DOCSLIB.ORG

Expression-Functional Correlation and Validation of a Surrogate Marker for DAPC Restoration in a Mouse Model of LGMD2E Eric R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression-Functional Correlation and Validation of a Surrogate Marker for DAPC Restoration in a Mouse Model of LGMD2E Eric R #602 Expression-Functional Correlation and Validation of a Surrogate Marker for DAPC Restoration in a Mouse Model of LGMD2E Eric R. Pozsgai, Ellyn L. Peterson, Amber Kempton, Oliver Rogers, Young-Eun Seo, Louise R. Rodino-Klapac Sarepta Therapeutics, Inc., Cambridge, Massachusetts, USA BACKGROUND RESULTS RESULTS (CONT’D) • Limb-girdle muscular dystrophy type 2E (LGMD2E) is an autosomal • Alpha-sarcoglycan, β-sarcoglycan, and dystrophin expression were recessive disease caused by mutations in β-sarcoglycan (SGCB) leading RNA TRANSCRIPT AND PROTEIN EXPRESSION LEVELS restored after AAV.hSGCG gene transfer in the TA muscle of SGCG-/- to protein deficiency, loss of formation of the sarcoglycan complex, • Sarcoglycan expression in SGCB+/-, SGCB-/-, and WT mice was mice (Figure 6). and loss of stabilization of the dystrophin-associated protein complex determined at the transcript level and protein level. Transcript mRNA (DAPC). levels were measured by qRT-PCR, and protein production was measured by western blot (immunofluorescence images also shown). Figure 6. Immunofluorescence staining of SGCG-/-mouse • Individuals who have a single pathogenic variant are asymptomatic muscle (carriers), and therefore able to compensate for the defective gene SGCB expression is significantly reduced for the SGCB-/- mice as copy. expected. SGCB mRNA levels are reduced for the SGCB+/- mice • Sarcoglycanopathies present as progressive muscular dystrophies compared to WT mice, but no detectable differences are observed in starting in the girdle muscles before extending to lower and upper protein production (Figure 2). extremity muscles, and can also present in the diaphragm and heart, resulting in respiratory and cardiac failure in specific patient subtypes. Figure 2. SGCB transcript and protein levels in SGCB+/- mice: • The sarcoglycans and sarcospan are integral proteins critical for qRT-PCR, immunofluorescence, and western blot stabilizing the DAPC and providing mechanical support to the sarcolemma. RNA PROTEIN • Adeno-associated virus (AAV)-mediated gene replacement therapy has Relative SGCB Expression Immunofluorescence shown early signs of potential to treat sarcoglycanopathies. Key 1.5 considerations include a systematic and stepwise evaluation of safety, *** transduction, expression, localization, cellular impact, and clinical 1.0 function. • With these considerations in mind, the self-complementary 0.5 AAV.MHCK7.hSGCB construct was designed to restore functional Change Fold Western Blot SGCB Expression: WT vs HET BL6 WT β-sarcoglycan to muscles: 0.0 1.5 • AAVrh74 vector: Displays robust muscle (skeletal and cardiac) SGCB Het tissue tropism and has relatively low level of pre-existing BL6 WT immunity SGCB Het SGCB KO 1.0 • MHCK7 promoter: Regulates and drives transgene expression 0.5 N orm alized selectively in skeletal and cardiac muscle; includes an SARCOSPAN AS SURROGATE BIOMARKER FOR alphamyosin heavy chain enhancer to drive especially strong SGCB Expression RESTORATION OF DAPC expression in cardiac muscle ***=p<0.001 0.0 • Sarcospan was reduced or absent in the TA muscle of SGCB-/- mice TA • hSGCB transgene: Carries full-length β-sarcoglycan cDNA. GAS HRT D IA and restored in SGCB-/- mice following AAV.hSGCB gene transfer Muscle • SGCB-/- mice have been shown to concurrently display loss of measured by immunofluorescence (Figure 7) and western blot additional sarcoglycans (α, γ, and δ). Evidence suggests sarcospan may (Figure 8). also be lost in the absence of SGCB. ANALYSIS OF FUNCTIONAL OUTPUTS IN SGCB HET MICE • We hypothesize that other sarcoglycan and sarcospan expression may • Absolute force and resistance to eccentric contraction were similar to WT mice in SGCB+/- TA muscle and significantly different compared to Figure 7. Immunofluorescence staining for sarcospan in be able to serve as a surrogate marker for functional restoration of LGMD2E mice DAPC following SGCB gene transfer. SGCB-/- mice (Figure 3). Analysis of open-field cage activity shows that both ambulation and vertical activity is not affected in the SGCB+/- OBJECTIVES mice compared to WT mice (Figure 4). • Characterize SGCB heterozygous mice and determine the Figure 3. Physiology assessments in skeletal muscle (TA) downstream effects from one wild-type (WT) copy of the SGCB gene, ultimately assessing if these mice presented asymptomatic as human carriers do; Absolute-Force TA ECC-TA BL6 WT ECC-TA SGCB Het • Assess the ability for SGCB gene transfer to restore sarcoglycan and **** 1.5 SGCB KO sarcospan expression in SGCB-/- mice; and 1500 **** • Test their utility as a surrogate marker for DAPC restoration. 1.0 1000 Figure 8. Western blotting for sarcospan in LGMD2E mice METHODS **** 0.5 • Transcriptional and translational regulation of SGCB along with 500 functional outputs were assessed in normal WT mice, heterozygous (mN) Force Absolute SGCB+/- mice, and homozygous knockout (KO) SGCB-/- mice. 0 0.0 1 2 3 4 5 6 7 8 9 10 • Transcript levels of SGCB in skeletal muscle of mice were measured contraction) first of (Fraction Force BL6 WT Eccentric Contraction (Cycle Number) using quantitative reverse transcription PCR (qRT-PCR). SGCB Het SGCB KO • Sarcoglycan and sarcospan protein expression in skeletal and cardiac muscle from untreated and vector-dosed SGCB-/- mice was evaluated ****=p<0.0001 ****=p<0.0001 by immunofluorescence staining and western blot. • Histological evaluations included hematoxylin and eosin staining of skeletal muscle (tibialis anterior [TA] and gastrocnemius [GAS]) and Figure 4. Open-field cage activity Normalized SSPN WB Quantitation quantification of central nucleation. **** • Functional assessments included measurement of force production 3 Ambulation Vertical Activity and resistance to contraction-induced injury in the TA muscle along 2 with laser monitoring of open-field cage activity to assess overall 10000 ** 1000 ambulation (movement around the cage) and vertical activity (rearing ** 8000 800 onto hind limbs). 1 • Animal models: All procedures were conducted in accordance with 6000 600 W to T Relative approval by the Research Institute at the Nationwide Children’s 4000 0 Hospital Institutional Animal Care and Use Committee. C57BL6 WT, 400 B 2000 200 Beam Breaks/Hour SGCB+/-, and SGCB-/- mice were maintained under standardized Beam Breaks/Hour BL6 W T conditions on a 12:12-hour light:dark cycle, with food and water 0 0 provided ad libitum. Untreated SGCB KO W ild Type SGCB KO SGCB Het W ild T y p e SGCB Het SGCB KO RESULTS ****=p<0.0001 Short Term AAV.MHCK7.hSGCBLong Term AAV.MHCK7.hSGC **=p<0.01 **=p<0.01 HISTOPATHOLOGY ANALYSIS IN SGCB HET MICE • SGCB+/- mice were not found to have any significant dystrophic DAPC RESTORATION CONCLUSIONS phenotype as shown by histopathology and quantification of central • Dystrophin and alpha-sarcoglycan expression was restored following nucleation in the TA and GAS. Levels of central nucleation are similar AAV.hSGCB gene transfer in SGCB-/- mice in both TA and cardiac • Overall SGCB+/- mice present with normal muscle phenotype similar to to WT and dramatically different to SGCB KO mice (Figure 1). muscle (Figure 5). WT mice and do not develop any dystrophic histopathology. • RNA transcript levels of SGCB in Het mice were found to be about half Figure 1. No difference in histopathology between WT and Figure 5. Immunofluorescence staining of SGCB-/- the level of WT mice as expected; however, protein levels were normal SGCB+/- muscle and similar to WT mice. mouse muscle • SGCB+/- mice do not present with any functional deficits. CENTRAL NUCLEATION • Further evaluation of lower doses in SGCB-/- will provide insight into a WT vs. SGCB Het vs. SGCB KO Tibialis Anterior Muscle Cardiac Muscle potential expression-function correlation. BL6 WT • Preliminary co-localization studies confirmed restoration of the DAPC **** 80 SGCB Het **** following SGCB or SGCG gene therapy. This data suggests the potential SGCB KO for additional sarcoglycans and sarcospan to serve as a surrogate 60 marker for functional restoration of the DAPC. 40 ACKNOWLEDGEMENTS & DISCLOSURES 20 % Centralized Nuclei %Centralized This study was sponsored by Sarepta Therapeutics, Inc. Authors are 0 employees of Sarepta Therapeutics and may have stock options. TA GAS Medical writing and editorial support was provided by Absence of central nucleation in SGCB Het muscle Health & Wellness Partners, LLC, funded by Sarepta Therapeutics. ****=p<0.0001 Presented at ASGCT 23rd Annual Meeting | May 12-15, 2020 | Virtual Format.
Load more

Recommended publications
  • 2.04.132 Genetic Testing for Limb-Girdle Muscular Dystrophies
    Medical Policy MP 2.04.132 Genetic Testing for Limb-Girdle Muscular Dystrophies BCBSA Ref. Policy: 2.04.132 Related Policies Last Review: 05/27/2021 2.04.86 Genetic Testing for Duchenne and Becker Effective Date: 05/27/2021 Muscular Dystrophy Section: Medicine 2.04.105 Genetic Testing for Facioscapulohumeral Muscular Dystrophy 2.04.570 Genetic Counseling DISCLAIMER/INSTRUCTIONS FOR USE Medical policy provides general guidance for applying Blue Cross of Idaho benefit plans (for purposes of medical policy, the terms “benefit plan” and “member contract” are used interchangeably). Coverage decisions must reference the member specific benefit plan document. The terms of the member specific benefit plan document may be different than the standard benefit plan upon which this medical policy is based. If there is a conflict between a member specific benefit plan and the Blue Cross of Idaho’s standard benefit plan, the member specific benefit plan supersedes this medical policy. Any person applying this medical policy must identify member eligibility, the member specific benefit plan, and any related policies or guidelines prior to applying this medical policy, including the existence of any state or federal guidance that may be specific to a line of business. Blue Cross of Idaho medical policies are designed for informational purposes only and are not an authorization, explanation of benefits or a contract. Receipt of benefits is subject to satisfaction of all terms and conditions of the member specific benefit plan coverage. Blue Cross of Idaho reserves the sole discretionary right to modify all its policies and guidelines at any time.
    [Show full text]
  • Development of a High-Throughput Screen to Identify Small Molecule Enhancers of Sarcospan for the Treatment of Duchenne Muscular Dystrophy
    UCLA UCLA Previously Published Works Title Development of a high-throughput screen to identify small molecule enhancers of sarcospan for the treatment of Duchenne muscular dystrophy. Permalink https://escholarship.org/uc/item/85z6k8t7 Journal Skeletal muscle, 9(1) ISSN 2044-5040 Authors Shu, Cynthia Kaxon-Rupp, Ariana N Collado, Judd R et al. Publication Date 2019-12-12 DOI 10.1186/s13395-019-0218-x Peer reviewed eScholarship.org Powered by the California Digital Library University of California Shu et al. Skeletal Muscle (2019) 9:32 https://doi.org/10.1186/s13395-019-0218-x RESEARCH Open Access Development of a high-throughput screen to identify small molecule enhancers of sarcospan for the treatment of Duchenne muscular dystrophy Cynthia Shu1,2,3, Ariana N. Kaxon-Rupp2, Judd R. Collado2, Robert Damoiseaux4,5 and Rachelle H. Crosbie1,2,3,6* Abstract Background: Duchenne muscular dystrophy (DMD) is caused by loss of sarcolemma connection to the extracellular matrix. Transgenic overexpression of the transmembrane protein sarcospan (SSPN) in the DMD mdx mouse model significantly reduces disease pathology by restoring membrane adhesion. Identifying SSPN-based therapies has the potential to benefit patients with DMD and other forms of muscular dystrophies caused by deficits in muscle cell adhesion. Methods: Standard cloning methods were used to generate C2C12 myoblasts stably transfected with a fluorescence reporter for human SSPN promoter activity. Assay development and screening were performed in a core facility using liquid handlers and imaging systems specialized for use with a 384-well microplate format. Drug-treated cells were analyzed for target gene expression using quantitative PCR and target protein expression using immunoblotting.
    [Show full text]
  • Beta Sarcoglycan (SGCB) (NM 000232) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC120022 beta Sarcoglycan (SGCB) (NM_000232) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: beta Sarcoglycan (SGCB) (NM_000232) Human Untagged Clone Tag: Tag Free Symbol: SGCB Synonyms: A3b; LGMD2E; LGMDR4; SGC Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_000232, the custom clone sequence may differ by one or more nucleotides ATGGCGGCAGCGGCGGCGGCGGCTGCAGAACAGCAAAGTTCCAATGGTCCTGTAAAGAAGTCCATGCGTG AGAAGGCTGTTGAGAGAAGGAGTGTCAATAAAGAGCACAACAGTAACTTTAAAGCTGGATACATTCCGAT TGATGAAGATCGTCTCCACAAAACAGGGTTGAGAGGAAGAAAGGGCAATTTAGCCATCTGTGTGATTATC CTCTTGTTTATCCTGGCTGTCATCAATTTAATAATAACACTTGTTATTTGGGCCGTGATTCGCATTGGAC CAAATGGCTGTGATAGTATGGAGTTTCATGAAAGTGGCCTGCTTCGATTTAAGCAAGTATCTGACATGGG AGTGATCCACCCTCTTTATAAAAGCACAGTAGGAGGAAGGCGAAATGAAAATTTGGTCATCACTGGCAAC AACCAGCCTATTGTTTTTCAGCAAGGGACAACAAAGCTCAGTGTAGAAAACAACAAAACTTCTATTACAA GTGACATCGGCATGCAGTTTTTTGACCCGAGGACTCAAAATATCTTATTCAGCACAGACTATGAAACTCA TGAGTTTCATTTGCCAAGTGGAGTGAAAAGTTTGAATGTTCAAAAGGCATCTACTGAAAGGATTACCAGC AATGCTACCAGTGATTTAAATATAAAAGTTGATGGGCGTGCTATTGTGCGTGGAAATGAAGGTGTATTCA TTATGGGCAAAACCATTGAATTTCACATGGGTGGTAATATGGAGTTAAAGGCGGAAAACAGTATCATCCT AAATGGATCTGTGATGGTCAGCACCACCCGCCTACCCAGTTCCTCCAGTGGAGACCAGTTGGGTAGTGGT GACTGGGTACGCTACAAGCTCTGCATGTGTGCTGATGGGACGCTCTTCAAGGTGCAAGTAACCAGCCAGA
    [Show full text]
  • Altered Ca2+ Handling and Oxidative Stress Underlie Mitochondrial Damage and Skeletal Muscle Dysfunction in Aging and Disease
    H OH metabolites OH Review Altered Ca2+ Handling and Oxidative Stress Underlie Mitochondrial Damage and Skeletal Muscle Dysfunction in Aging and Disease Antonio Michelucci 1,*, Chen Liang 2 , Feliciano Protasi 3 and Robert T. Dirksen 2 1 DNICS, Department of Neuroscience, Imaging, and Clinical Sciences, University G. d’Annunzio of Chieti-Pescara, I-66100 Chieti, Italy 2 Department of Pharmacology and Physiology, School of Medicine and Dentistry, University of Rochester Medical Center, Rochester, NY 14642, USA; [email protected] (C.L.); [email protected] (R.T.D.) 3 CAST, Center for Advanced Studies and Technology, DMSI, Department of Medicine and Aging Sciences, University G. d’Annunzio of Chieti-Pescara, I-66100 Chieti, Italy; [email protected] * Correspondence: [email protected] Abstract: Skeletal muscle contraction relies on both high-fidelity calcium (Ca2+) signals and robust capacity for adenosine triphosphate (ATP) generation. Ca2+ release units (CRUs) are highly organized junctions between the terminal cisternae of the sarcoplasmic reticulum (SR) and the transverse tubule (T-tubule). CRUs provide the structural framework for rapid elevations in myoplasmic Ca2+ during excitation–contraction (EC) coupling, the process whereby depolarization of the T-tubule membrane triggers SR Ca2+ release through ryanodine receptor-1 (RyR1) channels. Under conditions of local Citation: Michelucci, A.; Liang, C.; or global depletion of SR Ca2+ stores, store-operated Ca2+ entry (SOCE) provides an additional 2+ Protasi, F.; Dirksen, R.T. Altered Ca source of Ca2+ that originates from the extracellular space. In addition to Ca2+, skeletal muscle also Handling and Oxidative Stress requires ATP to both produce force and to replenish SR Ca2+ stores.
    [Show full text]
  • Limb-Girdle Muscular Dystrophy
    www.ChildLab.com 800-934-6575 LIMB-GIRDLE MUSCULAR DYSTROPHY What is Limb-Girdle Muscular Dystrophy? Limb-Girdle Muscular Dystrophy (LGMD) is a group of hereditary disorders that cause progressive muscle weakness and wasting of the shoulders and pelvis (hips). There are at least 13 different genes that cause LGMD, each associated with a different subtype. Depending on the subtype of LGMD, the age of onset is variable (childhood, adolescence, or early adulthood) and can affect other muscles of the body. Many persons with LGMD eventually need the assistance of a wheelchair, and currently there is no cure. How is LGMD inherited? LGMD can be inherited by autosomal dominant (AD) or autosomal recessive (AR) modes. The AR subtypes are much more common than the AD types. Of the AR subtypes, LGMD2A (calpain-3) is the most common (30% of cases). LGMD2B (dysferlin) accounts for 20% of cases and the sarcoglycans (LGMD2C-2F) as a group comprise 25%-30% of cases. The various subtypes represent the different protein deficiencies that can cause LGMD. What testing is available for LGMD? Diagnosis of the LGMD subtypes requires biochemical and genetic testing. This information is critical, given that management of the disease is tailored to each individual and each specific subtype. Establishing the specific LGMD subtype is also important for determining inheritance and recurrence risks for the family. The first step in diagnosis for muscular dystrophy is usually a muscle biopsy. Microscopic and protein analysis of the biopsy can often predict the type of muscular dystrophy by analyzing which protein(s) is absent. A muscle biopsy will allow for targeted analysis of the appropriate LGMD gene(s) and can rule out the diagnosis of the more common dystrophinopathies (Duchenne and Becker muscular dystrophies).
    [Show full text]
  • Dystrophin Complex Functions As a Scaffold for Signalling Proteins☆
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1838 (2014) 635–642 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamem Review Dystrophin complex functions as a scaffold for signalling proteins☆ Bruno Constantin IPBC, CNRS/Université de Poitiers, FRE 3511, 1 rue Georges Bonnet, PBS, 86022 Poitiers, France article info abstract Article history: Dystrophin is a 427 kDa sub-membrane cytoskeletal protein, associated with the inner surface membrane and Received 27 May 2013 incorporated in a large macromolecular complex of proteins, the dystrophin-associated protein complex Received in revised form 22 August 2013 (DAPC). In addition to dystrophin the DAPC is composed of dystroglycans, sarcoglycans, sarcospan, dystrobrevins Accepted 28 August 2013 and syntrophin. This complex is thought to play a structural role in ensuring membrane stability and force trans- Available online 7 September 2013 duction during muscle contraction. The multiple binding sites and domains present in the DAPC confer the scaf- fold of various signalling and channel proteins, which may implicate the DAPC in regulation of signalling Keywords: Dystrophin-associated protein complex (DAPC) processes. The DAPC is thought for instance to anchor a variety of signalling molecules near their sites of action. syntrophin The dystroglycan complex may participate in the transduction of extracellular-mediated signals to the muscle Sodium channel cytoskeleton, and β-dystroglycan was shown to be involved in MAPK and Rac1 small GTPase signalling. More TRPC channel generally, dystroglycan is view as a cell surface receptor for extracellular matrix proteins.
    [Show full text]
  • Dystrobrevin Alpha Gene Is a Direct Target of the Vitamin D Receptor in Muscle
    64 3 Journal of Molecular M K Tsoumpra et al. Upregulation of dystrobrevin by 64:3 195–208 Endocrinology calcitriol RESEARCH Dystrobrevin alpha gene is a direct target of the vitamin D receptor in muscle Maria K Tsoumpra1, Shun Sawatsubashi2, Michihiro Imamura1, Seiji Fukumoto2, Shin’ichi Takeda1, Toshio Matsumoto2 and Yoshitsugu Aoki1 1Department of Molecular Therapy, National Institute of Neuroscience, National Centre of Neurology and Psychiatry, Tokyo, Japan 2Fujii Memorial Institute of Medical Sciences, Tokushima University, Tokushima, Japan Correspondence should be addressed to S Fukumoto: [email protected] Abstract The biologically active metabolite of vitamin D, 1,25-dihydroxyvitamin D3 (VD3), exerts its Key Words tissue-specific actions through binding to its intracellular vitamin D receptor (VDR) which f vitamin D functions as a heterodimer with retinoid X receptor (RXR) to recognize vitamin D response f muscle elements (VDRE) and activate target genes. Upregulation of VDR in murine skeletal muscle f gene regulation cells occurs concomitantly with transcriptional regulation of key myogenic factors upon f receptor binding VD3 administration, reinforcing the notion that VD3 exerts beneficial effects on muscle. Herein we elucidated the regulatory role of VD3/VDR axis on the expression of dystrobrevin alpha (DTNA), a member of dystrophin-associated protein complex (DAPC). In C2C12 cells, Dtna and VDR gene and protein expression were upregulated by 1–50 nM of VD3 during all stages of myogenic differentiation. In the dystrophic-derived H2K-mdx52 cells, upregulation of DTNA by VD3 occurred upon co-transfection of VDR and RXR expression vectors. Silencing of MyoD1, an E-box binding myogenic transcription factor, did not alter the VD3-mediated Dtna induction, but Vdr silencing abolished this effect.
    [Show full text]
  • Diagnosis and Cell-Based Therapy for Duchenne Muscular Dystrophy in Humans, Mice, and Zebrafish
    J Hum Genet (2006) 51:397–406 DOI 10.1007/s10038-006-0374-9 MINIREVIEW Louis M. Kunkel Æ Estanislao Bachrach Richard R. Bennett Æ Jeffrey Guyon Æ Leta Steffen Diagnosis and cell-based therapy for Duchenne muscular dystrophy in humans, mice, and zebrafish Received: 3 January 2006 / Accepted: 4 January 2006 / Published online: 1 April 2006 Ó The Japan Society of Human Genetics and Springer-Verlag 2006 Abstract The muscular dystrophies are a heterogeneous mutants carries a stop codon mutation in dystrophin, group of genetically caused muscle degenerative disor- and we have recently identified another carrying a ders. The Kunkel laboratory has had a longstanding mutation in titin. We are currently positionally cloning research program into the pathogenesis and treatment of the disease-causative mutation in the remaining 12 mu- these diseases. Starting with our identification of dys- tant strains. We hope that one of these new mutant trophin as the defective protein in Duchenne muscular strains of fish will have a mutation in a gene not previ- dystrophy (DMD), we have continued our work on ously implicated in human muscular dystrophy. This normal dystrophin function and how it is altered in gene would become a candidate gene to be analyzed in muscular dystrophy. Our work has led to the identifi- patients which do not carry a mutation in any of the cation of the defective genes in three forms of limb girdle known dystrophy-associated genes. By studying both muscular dystrophy (LGMD) and a better understand- disease pathology and investigating potential therapies, ing of how muscle degenerates in many of the different we hope to make a positive difference in the lives of dystrophies.
    [Show full text]
  • Characterization of the Dysferlin Protein and Its Binding Partners Reveals Rational Design for Therapeutic Strategies for the Treatment of Dysferlinopathies
    Characterization of the dysferlin protein and its binding partners reveals rational design for therapeutic strategies for the treatment of dysferlinopathies Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Sabrina Di Fulvio von Montreal (CAN) Basel, 2013 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Michael Sinnreich Prof. Dr. Martin Spiess Prof. Dr. Markus Rüegg Basel, den 17. SeptemBer 2013 ___________________________________ Prof. Dr. Jörg SchiBler Dekan Acknowledgements I would like to express my gratitude to Professor Michael Sinnreich for giving me the opportunity to work on this exciting project in his lab, for his continuous support and guidance, for sharing his enthusiasm for science and for many stimulating conversations. Many thanks to Professors Martin Spiess and Markus Rüegg for their critical feedback, guidance and helpful discussions. Special thanks go to Dr Bilal Azakir for his guidance and mentorship throughout this thesis, for providing his experience, advice and support. I would also like to express my gratitude towards past and present laB members for creating a stimulating and enjoyaBle work environment, for sharing their support, discussions, technical experiences and for many great laughs: Dr Jon Ashley, Dr Bilal Azakir, Marielle Brockhoff, Dr Perrine Castets, Beat Erne, Ruben Herrendorff, Frances Kern, Dr Jochen Kinter, Dr Maddalena Lino, Dr San Pun and Dr Tatiana Wiktorowitz. A special thank you to Dr Tatiana Wiktorowicz, Dr Perrine Castets, Katherine Starr and Professor Michael Sinnreich for their untiring help during the writing of this thesis. Many thanks to all the professors, researchers, students and employees of the Pharmazentrum and Biozentrum, notaBly those of the seventh floor, and of the DBM for their willingness to impart their knowledge, ideas and technical expertise.
    [Show full text]
  • Reviewreview Duchenne Muscular Dystrophy and Dystrophin: Pathogenesis and Opportunities for Treatment Third in Molecular Medicine Review Series Kristen J
    reviewreview Duchenne muscular dystrophy and dystrophin: pathogenesis and opportunities for treatment Third in Molecular Medicine Review Series Kristen J. Nowak† & Kay E. Davies+ MRC Functional Genetics Unit, University of Oxford, UK Duchenne muscular dystrophy (DMD) is caused by mutations in protein. Becker muscular dystrophy (BMD; OMIM 300376)—a the gene that encodes the 427-kDa cytoskeletal protein dys- much milder form of the disease—is caused by a reduction in the trophin. Increased knowledge of the function of dystrophin and amount, or alteration in the size, of the dystrophin protein. The its role in muscle has led to a greater understanding of the high incidence of sporadic cases of DMD (1 in 10,000 sperm or pathogenesis of DMD. This, together with advances in the eggs) means that genetic screening will never eliminate this dis- genetic toolkit of the molecular biologist, are leading to many ease, so an effective therapy is highly desirable. This review sum- different approaches to treatment. Gene therapy can be marizes our understanding of the disease and the strategies that are achieved using plasmids or viruses, mutations can be corrected being developed for an effective treatment (Fig 1). using chimaeraplasts and short DNA fragments, exon skipping of mutations can be induced using oligonucleotides and Pathogenesis readthrough of nonsense mutations can be achieved using Dystrophin has a major structural role in muscle as it links the aminoglycoside antibiotics. Blocking the proteasome degrada- internal cytoskeleton to the extracellular matrix. The amino-terminus tion pathway can stabilize any truncated dystrophin protein, of dystrophin binds to F-actin and the carboxyl terminus to the and upregulation of other proteins can also prevent the dys- dystrophin-associated protein complex (DAPC) at the sarcolemma trophic process.
    [Show full text]
  • Governs the Making of Photocopies Or Other Reproductions of Copyrighted Materials
    Warning Concerning Copyright Restrictions The Copyright Law of the United States (Title 17, United States Code) governs the making of photocopies or other reproductions of copyrighted materials. Under certain conditions specified in the law, libraries and archives are authorized to furnish a photocopy or other reproduction. One of these specified conditions is that the photocopy or reproduction is not to be used for any purpose other than private study, scholarship, or research. If electronic transmission of reserve material is used for purposes in excess of what constitutes "fair use," that user may be liable for copyright infringement. University of Nevada, Reno The Role of Utrophin, Sarcospan, and Glycosyltransferase Activity in the Pathogenesis of Duchenne Muscular Dystrophy and a Representative Case Study A thesis submitted in partial fulfillment of the requirements for the degree of Bachelor of Science in Biochemistry & Molecular Biology by Susan T. Alaei Josh Baker, Ph.D., Thesis Advisor May, 2013 UNIVERSITY OF NEVADA THE HONORS PROGRAM RENO We recommend that the thesis prepared under our supervision by Susan T. Alaei entitled The Role of Utrophin, Sarcospan, and Glycosyltransferase Activity in the Pathogenesis of Duchenne Muscular Dystrophy and a Representative Case Study be accepted in partial fulfillment of the requirements for the degree of Bachelor of Science in Biochemistry & Molecular Biology ______________________________________________ Josh Baker, Ph.D., Thesis Advisor ______________________________________________ Tamara Valentine, Ph.D., Director, Honors Program May 2013 i Abstract Duchenne Muscular Dystrophy is a degenerative muscle disease that is characterized by the breakdown of skeletal muscle as a result of membrane instability. A mutation in the dystrophin gene, one of the largest gene in the human genome, results in a complete lack of dystrophin in the membrane of skeletal muscle cells.
    [Show full text]
  • Analysis of the Dystrophin Interactome
    Analysis of the dystrophin interactome Dissertation In fulfillment of the requirements for the degree “Doctor rerum naturalium (Dr. rer. nat.)” integrated in the International Graduate School for Myology MyoGrad in the Department for Biology, Chemistry and Pharmacy at the Freie Universität Berlin in Cotutelle Agreement with the Ecole Doctorale 515 “Complexité du Vivant” at the Université Pierre et Marie Curie Paris Submitted by Matthew Thorley born in Scunthorpe, United Kingdom Berlin, 2016 Supervisor: Simone Spuler Second examiner: Sigmar Stricker Date of defense: 7th December 2016 Dedicated to My mother, Joy Thorley My father, David Thorley My sister, Alexandra Thorley My fiancée, Vera Sakhno-Cortesi Acknowledgements First and foremost, I would like to thank my supervisors William Duddy and Stephanie Duguez who gave me this research opportunity. Through their combined knowledge of computational and practical expertise within the field and constant availability for any and all assistance I required, have made the research possible. Their overarching support, approachability and upbeat nature throughout, while granting me freedom have made this year project very enjoyable. The additional guidance and supported offered by Matthias Selbach and his team whenever required along with a constant welcoming invitation within their lab has been greatly appreciated. I thank MyoGrad for the collaboration established between UPMC and Freie University, creating the collaboration within this research project possible, and offering research experience in both the Institute of Myology in Paris and the Max Delbruck Centre in Berlin. Vital to this process have been Gisele Bonne, Heike Pascal, Lidia Dolle and Susanne Wissler who have aided in the often complex processes that I am still not sure I fully understand.
    [Show full text]