parkin was then eluted with 50 mM Tris-HCl pH 8.0, 150 mM NaCl,
35 and 2 mM DTT, and 20 mM reduced glutathione pH 7.4. The GST tag were cleaved by
incubating the GST tagged parkin with 100 μL of 1 mg/mL 3C PreScission Protease for
16 hours at 4°C. Size-exclusion chromatography was performed on the cleaved parkin
using HiLoad 16/600 Superdex 200 pg column and GSTrap HP column with a flow rate
of 1.00 mL/min on an ÄKTA Pure protein purification system, provided by GE
Healthcare. The fractions corresponding to the peak of parkin were collected and
concentrated using Amicon Ultra-15 10 kDa centrifugal concentrators, provided by
Millipore. The concentrations of parkin were measured at 280 nm with a UV extinction
coefficient of 58900 using SpectraMax M Series Multi-Mode Microplate Readers,
provided by Molecular Devices.
2.5 Expression and purification of GST
GST was expressed as a fusion protein with parkin. After cleavage with 3C PreScission
Protease, GST was separated from parkin through size-exclusion chromatography using
HiLoad 16/600 Superdex 200 pg column and GSTrap HP column on an ÄKTA Pure
protein purification system, provided by GE Healthcare. The fractions corresponding to
the peak of GST were collected and concentrated usingn Amicon Ultra-15 10 kDa
centrifugal concentrators, provided by Millipore.
The concentration of GST were measured at 280 nm using SpectraMax M Series Multi-
Mode Microplate Readers, provided by Molecular Devices.
2.6 Expression and purification of GST-PICK1
The plasmid of GST-tagged full length PICK1 was obtained from Ms. Jing Lian from Dr.
Edward Fon’s lab at McGill University. The sequence of GST-PICK1 was validated
36 through Sanger sequencing, performed by McGill University and Génome Québec
Innovation Centre. The GST-PICK1 plasmid was transformed into E. coli BL21 strain as
described in section 2.3.
GST-PICK1 was expressed following the protocol described in 2.4 with several
alterations. The cells were induced with 40μM IPTG after the optical density reached
0.600~0.800 at 600 nm. The lysis buffer contained 20 mM pH 7.4, 200 mM NaCl, 1 mM
DTT, and 100 μM ZnSO4. The binding buffer for affinity chromatography contained 50
mM Tris pH 8.0, 150 mM NaCl, 5 mM MgCl2, 2.5 mM CaCl2, and 1 mM DTT.
2.7 SDS-PAGE
SDS-PAGE was used after each purification step to assess the purity of purified proteins.
The electrophoresis protocol was used as described in Laemmli, 1970. 10% of resolving
gel along with 5% stacking gel were used for parkin. Phos-tag gels contain 7.5% of
resolving gel and 5% stacking gel, along with 20 μM Phos-tag and 40 μM MnCl2. The
gels were run at 190 V for 45 minutes.
2.8 Phosphorylation of human parkin by PINK1
3 μM of parkin was incubated with 0.15 μM GST-TcPINK1, 50 mM Tris-HCl pH 7.4,
150 mM NaCl, 0.5 mM TCEP-HCl, 10 mM MgCl2, 5 mM ATP, and 10 μM of
commercial ubiquitin, provided by Sigma, at 30°C for 4 hours. An aliquot was taken
before and after the reaction to analyze the level of phosphorylation of parkin.
The phosphorylation of parkin was verified with a 7.5% Tris-glycine gel containing 20
μM Phos-tag, provided by ApexBio, and 40 µM MnCl2. The gel was analyzed after
staining with Coomassie blue.
37 2.9 Autoubiquitination assay
The autoubiquitination assays of WT parkin were carried out after verifying that parkin
has been completely phosphorylated by PINK1. Autoubiquitination reactions were
performed at room temperature for 5 minutes. The completed phosphorylation reaction
was incubated with 50 nM human His-E1, 60 μM UbcH7, 40 μM ubiquitin, and 50 mM
MgCl2. The final concentration of parkin was 2.7 μM. A sample was taken before 20 mM
ATP is added. Immediately after the addition of 20 mM ATP, a sample was taken. The
reaction was kept at room temperature, and samples were taken at 1 minute, 2 minutes,
and 5 minutes. Products were resolved by SDS–PAGE and stained with Coomassie blue.
Reactions were stopped by the addition of 5X SDS–PAGE loading buffer, and the level
of ubiquitination was analyzed on 10% Tris-glycine gels stained with Coomassie blue.
2.10 In vitro binding assay
30 μL per construct of Glutathione Sepharose 4B GST-tagged protein purification resin,
provided by GE Healthcare, was washed with double distilled water twice through
centrifugation at 3000 rpm for 1 minute and incubate with binding buffer, containing 50
mM Tris pH 7.4, 140 mM NaCl, 0.1% Triton X-100, and one tablet of cOmplete™
Protease Inhibitor Cocktail, provided by Roche. The resins were incubated with 1 mg/mL
of GST-tagged bait proteins on ice for 15 minutes and then washed twice with binding
buffer. The prey proteins were then added to the resins and kept on ice for 30 minutes.
The resins were washed with wash buffer, containing 50 mM pH 7.4 and 150 mM NaCl.
20 mM of reduced glutathione was dissolved in TBS buffer and added to the resins. Five
minutes after the addition of reduced glutathione, the resins were spun at 3000 rpm for 2
minutes. 5X SDS–PAGE loading buffer was added to the eluate, and the eluate was
analyzed on 10% Tris-glycine gels stained with Coomassie blue.
38 3. Results
3.1 The ACT element is conserved in invertebrates
In order to study the ACT element in detail, specific residues in the ACT element
that participate in the activation of parkin should first be identified. In the work published
by Gladkova and colleagues, the sequences of parkin of different vertebrates have been
aligned (Figure 7); to narrow down the residues of interest, we further aligned the human
parkin sequence with invertebrates (Gladkova et al., 2018). The sequence alignment of
human parkin is shown in Figure 12.
Figure 12: Sequence alignment around the Ubl-RING0 linker region of parkin. The sequence of parkin in different vertebrates and invertebrates were aligned, and the conserved residues are highlighted in orange. The sequences were aligned using protein Blast provided by National Institutes of Health.
According to Figure 12, five residues that are located in the ACT element were
found to be conserved when aligned with non-vertebrate species. Each of these conserved
residues was then mutated based on the specific molecular interactions it can form in
order to obtain different ACT mutant constructs. The mutant constructs are as follows:
L102K, T103A, R104A, V105K, D106A, and L107K.
3.2 Purification of ACT mutants of parkin
The ACT mutant constructs were obtained through mutagenesis described in
Materials and Methods using WT human parkin as a template. The mutant proteins were
transformed into BL21 E. coli cells for expressions and were purified through affinity
39 chromatography and size-exclusion chromatography as described in Material and
Methods. The typical purification results with R104A parkin are shown in Figure 13 and
14.
Figure 13: Size-exclusion chromatogram of R104A.
Protein was detected at 280 nm and collected by the ÄKTA Pure system. Fractions were collected from 74 to 88 minutes with a total volume of 14 mL. The collected fractions were analyzed by SDS-PAGE shown in Figure 14.
40
Figure 14: SDS-PAGE for Parkin R104A. The lane labelled 3C cleavage contained parkin R104A after affinity chromatography followed by 3C PreScission protease cleavage. The following lanes, labelled with elution time, contain fractions collected from size-exclusion chromatography. The bands of parkin at 52 kDa and GST at 27 kDa are labelled. Fractions at 76 minute, 78 minute, 80 minute, and 82 minute were concentrated, resulting in a final yield of 2.63 mg of protein.
3.3 Autoubiquitination assay
In order to examine whether these ACT mutants are important for parkin’s
activation, in vitro ubiquitination assays were performed. Since parkin has been reported
to show autoubiquitination activities, we used parkin itself as a substrate for its E3 ligase
activity (Imai et al., 2000; Shimura et al., 2000; Zhang et al., 2000). The activity of
parkin must be carried out after parkin has been successfully bound to pUb and
phosphorylated by PINK1; thus, prior to the autoubiquitination assay, phosphorylation
reactions were performed on parkin, as described in Materials and Methods. Successfully
phosphorylated parkin constructs would have a lower mobility on phostag gels as the
41 additional phosphate group interacts with the phostag and slows down the movement.
The results of the phosphorylated ACT mutant constructs are shown in Figure 15.
Figure 15: Parkin phosphorylation by PINK1. Phosphorylated ACT mutant constructs were resolved on 10% phostag gel. After 4 hours of incubation, all constructs show a single band at a higher position, which corresponds to phosphorylated parkin, indicating that all constructs were fully phosphorylated.
After confirming that all mutant constructs have been fully phosphorylated by
PINK1, autoubiquitination assays can be performed. Autoubiquitination assay was carried out for 30 minutes at 37°C. The concentration of parkin was chosen based on the amount that can be properly visualized on an SDS-PAGE gel by Coomassie blue staining, and an excess of ubiquitin (1:13 parkin-to-ubiquitin ratio) was added in order to ensure that ubiquitin was not depleted before the reaction was complete. The final products were compared to the starting materials through SDS-PAGE, and the results are shown in
Figure 16.
42
Figure 16: Autoubiquitination assay of phosphorylated ACT mutants. The end product of autoubiquitination assay is resolved on a 10% polyacrylamide gel. The bands are labelled on the right. It is observed that after 30 minutes, all ACT mutant constructs have been autoubiquitinated.
The results of the ACT mutant autoubiquitination activities in Figure 16 can be visualized through the depletion of the starting material, phosphorylated parkin (pParkin), or the appearance of various bands labelled pParkin-Ubn. The results were unexpected since in the activity assays performed by Gladkova and colleagues (Figure 8), the removal of the ACT element, especially for R104A, were reported to significantly reduce the activity of parkin (Gladkova et al., 2018). However, the results of this experiment suggested that parkin was still active and able to perform its E3 ligase activity when individual residues in the ACT elements were mutated. Yet, further studies are required since 30 minutes of incubation may have led to the completion of the reactions, preventing the comparison between different constructs. Thus, in order to identify the subtle differences between the activities of these ACT mutant constructs, additional time
43 points of 10 minute and 20 minute were incorporated into the autoubiquitination assays, and the results are shown in Figure 17 and 18.
Figure 17: Parkin phosphorylation by PINK1 for modified autoubiquitination assay. Phosphorylated ACT mutant constructs were resolved on 7.5% phostag gel. After 4 hours of incubation, all constructs have shown a sharp band at a higher position, which corresponds to phosphorylated parkin, indicating that all constructs have been successfully phosphorylated.
Figure 18: Modified Autoubiquitination Assay. Additional time points were added to the autoubiquitination assay to visualize the difference between the activities of each construct. The ubiquitination products were resolved on a 10% polyacrylamide gel. The bands are labelled on the right.
In the modified autoubiquitination assay, additional constructs were incorporated:
Δ101-109 and K161N. Δ101-109 is the construct tested by Gladkova and colleagues; this
44 construct removed all the conserved residues we identified in our study, so it is more likely to observe a significant decrease in parkin’s activity through this construct. K161 plays a major role in interacting with the phosphate on the pUbl domain after the phosphorylation by PINK1, and previous studies have shown that K161N is a mutation found in AR-JP patients and can abrogate the function of parkin in mitophagy (Geisler et al., 2010; Gladkova et al., 2018; Ordureau et al., 2014). Thus, K161N was used as a negative control as it was already shown to have a lower E3 ligase activity. While K161N showed an observable reduction in its activity, the other mutants did not exhibit any differences in activities.
In order to determine the optimal time points that allow us to visualize the E3 ligase activities of the constructs, a trial experiment was set up using phosphorylated WT parkin. The time points taken were as follows: 0 min, 1 min, 2 min, 5 min, 10 min, 20 min, 30 min, 50 min, and 1 hour. The results of the trial experiment were shown in Figure
19.
Figure 19: Time point determination for optimizing autoubiquitination assay. The end product of autoubiquitination assay is resolved on a 10% polyacrylamide gel. The bands are labelled on the right.
45 In Figure 19, major differences in the level of autoubiquitination were best observed at time 0, 1, 2, and 5 minutes. Thus, these time points were incorporated into the subsequent autoubiquitination assay, shown in Figure 20 to 21.
Figure 20: Parkin phosphorylation by PINK1 after time-point determination. Phosphorylated ACT mutant constructs were resolved on 7.5% phostag gel. After 4 hours of incubation, all constructs have shown a sharp band at a higher position, which corresponds to phosphorylated parkin, indicating that all constructs have been successfully phosphorylated.
Figure 21: Autoubiquitination assay with additional time points. Additional time points were added to the autoubiquitination assay to visualize the difference between the activities of each construct. The end product of autoubiquitination assay is resolved on a 10% polyacrylamide gel. The bands are labelled on the right.
46 The band intensities of non-ubiquitinated parkin variants from Figure 21 were quantified using ImageJ (Schindelin et al., 2012). The quantified results were plotted against reaction time, and the quantities were compared between different ACT mutants at t = 5 minutes, which are shown in Figure 22 and 23.
120
100 WT Parkin
80 WT pParkin R104A L102K 60 T103A V105K (relative to t = 0) to t 0) = (relative ubiquitinated Parkin variants - 40 D106A L107K
% of non 20 Δ101-109 K161N
0 0 1 2 3 4 5 6 Reaction Time (minutes)
Figure 22: Quantification of non-ubiquitinated Parkin variants vs. reaction time. The intensity of Parkin bands in Figure 21 were quantified by ImageJ. The percentage of non-ubiquitinated Parkin were calculated relative to the quantity of each Parkin variant at t = 0.
47 100
90 WT Parkin 80 WT pParkin
70 R104A L102K 60 T103A 50 V105K 40 D106A after 5 minutes ubiquitinated Parkin variants - 30 L107K 20 Δ101-109
% of non 10 K161N
0
Figure 23: Quantification of non-ubiquitinated Parkin variants after five minutes of autoubiquitination activity. The intensities of non-ubiquitinated Parkin bands in Figure 21 were quantified by ImageJ. The percentage of non-ubiquitinated Parkin were calculated relative to the quantity of each Parkin variant at t = 0.
The percentage of pParkin constructs at time points 1, 2, and 5 minutes were determined by comparing the band intensities to WT pParkin. As expected, K161N showed a lower decrease in both phosphorylated parkin and UbcH7 (Figure 22, 23), which was supported by the fact that K161N has a lower E3 ligase activity, further confirming that this assay can properly report the reduced activity of parkin. In Figure 22,
L102K, L107K, and Δ101-109 demonstrated a lower activity when compared to WT phosphorylated parkin. Both L102 and L107 were proposed to directly interact with
RING0 domain when pUbl binds to RING0, suggesting the potential importance of these residues in the activation of parkin (Gladkova et al., 2018). Surprisingly, R104A, the mutant that was suggested to play a critical role in parkin activation, showed an increased activity when compared to WT phosphorylated parkin.
48 3.4 In vitro binding assay for PICK1 and parkin
In order to accurately determine the binding sites from interactions between
PICK1 and parkin, in vitro binding assay was first carried out to confirm whether PICK1
directly binds to parkin. The purification of GST-PICK1 was performed as described in
Materials and Methods, and the purification results are shown in Figure 24 and 25.
Figure 24: Size-exclusion chromatogram for GST-PICK1.
Samples were measured at 280 nm using the UV spectrometer and collected by the ÄKTA Pure system. Fractions were collected from t = 70 minutes to t = 88 minutes. The collected fractions were analyzed by SDS-PAGE shown in Figure 25.
49
Figure 25: SDS-PAGE for GST-PICK1 Purification. The lanes labelled wash and elution contained GST-PICK1 after washing and eluting during affinity chromatography, respectively. The following lanes, labelled with elution time, contained fractions collected from size-exclusion chromatography. The bands of GST-PICK1 at around 73 kDa and GST at 27 kDa are labelled. GST-tag was kept on GST-PICK1 for in vitro GST-pulldown assays.
The purified GST-PICK1 was then tested on its interaction with parkin through
GST-pulldown assay. The first attempt of this experiment was performed as described in the article by He and colleagues (He et al., 2018), and the results are shown in Figure 26.
50 Figure 26: GST-Pulldown assay for parkin and GST-PICK1 interaction. GST was used as a control to ensure that the binding between parkin and PICK1 was not influenced by GST. However, non-specific binding was observed between GST and parkin, and no parkin was pulled down by GST-PICK1.
a
From the pulldown assay shown in Figure 26, non-specific binding was observed between WT parkin and GST, whereas no binding between WT parkin and GST-PICK1 was observed. Thus, modifications were made for subsequent attempts to test the interactions between parkin and PICK1. The modified protocol is described in Materials and Methods, and the results are shown in Figure 27.
Figure 27: GST-Pulldown assay after protocol modifications. 10% input was loaded. GST was used as a control. WT parkin of the same intensity was observed in both GST and GST-PICK1 lanes.
51 Unfortunately, the modifications did not resolve the problem of non-specific binding as WT parkin was observed when incubated with either GST or GST-PICK1, so two more changes were made to improve the experiment. First, since the assay performed by He and colleagues tested the binding between His-parkin and GST-PICK1, we questioned whether the interactions observed between parkin and PICK1 was due to the interaction with the His-tag (He et al., 2018). In the following experiment, we tested the interaction between GST-PICK1 with His-CNNM, a His-tagged protein that has not been reported to interaction with PICK1. Second, the PDZ domain binds to the C-terminal end of parkin, and the BAR domain binds near the E2 binding site on RING1 (He et al., 2018;
Joch et al., 2007). This knowledge, combined with the recent finding in parkin’s activation, suggested that these two putative PICK1 binding sites on parkin are both occluded when parkin is in its autoinhibited state (Gladkova et al., 2018; Sauve et al.,
2018). Thus, incorporating phosphorylated parkin may result in stronger binding between
PICK1 and parkin. The results are shown in Figure 28 and 29.
Figure 28: Parkin phosphorylation by PINK1, in preparation for GST- pulldown assay.
Phosphorylated WT parkin resolved on 7.5% phostag gel. After 4 hours of incubation, parkin showed a sharp band at a higher position, which corresponds to phosphorylated parkin, indicating that WT parkin have been successfully phosphorylated.
52
Figure 29: Modified GST-pulldown assay (with phosphorylated parkin and His- CNNM.) 10% of input was loaded. The phosphorylated parkin, shown in Figure 28, was used to test whether phosphorylation would enhance the binding between parkin and PICK1.
The phosphorylated parkin in Figure 28 was used in the GST-pulldown assay without further purification. Since the phosphorylation reaction contained other proteins, including GST-PINK1 and ubiquitin, the measurement by the spectrophotometer did not accurately represent the amount of protein in the sample, resulting in a faint band for phosphorylated parkin. The large difference between parkin and phosphorylated parkin prevented any conclusions to be drawn.
The direct interpretation of Figure 29 suggested that neither parkin nor phosphorylated parkin bind to PICK1, and the interaction observed between GST-PICK1 and His-parkin was not affected by the His-tag on parkin (He et al., 2018). In addition, non-specific binding was noted between GST and phosphorylated parkin; even though
53 this may be caused by GST-PINK1 that resided in the parkin phosphorylation reaction, which could also interact with GST resin, this was unlikely since only a low concentration of GST-PINK1 (0.45 μM) was added.
To resolve the problem of an inaccurate volume of unpurified phosphorylated parkin, the concentration was calculated instead of measuring using the spectrophotometer. The calculation was based on the amount of parkin added to the phosphorylation reaction and the final volume of the concentrated phosphorylated parkin, and the GST-pulldown experiment was performed again, shown in Figure 30.
Figure 30: GST-Pulldown assay. 10% of input was loaded. The amount of phosphorylated parkin was adjusted so that the bindings are comparable between parkin and phosphorylated parkin.
This attempt fixed the problem of incomparable binding resulted from loading a lower amount of phosphorylated parkin. Moreover, the non-specific binding between parkin and GST was no longer observed after the addition of a reducing agent. This non-
54 specific binding could be due to the formation of disulfide bridges between the cysteines on GST and parkin. Similar to the results in Figure 27, the phosphorylated parkin bands were present in both GST and GST-PICK1 lanes, rendering the experimental results inconclusive.
55 4. Discussion/Conclusion
Recent studies provided comprehensive insights into the structural changes
associated with the activation of parkin. The attachment of pUbl domain to RING0
domain is one of the most critical steps as it releases the RING2 domain and REP linker,
resulting in catalytically active parkin (Gladkova et al., 2018; Sauve et al., 2018).
Gladkova and colleagues reported another potential player in this step of the activation:
the ACT element, which was found to mimic RING2 binding site on RING0 and aids
pUbl in releasing RING2 domain (Gladkova et al., 2018). Moreover, this group reported
that R104, a residue in the ACT element, is essential for the activation of parkin
(Gladkova et al., 2018). This supported a previous study that reported R104W as a
heterozygous mutation found in a young-onset PD patient (Chaudhary et al., 2006). Thus,
the present work investigates the effect of the ACT element on the activation of parkin.
Five residues in the ACT element were identified to be conserved between
vertebrates and invertebrates, and these residues were each mutated to study their
importance on parkin’s activation. After verifying the purified and phosphorylated parkin
samples, the activities of these mutants were examined by their level of
autoubiquitination. Initially, the autoubiquitination assay was performed for 30 minutes at
37°C; however, the results showed that WT parkin as well as all ACT mutant constructs
all exhibited similar level of autoubiquitination activities, suggesting that these residues
on the ACT element did not affect the activation and activity of parkin. However, the
condition of the assay may have caused the reaction to reach completion, preventing the
comparison of activities between different mutants. Thus, time points were introduced to
the assay in order to visualize the subtle differences of parkin activity between different
mutants. Optimal time points of 0 min, 1 min, 2 min, and 5 min have been determined
56 through a trial experiment using WT parkin, and these time points have effectively facilitated the visualization of the autoubiquitination levels of ACT mutants. Surprisingly,
R104A, which resembles an ACT mutant found in AR-JP patients (R104W), did not exhibit any reduced activity in the autoubiquitination assays (Chaudhary et al., 2006).
Only two ACT mutant constructs exhibited a decrease in their E3 ligase activities: L102K and L107K. These mutated residues were both proposed to directly interact with RING0 domain when pUbl binds to RING0, suggesting a potential role in the activation of parkin
(Gladkova et al., 2018). The Δ101-109 construct, which deleted all of the conserved residues in the ACT, also exhibited a slightly lower level of autoubiquitination, although the autoubiquitination became comparable to WT parkin at later time points. It is worth noting that in the work published by Sauvé and colleagues, parkin was fully active even when the ACT element was truncated in the study (Sauve et al., 2018). Altogether, the minor decrease in the activity of certain ACT point mutants indicates that while the ACT element may enhance the activation of parkin, it is not essential for the activation of parkin. Further experiments should be carried out to confirm the findings in this study.
For instance, Ub-VS charging assay is an alternative method that can be used to examine the activity of parkin and validate the results of the autoubiquitination assays. Moreover, since the autoubiquitination assays performed in this study were in vitro and were designed to be visualized by Coomassie blue staining, the parkin concentration did not represent the physiological level of parkin. In healthy human neurons, the concentration of parkin ranges from 0.036 to 4.436 ng/mL (0.69 pM - 85.2 pM), whereas 2.7 μM of parkin was used in the autoubiquitination assays (Oczkowska et al., 2014). Thus, the in vitro autoubiquitination assays were performed to provide information for further studies that can represent the biological system more accurately. For example, the ACT mutants
57 that exhibited a decrease in autoubiquitination activity can be further tested using mt-
Keima assays. Keima is a fluorescent protein that exhibits pH-dependent excitation and is resistant to lysosomal proteases; thus, these properties of Keima enable the determination of whether the protein is in the pH-neutral mitochondria or acidic lysosome, allowing the measurement of mitophagy level (Sun et al., 2015). Since the mt-Keima assay could be used to measure the mitophagy level in vivo, it would provide deeper insight into the role of ACT elements in mitophagy in an environment that closely resembles the biological system (Sun et al., 2015).
PICK1 has been shown to bind a great number of transmembrane receptors, transporters, and ion channels via its single N-terminal PDZ domain, and it has been reported to bind to the C-terminal PDZ-binding motif of parkin through its PDZ domain
(Joch et al., 2007). Alternatively, a recent study reported that PICK1 binds RING1 on parkin through its BAR domain (He et al., 2018). The present work aimed to accurately determine the binding sites of PICK1-parkin interactions. Two critical problems were encountered: 1) no binding was observed between parkin and PICK1, and 2) significant non-specific binding was observed between parkin and GST. Even though the non- specific binding was eventually resolved by adding reducing agent to the pull-down assay to prevent disulfide bridges to form between the cysteines on parkin and GST, the absence of direct interaction between parkin and PICK1 remained to be the major obstacle of this study.
The recently discovered mechanism of parkin activation provided insights into a potential modification of the pull-down assay. Since these studies suggested that the two putative PICK1 binding sites on parkin are both occluded when parkin is in its autoinhibited state, incorporating phosphorylated parkin may result in stronger binding
58 between PICK1 and parkin (Gladkova et al., 2018; Sauve et al., 2018). However, the binding with PICK1 was not observed for phosphorylated parkin, suggesting that phosphorylation of parkin does not enhance the binding between parkin and PICK1. Yet, the lack of binding between unphosphorylated parkin and PICK1 was inconsistent with the previous studies. Moreover, the facts that the GST-PICK1 clone was obtained from the lab that originally observed binding between parkin and PICK1 and that the sequence had been confirmed argued against a trivial explanation for the lack of binding, and further experiments should be carried out to verify these results. Since parkin was the only protein tested with PICK1 in the present work, an important subsequent step is to introduce a positive control that examines the binding between PICK1 and another protein with a PDZ-binding motif.
Ultimately, the fact that PICK1 can be monoubiquitinated by parkin and can act as a parkin inhibitor still make PICK1 an intriguing topic to investigate since the reduction of PICK1 may enhance the protective function of parkin (He et al., 2018).
59 References
Ali, K., & Morris, H. R. (2015). Parkinson's disease: chameleons and mimics. Practical Neurology, 15(1), 14-25.
Beasley, S. A., Hristova, V. A., & Shaw, G. S. (2007). Structure of the Parkin in-between-ring domain provides insights for E3-ligase dysfunction in autosomal recessive Parkinson’s disease. Proceedings of the National Academy of Sciences, 104(9), 3095.
Bingol, B., Tea, J. S., Phu, L., Reichelt, M., Bakalarski, C. E., Song, Q., Foreman, O., Kirkpatrick, D. S., & Sheng, M. (2014). The mitochondrial deubiquitinase USP30 opposes parkin-mediated mitophagy. Nature, 510(7505), 370-375.
Borden, K. L. B., & Freemont, P. S. (1996). The RING finger domain: a recent example of a sequence—structure family. Current Opinion in Structural Biology, 6(3), 395-401.
Böttner, M., Fricke, T., Müller, M., Barrenschee, M., Deuschl, G., Schneider, S. A., Egberts, J.- H., Becker, T., Fritscher-Ravens, A., Ellrichmann, M., Schulz-Schaeffer, W. J., & Wedel, T. (2015). Alpha-synuclein is associated with the synaptic vesicle apparatus in the human and rat enteric nervous system. Brain Research, 1614, 51-59.
Bravo-San Pedro, J. M., Niso-Santano, M., Gomez-Sanchez, R., Pizarro-Estrella, E., Aiastui- Pujana, A., Gorostidi, A., Climent, V., Lopez de Maturana, R., Sanchez-Pernaute, R., Lopez de Munain, A., Fuentes, J. M., & Gonzalez-Polo, R. A. (2013). The LRRK2 G2019S mutant exacerbates basal autophagy through activation of the MEK/ERK pathway. Cellular and Molecular Life Sciences, 70(1), 121-136.
Byrne, R., Mund, T., & Licchesi, J. D. F. (2017). Activity-Based Probes for HECT E3 Ubiquitin Ligases. ChemBioChem, 18(14), 1415-1427.
Cao, M., Xu, J., Shen, C., Kam, C., Huganir, R. L., & Xia, J. (2007). PICK1-ICA69 heteromeric BAR domain complex regulates synaptic targeting and surface expression of AMPA receptors. Journal of Neuroscience, 27(47), 12945-12956.
Caulfield, T. R., Fiesel, F. C., Moussaud-Lamodiere, E. L., Dourado, D. F., Flores, S. C., & Springer, W. (2014). Phosphorylation by PINK1 releases the UBL domain and initializes
60 the conformational opening of the E3 ubiquitin ligase Parkin. PLOS Computational Biology, 10(11), e1003935.
Charcot, J. M. (1875). Leçons sur les Maladies du Système Nerveux Vol. 1. In. Paris: Delahaye et Cie.
Chaudhary, S., Behari, M., Dihana, M., Swaminath, P. V., Govindappa, S. T., Jayaram, S., Goyal, V., Maitra, A., Muthane, U. B., Juyal, R. C., & Thelma, B. K. (2006). Parkin mutations in familial and sporadic Parkinson's disease among Indians. Parkinsonism & Related Disorders, 12(4), 239-245.
Chaugule, V. K., Burchell, L., Barber, K. R., Sidhu, A., Leslie, S. J., Shaw, G. S., & Walden, H. (2011). Autoregulation of Parkin activity through its ubiquitin-like domain. The EMBO Journal, 30(14), 2853-2867.
Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., Yoo, S. J., Hay, B. A., & Guo, M. (2006). Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature, 441(7097), 1162-1166.
Cookson, M. R. (2010). The role of leucine-rich repeat kinase 2 (LRRK2) in Parkinson's disease. Nature reviews. Neuroscience, 11(12), 791-797.
Cunningham, C. N., Baughman, J. M., Phu, L., Tea, J. S., Yu, C., Coons, M., Kirkpatrick, D. S., Bingol, B., & Corn, J. E. (2015). USP30 and parkin homeostatically regulate atypical ubiquitin chains on mitochondria. Nature Cell Biology, 17(2), 160-169.
Ding, M., & Shen, K. (2008). The role of the ubiquitin proteasome system in synapse remodeling and neurodegenerative diseases. BioEssays : news and reviews in molecular, cellular and developmental biology, 30(11-12), 1075-1083.
Dorsey, E. R., Elbaz, A., Nichols, E., Abd-Allah, F., Abdelalim, A., Adsuar, J. C., Ansha, M. G., Brayne, C., Choi, J.-Y. J., Collado-Mateo, D., Dahodwala, N., Do, H. P., Edessa, D., Endres, M., Fereshtehnejad, S.-M., Foreman, K. J., Gankpe, F. G., Gupta, R., Hankey, G. J., Hay, S. I., Hegazy, M. I., Hibstu, D. T., Kasaeian, A., Khader, Y., Khalil, I., Khang, Y.-H., Kim, Y. J., Kokubo, Y., Logroscino, G., Massano, J., Mohamed Ibrahim, N., Mohammed, M. A., Mohammadi, A., Moradi-Lakeh, M., Naghavi, M., Nguyen, B. T., 61 Nirayo, Y. L., Ogbo, F. A., Owolabi, M. O., Pereira, D. M., Postma, M. J., Qorbani, M., Rahman, M. A., Roba, K. T., Safari, H., Safiri, S., Satpathy, M., Sawhney, M., Shafieesabet, A., Shiferaw, M. S., Smith, M., Szoeke, C. E. I., Tabarés-Seisdedos, R., Truong, N. T., Ukwaja, K. N., Venketasubramanian, N., Villafaina, S., weldegwergs, K. g., Westerman, R., Wijeratne, T., Winkler, A. S., Xuan, B. T., Yonemoto, N., Feigin, V. L., Vos, T., & Murray, C. J. L. (2018). Global, regional, and national burden of Parkinson's disease, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. The Lancet Neurology, 17(11), 939-953.
Durcan, T. M., & Fon, E. A. (2015). The three 'P's of mitophagy: PARKIN, PINK1, and post- translational modifications. Genes & Development, 29(10), 989-999.
Fahn, S. (2015). The medical treatment of Parkinson disease from James Parkinson to George Cotzias. Movement Disorders, 30(1), 4-18.
Fallon, L., Belanger, C. M., Corera, A. T., Kontogiannea, M., Regan-Klapisz, E., Moreau, F., Voortman, J., Haber, M., Rouleau, G., Thorarinsdottir, T., Brice, A., van Bergen En Henegouwen, P. M., & Fon, E. A. (2006). A regulated interaction with the UIM protein Eps15 implicates parkin in EGF receptor trafficking and PI(3)K-Akt signalling. Nature Cell Biology, 8(8), 834-842.
Ferrús, A., & Marín, I. (2002). Comparative Genomics of the RBR Family, Including the Parkinson's Disease–Related Gene Parkin and the Genes of the Ariadne Subfamily. Molecular Biology and Evolution, 19(12), 2039-2050.
GBD 2015 Neurological Disorders Collaborator Group. (2017). Global, regional, and national burden of neurological disorders during 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015. The Lancet Neurology, 16(11), 877-897.
Geisler, S., Holmstrom, K. M., Skujat, D., Fiesel, F. C., Rothfuss, O. C., Kahle, P. J., & Springer, W. (2010). PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1. Nature Cell Biology, 12(2), 119-131.
Gladkova, C., Maslen, S. L., Skehel, J. M., & Komander, D. (2018). Mechanism of parkin activation by PINK1. Nature, 559(7714), 410-414.
62 Greene, A. W., Grenier, K., Aguileta, M. A., Muise, S., Farazifard, R., Haque, M. E., McBride, H. M., Park, D. S., & Fon, E. A. (2012). Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Reports, 13(4), 378-385.
Haas, A. L., & Rose, I. A. (1982). The mechanism of ubiquitin activating enzyme. A kinetic and equilibrium analysis. The Journal of Biological Chemistry, 257(17), 10329-10337.
Harrison, M. S., Hung, C. S., Liu, T. T., Christiano, R., Walther, T. C., & Burd, C. G. (2014). A mechanism for retromer endosomal coat complex assembly with cargo. Proceedings of the National Academy of Sciences of the United States of America, 111(1), 267-272.
He, J., Xia, M., Yeung, P. K. K., Li, J., Li, Z., Chung, K. K., Chung, S. K., & Xia, J. (2018). PICK1 inhibits the E3 ubiquitin ligase activity of Parkin and reduces its neuronal protective effect. Proceedings of the National Academy of Sciences of the United States of America, 115(30), E7193-E7201.
Henn, I. H., Gostner, J. M., Lackner, P., Tatzelt, J., & Winklhofer, K. F. (2005). Pathogenic mutations inactivate parkin by distinct mechanisms. Journal of Neurochemistry, 92(1), 114-122.
Hershko, A., Heller, H., Elias, S., & Ciechanover, A. (1983). Components of ubiquitin-protein ligase system. Resolution, affinity purification, and role in protein breakdown. The Journal of Biological Chemistry, 258(13), 8206-8214.
Hristova, V. A., Beasley, S. A., Rylett, R. J., & Shaw, G. S. (2009). Identification of a Novel Zn2+-binding Domain in the Autosomal Recessive Juvenile Parkinson-related E3 Ligase Parkin. The Journal of Biological Chemistry, 284(22), 14978-14986.
Huibregtse, J. M., Scheffner, M., Beaudenon, S., & Howley, P. M. (1995). A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proceedings of the National Academy of Sciences of the United States of America, 92(7), 2563-2567.
Imai, Y., Soda, M., & Takahashi, R. (2000). Parkin suppresses unfolded protein stress-induced cell death through its E3 ubiquitin-protein ligase activity. The Journal of Biological Chemistry, 275(46), 35661-35664.
63 Inestrosa, N. C., & Arenas, E. (2010). Emerging roles of Wnts in the adult nervous system. Nature Reviews Neuroscience, 11(2), 77-86.
Jankovic, J. (2008). Parkinson's disease: clinical features and diagnosis. Journal of Neurology, Neurosurgery, and Psychiatry, 79(4), 368-376.
Jin, J., Li, X., Gygi, S. P., & Harper, J. W. (2007). Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature, 447(7148), 1135-1138.
Joch, M., Ase, A. R., Chen, C. X. Q., MacDonald, P. A., Kontogiannea, M., Corera, A. T., Brice, A., Séguéla, P., & Fon, E. A. (2007). Parkin-mediated monoubiquitination of the PDZ protein PICK1 regulates the activity of acid-sensing ion channels. Molecular biology of the cell, 18(8), 3105-3118.
Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y., & Shimizu, N. (1998). Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature, 392(6676), 605-608.
Koch, J. C., Bitow, F., Haack, J., d'Hedouville, Z., Zhang, J. N., Tönges, L., Michel, U., Oliveira, L. M. A., Jovin, T. M., Liman, J., Tatenhorst, L., Bähr, M., & Lingor, P. (2015). Alpha- Synuclein affects neurite morphology, autophagy, vesicle transport and axonal degeneration in CNS neurons. Cell Death &Amp; Disease, 6, e1811.
Kondapalli, C., Kazlauskaite, A., Zhang, N., Woodroof, H. I., Campbell, D. G., Gourlay, R., Burchell, L., Walden, H., Macartney, T. J., Deak, M., Knebel, A., Alessi, D. R., & Muqit, M. M. (2012). PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65. Open Biology, 2(5), 120080.
Konermann, L., Pan, J., & Liu, Y.-H. (2011). Hydrogen exchange mass spectrometry for studying protein structure and dynamics. Chemical Society Reviews, 40(3), 1224-1234.
Kravtsova-Ivantsiv, Y., & Ciechanover, A. (2012). Non-canonical ubiquitin-based signals for proteasomal degradation. Journal of Cell Science, 125(3), 539.
64 Kumar, A., Chaugule, V. K., Condos, T. E. C., Barber, K. R., Johnson, C., Toth, R., Sundaramoorthy, R., Knebel, A., Shaw, G. S., & Walden, H. (2017). Parkin- phosphoubiquitin complex reveals cryptic ubiquitin-binding site required for RBR ligase activity. Nature Structural & Molecular Biology, 24(5), 475-483.
Kumar, K. R., Weissbach, A., Heldmann, M., Kasten, M., Tunc, S., Sue, C. M., Svetel, M., Kostić, V. S., Segura-Aguilar, J., Ramirez, A., Simon, D. K., Vieregge, P., Münte, T. F., Hagenah, J., Klein, C., & Lohmann, K. (2012). Frequency of the D620N Mutation in VPS35 in Parkinson DiseaseD620N Mutation Frequency in Parkinson Disease. Archives of Neurology, 69(10), 1360-1364.
Lees, A. J., Tolosa, E., & Olanow, C. W. (2015). Four pioneers of L-dopa treatment: Arvid Carlsson, Oleh Hornykiewicz, George Cotzias, and Melvin Yahr. Movement Disorders, 30(1), 19-36.
Lewy, F. (1912). Paralysis agitans. In Handbuch der Neurologie Vol. 3 (pp. 920-933). Berlin: Springer-Verlag.
MacLeod, D. A., Rhinn, H., Kuwahara, T., Zolin, A., Di Paolo, G., McCabe, B. D., Marder, K. S., Honig, L. S., Clark, L. N., Small, S. A., & Abeliovich, A. (2013). RAB7L1 interacts with LRRK2 to modify intraneuronal protein sorting and Parkinson's disease risk. Neuron, 77(3), 425-439.
Matheoud, D., Sugiura, A., Bellemare-Pelletier, A., Laplante, A., Rondeau, C., Chemali, M., Fazel, A., Bergeron, J. J., Trudeau, L. E., Burelle, Y., Gagnon, E., McBride, H. M., & Desjardins, M. (2016). Parkinson's Disease-Related Proteins PINK1 and Parkin Repress Mitochondrial Antigen Presentation. Cell, 166(2), 314-327.
Matsuda, N., Kimura, M., Queliconi, B. B., Kojima, W., Mishima, M., Takagi, K., Koyano, F., Yamano, K., Mizushima, T., Ito, Y., & Tanaka, K. (2017). Parkinson's disease-related DJ-1 functions in thiol quality control against aldehyde attack in vitro. Scientific Reports, 7(1), 12816-12816.
65 McLelland, G. L., Soubannier, V., Chen, C. X., McBride, H. M., & Fon, E. A. (2014). Parkin and PINK1 function in a vesicular trafficking pathway regulating mitochondrial quality control. The EMBO Journal, 33(4), 282-295.
Metzger, M. B., Hristova, V. A., & Weissman, A. M. (2012). HECT and RING finger families of E3 ubiquitin ligases at a glance. Journal of Cell Science, 125(Pt 3), 531-537.
Mhyre, T. R., Boyd, J. T., Hamill, R. W., & Maguire-Zeiss, K. A. (2012). Parkinson's disease. Sub-cellular Biochemistry, 65, 389-455.
Morett, E., & Bork, P. (1999). A novel transactivation domain in parkin. Trends in Biochemical Sciences, 24(6), 229-231.
Mortiboys, H., Johansen, K. K., Aasly, J. O., & Bandmann, O. (2010). Mitochondrial impairment in patients with Parkinson disease with the G2019S mutation in LRRK2. Neurology, 75(22), 2017-2020.
Nandi, D., Tahiliani, P., Kumar, A., & Chandu, D. (2006). The ubiquitin-proteasome system. Journal of Biosciences, 31(1), 137-155.
Narendra, D. P., Jin, S. M., Tanaka, A., Suen, D.-F., Gautier, C. A., Shen, J., Cookson, M. R., & Youle, R. J. (2010). PINK1 Is Selectively Stabilized on Impaired Mitochondria to Activate Parkin. PLOS Biology, 8(1), e1000298.
Newman, L. E., & Shadel, G. S. (2018). Pink1/Parkin link inflammation, mitochondrial stress, and neurodegeneration. The Journal of Cell Biology, 217(10), 3327-3329.
Oczkowska, A., Lianeri, M., Kozubski, W., & Dorszewska, J. (2014). Mutations of PARK Genes and Alpha-Synuclein and Parkin Concentrations in Parkinson’s Disease. In A Synopsis of Parkinson's Disease. IntechOpen.
Okatsu, K., Kimura, M., Oka, T., Tanaka, K., & Matsuda, N. (2015). Unconventional PINK1 localization to the outer membrane of depolarized mitochondria drives Parkin recruitment. Journal of Cell Science, 128(5), 964-978.
66 Ordureau, A., Sarraf, S. A., Duda, D. M., Heo, J. M., Jedrychowski, M. P., Sviderskiy, V. O., Olszewski, J. L., Koerber, J. T., Xie, T., Beausoleil, S. A., Wells, J. A., Gygi, S. P., Schulman, B. A., & Harper, J. W. (2014). Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Molecular Cell, 56(3), 360-375.
Parkinson, J. (2002). An essay on the shaking palsy. 1817. The Journal of Neuropsychiatry and Clinical Neurosciences, 14(2), 223-236.
Pickart, C. M. (2001). Mechanisms underlying ubiquitination. Annual Review of Biochemistry, 70, 503-533.
Polymeropoulos, M. H., Lavedan, C., Leroy, E., Ide, S. E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R., Stenroos, E. S., Chandrasekharappa, S., Athanassiadou, A., Papapetropoulos, T., Johnson, W. G., Lazzarini, A. M., Duvoisin, R. C., Di Iorio, G., Golbe, L. I., & Nussbaum, R. L. (1997). Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science, 276(5321), 2045-2047.
Riley, B. E., Lougheed, J. C., Callaway, K., Velasquez, M., Brecht, E., Nguyen, L., Shaler, T., Walker, D., Yang, Y., Regnstrom, K., Diep, L., Zhang, Z., Chiou, S., Bova, M., Artis, D. R., Yao, N., Baker, J., Yednock, T., & Johnston, J. A. (2013). Structure and function of Parkin E3 ubiquitin ligase reveals aspects of RING and HECT ligases. Nature Communications, 4, 1982.
Sarraf, S. A., Raman, M., Guarani-Pereira, V., Sowa, M. E., Huttlin, E. L., Gygi, S. P., & Harper, J. W. (2013). Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature, 496(7445), 372-376.
Sauve, V., Lilov, A., Seirafi, M., Vranas, M., Rasool, S., Kozlov, G., Sprules, T., Wang, J., Trempe, J. F., & Gehring, K. (2015). A Ubl/ubiquitin switch in the activation of Parkin. The EMBO Journal, 34(20), 2492-2505.
Sauve, V., Sung, G., Soya, N., Kozlov, G., Blaimschein, N., Miotto, L. S., Trempe, J. F., Lukacs, G. L., & Gehring, K. (2018). Mechanism of parkin activation by phosphorylation. Nature Structural & Molecular Biology, 25(7), 623-630.
67 Scheffner, M., Huibregtse, J. M., & Howley, P. M. (1994). Identification of a human ubiquitin- conjugating enzyme that mediates the E6-AP-dependent ubiquitination of p53. Proceedings of the National Academy of Sciences of the United States of America, 91(19), 8797-8801.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J.-Y., White, D. J., Hartenstein, V., Eliceiri, K., Tomancak, P., & Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nature Methods, 9, 676.
Seidel, K., Mahlke, J., Siswanto, S., Krüger, R., Heinsen, H., Auburger, G., Bouzrou, M., Grinberg, L. T., Wicht, H., Korf, H.-W., den Dunnen, W., & Rüb, U. (2015). The brainstem pathologies of Parkinson's disease and dementia with Lewy bodies. Brain pathology, 25(2), 121-135.
Sha, D., Chin, L. S., & Li, L. (2010). Phosphorylation of parkin by Parkinson disease-linked kinase PINK1 activates parkin E3 ligase function and NF-kappaB signaling. Human Molecular Genetics, 19(2), 352-363.
Shiba-Fukushima, K., Imai, Y., Yoshida, S., Ishihama, Y., Kanao, T., Sato, S., & Hattori, N. (2012). PINK1-mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Scientific Reports, 2, 1002.
Shimura, H., Hattori, N., Kubo, S., Mizuno, Y., Asakawa, S., Minoshima, S., Shimizu, N., Iwai, K., Chiba, T., Tanaka, K., & Suzuki, T. (2000). Familial Parkinson disease gene product, parkin, is a ubiquitin-protein ligase. Nature Genetics, 25(3), 302-305.
Shimura, H., Schlossmacher, M. G., Hattori, N., Frosch, M. P., Trockenbacher, A., Schneider, R., Mizuno, Y., Kosik, K. S., & Selkoe, D. J. (2001). Ubiquitination of a New Form of α- Synuclein by Parkin from Human Brain: Implications for Parkinson’s Disease. Science, 293(5528), 263.
68 Singer, H. S., Mink, J. W., Gilbert, D. L., & Jankovic, J. (2010). 1 - Basal Ganglia Anatomy, Biochemistry, and Physiology. In H. S. Singer, J. W. Mink, D. L. Gilbert, & J. Jankovic (Eds.), Movement Disorders in Childhood (pp. 2-8). Philadelphia: W.B. Saunders.
Sliter, D. A., Martinez, J., Hao, L., Chen, X., Sun, N., Fischer, T. D., Burman, J. L., Li, Y., Zhang, Z., Narendra, D. P., Cai, H., Borsche, M., Klein, C., & Youle, R. J. (2018). Parkin and PINK1 mitigate STING-induced inflammation. Nature, 561(7722), 258-262.
Songyang, Z., Fanning, A. S., Fu, C., Xu, J., Marfatia, S. M., Chishti, A. H., Crompton, A., Chan, A. C., Anderson, J. M., & Cantley, L. C. (1997). Recognition of unique carboxyl- terminal motifs by distinct PDZ domains. Science, 275(5296), 73-77.
Spatola, M., & Wider, C. (2014). Genetics of Parkinson's disease: the yield. Parkinsonism & Related Disorders, 20 Suppl 1, S35-38.
Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R., & Goedert, M. (1997). Alpha-synuclein in Lewy bodies. Nature, 388(6645), 839-840.
Spratt, D. E., Walden, H., & Shaw, G. S. (2014). RBR E3 ubiquitin ligases: new structures, new insights, new questions. Biochemical Journal, 458(3), 421-437.
Sun, N., Yun, J., Liu, J., Malide, D., Liu, C., Rovira, Ilsa I., Holmström, Kira M., Fergusson, Maria M., Yoo, Young H., Combs, Christian A., & Finkel, T. (2015). Measuring In Vivo Mitophagy. Journal of Molecular Cell Biology, 60(4), 685-696.
Trempe, J.-F., Sauvé, V., Grenier, K., Seirafi, M., Tang, M. Y., Ménade, M., Al-Abdul-Wahid, S., Krett, J., Wong, K., Kozlov, G., Nagar, B., Fon, E. A., & Gehring, K. (2013). Structure of Parkin Reveals Mechanisms for Ubiquitin Ligase Activation. Science, 340(6139), 1451.
Tretiakoff, C. (1919). Contribution à l'étude de l'anatomie pathologique du locus niger de Soemmering avec quelques déductions relatives à la pathogénie des troubles du tonus musculaire et de la maladie de Parkinson.
Valente, E. M., Abou-Sleiman, P. M., Caputo, V., Muqit, M. M., Harvey, K., Gispert, S., Ali, Z., Del Turco, D., Bentivoglio, A. R., Healy, D. G., Albanese, A., Nussbaum, R., Gonzalez-
69 Maldonado, R., Deller, T., Salvi, S., Cortelli, P., Gilks, W. P., Latchman, D. S., Harvey, R. J., Dallapiccola, B., Auburger, G., & Wood, N. W. (2004). Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science, 304(5674), 1158-1160.
Walden, H., & Rittinger, K. (2018). RBR ligase-mediated ubiquitin transfer: a tale with many twists and turns. Nature Structural & Molecular Biology, 25(6), 440-445.
Wang, J., & Maldonado, M. A. (2006). The ubiquitin-proteasome system and its role in inflammatory and autoimmune diseases. Cellular & Molecular Immunology, 3(4), 255- 261.
Wauer, T., & Komander, D. (2013). Structure of the human Parkin ligase domain in an autoinhibited state. The EMBO Journal, 32(15), 2099-2112.
Wauer, T., Simicek, M., Schubert, A., & Komander, D. (2015). Mechanism of phospho- ubiquitin-induced PARKIN activation. Nature, 524(7565), 370-374.
Wenzel, D. M., Lissounov, A., Brzovic, P. S., & Klevit, R. E. (2011). UBCH7 reactivity profile reveals parkin and HHARI to be RING/HECT hybrids. Nature, 474(7349), 105-108.
Xu, P., & Peng, J. (2008). Characterization of polyubiquitin chain structure by middle-down mass spectrometry. Analytical Chemistry, 80(9), 3438-3444.
Yang, Y., Gehrke, S., Imai, Y., Huang, Z., Ouyang, Y., Wang, J. W., Yang, L., Beal, M. F., Vogel, H., & Lu, B. (2006). Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proceedings of the National Academy of Sciences of the United States of America, 103(28), 10793-10798.
Zhang, Y., Gao, J., Chung, K. K., Huang, H., Dawson, V. L., & Dawson, T. M. (2000). Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proceedings of the National Academy of Sciences of the United States of America, 97(24), 13354-13359.
70