DOCSLIB.ORG

Apocarotenoids Produced from Β−Carotene by Dioxygenases from Mucor Circinelloides

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Apocarotenoids Produced from Β−Carotene by Dioxygenases from Mucor Circinelloides Apocarotenoids produced from β-carotene by dioxygenases from Mucor circinelloides Item Type Article Authors Alcalde, Eugenio; Cerdá-Olmedo, Enrique; Al-Babili, Salim Citation Alcalde E, Cerdá-Olmedo E, Al-Babili S (2019) Apocarotenoids produced from β-carotene by dioxygenases from Mucor circinelloides. Microbiology. Available: http://dx.doi.org/10.1099/ mic.0.000762. DOI 10.1099/mic.0.000762 Publisher Microbiology Society Journal Microbiology Download date 29/09/2021 20:36:43 Link to Item http://hdl.handle.net/10754/631242 1 Title: Apocarotenoids produced from β−carotene by dioxygenases from Mucor circinelloides 2 Running title: Apocarotenoid formation in Mucor circinelloides. 3 Eugenio Alcaldea, Enrique Cerdá-Olmedob, and Salim Al-Babilic, d* 4 a School of Biological Sciences, Royal Holloway, University of London, Egham Hill, Egham, Surrey TW20OEX, 5 UK. 6 b Departamento de Genética, Universidad de Sevilla, Apartado 1095, E-41080 Sevilla, Spain. 7 c King Abdullah University of Science and Technology (KAUST), Biological and Environmental Sciences and 8 Engineering Division, the BioActives lab, Thuwal 23955-6900, Kingdom of Saudi Arabia. 9 d Faculty of Biology, University of Freiburg, Schaenzlestr. 1, 79104 Freiburg, Germany. 10 11 12 E-mail addresses: [email protected], [email protected], [email protected] 13 14 *Corresponding author. 15 16 Abstract 17 18 Mucor circinelloides exhibits the complex sexual behaviour that is induced in other Mucoromycotina by a family 19 of apocarotenoids called trisporoids. The genome of M. circinelloides contains four genes encoding putative 20 carotenoid cleavage dioxygenases. The gene products of two of them were sufficient to convert β-carotene into 21 the precursors of three families of apocarotenoids, both in vitro and in the Escherichia coli heterologous in vivo 22 system. The first one, CarS, cleaved the C40 β-carotene into the C15 precursor of cyclofarnesoids and a C25 23 apocarotenal that was converted by the second enzyme, AcaA, into the C18-precursor of trisporoids and the C7 24 precursor of methylhexanoids. Apocarotenoids were not found in single or mixed cultures of the two strains of 25 opposite sex, whose interaction readily produced zygospores, the sexual fusion cells. 26 27 28 Abbreviations 29 Carotenoid cleavage dioxygenase: CCD 30 —————————— 31 32 Mucor [1] is a large and diverse genus of fungi, the epitome of the Mucorales [2]. M. circinelloides [3], a 33 saprophyte and an opportunistic pathogen, is a convenient laboratory organism with excellent tools for molecular 34 genetics [4], including effective DNA transformation [5–7], gene replacement [8], and gene silencing pathways 35 [9, 10]. Hyphae of opposite sex, (+) and (–), react to the vicinity of each other with complex changes that include 36 cellular differentiation and increased accumulation of β-carotene and culminate in the production of fusion cells, 37 the zygospores. These have not been seen to germinate, so that no sexual cycle is available for research [11]. 38 The sexual interaction in the Mucorales was the first known case of pheromone-mediated signalling [12]. 39 These pheromones derive from β-carotene [13, 14] and a group of apocarotenoids, known as trisporoids, which 40 sexually stimulate single cultures [15–19]. Phycomyces blakesleeanus, another species of the Mucorales, contains 41 three families of apocarotenoids, the C18/C19 trisporoids, the C15 cyclofarnesoids, and the C7 methylhexanoids [20– Alcalde et al 1 1 22]. In this fungus, C40 β-carotene is cleaved sequentially (Fig. 1) into the three precursors of these families by 2 the dioxygenases CarS and AcaA [23, 24]. This cleavage scheme has been extended to the Mucorales Blakeslea 3 trispora and Mucor mucedo [19, 25]. CarS and AcaA are members of a large group of non-heme iron enzymes, 4 the carotenoid cleavage dioxygenases (CCDs), which cut double bonds in carbon chains of carotenes and other 5 substrates in most organisms [26, 27]. 6 The genome of M. circinelloides strain CBS277.49 [28] contains four sequences similar to the 7 Phycomyces genes carS and acaA [23]. Two of them, 146755 and 141273, could encode proteins designated CarS 8 and AcaA, respectively. The amino acid positions of their sequences proved to be identical with those of their 9 Phycomyces orthologues in 72% and 45%, respectively.; they contain the conserved histidine and glutamate or 10 aspartate residues that are required for the enzymatic catalysis [29, 30]; and they resemble carotene-cleaving 11 dioxygenases from a cyanobacterium, a plant, an ascomycete and a mammal, particularly in their terminal regions 12 (Fig. 2). To date no further indications about the functions of the two remaining putative proteins, 114475 and 13 189974, can be made, which contain only two of the four conserved histidine residues. 14 We tested the activity of the encoded proteins by heterologous expression in transgenic Escherichia coli 15 strains that produce β-carotene [31], lycopene [32], or zeaxanthin [33]. For this purpose, we amplified the 16 corresponding cDNAs from total cDNA synthesized using the Superscript III First Strand System for RT-PCR 17 (Invitrogen, Paisley, UK) from total mRNA that was extracted following the protocol of Rodríguez-Romero and 18 Corrochano [34] from two days-old mycelia. For amplification, we used the Expand High Fidelity polymerase 19 (Roche) and the primers carS-F: 5’−CATGATCACTCCCGCTGAAG−3’, carS-R: 5’− 20 TTAATTGACGGCAATGCCTC −3’, acaA-F: 5’− CAAGATGATTGTAGGATTGCTTAC −3’, acaA-R: 5’− 21 CATTTTAATTGATATTGATAGAC −3’, 114475-F: 5’− CATGTCTGATTTGAACAAGGTC −3’, and 22 114475-R: 5’− CTCTAGTTTTCTCGAAGTCG. Amplified fragments were ligated into pGEM−T Easy 23 (Promega), using the T4 DNA ligase (Promega). cDNAs were then re-amplified and inserted into 24 pBAD−Thio−Topo (Invitrogen) that leads to fusion proteins with thioredoxin. The integrity of cloned cDNAs was 25 verified by sequencing. Carotenoid-accumulating E. coli cultures transformed with the obtained plasmids were 26 induced and analyzed by HPLC, following the method described by Medina et al. [23]. Lycopene and -carotene 27 were purchased from Sigma-Aldrich. Zeaxanthin was purified from Synechocystis sp. PCC 6803, according to 28 [35]. Apocarotenoids were kindly provided by the BASF (Ludwigshafen, Germany).The thioredoxin-CarS fusion 29 decolorized the yellow β-carotene-producing cultures and made them accumulate β-apo-12’-carotenal, confirmed 30 by comparison with an authentic standard (Fig. 3 A, D). No activity was detected when the same thioredoxin- 31 CarS fusion was expressed in cells that produced lycopene or zeaxanthin, suggesting specificity for β-carotene. 32 The thioredoxin-AcaA and thioredoxin-114475 fusions did not affect the E. coli cultures accumulating any of the 33 carotenoids tested. 34 The activity of the enzymes was investigated in vitro by incubating cell-free extracts of E. coli BL21 35 cells, which produce the corresponding thioredoxin fusions, with different carotenoid substrates, following the 36 protocol described by Medina et al. [23]. The thioredoxin-CarS fusion cleaved β-carotene to β-apo-12’carotenal 37 (Fig. 3 E) that was further converted by the thioredoxin-AcaA fusion into β-apo-13-carotenone, a C18-ketone 38 (Figure 3 B and F). These reactions predicted the formation of a C15 apocarotenal and a C7 dialdehyde as further 39 products of the cleavage of β-carotene and β-apo-12’carotenal, respectively. Specificity was suggested by the 40 negative results: thioredoxin-CarS did not cleave lycopene; thioredoxin-AcaA did neither cleave lycopene nor the 41 long apocarotenoids β-apo-8′- and β-apo-10′- carotenal; zeaxanthin was not cleaved by any of the investigated 42 enzymes. Thioredoxin-114475 gave negative results with all tested substrates. 43 A distinctive and seemingly universal trait of the Mucorales is the cleavage of β-carotene by the CarS 44 and AcaA dioxygenases into three fragments. The main activities of these enzymes are conserved: CarS cleaves 45 β-carotene, but not β-apo-12´-carotenal (C25), and AcaA the other way around. Mucor and Phycomyces differ in 46 the details [23], as expected from the large differences in their morphology and genome sequences [2, 36]: the 47 CarS of M. circinelloides was active in vitro, while the CarS of Phycomyces was not; the AcaA of Phycomyces 48 cleaves the long straight chains of lycopene, β-apo-8′-carotenal (C30) and β-apo-10′-carotenal (C27), while the 49 AcaA of M. circinelloides did not. Similar to the previous report on Phycomyces apocarotenoid synthesis [23], 50 we could not detect the C15 and C7 apocarotenoids expected to be formed by Mucor CarS and Aca, respectively, 51 which can be explained by the instability of the C15 apocarotenal and limitation of our extraction/analysis method 52 in detecting the C7 dialdehyde . Alcalde et al 2 1 In the present study, we could not detect apocarotenoids in mixed cultures of M. circinelloides strains of 2 opposite sex, CBS277.49 (–) and NRRL3631 (+) or in the corresponding single cultures, albeit abundant 3 production of zygophores, the sexual fusion cells, and the usage of the analytical methods that had previously 4 detected apocarotenoids in Phycomyces [21, 22]. If we have not missed the right conditions, the apocarotenoids 5 of M. circinelloides may be present at very low concentrations and be unstable after extraction. The signalling 6 trisporoids could be rare if their receptors are sufficiently sensitive. 7 8 Acknowledgements 9 We thank Prof Paul Fraser for valuable discussions and Dr. Hansgeorg Ernst for providing carotenoid and 10 apocarotenoid substrates and standards This work was supported by Deutsche Forschungsgemeinschaft grant 11 number AL 892/1-4 and by baseline funding given to S-A from the King Abdullah University of Science and 12 Technology (KAUST). 13 14 The authors declare no conflicts of interests. 15 16 References 17 18 1. Michelius PA. Nova Plantarum Genera. Florentia: Typis Bernardi Paperinii; 1729. 19 2. Hoffmann K, Pawłowska J, Walther G, Wrzosek M, de Hoog GS, et al.
Load more

Recommended publications
  • Synthetic Conversion of Leaf Chloroplasts Into Carotenoid-Rich Plastids Reveals Mechanistic Basis of Natural Chromoplast Development
    Synthetic conversion of leaf chloroplasts into carotenoid-rich plastids reveals mechanistic basis of natural chromoplast development Briardo Llorentea,b,c,1, Salvador Torres-Montillaa, Luca Morellia, Igor Florez-Sarasaa, José Tomás Matusa,d, Miguel Ezquerroa, Lucio D’Andreaa,e, Fakhreddine Houhouf, Eszter Majerf, Belén Picóg, Jaime Cebollag, Adrian Troncosoh, Alisdair R. Ferniee, José-Antonio Daròsf, and Manuel Rodriguez-Concepciona,f,1 aCentre for Research in Agricultural Genomics (CRAG) CSIC-IRTA-UAB-UB, Campus UAB Bellaterra, 08193 Barcelona, Spain; bARC Center of Excellence in Synthetic Biology, Department of Molecular Sciences, Macquarie University, Sydney NSW 2109, Australia; cCSIRO Synthetic Biology Future Science Platform, Sydney NSW 2109, Australia; dInstitute for Integrative Systems Biology (I2SysBio), Universitat de Valencia-CSIC, 46908 Paterna, Valencia, Spain; eMax-Planck-Institut für Molekulare Pflanzenphysiologie, 14476 Potsdam-Golm, Germany; fInstituto de Biología Molecular y Celular de Plantas, CSIC-Universitat Politècnica de València, 46022 Valencia, Spain; gInstituto de Conservación y Mejora de la Agrodiversidad, Universitat Politècnica de València, 46022 Valencia, Spain; and hSorbonne Universités, Université de Technologie de Compiègne, Génie Enzymatique et Cellulaire, UMR-CNRS 7025, CS 60319, 60203 Compiègne Cedex, France Edited by Krishna K. Niyogi, University of California, Berkeley, CA, and approved July 29, 2020 (received for review March 9, 2020) Plastids, the defining organelles of plant cells, undergo physiological chromoplasts but into a completely different type of plastids and morphological changes to fulfill distinct biological functions. In named gerontoplasts (1, 2). particular, the differentiation of chloroplasts into chromoplasts The most prominent changes during chloroplast-to-chromo- results in an enhanced storage capacity for carotenoids with indus- plast differentiation are the reorganization of the internal plastid trial and nutritional value such as beta-carotene (provitamin A).
    [Show full text]
  • Novel Carotenoid Cleavage Dioxygenase Catalyzes the First Dedicated Step in Saffron Crocin Biosynthesis
    Novel carotenoid cleavage dioxygenase catalyzes the first dedicated step in saffron crocin biosynthesis Sarah Frusciantea,b, Gianfranco Direttoa, Mark Brunoc, Paola Ferrantea, Marco Pietrellaa, Alfonso Prado-Cabrerod, Angela Rubio-Moragae, Peter Beyerc, Lourdes Gomez-Gomeze, Salim Al-Babilic,d, and Giovanni Giulianoa,1 aItalian National Agency for New Technologies, Energy, and Sustainable Development, Casaccia Research Centre, 00123 Rome, Italy; bSapienza, University of Rome, 00185 Rome, Italy; cFaculty of Biology, University of Freiburg, D-79104 Freiburg, Germany; dCenter for Desert Agriculture, Division of Biological and Environmental Science and Engineering, King Abdullah University of Science and Technology, Thuwal 23955-6900, Saudi Arabia; and eInstituto Botánico, Facultad de Farmacia, Universidad de Castilla–La Mancha, 02071 Albacete, Spain Edited by Rodney B. Croteau, Washington State University, Pullman, WA, and approved July 3, 2014 (received for review March 16, 2014) Crocus sativus stigmas are the source of the saffron spice and responsible for the synthesis of crocins have been characterized accumulate the apocarotenoids crocetin, crocins, picrocrocin, and in saffron and in Gardenia (5, 6). safranal, responsible for its color, taste, and aroma. Through deep Plant CCDs can be classified in five subfamilies according to transcriptome sequencing, we identified a novel dioxygenase, ca- the cleavage position and/or their substrate preference: CCD1, rotenoid cleavage dioxygenase 2 (CCD2), expressed early during CCD4, CCD7, CCD8, and nine-cis-epoxy-carotenoid dioxygen- stigma development and closely related to, but distinct from, the ases (NCEDs) (7–9). NCEDs solely cleave the 11,12 double CCD1 dioxygenase family. CCD2 is the only identified member of bond of 9-cis-epoxycarotenoids to produce the ABA precursor a novel CCD clade, presents the structural features of a bona fide xanthoxin.
    [Show full text]
  • Carotenoids Support Normal Embryonic Development During Vitamin A
    www.nature.com/scientificreports OPEN β-apo-10′-carotenoids support normal embryonic development during vitamin A defciency Received: 29 December 2017 Elizabeth Spiegler1, Youn-Kyung Kim1, Beatrice Hoyos2, Sureshbabu Narayanasamy3,4, Accepted: 24 May 2018 Hongfeng Jiang5, Nicole Savio1, Robert W. Curley Jr.3, Earl H. Harrison4, Ulrich Hammerling1,2 Published: xx xx xxxx & Loredana Quadro 1 Vitamin A defciency is still a public health concern afecting millions of pregnant women and children. Retinoic acid, the active form of vitamin A, is critical for proper mammalian embryonic development. Embryos can generate retinoic acid from maternal circulating β-carotene upon oxidation of retinaldehyde produced via the symmetric cleavage enzyme β-carotene 15,15′-oxygenase (BCO1). Another cleavage enzyme, β-carotene 9′,10′-oxygenase (BCO2), asymmetrically cleaves β-carotene in adult tissues to prevent its mitochondrial toxicity, generating β-apo-10′-carotenal, which can be converted to retinoids (vitamin A and its metabolites) by BCO1. However, the role of BCO2 during mammalian embryogenesis is unknown. We found that mice lacking BCO2 on a vitamin A defciency-susceptible genetic background (Rbp4−/−) generated severely malformed vitamin A-defcient embryos. Maternal β-carotene supplementation impaired fertility and did not restore normal embryonic development in the Bco2−/−Rbp4−/− mice, despite the expression of BCO1. These data demonstrate that BCO2 prevents β-carotene toxicity during embryogenesis under severe vitamin A defciency. In contrast, β-apo-10′-carotenal dose-dependently restored normal embryonic development in Bco2−/−Rbp4−/− but not Bco1−/−Bco2−/−Rbp4−/− mice, suggesting that β-apo-10′-carotenal facilitates embryogenesis as a substrate for BCO1-catalyzed retinoid formation.
    [Show full text]
  • On the Biosynthesis and Evolution of Apocarotenoid Plant Growth Regulators
    On the biosynthesis and evolution of apocarotenoid plant growth regulators. Item Type Article Authors Wang, Jian You; Lin, Pei-Yu; Al-Babili, Salim Citation Wang, J. Y., Lin, P.-Y., & Al-Babili, S. (2020). On the biosynthesis and evolution of apocarotenoid plant growth regulators. Seminars in Cell & Developmental Biology. doi:10.1016/ j.semcdb.2020.07.007 Eprint version Post-print DOI 10.1016/j.semcdb.2020.07.007 Publisher Elsevier BV Journal Seminars in cell & developmental biology Rights NOTICE: this is the author’s version of a work that was accepted for publication in Seminars in cell & developmental biology. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in Seminars in cell & developmental biology, [, , (2020-08-01)] DOI: 10.1016/j.semcdb.2020.07.007 . © 2020. This manuscript version is made available under the CC- BY-NC-ND 4.0 license http://creativecommons.org/licenses/by- nc-nd/4.0/ Download date 27/09/2021 08:08:14 Link to Item http://hdl.handle.net/10754/664532 1 On the Biosynthesis and Evolution of Apocarotenoid Plant Growth Regulators 2 Jian You Wanga,1, Pei-Yu Lina,1 and Salim Al-Babilia,* 3 Affiliations: 4 a The BioActives Lab, Center for Desert Agriculture (CDA), Biological and Environment Science 5 and Engineering (BESE), King Abdullah University of Science and Technology, Thuwal, Saudi 6 Arabia.
    [Show full text]
  • Simultaneous LC/MS Analysis of Carotenoids and Fat-Soluble Vitamins in Costa Rican Avocados (Persea Americana Mill.)
    molecules Article Simultaneous LC/MS Analysis of Carotenoids and Fat-Soluble Vitamins in Costa Rican Avocados (Persea americana Mill.) Carolina Cortés-Herrera 1,*, Andrea Chacón 1, Graciela Artavia 1 and Fabio Granados-Chinchilla 2 1 Centro Nacional de Ciencia y Tecnología de Alimentos, Universidad de Costa Rica, Ciudad Universitaria Rodrigo Facio, 11501-2060 San José, Costa Rica; [email protected] (A.C.); [email protected] (G.A.) 2 Centro de Investigación en Nutrición Animal (CINA), Universidad de Costa Rica, Ciudad Universitaria Rodrigo Facio, 11501-2060 San José, Costa Rica; [email protected] * Correspondence: [email protected]; Tel.: +506-2511-7226 Academic Editor: Severina Pacifico Received: 26 August 2019; Accepted: 5 October 2019; Published: 10 December 2019 Abstract: Avocado (a fruit that represents a billion-dollar industry) has become a relevant crop in global trade. The benefits of eating avocados have also been thoroughly described as they contain important nutrients needed to ensure biological functions. For example, avocados contain considerable amounts of vitamins and other phytonutrients, such as carotenoids (e.g., β-carotene), which are fat-soluble. Hence, there is a need to assess accurately these types of compounds. Herein we describe a method that chromatographically separates commercial standard solutions containing both fat-soluble vitamins (vitamin A acetate and palmitate, Vitamin D2 and D3, vitamin K1, α-, δ-, and γ-vitamin E isomers) and carotenoids (β-cryptoxanthin, zeaxanthin, lutein, β-carotene, and lycopene) effectively (i.e., analytical recoveries ranging from 80.43% to 117.02%, for vitamins, and from 43.80% 1 to 108.63%).
    [Show full text]
  • Apocarotenoids: a Brief Review
    International Journal of Research and Review Vol.7; Issue: 12; December 2020 Website: www.ijrrjournal.com Review Article E-ISSN: 2349-9788; P-ISSN: 2454-2237 Apocarotenoids: A Brief Review Seba M C, Anatt Treesa Mathew, Sheeja Rekha, Prasobh G R Department of Pharmaceutical Chemistry, Sree Krishna College of Pharmacy and Research Centre, Parassala, Kerala Corresponding Author: Seba M C ABSTRACT The development of apocarotenoids is started by oxidative cleavage reactions Carotenoids are broad group of natural that can be catalyzed by enzymes, generally pigments, extending from red to orange, to CCDs, or take place via exposure of yellow colours. Produced by plants and certain carotenoids to ROS. β-Cyclocitral is an microorganisms (e.g.: fungi, bacteria and example for a carotenoid cleavage product microalgae), carotenoids have significant physiological function (e.g.: light harvesting). that can be produced following both Apocarotenoids are organic compounds, which scenarios. The formation of this β-carotene– is cleavage products of C40 isoprenoid derived volatile in photosynthetic tissues is 1 pigments, named carotenoids, catalyzed by initiated by a singlet oxygen O2 attack, enzyme carotenoid oxygenase, produced which takes place in the photosystem II, absolutely by plants and microorganisms. particularly in the presence of high light Apocarotenoids show vital roles in several stress, while in citrus fruits, it is catalyzed biological activities (e.g., plant hormones). by a CCD (CCD4b) that cleaves β-carotene, Various carotenoids and apocarotenoids have β-cryptoxanthin, and zeaxanthin. Although great economic significance in feed, cosmetics, some CCDs display a quite relaxed substrate food supplements, pharmaceutical industries and and site (double bond) specificity , cleavage also possess high commercial values Key Words: Carotenoids, Apocarotenoids, reactions catalyzed by these enzymes Carotenoid oxygenase generally take place at definite double bond(s) in defined carotenoid/apocarotenoid INTRODUCTION substrate(s).
    [Show full text]
  • Periodic Root Branching in Arabidopsis Requires Synthesis of An
    Periodic root branching in Arabidopsis requires PNAS PLUS synthesis of an uncharacterized carotenoid derivative Jaimie M. Van Normana, Jingyuan Zhanga, Christopher I. Cazzonellib, Barry J. Pogsonb, Peter J. Harrisonc, Timothy D. H. Buggc, Kai Xun Chanb, Andrew J. Thompsond, and Philip N. Benfeya,e,1 aDepartment of Biology, Duke Center for Systems Biology and eHoward Hughes Medical Institute, Duke University, Durham, NC 27708; bAustralian Research Council Centre of Excellence in Plant Energy Biology, Research School of Biology, The Australian National University, Canberra, ACT 0200, Australia; cDepartment of Chemistry, University of Warwick, Coventry CV4 7AL, United Kingdom; and dCranfield Soil and Agri-Food Institute, Cranfield University, Cranfield, Bedfordshire MK43 0AL, United Kingdom Contributed by Philip N. Benfey, February 24, 2014 (sent for review January 5, 2014) In plants, continuous formation of lateral roots (LRs) facilitates the primary root tip but remains confined within the primary efficient exploration of the soil environment. Roots can maximize root. The primordium is considered to be an LR only after it has developmental capacity in variable environmental conditions emerged from the primary root and cell division is activated at its through establishment of sites competent to form LRs. This LR apex (8). Developmental progression of individual LRPs is sen- prepattern is established by a periodic oscillation in gene expres- sitive to a vast range of developmental and environmental cues sion near the root tip. The spatial distribution of competent (reviewed in ref. 10), which, ultimately, allows for plasticity in (prebranch) sites results from the interplay between this periodic root system architecture in variable subterranean environments. process and primary root growth; yet, much about this oscillatory In the root’s radial axis, LRs form strictly from a subset of process and the formation of prebranch sites remains unknown.
    [Show full text]
  • Carotenoid Cleavage Oxygenases from Microbes and Photosynthetic Organisms: Features and Functions
    International Journal of Molecular Sciences Review Carotenoid Cleavage Oxygenases from Microbes and Photosynthetic Organisms: Features and Functions Oussama Ahrazem 1, Lourdes Gómez-Gómez 1, María J. Rodrigo 2, Javier Avalos 3 and María Carmen Limón 3,* 1 Instituto Botánico, Departamento de Ciencia y Tecnología Agroforestal y Genética, Facultad de Farmacia, Universidad de Castilla-La Mancha, Campus Universitario s/n, 02071 Albacete, Spain; [email protected] (O.A.); [email protected] (L.G.-G.) 2 Instituto de Agroquímica y Tecnología de Alimentos (IATA-CSIC), Departamento de Ciencia de los Alimentos, Calle Catedrático Agustín Escardino 7, 46980 Paterna, Spain; [email protected] 3 Departamento de Genética, Facultad de Biología, Universidad de Sevilla, Avenida Reina Mercedes 6, 41012 Sevilla, Spain; [email protected] * Correspondence: [email protected]; Tel.: +34-954-555947 Academic Editor: Vladimír Kˇren Received: 5 September 2016; Accepted: 8 October 2016; Published: 26 October 2016 Abstract: Apocarotenoids are carotenoid-derived compounds widespread in all major taxonomic groups, where they play important roles in different physiological processes. In addition, apocarotenoids include compounds with high economic value in food and cosmetics industries. Apocarotenoid biosynthesis starts with the action of carotenoid cleavage dioxygenases (CCDs), a family of non-heme iron enzymes that catalyze the oxidative cleavage of carbon–carbon double bonds in carotenoid backbones through a similar molecular mechanism, generating aldehyde or ketone groups in the cleaving ends. From the identification of the first CCD enzyme in plants, an increasing number of CCDs have been identified in many other species, including microorganisms, proving to be a ubiquitously distributed and evolutionarily conserved enzymatic family.
    [Show full text]
  • Β-Carotene Oxidation Products - Function and Safety
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.18.436000; this version posted March 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 β-Carotene oxidation products - function and safety 2 3 Graham W. Burton1*, Trevor J. Mogg1, William W. Riley2, and James G. Nickerson1 4 5 1Avivagen Inc., 100 Sussex Drive, Ottawa, Ontario, Canada K1A 0R6 6 2Jinan University, International School, Guangzhou, China 7 8 * Corresponding author. Avivagen Inc., 100 Sussex Drive, Ottawa, Ontario, Canada K1A 0R6. 9 E-mail address: [email protected] (GB) 10 11 Abbreviations 12 OxBC: fully oxidized β-carotene 13 14 Declaration of competing interest: GWB, TJM and JGN are employees and WWR is a 15 technical consultant of Avivagen Inc. GWB owns shares in Avivagen Inc. 16 Funding: The authors declare no specific funding for this work. 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.18.436000; this version posted March 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 18 Abstract 19 β-Carotene oxidation products have newly discovered bioactivity in plants and animals. 20 Synthetic fully oxidized β-carotene (OxBC) has application in supporting livestock health, with 21 potential human applications.
    [Show full text]
  • A Cis-Carotene Derived Apocarotenoid Regulates Etioplast And
    bioRxiv preprint doi: https://doi.org/10.1101/528331; this version posted January 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 A cis-carotene derived apocarotenoid regulates etioplast and chloroplast development 2 3 Christopher I Cazzonellia,*, 1, Xin Houb,*, Yagiz Alagoza, John Riversb, Namraj Dhamia, Jiwon Leec, Marri 4 Shashikanthb and Barry J Pogsonb, 1 5 6 Affiliations: 7 * These two authors contributed equally 8 a Hawkesbury Institute for the Environment, Western Sydney University, Locked Bag 1797, Penrith 9 NSW 2751, Australia. 10 b Australian Research Council Centre of Excellence in Plant Energy Biology, Research School of 11 Biology, The Australian National University, Canberra, ACT 2601, Australia. 12 c Centre for Advanced Microscopy, The Australian National University, Canberra, ACT 2601, Australia 13 14 1 Address correspondence to [email protected] and [email protected]. 15 The author(s) responsible for distribution of materials integral to the findings presented in this article in 16 accordance with the policy described in the Instructions for Authors (www.plantcell.org) are: Barry 17 Pogson ([email protected]) and Christopher Cazzonelli ([email protected]) 18 19 The authors declare no conflict of interest 20 Short Title: Apocarotenoid control of plastid development 21 One-sentence summary: Carotenoids are not just required as core components for plastid biogenesis, 22 they can be cleaved into an apocarotenoid signal that regulates etioplast and chloroplast development 23 during extended periods of darkness.
    [Show full text]
  • Carotene and Novel Apocarotenoid Concentrations in Orange-Fleshed Cucumis Melo Melons: Determinations of Β-Carotene Bioaccessibility and Bioavailability Matthew K
    ARTICLE pubs.acs.org/JAFC Carotene and Novel Apocarotenoid Concentrations in Orange-Fleshed Cucumis melo Melons: Determinations of β-Carotene Bioaccessibility and Bioavailability Matthew K. Fleshman,† Gene E. Lester,*,‡ Ken M. Riedl,§ Rachel E. Kopec,§ Sureshbabu Narayanasamy,|| Robert W. Curley, Jr.,|| Steven J. Schwartz,§ and Earl H. Harrison*,† † Department of Human Nutrition, The Ohio State University, Columbus, Ohio 43210, United States ‡ Kika de la Garza Subtropical Agricultural Research Center, United States Department of Agriculture, Weslaco, Texas 78596, United States § Department of Food Science and Technology, The Ohio State University, Columbus, Ohio 43210, United States College) of Pharmacy, The Ohio State University, Columbus, Ohio 43210, United States ABSTRACT: Muskmelons, both cantaloupe (Cucumis melo Reticulatus Group) and orange-fleshed honeydew (C. melo Inodorus Group), a cross between orange-fleshed cantaloupe and green-fleshed honeydew, are excellent sources of β-carotene. Although β- carotene from melon is an important dietary antioxidant and precursor of vitamin A, its bioaccessibility/bioavailability is unknown. We compared β-carotene concentrations from previously frozen orange-fleshed honeydew and cantaloupe melons grown under the same glasshouse conditions, and from freshly harvested field-grown, orange-fleshed honeydew melon to determine β-carotene bioaccessibility/bioavailability, concentrations of novel β-apocarotenals, and chromoplast structure of orange-fleshed honeydew melon. β-Carotene and β-apocarotenal concentrations were determined by HPLC and/or HPLC-MS, β-carotene bioaccessibility/ bioavailability was determined by in vitro digestion and Caco-2 cell uptake, and chromoplast structure was determined by electron microscopy. The average β-carotene concentrations (μg/g dry weight) for the orange-fleshed honeydew and cantaloupe were 242.8 and 176.3 respectively.
    [Show full text]
  • Periodic Root Branching in Arabidopsis Requires Synthesis of an Uncharacterized Carotenoid Derivative
    Periodic root branching in Arabidopsis requires synthesis of an uncharacterized carotenoid derivative Jaimie M. Van Normana, Jingyuan Zhanga, Christopher I. Cazzonellib, Barry J. Pogsonb, Peter J. Harrisonc, Timothy D. H. Buggc, Kai Xun Chanb, Andrew J. Thompsond, and Philip N. Benfeya,e,1 aDepartment of Biology, Duke Center for Systems Biology and eHoward Hughes Medical Institute, Duke University, Durham, NC 27708; bAustralian Research Council Centre of Excellence in Plant Energy Biology, Research School of Biology, The Australian National University, Canberra, ACT 0200, Australia; cDepartment of Chemistry, University of Warwick, Coventry CV4 7AL, United Kingdom; and dCranfield Soil and Agri-Food Institute, Cranfield University, Cranfield, Bedfordshire MK43 0AL, United Kingdom Contributed by Philip N. Benfey, February 24, 2014 (sent for review January 5, 2014) In plants, continuous formation of lateral roots (LRs) facilitates the primary root tip but remains confined within the primary efficient exploration of the soil environment. Roots can maximize root. The primordium is considered to be an LR only after it has developmental capacity in variable environmental conditions emerged from the primary root and cell division is activated at its through establishment of sites competent to form LRs. This LR apex (8). Developmental progression of individual LRPs is sen- prepattern is established by a periodic oscillation in gene expres- sitive to a vast range of developmental and environmental cues sion near the root tip. The spatial distribution of competent (reviewed in ref. 10), which, ultimately, allows for plasticity in (prebranch) sites results from the interplay between this periodic root system architecture in variable subterranean environments. process and primary root growth; yet, much about this oscillatory In the root’s radial axis, LRs form strictly from a subset of process and the formation of prebranch sites remains unknown.
    [Show full text]