A Proteomic Screen Reveals Novel Fas Ligand Interacting Proteins Within Nervous System Schwann Cells

FEBS Letters 581 (2007) 4455–4462

A proteomic screen reveals novel Fas ligand interacting proteins within nervous system Schwann cells

Peter B. Thornhilla, Jason B. Cohnb,c, Gillian Drurya, William L. Stanforde, Alan Bernsteinb,c,d, Julie Desbaratsa,* a Department of Physiology, McGill University, 3655 Promenade Sir William Osler, Montre´al, Que´bec, Canada H3G 1Y6 b Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, ON, Canada M5G 1X5 c Department of Molecular and Medical Genetics, University of Toronto, Toronto, ON, Canada M5S 1A8 d Canadian Institutes of Health Research, 410 Laurier Ave. W., Ottawa, ON, Canada K1A 0W9 e Institute for Biomaterials and Biomedical Engineering, University of Toronto, 164 College Street, Toronto, ON, Canada M5S 3G9

Received 19 July 2007; revised 10 August 2007; accepted 13 August 2007

Available online 22 August 2007

Edited by Ned Mantei

tion of a death inducing signaling complex (DISC) and activa- Abstract Fas ligand (FasL) binds Fas (CD95) to induce apoptosis or activate other signaling pathways. In addition, FasL tion of a caspase cascade, ultimately culminating in apoptosis transduces bidirectional or ‘reverse signals’. The intracellular do- [3]. The apoptotic effector function of FasL is particularly well main of FasL contains consensus sequences for phosphorylation documented in the immune system, where FasL is an effector and an extended proline rich region, which regulate its surface of activation induced lymphocyte cell death (AICD), and of expression through undetermined mechanism(s). Here, we used target cell killing by cytotoxic T lymphocytes [4]. In addition a proteomics approach to identify novel FasL interacting pro- to the effector function of FasL as a ligand for Fas, increasing teins in Schwann cells to investigate signaling through and traf- evidence has suggested that FasL and other membrane-bound ficking of this protein in the nervous system. We identified two TNF superfamily ligands can also transduce ‘‘reverse signals’’ novel FasL interacting proteins, sorting nexin 18 and adaptin and thus participate in bidirectional signaling [5]. b, as well as two proteins previously identified as FasL interact- The FasL intracellular domain (ICD) contains a modular ing proteins in T cells, PACSIN2 and PACSIN3. These proteins are all associated with endocytosis and trafficking, highlighting architecture consistent with its role as a signal transducing the tight regulation of cell surface expression of FasL in the ner- molecule. It contains a 26 amino acid proline rich region which vous system. interacts with multiple Src homology 3 (SH3) and WW do- 2007 Federation of European Biochemical Societies. main containing proteins in T cells, including several members Published by Elsevier B.V. All rights reserved. of the Src tyrosine kinase family [6,7]. In T cells, stimulation of FasL with agonistic antibodies or Fas fusion proteins increases Keywords: Fas ligand; Src homology 3 domain; Schwann cell; its association with specific SH3 domain containing proteins PACSIN; Sorting nexin 18; Adaptin b and results in activation of the extracellular-signal regulated kinase (ERK) mitogen activated protein kinase (MAPK) pathway [8,9]. In addition to its potential role in signal transduction, the FasL proline rich region has also been implicated in sorting of the molecule to different cellular compartments 1. Introduction [10], which may be important for regulating both FasL effector and reverse signaling activities. The FasL ICD also contains a Fas ligand (FasL, CD95L, CD178), a member of the tumor conserved, cytosolic casein kinase I (CKI) motif, SXXS, that necrosis factor (TNF) superfamily, is a type II, homotrimeric has been implicated in reverse signaling in other TNF family protein with cell surface and secreted isoforms. FasL is induc- members [5,11]. Recently, Sun et al. have documented changes ibly expressed by cells of the immune system upon activation in FasL serine phosphorylation following treatment of cul- and in the nervous system after injury, and is constitutively ex- tured cells with a Fas fusion protein [9]. pressed in ‘‘immune privileged’’ tissues, such as the eye and Although FasL has been extensively studied in the immune reproductive system [1,2]. Traditionally, FasL has been viewed system, FasL trafficking and reverse signaling have never been exclusively as a ligand for the Fas receptor, stimulating forma- studied in the nervous system. FasL expression is induced on nervous system glial cells, including Schwann cells, following injury [12]. Fas is also expressed in the nervous system and is *Corresponding author. Fax: +1 514 398 7452. upregulated after injury, suggesting that Fas/FasL interactions E-mail address: [email protected] (J. Desbarats). may play a role in the injured nervous system [13]. We have Abbreviations: AICD, activation induced cell death; DISC, death previously found that expression of Fas and FasL influenced inducing signaling complex; SH3, Src homology 3; ICD, intracellular peripheral nerve regeneration after crush injury [14]. domain; LC-MSMS, liquid chromatography coupled tandem mass Here, we used a proteomic approach to identify novel FasL spectrometry; IRES, internal ribosomal entry site; GST, glutathione-S- interacting proteins in Schwann cells, the glial cells of the transferase; PX, Phox homology domain; CC, coiled coil domain; peripheral nervous system, to gain insight into mechanisms MAPK, mitogen activated protein kinase; ERK, extracellular-signal regulated kinase; AP, adaptor protein; EGFP, enhanced green of reverse signaling and trafficking of FasL in the nervous sys- fluorescent protein; TNF, tumor necrosis factor tem. Using liquid chromatography-tandem mass spectrometry

0014-5793/$32.00 2007 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2007.08.025 4456 P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462

(LC-MSMS) for identification of FasL co-immunoprecipitat- 2.4. RNA extraction and RT-PCR 5 ing proteins, we identified Sorting Nexin 18 (SNX18), adaptin RNA extraction was performed on 2 · 10 cells using the Charge- b, Protein Kinase C and Casein Kinase Substrate in Neurons 2 Switch total RNA kit (Invitrogen) according to the manufacturer’s instructions. RNA was quantified using the Quant-iT Ribogreen (PACSIN2), and PACSIN3 as FasL interacting proteins. The RNA assay kit (Invitrogen) according to the manufacturer’s protocol. binding of FasL to multiple proteins implicated in trafficking Reverse transcription reactions were primed with 5 lM random suggests tight regulation of the reverse signaling and effector decamers (Ambion), and amplified with 4U Sensicript reverse functions of FasL within the nervous system. transcriptase (Qiagen). Primers for PCR amplification were as follows: 18S rRNA sense: 50TGAGAAACGGCTACCACATCC30, 18S rRNA antisense: 50TCGCTCTGGTCCGTCTTGC30, FasL sense: 50CTGGTTGCCTTGGTAGGATTGGG30, FasL antisense: 2. Materials and methods 50GGACCTTGAGTTGGACTTGCCTG30, EGFP sense: 50GCCAC- AAGTTCAGCGTGCTCG30, EGFP antisense: 50TCTTCTGCTTG- TCGGCCATGATAT30 (Invitrogen). PCR reactions were performed 2.1. Cells using HotstarTaq (Qiagen) in a Techne Touchgene Gradient thermo- Mouse Schwann cells were isolated from sciatic nerves of neonatal cycler as follows: 18S rRNA: 15 min at 95 C, cycled 13 · 60 s at (P1 to P3) C3H/HeJ mice. Nerves were digested in collagenase (Sigma) 94 C, 40 s at 66.2 C, 30 s at 72 C, then final elongation 10 min at then in trypsin/DNase (Worthington Biochemicals). Cells were grown 72 C. EGFP and FasL: 15 min at 95 C, cycled 25 · 60 s at 94 C, in DMEM plus 10% fetal calf serum (FCS, Hyclone), 100 U/ml peni- 20 s at 65.2 C, 40 s at 72 C, then final elongation 10 min at 72 C. cillin, 100 lg/ml streptomycin (Gibco), 0.1 mM non-essential amino PCR products were visualized on 1.2% agarose gel (Invitrogen). acids (Gibco), and 10 lM cytosine-b-D-arabinofuranoside (Ara-C, Sigma). Schwann cell cultures were treated with anti-mouse Thy1.2 (CD90.2) antibody-containing supernatant derived from the HO-13-4 2.5. Immunoprecipitation (IP) and immunoblotting hybridoma (American Type Culture Collection) and rabbit LowTox For IP, mouse Schwann cells were lysed in buffer containing 0.5% complement (Cedarlane) to remove residual fibroblasts. To verify the Nonidet P-40 (Bioshop Canada), 25 mM HEPES, pH 7.4, 115 mM purity of the cultures, cells were examined using flow cytometry as potassium acetate, 5 mM magnesium chloride, 1 mM sodium ortho- follows: cells were trypsinized from cell culture plates, then either vanadate (all from Sigma), and Complete Mini protease inhibitor permeabilized and stained using the Cytofix/Cytoperm fixation/ cocktail (Roche). Lysates remained on ice for 15 min before centrifuga- permeabilization solution kit (BD Biosciences) for intracellular pro- tion at 15000 rpm for 10 min at 4 C. Supernatants were then pre- teins according to the manufacturer’s recommendations, or stained cleared against unconjugated Sepharose 4B (Sigma) for 1.5 h at 4 C. in PBS/2% FCS for surface markers. Labelling was performed on ice For validation experiments, supernatants were precleared with Protein for 25 min with the indicated primary antibodies or isotype control G-Sepharose and isotype control antibodies. Beads were then pelleted, antibodies. After two wash cycles all samples were stained with phyco- and precleared supernatants were incubated for at least 2 h at 4 C erythrin conjugated secondary antibodies. Cells were washed twice with anti-FLAG or isotype control antibodies (Sigma) covalently more and analyzed using a FACSAria cell analyzer (BD Biosci- cross-linked to Protein G-Sepharose (GE Healthcare) using dimethyl ences). pimelimidate (Sigma). The beads were pelleted, washed three times in cold lysis buffer, boiled in Laemli buffer containing b-mercap- toethanol, and electrophoresed on SDS–polyacrylamide gels. SDS gels 2.2. Construction of FasL deletion mutants were then either transferred to polyvinylidene difluoride membranes Human Fas Ligand (huFasL) cDNA was purchased from Open (PVDF, BioRad) and subjected to immunoblotting or stained with Biosystems. FasL deletion mutants, HuFasLD 2–33-FLAG and colloidal Coomassie blue (Invitrogen) followed by tandem mass HuFasLD2–70-FLAG, were created using wild-type FasL cDNA as spectrometry of selected gel bands. PVDF membranes were blocked a template to produce PCR products missing base pairs corresponding overnight at 4 C in 5% non-fat dry milk powder (w/v) in Tris-buffered to N-terminal amino acids 2–33 and 2–70, respectively, but still con- saline/0.1% Tween 20 (Fisher Scientific, TBST) and blotted with the taining the initiator methionine (AUG) base pairs. The huFasL and indicated primary antibody and horseradish peroxidase (HRP)-conju- huFasLD2–33 coding sequences were PCR amplified using forward gated secondary antibodies. Bands were visualized using ECL PLUS 0 0 0 primers 5 -CACCTGCAGCCATGCAGC-3 and 5 -GGGCTGC- reagents (GE Healthcare) and film from Molecular Technologies Inc. AGCCATGACCTCTGTGCCCAGAAGGC-30, respectively, paired with the reverse 50-CTCTTAAAGCTTATATAAGCCG-30 primer and PFUltra DNA polymerase (Stratagene). The resulting PCR 2.6. Mass spectrometry of selected gel bands products were cloned in frame into pCMV-Tag4A (Stratagene) with Coomassie stained gel bands detected at higher intensity in the PstI (Invitrogen) and HindIII (New England Biolabs) to generate FLAG IP than in the isotype control IP were excised and minced man- C-terminal FLAG tagged proteins. HuFasL-FLAG and huFasLD ually with a scalpel, washed with water and dehydrated in acetonitrile 2–33-FLAG were then excised with PstI and Acc65I (Fermentas), (Sigma-Aldrich). The corresponding gel area in the isotype control lane and subcloned into the pIRES2-EGFP (Clontech) SmaI (New England was also excised for mass spectrometric analysis to separate legitimate Biolabs) site after fill-in reactions using the Klenow fragment (Invitro- interacting proteins from those highly prevalent at the same molecular gen). HuFasLD 2-70-FLAG was created by PCR amplification weight. Gel pieces were spun down and dried using a vacuum centri- with primers 50-GGGCTGCAGCCATGCTGAAGAAGAGAGGG- fuge, followed by reduction in 10 mM dithiotreitol/0.1 M ammonium AACCACAGC-30 (forward) and 50-CTACTTATCGTCGTCAT- bicarbonate (Sigma-Aldrich), alkylation in 55 mM iodoacetamide (Sig- CCTTG-30 (reverse) using huFasL-FLAG as a template and cloned ma-Aldrich)/0.1 M ammonium bicarbonate, followed by extensive into the pIRES2-EGFP SmaI site. All vectors were fully sequenced washing in 1:1 (v/v) 0.1 M ammonium bicarbonate/acetonitrile to before transfecting into cells to ensure the absence of mutations/frame- remove residual Coomassie stain. Digestion was performed with shifts created during PCR amplification. 12.5 ng/ll trypsin (Promega) in 50 mM ammonium bicarbonate, 5 mM calcium chloride (Sigma-Aldrich). Peptides remaining in the gel were then extracted twice in 1:1 (v/v) 25 mM ammonium bicarbon- 2.3. Creation of stably transfected cell lines ate/acetonitrile and 1:1 (v/v) 5% formic acid/acetonitrile, respectively. Mouse Schwann cells were transfected with huFasL-FLAG, Extracted samples were pooled and dried using a vacuum centrifuge huFasLD2-33-FLAG, huFasLD2-70-FLAG, or empty pIRES2-EGFP for mass spectrometry at the Institute for Research in Immunology vector as a control using Lipofectamine 2000 (Invitrogen) according and Cancer proteomic center at the Universite´ de Montreál. The dried to the manufacturer’s recommendations. EGFP positive cells were sin- peptides were resuspended in 5 ll of 0.2% formic acid and injected on a gle cell sorted into 96 well plates using a FACSAria fluorescence acti- NanoACQUITY HPLC system (Waters Limiteé). Peptides were first vated cell sorter (BD Biosciences). Cells were expanded in DMEM trapped by a reversed phase C18 precolumn (300 lm i.d. · 5mm with 10% FCS, 0.1 mM non-essential amino acids, 1 mM sodium pyru- length) and subsequently separated on a C18 analytical column vate (Gibco) and 400 lg/ml G418 (Wisent Bioproducts). Clones were (150 lm i.d. · 10 cm, particle size 3 lm). NanoLC separation was screened for expression of FasL constructs and EGFP by immunoblot- achieved using a 56-min linear gradient from 5% to 60% aqueous ace- ting cellular lysates. tonitrile (0.2% FA) at a flow rate of 600 nl/min. Mass spectrometric P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462 4457 acquisitions in the MS/MS mode were performed on a Q-TOF Premier times with peptide (100 lg) in Freund’s Incomplete Adjuvant. For flow instrument (Waters Limiteé). Database searches were performed cytometric detection, anti-S100 (Chemicon), anti-GFAP (BD Biosci- against the NCBI non-redundant protein database using Mascot soft- ences), or anti-Thy1.2-PE (BD Biosciences) were used and compared ware (http://www.matrixscience.com). We used the following criteria to isotype control antibodies mouse IgG2a (BD Biosciences), mouse to define potentially valid protein hits (Table 1): protein hits were sup- IgG2b (Sigma), and rat IgG2a-PE (BD Biosciences), respectively. ported by at least 2 peptides and had a predicted molecular weight within 10 kDa of the excised gel band. Proteins with peptide hits present in the isotype background band were excluded from further analysis, as well as hits for antibody fragments, trypsin, and/or other 3. Results highly prevalent cellular proteins known to non-specifically precipitate in IP experiments. 3.1. Stable expression of FasL constructs in Schwann cell lines To investigate the proteins associated with FasL within the 2.7. Generation of GST-SNX18 SH3 domain and peptide spots array nervous system, we first created stable Schwann cell transfec- synthesis tants expressing wild-type or truncated FasL constructs. Wild-type SH3 domain SNX18 cDNA was subcloned into pGEX3X-4T1 (Amersham Pharmacia Biotech) expression vector by Schwann cells isolated from mouse sciatic nerve which sponta- PCR and its sequence was verified. To isolate recombinant protein, neously became transformed in cell culture were used for the GST-fusion constructs were expressed in BL21-Codon Plus RP cells establishment of stable transfectants. These cells expressed (Stratagene) and induced with 0.1 M isopropyl-b-D-thiogalactopyra- the Schwann cell markers S100 and glial fibrillary acidic pro- noside (IPTG) for 3 h at 18 C. Bacterial pellets were resuspended in 100 mM potassium phosphate buffer and sonicated. Lysate was then tein (GFAP), but not the fibroblast marker Thy1.2 (Fig. 1A). cleared by centrifugation at 35000 · g and recombinant GST-fusion Wild-type FasL-FLAG (wtFasL), FasL-FLAG lacking amino protein was isolated using Glutathione Sepharose 4 Fast Flow (Amer- acids 2–33 (FasLD2–33), which include the casein kinase con- sham Pharmacia Biotech) and eluted with 50 mM reduced glutathione sensus sequence, and FasL-FLAG lacking amino acids 2–70 (Sigma) in 50 mM Tris, pH 8.5. (FasLD2–70), which encode the proline rich domain Peptide arrays were produced according to the spots-synthesis meth- od [15]. Acid-hardened cellulose membranes prederivatized with a (Fig. 1B), were stably expressed in Schwann cells in conjunc- polyethylene glycol spacer (Intavis AG, Cologne, Germany) and stan- tion with the enhanced green fluorescent protein (EGFP), dard 9-fluorenylmethoxy carbonyl (Fmoc) chemistry was used for syn- using a bicistronic approach. The bicistronic vector, pIRES2, thesis. Fmoc-protected and activated amino acids (Intavis) were contains an internal ribosomal entry site (IRES) upstream of spotted in high-density 20 · 30 arrays on 150- by 100-mm membranes using an Intavis MultiPep robot. Membranes were blocked overnight the EGFP gene, resulting in co-translational expression of in 5% skim milk, incubated with 1 lM purified GST fusion proteins FasL and EGFP on the same mRNA. As expected, the ratio in TBST for 3 h at 4 C, washed three times, and probed with mouse of FasL to EGFP mRNA was similar for all three FasL con- monoclonal anti-GST HRP-conjugated antibody (Santa Cruz) fol- structs (Fig. 1C). However, we noticed substantial differences lowed by enhanced chemiluminescence detection (Pierce). in the ratios of FasL to EGFP protein expression between the different FasL constructs (Fig. 1D). While wtFasL was 2.8. Antibodies For IP, monoclonal anti-FLAG M2 (Sigma) or mouse IgG1 control expressed at very low levels compared to EGFP, the ratio of (Sigma) antibodies were used. Anti-FasL (cloneG247.4, BD Biosci- FasLD2–33 to EGFP was roughly 10-fold higher. The expres- ences) or anti-adaptin b (BD Biosciences) were used for the detection sion ratio of FasLD2–70 to EGFP was also increased 6-fold of immunoprecipitated proteins in immunoblots. EGFP was detected relative to wtFasL. Our results suggest that truncations in using clone JL-8 (Clontech). Anti-SNX18 antisera were generated by the coding region of FasL do not alter the transcriptional effi- immunizing rabbits with a KLH-conjugated GFKKEYQKVGQSFR peptide (500 lg) in Freund’s Complete Adjuvant and boosting two ciency of FasL with respect to EGFP, but may increase the

Table 1 LC-MSMS proteins ‘‘Hits’’ co-precipitated with human FasLD33 in murine Schwann cells Protein name(s) Band MW Predicted # of Unique Sequence UniProt Matched peptides MW peptides Coverage accession # Fas ligand 35 kDa 37 kDa 5 20% gij2168140 ELAELR, QIGHPSPPPEK, GQSNNLPLSHK, ESTSQMHTASSLEK, MMSYCTTGQMWAR, Protein kinase C and casein 52 kDa 48 kDa 2 4% gij11127644 GPQYGTLEK, TQYEQTLAELNR kinase substrate in neurons 3(PACSIN3);Syndapin 3 Protein kinase C and casein 60 kDa 56 kDa 12 30% gij19483913 EVLLEVQK, AADAVEDLR, GPQYGTVEK, kinase substrate in neurons 2 VSELHLEVK, ASLMNEDFEK, (PACSIN2); Syndapin 2 ADPSLNPEQLK, HLDLSNVASYK, AWIAVMSEAER, IEDEDEQGWK, LGDLMNLHER, ALYDYEGQEHDELSFK, ANHGPGMAMNWPQFE- EWSADLNR Sorting nexin associated 71 kDa 68 kDa 9 18% gij26342577 ALYDFK, SDLSLGSR, FEEDFISK, golgi protein 1; SENPGEISLR, GLFPASYVQVIR, Sorting Nexin 18 APEPGPPADGGPGAPAR, SGGEAFVLGEASGFVK, SQMQHFLQQQIIFFQK, KMDDSALQLNHTANEFAR Sorting nexin associated 74 kDa 68 kDa 3 7% gij26342577 GLFPASYVQVIR, golgi protein 1; APEPGPPADGGPGAPAR, Sorting Nexin 18 SGGEAFVLGEASGFVK Beta adaptin subunit 110 kDa 98 kDa 2 5% gij51701351 EYATEVDVDFVR, LASQANIAQVLAELK 4458 P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462

Fig. 1. FasL deletion mutants are expressed more efficiently than wild-type FasL. (A) The Schwann cell line used in our proteomic screen expresses GFAP and S100, but not Thy1.2, as detected by flow cytometry. Dotted lines show background control staining and solid lines represent staining for GFAP, S100, or Thy1.2. (B) The 80 amino acid FasL intracellular domain is shown in biochemical single letter code. Sites of truncation for FasL constructs (D33, D70), the proline rich region, and casein kinase phosphorylation consensus are indicated. (C) Stably transfected Schwann cell clones expressing bicistronic wild-type (Wt) or truncated FasL-IRES-EGFP constructs were analysed for expression of FasL. FasL and EGFP mRNA, as well as 18S rRNA, were amplified by RT-PCR to examine the relative expression of FasL and EGFP message. Densitometric values were normalized to 18S rRNA to control for loading differences. Graphs show the ratios of FasL to EGFP mRNA for each construct. (D) Lysates from Schwann cells expressing Wt and truncated FasL were simultaneously immunoblotted for FasL and EGFP. Graphs show the densitometric ratios of FasL to EGFP protein expression for each construct. Blots and ratios are representative of multiple Schwann cell clones expressing each construct.

translational efficiency or stability of the protein in Schwann and 110 kDa were uniquely present or greatly increased in cells. Previous reports have documented increased translation anti-FLAG IPs versus control IgG IPs (Fig. 2). Using LC- and decreased cytotoxicity of FasL constructs after deletion MSMS, we identified these proteins as FasL, Protein Kinase of the intracellular region of FasL [16,17]. It is therefore C and casein kinase substrate in Neurons 2 (PACSIN2; Synda- possible that the dramatically greater expression of the FasL pin2), PACSIN3/Syndapin3, Sorting Nexin Associated Golgi deletion mutants compared to the wtFasL protein may be protein 1 (SNAG1; Sorting Nexin 18; SNX18 – present in attributed to increased translational efficiency and/or de- two bands at 71 and 74 kDa), and adaptin b, respectively (Ta- creased cytotoxicity of the truncated forms of FasL. ble 1). Of the proteins identified, the SH3 domain-containing adaptor proteins PACSIN2 and 3 have been previously reported to interact with the proline rich region of FasL in T 3.2. Screen for FasL interacting proteins in Schwann cells cells, validating our screen and suggesting that these two inter- We used Schwann cells expressing FasLD2–33 for our screen actions are conserved in multiple cell types [6]. due to the poor expression of wtFasL (Fig. 1D), and because previous screens in T cells did not detect proteins able to interact with GST-FasL2–29 [6]. We employed a co-immunoprecip- 3.3. Validation of FasL interaction with adaptin b itation (co-IP) approach to identify FasL interacting proteins We proceeded to validate the novel interactions detected in in lysates from Schwann cells expressing FLAG-tagged our screen by immunoblotting FasL IPs prepared from FasLD2–33. When IPs were run on gel and stained with colloi- Schwann cells stably expressing FasLD2–33 and FasLD2–70. dal Coomassie, six bands at approximately 37, 52, 60, 71, 74 Antibodies to adaptin b detected a band at approximately P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462 4459

Fig. 2. Six bands are speciﬁcally co-immunoprecipitated by FLAG antibodies in FasLD2–33-FLAG transfected Schwann cells FLAG- tagged human FasLD2–33 was immunoprecipitated from stably transfected Schwann cells using antibodies to FLAG, run on 4–20% gradient SDS–PAGE, and stained with colloidal Coomassie Blue. Six bands at 37, 52, 60, 71, 74 and 110 kDa were uniquely present or greatly increased in anti-FLAG IPs versus control IgG IPs (arrows). These bands and the corresponding gel regions from the control IPs were excised for identiﬁcation using LC-MSMS.

Fig. 3. Adaptin b co-precipitates with FasL. (A) Lysates from Schwann cells expressing FasLD2–33 or FasLD2–70 were immuno- 100 kDa co-precipitating with both FasL deletion mutants precipitated using control or FLAG antibodies and subjected to (Fig. 3A), indicating that the proline rich region of FasL was immunoblotting for FasL and adaptin b. Co-precipitation of adaptin b not necessary for this interaction. Unsurprisingly, adaptin b with both FasLD2–33 and FasLD2–70 indicates that the FasL proline contains no proline binding motifs, although it contains an rich region is not necessary for this interaction. (B) Lysates from Schwann cells expressing FasLD2–33 or FasLD2–70 were immuno- appendage domain that interacts directly with clathrin precipitated as above and blotted for adaptin a or adaptin c. Bands in vitro [18]. b adaptins make up one of the two large subunits present in the lysate lanes indicate appropriate recognition of the present in each of the heterotetrameric adaptor protein (AP) respective proteins in the immunoblot, although co-precipitation with complexes that bind ‘cargo’ proteins and facilitate the forma- FasL was not detected. (C) Lysates from Schwann cells transiently tion of clathrin coated vesicles [19]. Each of these heterotetra- transfected with Wt FasL-FLAG were immunoprecipitated using control or FLAG antibodies. Adaptin b was enriched in the FLAG co- meric AP complexes possesses a unique subunit composition: IP despite extremely low expression levels of Wt FasL. b1 is present with c adaptin in the AP-1 complex, and b2 with a adaptin in the AP-2 complex. We sought to distinguish which AP complex bound to FasL using antibodies to these unique subunits. Although appropriate bands were observed teins to cellular membranes. SNX18 contains an amino termi- in cell lysates with antibodies to c and a adaptins, no corre- nal SH3 domain, a PX domain, and a carboxyl terminal coiled sponding bands were detected in control or FasL IPs coil (CC) domain. As no antisera to SNX18 were available to (Fig. 3B). To ensure that the interaction of FasL with adaptin validate the interaction with FasL, we immunized rabbits with b was legitimate and not an artifact due to FasL truncation, we SNX18-derived peptides conjugated to Keyhole Limpet transiently transfected mouse Schwann cells with wild-type Hemocyanin. The resulting antisera reproducibly recognized FasL-FLAG and immunoblotted the co-IP products for b a protein band of approximately 50 kDa and multiple bands adaptin (Fig. 3C). Although wild-type FasL is very poorly of 68–74 kDa in Schwann cells (Fig. 4) and mouse tissues (data expressed even during transient transfections, we observed a not shown). In agreement with our mass spectrometric data specific enrichment of b adaptin in co-IPs performed with (Table 1), an antisera-reactive band of approximately 74 kDa anti-FLAG compared with isotype control antibodies. co-precipitated with FasLD2–33, but not with FasLD2–70. An additional band at approximately 50 kD, not detected in 3.4. Validation of FasL interaction with SNX18 our screen, also co-precipitated specifically with FasLD2–33. Sorting Nexins are a family of 30 proteins involved in endo- The inability of FasLD2–70 to co-precipitate significant cytosis and protein trafficking. This protein family is character- amounts of either band suggests that the binding of SNX18 ized by the presence of a Phox (PX) domain, which binds to FasL requires an intact proline rich region, and may there- various phosphatidylinositol phosphates, targeting the pro- fore be mediated by the SH3 domain of SNX18. 4460 P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462

immunoblotted the co-IP products for SNX18. Although wild-type FasL is expressed far less efficiently than FasLD2– 33 (Fig. 1D), we confirmed the interaction of wild-type FasL with the 50 kDa isoform of SNX18 (Fig. 4B). The 74 kDa band could not be detected here, possibly because it is expressed at lower levels than the 50 kDa SNX18-reactive band. Our results suggest that the proline-rich domain of FasL interacts directly with the SH3 domain of SNX18, and confirm that SNX18 can associate with wild-type FasL, as well as with FasLD2–33.

4. Discussion Fig. 4. SNX18 co-precipitates with FasL. Lysates from Schwann cells expressing FasLD2–33 or FasLD2–70 were immunoprecipitated using control or FLAG antibodies and subjected to immunoblotting with In this report, we present the first investigation of FasL antibodies to FasL and antiserum to SNX18. Bands at 74 and 50 kDa interacting proteins in cells of the nervous system. Our screen (arrows) co-precipitated with FasLD2–33, but not with FasLD2-70, identified four FasL interacting proteins, two previously suggesting that the proline rich region of FasL is necessary for this interaction. reported in T cells, PACSIN 2 and 3, and two novel FasL interactors, SNX18 and adaptin b. SNX18 represents a novel FasL interacting protein in Schw- 3.5. Peptides from FasLD2–33 interact with the SH3 domain of ann cells. Our antisera reacted with multiple bands present at SNX18 68–74 kDa as well as with a 50 kDa band, of which the bands To determine whether FasL could interact directly with the at 74 and 50 kDa co-precipitated with FasL (Figs. 4 and 5). SH3 domain of SNX18, we investigated whether peptides cor- SNX18 is phosphorylated on serine and tyrosine residues responding to FasL 1–12, 18–29, 33–44, 61–72, and 130–141 downstream of multiple receptor tyrosine kinases (JBC, could bind to an SNX18-SH3 construct fused to GST. We unpublished data), and these bands may correspond to differ- found that FasL 33–44 and 61–72 specifically bound SNX18- entially phosphorylated isoforms of SNX18. In support of this SH3-GST (Fig. 5A). These peptides both contain portions of hypothesis, phosphorylation of SNX9, the most closely related the FasL proline-rich domain, which supports a direct associ- member of the sorting nexin family, alters the cellular target of ation between the FasL proline-rich domain and the SH3 its SH3 domain in vitro [20]. Our results suggest that SNX18 domain of SNX18. In contrast, peptide 130–141 did not bind associates directly with the proline-rich domain of FasL via SNX18-SH3, consistent with the lack of specific binding of its SH3 domain. FasLD2–70 to SNX18 (Fig. 4). Finally, peptides 1–12 and Although there are to date no published data on the cellular 18–29, which were absent in the truncated FasLD2–33, also functions of SNX18, insights into the potential consequences showed no specific binding to SNX18-GST. To confirm that of its association with FasL can be gleaned by comparison wild-type FasL could interact with SNX18, we transiently with its closest homologue, SNX9. The domain architectures transfected Schwann cells with wild-type FasL-FLAG, and of SNX9 and SNX18 are identical, and the molecules are

Fig. 5. Peptides from the FasL proline-rich domain interact with the SNX18-SH3 domain. (A) Peptides corresponding to FasL 1–12, 18–29, 33–44, 61–72, and 130–141 were spotted onto an array and incubated with the SNX18 SH3 domain fused to GST (GST-SNX18SH3). Only peptides derived from the FasL proline rich region interacted with the SNX18 SH3 domain. (B) Lysates from Schwann cells transiently transfected with wild-type (wt) human FasL-FLAG were immunoprecipitated using control IgG or FLAG antibodies and subjected to immunoblotting with antibodies to FasL and antiserum to SNX18. The band corresponding to the 50 kDa isoform of SNX18 co-precipitated with wt FasL (bottom arrow). Although the band at 74 kDa (top arrow) is undetectable in this co-IP, this may be due to the extremely low expression levels of wt FasL, also undetectable in the lysate lane. P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462 4461

35% homologous at the amino acid level. SNX9 was originally line rich domain [10,32]. The presence of multiple FasL inter- identified as an interactor with two members of the A Disinte- acting proteins in T cells, as well as in Schwann cells, with roles grin And Metalloprotease (ADAM) family, ADAMs 9 and 15 in regulating its localization highlight the need for tight regu- [21]. Interestingly, ADAM family members are the proteases lation of the effector and reverse signaling activities of FasL. that mediate shedding of the FasL extracellular domain from This stringent regulation of FasL surface expression makes the cell surface to generate soluble FasL (sFasL) [22]. intuitive sense, given its role in apoptotic signaling. FasL re- SNX18 associated with FasL may therefore recruit ADAMs verse signaling, by contrast, is often cited as weak or modest. to FasL, promoting FasL shedding from the membrane. Fur- Our screen may have missed potential reverse signaling effec- thermore, SNX9, as well as SNX18, associate with the Ras tors due to the deletion of FasL amino acids 2–33; however, activating protein SOS [23], potentially linking FasL to the a previous report failed to identify binding partners for ERK signaling pathway and providing a mechanism for FasL GST-FasL2-29 [6]. Our screen may also have overlooked po- reverse signaling via ERK. As in T cells, we also observe ERK tential human-specific FasL interacting proteins, as we overex- activation in Schwann cells upon stimulation of FasL with pressed human FasL in murine Schwann cells. However, the agonistic antibodies or Fas fusion proteins (PBT, unpublished intracellular region of FasL is highly conserved across species, data), suggesting that this pathway is conserved across cell minimizing this possibility. Our findings suggest that the types. Finally, SNX9 also associates with the b2 adaptin sub- downstream molecular mediators of reverse signaling are not unit of the AP-2 complex [24], stimulates the budding step of constitutively associated with FasL, but likely are recruited endocytosis via activation of the GTPase activity of dynamin upon interaction with Fas. Interestingly, molecules primarily [25], and participates in the activation-dependent degradation implicated in trafficking may also recruit signaling molecules of the epidermal growth factor receptor [26]. Therefore, it is to the FasL complex, and therefore serve as upstream adaptor interesting to hypothesize that SNX18 may participate in the proteins for reverse signaling. This may be the case for SNX18, downregulation of cell surface FasL either by facilitating its which could regulate FasL trafficking and also participate in internalization, or by promoting extracellular domain shed- signaling by recruiting SOS to the complex upon Fas binding, ding of the protein. thereby activating the canonical ERK pathway. Our screen also identified b adaptin as a novel FasL interact- In summary, our screen for FasL interacting proteins within ing protein. We detected b adaptin associated with wild-type Schwann cells has identified two novel proteins, and confirmed FasL, FasLD2–33, and FasLD2–70 in Schwann cells (Fig. 3). two known FasL interactors, all with potential functions in Our data indicate that the 10 amino acids in the cytoplasmic regulating trafficking and subcellular localization. Identifica- tail of FasL that are still present in FasLD2–70 are sufficient tion of these novel FasL interactors provides insight into to mediate the interaction between FasL and b adaptin, and potential molecular mechanisms underlying this stringent reg- thus suggest a different mode of association for the FasL–b ulation of cell surface FasL. In particular, our findings suggest adaptin interaction than for the FasL–SNX18 interaction. that multiple FasL interacting proteins, including the FasL does not contain YXXU or dileucine sorting signals PACSINs and SNX18, could link the export pathways of FasL known to bind to the adaptor protein complexes, suggesting directly to its cleavage by ADAMs at the cell surface. that FasL may associate with b adaptin via a novel interaction domain or indirectly via a third protein. The association of Acknowledgements: This work was supported by Grant 53337 to J.D. FasL with b adaptin, whether direct or indirect, may be an from the Canadian Institute of Health Research (CIHR). PBT was supported by a fellowship from the National Science and Engineering important regulator of the surface expression of the protein Research Council of Canada, J.B.C. by a CIHR Doctoral Fellowship and hence control both FasL forward (via Fas) and reverse sig- and J.D. by a CIHR New Investigator award. The authors would like naling. to thank Dr. P. McPherson for adaptin antibodies and the proteomic Our screen further identified the PACSIN proteins 2 and 3 platform at the Institute for Research in Immunology and Cancer, led by Dr. P. Thibault, for their assistance with mass spectrometry. We as FasL interacting proteins in Schwann cells, confirming pre- thank Dr. K. Dejgaard for his help and expertise in interpreting mass vious findings in T cells and suggesting that these interactions spectrometry data, as well as N. Warner for assistance with the Multi- are conserved in multiple cell types. The three known PACSIN pep peptide spots array synthesis and Dr. T. Pawson for the use of his proteins all contain an SH3 domain and a coiled coil domain, Multipep peptide synthesizer. and are highly implicated in endocytosis. By binding the Wiskott Aldrich syndrome protein (WASP), a potent activator of actin nucleation, and the GTPase dynamin, they are References thought to link endocytosis to the actin cytoskeleton [27]. Based on colocalization data, these proteins may also partici- [1] Griffith, T.S., Brunner, T., Fletcher, S.M., Green, D.R. and Ferguson, T.A. (1995) Fas ligand-induced apoptosis as a mech- pate in the lysosomal localization of FasL [28]. Similar to anism of immune privilege. Science 270, 1189–1192. the Sorting Nexins, PACSIN proteins also bind to members [2] Newell, M.K. and Desbarats, J. (1999) Fas ligand: receptor or of the ADAM metalloprotease family and regulate ectodo- ligand? Apoptosis 4, 311–315. main shedding of the pro-heparin binding EGF-like growth [3] Nagata, S. and Golstein, P. (1995) The Fas death factor. Science 267, 1449–1456. factor [29]. [4] Krammer, P.H. (2000) CD95’s deadly mission in the immune Several previous studies have used GST pulldowns to exam- system. Nature 407, 789–795. ine FasL protein interactions in T cells [6,7]. Most of the FasL [5] Eissner, G., Kolch, W. and Scheurich, P. (2004) Ligands working interacting proteins identified appeared to attenuate the cell as receptors: reverse signaling by members of the TNF superfam- surface expression of FasL and/or alter its subcellular localiza- ily enhance the plasticity of the immune system. Cytokine Growth Factor Rev. 15, 353–366. tion [28,30–32], rather than participate in FasL reverse signal- [6] Ghadimi, M.P. et al. (2002) Identification of interaction partners ing. This is consistent with reports documenting increased of the cytosolic polyproline region of CD95 ligand (CD178). expression of FasL at the cell surface upon deletion of its pro- FEBS Lett. 519, 50–58. 4462 P.B. Thornhill et al. / FEBS Letters 581 (2007) 4455–4462

[7] Wenzel, J. et al. (2001) Multiple interactions of the cytosolic substrate, the sorting nexin DSH3PX1, to a protein complex polyproline region of the CD95 ligand: hints for the reverse signal involved in axonal guidance. J. Biol. Chem. 277, 9422–9428. transduction capacity of a death factor. FEBS Lett. 509, 255–262. [21] Howard, L., Nelson, K.K., Maciewicz, R.A. and Blobel, C.P. [8] Ulisse, S., Cinque, B., Silvano, G., Rucci, N., Biordi, L., Cifone, (1999) Interaction of the metalloprotease disintegrins MDC9 and M.G. and D’armiento, M. (2000) Erk-dependent cytosolic phos- MDC15 with two SH3 domain-containing proteins, endophilin I pholipase A2 activity is induced by CD95 ligand cross-linking in and SH3PX1. J. Biol. Chem. 274, 31693–31699. the mouse derived Sertoli cell line TM4 and is required to trigger [22] Schulte, M. et al. (2007) ADAM10 regulates FasL cell surface apoptosis in CD95 bearing cells. Cell Death Differ. 7, 916–924. expression and modulates FasL-induced cytotoxicity and activa- [9] Sun, M., Ames, K.T., Suzuki, I. and Fink, P.J. (2006) The tion-induced cell death. Cell Death Differ. 14, 1040–1049. cytoplasmic domain of Fas ligand costimulates TCR signals. J. [23] Schulze, W.X. and Mann, M. (2004) A novel proteomic screen for Immunol. 177, 1481–1491. peptide–protein interactions. J. Biol. Chem. 279, 10756–10764. [10] Blott, E.J., Bossi, G., Clark, R., Zvelebil, M. and Griffiths, G.M. [24] Lundmark, R. and Carlsson, S.R. (2002) The beta-appendages of (2001) Fas ligand is targeted to secretory lysosomes via a proline- the four adaptor-protein (AP) complexes: structure and binding rich domain in its cytoplasmic tail. J. Cell Sci. 114, 2405–2416. properties, and identification of sorting nexin 9 as an accessory [11] Watts, A.D., Hunt, N.H., Wanigasekara, Y., Bloomfield, G., protein to AP-2. Biochem. J. 362, 597–607. Wallach, D., Roufogalis, B.D. and Chaudhri, G. (1999) A casein [25] Soulet, F., Yarar, D., Leonard, M. and Schmid, S.L. (2005) SNX9 kinase I motif present in the cytoplasmic domain of members of regulates dynamin assembly and is required for efficient clathrin- the tumour necrosis factor ligand family is implicated in ’reverse mediated endocytosis. Mol. Biol. Cell 16, 2058–2067. signalling’. EMBO J. 18, 2119–2126. [26] Lin, Q., Lo, C.G., Cerione, R.A. and Yang, W. (2002) The Cdc42 [12] Choi, C. and Benveniste, E.N. (2004) Fas ligand/Fas system in the target ACK2 interacts with sorting nexin 9 (SH3PX1) to regulate brain: regulator of immune and apoptotic responses. Brain Res. epidermal growth factor receptor degradation. J. Biol. Chem. 277, Rev. 44, 65–81. 10134–10138. [13] Lambert, C., Landau, A.M. and Desbarats, J. (2003) Fas – [27] Kessels, M.M. and Qualmann, B. (2004) The syndapin protein beyond death: a regenerative role for Fas in the nervous system. family: linking membrane trafficking with the cytoskeleton. J. Cell Apoptosis 8, 551–562. Sci. 117, 3077–3086. [14] Desbarats, J., Birge, R.B., Mimouni-Rongy, M., Weinstein, D.E., [28] Qian, J., Chen, W., Lettau, M., Podda, G., Zornig, M., Kabelitz, Palerme, J.S. and Newell, M.K. (2003) Fas engagement induces D. and Janssen, O. (2006) Regulation of FasL expression: a SH3 neurite growth through ERK activation and p35 upregulation. domain containing protein family involved in the lysosomal Nat. Cell Biol. 5, 118–125. association of FasL. Cell Signal. 18, 1327–1337. [15] Frank, R. (2002) The SPOT-synthesis technique. Synthetic [29] Mori, S., Tanaka, M., Nanba, D., Nishiwaki, E., Ishiguro, H., peptide arrays on membrane supports–principles and applica- Higashiyama, S. and Matsuura, N. (2003) PACSIN3 binds tions. J. Immunol. Methods 267, 13–26. ADAM12/meltrin alpha and up-regulates ectodomain shedding [16] Jodo, S., Pidiyar, V.J., Xiao, S., Furusaki, A., Sharma, R., Koike, of heparin-binding epidermal growth factor-like growth factor. J. T. and Ju, S.T. (2005) Fas ligand (CD178) cytoplasmic tail is a Biol. Chem. 278, 46029–46034. positive regulator of Fas ligand-mediated cytotoxicity. J. Immu- [30] Baum, W., Kirkin, V., Fernandez, S.B., Pick, R., Lettau, M., nol. 174, 4470–4474. Janssen, O. and Zornig, M. (2005) Binding of the intracellular Fas [17] Xiao, S., Deshmukh, U.S., Jodo, S., Koike, T., Sharma, R., ligand (FasL) domain to the adaptor protein PSTPIP results in a Furusaki, A., Sung, S.S. and Ju, S.T. (2004) Novel negative cytoplasmic localization of FasL. J. Biol. Chem. 280, 40012– regulator of expression in Fas ligand (CD178) cytoplasmic tail: 40024. evidence for translational regulation and against Fas ligand [31] Lettau, M., Qian, J., Linkermann, A., Latreille, M., Larose, L., retention in secretory lysosomes. J. Immunol. 173, 5095–5102. Kabelitz, D. and Janssen, O. (2006) The adaptor protein Nck [18] Owen, D.J., Vallis, Y., Pearse, B.M., Mcmahon, H.T. and Evans, interacts with Fas ligand: Guiding the death factor to the P.R. (2000) The structure and function of the beta 2-adaptin cytotoxic immunological synapse. Proc. Natl. Acad. Sci. USA appendage domain. EMBO J. 19, 4216–4227. 103, 5911–5916. [19] Kirchhausen, T. (2002) Clathrin adaptors really adapt. Cell 109, [32] Zuccato, E., Blott, E.J., Holt, O., Sigismund, S., Shaw, M., Bossi, 413–416. G. and Griffiths, G.M. (2007) Sorting of Fas ligand to secretory [20] Worby, C.A., Simonson-Leff, N., Clemens, J.C., Huddler Jr., D., lysosomes is regulated by mono-ubiquitylation and phosphoryl- Muda, M. and Dixon, J.E. (2002) Drosophila Ack targets its ation. J. Cell Sci. 120, 191–199.