Muscle Diseases: the Muscular Dystrophies

Total Page:16

File Type:pdf, Size:1020Kb

Muscle Diseases: the Muscular Dystrophies ANRV295-PM02-04 ARI 13 December 2006 2:57 Muscle Diseases: The Muscular Dystrophies Elizabeth M. McNally and Peter Pytel Department of Medicine, Section of Cardiology, University of Chicago, Chicago, Illinois 60637; email: [email protected] Department of Pathology, University of Chicago, Chicago, Illinois 60637; email: [email protected] Annu. Rev. Pathol. Mech. Dis. 2007. Key Words 2:87–109 myotonia, sarcopenia, muscle regeneration, dystrophin, lamin A/C, The Annual Review of Pathology: Mechanisms of Disease is online at nucleotide repeat expansion pathmechdis.annualreviews.org Abstract by Drexel University on 01/13/13. For personal use only. This article’s doi: 10.1146/annurev.pathol.2.010506.091936 Dystrophic muscle disease can occur at any age. Early- or childhood- onset muscular dystrophies may be associated with profound loss Copyright c 2007 by Annual Reviews. All rights reserved of muscle function, affecting ambulation, posture, and cardiac and respiratory function. Late-onset muscular dystrophies or myopathies 1553-4006/07/0228-0087$20.00 Annu. Rev. Pathol. Mech. Dis. 2007.2:87-109. Downloaded from www.annualreviews.org may be mild and associated with slight weakness and an inability to increase muscle mass. The phenotype of muscular dystrophy is an endpoint that arises from a diverse set of genetic pathways. Genes associated with muscular dystrophies encode proteins of the plasma membrane and extracellular matrix, and the sarcomere and Z band, as well as nuclear membrane components. Because muscle has such distinctive structural and regenerative properties, many of the genes implicated in these disorders target pathways unique to muscle or more highly expressed in muscle. This chapter reviews the basic structural properties of muscle and genetic mechanisms that lead to myopathy and muscular dystrophies that affect all age groups. 87 ANRV295-PM02-04 ARI 13 December 2006 2:57 MUSCLE STRUCTURE organized, containing chains of sarcomeres that run parallel to the length of the myofiber. The basic cellular unit of voluntary mus- Electron-dense Z bands define the borders Muscular cle is the myofiber. Myofibers are elongated, of each sarcomere, and individual sarcomeres dystrophy: multinucleate cells. During development and are composed of actin-containing thin fila- genetically linked regeneration, myofibers arise from the fusion muscle disease ments and myosin-containing thick filaments of singly nucleated myoblasts to form myo- characterized by (Figure 2). The heavy chain of myosin hy- fibers. Individual myofibers are encased in an progressive drolyzes ATP to provide the energy for mus- destruction of endomysial sheath of connective tissue, and cle contraction. The rate at which myosin hy- muscle tissue groups of myofibers are encased in epimysial drolyzes ATP is proportional to the speed of Sarcomere: basic connective tissue (Figure 1). The ends of muscle contraction. Slow type I and fast type functional unit of myofibers form myotendinous junctions, a II fibers express different myosin isoforms and muscle contraction specialized attachment for bony insertion that consisting of actin, can be distinguished by enzyme histochem- can withstand considerable force. The cyto- myosin, and istry in the ATPase reaction (Figure 1d ). The associated proteins plasm of each individual myofiber is highly by Drexel University on 01/13/13. For personal use only. Annu. Rev. Pathol. Mech. Dis. 2007.2:87-109. Downloaded from www.annualreviews.org Figure 1 Normal muscle histology. (a) Low-power H&E-stained cross section of normal skeletal muscle showing the organization of myofibers into fascicles separated by epimysial connective tissue. Overall, there is little variation in myofiber size. (b) A high-power H&E-stained cross section of normal skeletal muscle. The myofiber nuclei are located peripherally, just below the sarcolemmal membrane. Only thin strands of connective tissue separate individual myofibers within each of the three depicted fascicles. (c)A high-power H&E-stained longitudinal section of normal muscle shows cross striation, which is evidence of the highly organized cytoskeletal architecture of the myofiber. (d ) The ATPase reaction can distinguish fiber types. At the pH shown here (pH 9.4), type I fibers are light and type II fibers are dark. The checkerboard pattern reflects the normal fiber-type distribution. 88 McNally · Pytel ANRV295-PM02-04 ARI 13 December 2006 2:57 fiber type is determined by the innervating motor neuron in the spinal cord. The motor unit is the functional unit of one motor neu- ron and all the myofibers innervated by it. Several groups of muscle diseases present as weakness, cramping, or muscle pain. These include the congenital myopathies, the mus- cular dystrophies, myotonic disorders, storage diseases, mitochondrial diseases, and inflam- matory myopathies. These primary muscle diseases are distinct from neuropathic diseases and disorders of neuromuscular transmission. This review focuses on myopathies arising from defects of cytoskeletal, sarcomeric, and membrane-associated proteins of the plasma membrane and the nucleus (Table 1). Histor- ically, the diseases that fall into this group were classified on the basis of features such as the pattern of inheritance, the age of disease on- set, and the primarily affected muscle groups. The increasing ability to link these entities to specific genetic defects has greatly increased our understanding of these diseases. MUSCLE DEGENERATION AND REGENERATION Muscle damage typically takes the form of my- ofiber necrosis and regeneration (Figure 3). This process can be segmental, involving only a part of an individual myofiber. The necrosis by Drexel University on 01/13/13. For personal use only. is associated with membrane damage and leak- Figure 2 age of cytoplasmic proteins, such as creatine kinase (CK) and lactate dehydrogenase, that Transmission electron micrograph and schematic representation of a sarcomere, the basic functional contraction unit in skeletal and cardiac can serve as serum markers of muscle dam- muscle. The A band (anisotropic as seen under polarized light) marks the age. The basement membrane of the necrotic extent of the thick myosin filaments and is indicated by the green box in the Annu. Rev. Pathol. Mech. Dis. 2007.2:87-109. Downloaded from www.annualreviews.org fiber remains as a scaffold for the regener- schematic diagram. The thin actin filaments are anchored at the Z disc. ative process. Muscle is highly regenerative. The area where the thin filaments do not overlap with the thick filaments is The regenerative process occurs with the or- the I band (isotropic as seen under polarized light). The membrane overlying the sarcomere is also shown. ganization of necrotic cytoplasmic debris by inflammatory cells. Depending on the degree of damage, the time course of muscle regener- indicating mitotic activity. These two fea- ation occurs over one to three weeks. Mature tures, the mitotic activity and the location be- muscle contains mononuclear cells that re- tween the plasma membrane and the basal side between the basement membrane and lamina, were used to define muscle satellite the plasma membrane or sarcolemma of each cells (1). Experimental evidence supports that myofiber. The nuclei of these mononuclear the origin of the satellite cell is the myotome cells selectively take up bromodeoxyuridine, (2), but additional evidence suggests that www.annualreviews.org • The Muscular Dystrophies 89 ANRV295-PM02-04 ARI 13 December 2006 2:57 Table 1 Summary of different genes or these nuclei will assume a peripheral position gene products and the type of muscle near the sarcolemma, as is characteristic of the disease with which they associate mature myofiber. Sarcolemma: the specialized plasma Gene product (gene) Disease Because most muscle disease involves membrane of the Laminin α2(LAMA2) CMD myofiber damage or degeneration, regenera- individual myofibers Integrin α7(ITGA7 ) CMD tion is a feature of all muscle disease. Although in skeletal muscle Fukutin (FCMD) CMD central nucleation is seen in normal muscle Satellite cell: pool POMGnT1 CMD fiber, an increase in the number of centrally of localized tissue POMT1 WWS nucleated myofibers may indicate an ongoing stem cells in the FKRP CMD, LGMD degenerative or necrotic process. The muscle skeletal muscle LARGE important for its biopsy, viewed perpendicular to the long axis Dystrophin (DYS ) DMD development and of the myofiber, remains the gold standard for α-sarcoglycan ( ) LGMD regenerative SGCA evaluating muscle disease. The main muscle β-sarcoglycan (SGCB ) LGMD potential biopsy changes found in myopathic diseases γ-sarcoglycan (SGCG ) LGMD CMD: congenital are the presence of necrotic myofibers and δ-sarcoglycan (SGCD) LGMD muscular dystrophy Dysferlin (DYSF ) LGMD regenerative myofibers. Necrotic myofibers Calpain-3 (CAPN3 ) LGMD contain variable amounts of amorphous cel- Caveolin-3 (CAV3) LGMD, RMD lular debris, inflammatory cells, and satellite E3-ubiquitin ligase LGMD cells. Regenerative myofibers are character- (TRIM 32) ized by their enlarged nucleus and basophilic Telethonin LGMD RNA-rich cytoplasm. After the reconstitution Titin LGMD of the sarcomeric myofiber architecture, the Myotilin LGMD myofiber nuclei maintain a centralized posi- Lamin A/C ( ) LGMD, EDMD LMNA tion away from their normal subsarcolemmal Emerin (EMD) EDMD location for several weeks. In addition, myo- Color coding reveals those genetic defects that are pathic diseases also show an increased varia- functionally related (see text). POMT: protein
Recommended publications
  • The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
    International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Treatment of Aged Mice and Long-Term Durability of AAV-Mediated Gene Therapy in Two Mouse Models of LGMD Eric R
    P.137 Treatment of Aged Mice and Long-term Durability of AAV-Mediated Gene Therapy in Two Mouse Models of LGMD Eric R. Pozsgai, Danielle A. Griffin, Ellyn L. Peterson, Amber Kempton, Oliver Rogers, Young-Eun Seo, Louise R. Rodino-Klapac Sarepta Therapeutics, Inc., Cambridge, Massachusetts, USA BACKGROUND RESULTS RESULTS (CONT’D) • The sarcoglycanopathies are a subset of autosomal recessive limb-girdle muscular dystrophies (LGMD) Figure 1. Expression analysis: Immunofluorescence staining and western blot on skeletal • Functional improvement was observed with significantly increased resistance to contraction-induced injury resulting from mutations in the sarcoglycans (α, β, γ, and δ-SG) leading to protein deficiency, loss of in the TA muscle (Figure 3). formation of the sarcoglycan complex, and loss of stabilization of the dystrophin-associated protein muscle indicating biomarker expression in aged, severely diseased muscle complex (DAPC). Figure 3. Functional analysis: Protection of force output following long-term treatment of • Sarcoglycanopathies present as progressive muscular dystrophies starting in the girdle muscles before aged SGCA-/- mice with severely diseased muscle extending to lower and upper extremity muscles, and can also present in the diaphragm and heart, resulting in respiratory and cardiac failure in specific patient subtypes. SKELETAL MUSCLE • Adeno-associated virus (AAV)-mediated gene transfer therapy has shown early signs of potential to treat sarcoglycanopathies. Key considerations include a systematic and stepwise
    [Show full text]
  • 2.04.132 Genetic Testing for Limb-Girdle Muscular Dystrophies
    Medical Policy MP 2.04.132 Genetic Testing for Limb-Girdle Muscular Dystrophies BCBSA Ref. Policy: 2.04.132 Related Policies Last Review: 05/27/2021 2.04.86 Genetic Testing for Duchenne and Becker Effective Date: 05/27/2021 Muscular Dystrophy Section: Medicine 2.04.105 Genetic Testing for Facioscapulohumeral Muscular Dystrophy 2.04.570 Genetic Counseling DISCLAIMER/INSTRUCTIONS FOR USE Medical policy provides general guidance for applying Blue Cross of Idaho benefit plans (for purposes of medical policy, the terms “benefit plan” and “member contract” are used interchangeably). Coverage decisions must reference the member specific benefit plan document. The terms of the member specific benefit plan document may be different than the standard benefit plan upon which this medical policy is based. If there is a conflict between a member specific benefit plan and the Blue Cross of Idaho’s standard benefit plan, the member specific benefit plan supersedes this medical policy. Any person applying this medical policy must identify member eligibility, the member specific benefit plan, and any related policies or guidelines prior to applying this medical policy, including the existence of any state or federal guidance that may be specific to a line of business. Blue Cross of Idaho medical policies are designed for informational purposes only and are not an authorization, explanation of benefits or a contract. Receipt of benefits is subject to satisfaction of all terms and conditions of the member specific benefit plan coverage. Blue Cross of Idaho reserves the sole discretionary right to modify all its policies and guidelines at any time.
    [Show full text]
  • Multiomic Approaches to Uncover the Complexities of Dystrophin-Associated Cardiomyopathy
    International Journal of Molecular Sciences Review Multiomic Approaches to Uncover the Complexities of Dystrophin-Associated Cardiomyopathy Aoife Gowran 1,*, Maura Brioschi 2, Davide Rovina 1 , Mattia Chiesa 3,4 , Luca Piacentini 3,* , Sara Mallia 1, Cristina Banfi 2,* , Giulio Pompilio 1,5,6,* and Rosaria Santoro 1,4 1 Unit of Vascular Biology and Regenerative Medicine, Centro Cardiologico Monzino-IRCCS, 20138 Milan, Italy; [email protected] (D.R.); [email protected] (S.M.); [email protected] (R.S.) 2 Unit of Cardiovascular Proteomics, Centro Cardiologico Monzino-IRCCS, 20138 Milan, Italy; [email protected] 3 Bioinformatics and Artificial Intelligence Facility, Centro Cardiologico Monzino-IRCCS, 20138 Milan, Italy; [email protected] 4 Department of Electronics, Information and Biomedical Engineering, Politecnico di Milano, 20133 Milan, Italy 5 Department of Cardiac Surgery, Centro Cardiologico Monzino-IRCCS, 20138 Milan, Italy 6 Department of Biomedical, Surgical and Dental Sciences, University of Milan, 20122 Milan, Italy * Correspondence: [email protected] (A.G.); [email protected] (L.P.); cristina.banfi@cardiologicomonzino.it (C.B.); [email protected] (G.P.) Abstract: Despite major progress in treating skeletal muscle disease associated with dystrophinopathies, cardiomyopathy is emerging as a major cause of death in people carrying dystrophin gene mutations that remain without a targeted cure even with new treatment directions and advances in modelling Citation: Gowran, A.; Brioschi, M.; abilities. The reasons for the stunted progress in ameliorating dystrophin-associated cardiomyopathy Rovina, D.; Chiesa, M.; Piacentini, L.; (DAC) can be explained by the difficulties in detecting pathophysiological mechanisms which can also Mallia, S.; Banfi, C.; Pompilio, G.; Santoro, R.
    [Show full text]
  • Development of a High-Throughput Screen to Identify Small Molecule Enhancers of Sarcospan for the Treatment of Duchenne Muscular Dystrophy
    UCLA UCLA Previously Published Works Title Development of a high-throughput screen to identify small molecule enhancers of sarcospan for the treatment of Duchenne muscular dystrophy. Permalink https://escholarship.org/uc/item/85z6k8t7 Journal Skeletal muscle, 9(1) ISSN 2044-5040 Authors Shu, Cynthia Kaxon-Rupp, Ariana N Collado, Judd R et al. Publication Date 2019-12-12 DOI 10.1186/s13395-019-0218-x Peer reviewed eScholarship.org Powered by the California Digital Library University of California Shu et al. Skeletal Muscle (2019) 9:32 https://doi.org/10.1186/s13395-019-0218-x RESEARCH Open Access Development of a high-throughput screen to identify small molecule enhancers of sarcospan for the treatment of Duchenne muscular dystrophy Cynthia Shu1,2,3, Ariana N. Kaxon-Rupp2, Judd R. Collado2, Robert Damoiseaux4,5 and Rachelle H. Crosbie1,2,3,6* Abstract Background: Duchenne muscular dystrophy (DMD) is caused by loss of sarcolemma connection to the extracellular matrix. Transgenic overexpression of the transmembrane protein sarcospan (SSPN) in the DMD mdx mouse model significantly reduces disease pathology by restoring membrane adhesion. Identifying SSPN-based therapies has the potential to benefit patients with DMD and other forms of muscular dystrophies caused by deficits in muscle cell adhesion. Methods: Standard cloning methods were used to generate C2C12 myoblasts stably transfected with a fluorescence reporter for human SSPN promoter activity. Assay development and screening were performed in a core facility using liquid handlers and imaging systems specialized for use with a 384-well microplate format. Drug-treated cells were analyzed for target gene expression using quantitative PCR and target protein expression using immunoblotting.
    [Show full text]
  • 'Clustering of Nicotinic Acetylcholine Receptors: from the Neuromuscular
    Huh, K H; Fuhrer, C. Clustering of nicotinic acetylcholine receptors: from the neuromuscular junction to interneuronal synapses. Mol. Neurobiol. 2002, 25(1):79-112. Postprint available at: http://www.zora.unizh.ch University of Zurich Posted at the Zurich Open Repository and Archive, University of Zurich. Zurich Open Repository and Archive http://www.zora.unizh.ch Originally published at: Mol. Neurobiol. 2002, 25(1):79-112 Winterthurerstr. 190 CH-8057 Zurich http://www.zora.unizh.ch Year: 2002 Clustering of nicotinic acetylcholine receptors: from the neuromuscular junction to interneuronal synapses Huh, K H; Fuhrer, C Huh, K H; Fuhrer, C. Clustering of nicotinic acetylcholine receptors: from the neuromuscular junction to interneuronal synapses. Mol. Neurobiol. 2002, 25(1):79-112. Postprint available at: http://www.zora.unizh.ch Posted at the Zurich Open Repository and Archive, University of Zurich. http://www.zora.unizh.ch Originally published at: Mol. Neurobiol. 2002, 25(1):79-112 Clustering of nicotinic acetylcholine receptors: from the neuromuscular junction to interneuronal synapses Abstract Fast and accurate synaptic transmission requires high-density accumulation of neurotransmitter receptors in the postsynaptic membrane. During development of the neuromuscular junction, clustering of acetylcholine receptors (AChR) is one of the first signs of postsynaptic specialization and is induced by nerve-released agrin. Recent studies have revealed that different mechanisms regulate assembly vs stabilization of AChR clusters and of the postsynaptic apparatus. MuSK, a receptor tyrosine kinase and component of the agrin receptor, and rapsyn, an AChR-associated anchoring protein, play crucial roles in the postsynaptic assembly. Once formed, AChR clusters and the postsynaptic membrane are stabilized by components of the dystrophin/utrophin glycoprotein complex, some of which also direct aspects of synaptic maturation such as formation of postjunctional folds.
    [Show full text]
  • Beta Sarcoglycan (SGCB) (NM 000232) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC120022 beta Sarcoglycan (SGCB) (NM_000232) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: beta Sarcoglycan (SGCB) (NM_000232) Human Untagged Clone Tag: Tag Free Symbol: SGCB Synonyms: A3b; LGMD2E; LGMDR4; SGC Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_000232, the custom clone sequence may differ by one or more nucleotides ATGGCGGCAGCGGCGGCGGCGGCTGCAGAACAGCAAAGTTCCAATGGTCCTGTAAAGAAGTCCATGCGTG AGAAGGCTGTTGAGAGAAGGAGTGTCAATAAAGAGCACAACAGTAACTTTAAAGCTGGATACATTCCGAT TGATGAAGATCGTCTCCACAAAACAGGGTTGAGAGGAAGAAAGGGCAATTTAGCCATCTGTGTGATTATC CTCTTGTTTATCCTGGCTGTCATCAATTTAATAATAACACTTGTTATTTGGGCCGTGATTCGCATTGGAC CAAATGGCTGTGATAGTATGGAGTTTCATGAAAGTGGCCTGCTTCGATTTAAGCAAGTATCTGACATGGG AGTGATCCACCCTCTTTATAAAAGCACAGTAGGAGGAAGGCGAAATGAAAATTTGGTCATCACTGGCAAC AACCAGCCTATTGTTTTTCAGCAAGGGACAACAAAGCTCAGTGTAGAAAACAACAAAACTTCTATTACAA GTGACATCGGCATGCAGTTTTTTGACCCGAGGACTCAAAATATCTTATTCAGCACAGACTATGAAACTCA TGAGTTTCATTTGCCAAGTGGAGTGAAAAGTTTGAATGTTCAAAAGGCATCTACTGAAAGGATTACCAGC AATGCTACCAGTGATTTAAATATAAAAGTTGATGGGCGTGCTATTGTGCGTGGAAATGAAGGTGTATTCA TTATGGGCAAAACCATTGAATTTCACATGGGTGGTAATATGGAGTTAAAGGCGGAAAACAGTATCATCCT AAATGGATCTGTGATGGTCAGCACCACCCGCCTACCCAGTTCCTCCAGTGGAGACCAGTTGGGTAGTGGT GACTGGGTACGCTACAAGCTCTGCATGTGTGCTGATGGGACGCTCTTCAAGGTGCAAGTAACCAGCCAGA
    [Show full text]
  • Limb-Girdle Muscular Dystrophy
    www.ChildLab.com 800-934-6575 LIMB-GIRDLE MUSCULAR DYSTROPHY What is Limb-Girdle Muscular Dystrophy? Limb-Girdle Muscular Dystrophy (LGMD) is a group of hereditary disorders that cause progressive muscle weakness and wasting of the shoulders and pelvis (hips). There are at least 13 different genes that cause LGMD, each associated with a different subtype. Depending on the subtype of LGMD, the age of onset is variable (childhood, adolescence, or early adulthood) and can affect other muscles of the body. Many persons with LGMD eventually need the assistance of a wheelchair, and currently there is no cure. How is LGMD inherited? LGMD can be inherited by autosomal dominant (AD) or autosomal recessive (AR) modes. The AR subtypes are much more common than the AD types. Of the AR subtypes, LGMD2A (calpain-3) is the most common (30% of cases). LGMD2B (dysferlin) accounts for 20% of cases and the sarcoglycans (LGMD2C-2F) as a group comprise 25%-30% of cases. The various subtypes represent the different protein deficiencies that can cause LGMD. What testing is available for LGMD? Diagnosis of the LGMD subtypes requires biochemical and genetic testing. This information is critical, given that management of the disease is tailored to each individual and each specific subtype. Establishing the specific LGMD subtype is also important for determining inheritance and recurrence risks for the family. The first step in diagnosis for muscular dystrophy is usually a muscle biopsy. Microscopic and protein analysis of the biopsy can often predict the type of muscular dystrophy by analyzing which protein(s) is absent. A muscle biopsy will allow for targeted analysis of the appropriate LGMD gene(s) and can rule out the diagnosis of the more common dystrophinopathies (Duchenne and Becker muscular dystrophies).
    [Show full text]
  • Profiling of the Muscle-Specific Dystroglycan Interactome Reveals the Role of Hippo Signaling in Muscular Dystrophy and Age-Dependent Muscle Atrophy Andriy S
    Yatsenko et al. BMC Medicine (2020) 18:8 https://doi.org/10.1186/s12916-019-1478-3 RESEARCH ARTICLE Open Access Profiling of the muscle-specific dystroglycan interactome reveals the role of Hippo signaling in muscular dystrophy and age-dependent muscle atrophy Andriy S. Yatsenko1†, Mariya M. Kucherenko2,3,4†, Yuanbin Xie2,5†, Dina Aweida6, Henning Urlaub7,8, Renate J. Scheibe1, Shenhav Cohen6 and Halyna R. Shcherbata1,2* Abstract Background: Dystroglycanopathies are a group of inherited disorders characterized by vast clinical and genetic heterogeneity and caused by abnormal functioning of the ECM receptor dystroglycan (Dg). Remarkably, among many cases of diagnosed dystroglycanopathies, only a small fraction can be linked directly to mutations in Dg or its regulatory enzymes, implying the involvement of other, not-yet-characterized, Dg-regulating factors. To advance disease diagnostics and develop new treatment strategies, new approaches to find dystroglycanopathy-related factors should be considered. The Dg complex is highly evolutionarily conserved; therefore, model genetic organisms provide excellent systems to address this challenge. In particular, Drosophila is amenable to experiments not feasible in any other system, allowing original insights about the functional interactors of the Dg complex. Methods: To identify new players contributing to dystroglycanopathies, we used Drosophila as a genetic muscular dystrophy model. Using mass spectrometry, we searched for muscle-specific Dg interactors. Next, in silico analyses allowed us to determine their association with diseases and pathological conditions in humans. Using immunohistochemical, biochemical, and genetic interaction approaches followed by the detailed analysis of the muscle tissue architecture, we verified Dg interaction with some of the discovered factors.
    [Show full text]
  • Anti-SGCG / Gamma Sarcoglycan Antibody (ARG41710)
    Product datasheet [email protected] ARG41710 Package: 100 μl anti-SGCG / gamma Sarcoglycan antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes SGCG / gamma Sarcoglycan Tested Reactivity Hu Tested Application IHC-P, IP, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name SGCG / gamma Sarcoglycan Antigen Species Human Immunogen Synthetic peptide of Human SGCG / gamma Sarcoglycan Conjugation Un-conjugated Alternate Names 35DAG; DMDA1; TYPE; SCG3; DMDA; Gamma-sarcoglycan; DAGA4; 35 kDa dystrophin-associated glycoprotein; A4; SCARMD2; Gamma-SG; LGMD2C; MAM Application Instructions Application table Application Dilution IHC-P 1:50 - 1:200 IP 1:50 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 32 kDa Observed Size ~ 32 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.4), 150 mM NaCl, 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol SGCG Gene Full Name sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) Background This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin.
    [Show full text]
  • Dystrophin Complex Functions As a Scaffold for Signalling Proteins☆
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1838 (2014) 635–642 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamem Review Dystrophin complex functions as a scaffold for signalling proteins☆ Bruno Constantin IPBC, CNRS/Université de Poitiers, FRE 3511, 1 rue Georges Bonnet, PBS, 86022 Poitiers, France article info abstract Article history: Dystrophin is a 427 kDa sub-membrane cytoskeletal protein, associated with the inner surface membrane and Received 27 May 2013 incorporated in a large macromolecular complex of proteins, the dystrophin-associated protein complex Received in revised form 22 August 2013 (DAPC). In addition to dystrophin the DAPC is composed of dystroglycans, sarcoglycans, sarcospan, dystrobrevins Accepted 28 August 2013 and syntrophin. This complex is thought to play a structural role in ensuring membrane stability and force trans- Available online 7 September 2013 duction during muscle contraction. The multiple binding sites and domains present in the DAPC confer the scaf- fold of various signalling and channel proteins, which may implicate the DAPC in regulation of signalling Keywords: Dystrophin-associated protein complex (DAPC) processes. The DAPC is thought for instance to anchor a variety of signalling molecules near their sites of action. syntrophin The dystroglycan complex may participate in the transduction of extracellular-mediated signals to the muscle Sodium channel cytoskeleton, and β-dystroglycan was shown to be involved in MAPK and Rac1 small GTPase signalling. More TRPC channel generally, dystroglycan is view as a cell surface receptor for extracellular matrix proteins.
    [Show full text]