Apocarotenoids produced from β-carotene by dioxygenases from Mucor circinelloides Item Type Article Authors Alcalde, Eugenio; Cerdá-Olmedo, Enrique; Al-Babili, Salim Citation Alcalde E, Cerdá-Olmedo E, Al-Babili S (2019) Apocarotenoids produced from β-carotene by dioxygenases from Mucor circinelloides. Microbiology. Available: http://dx.doi.org/10.1099/ mic.0.000762. DOI 10.1099/mic.0.000762 Publisher Microbiology Society Journal Microbiology Download date 29/09/2021 20:36:43 Link to Item http://hdl.handle.net/10754/631242 1 Title: Apocarotenoids produced from β−carotene by dioxygenases from Mucor circinelloides 2 Running title: Apocarotenoid formation in Mucor circinelloides. 3 Eugenio Alcaldea, Enrique Cerdá-Olmedob, and Salim Al-Babilic, d* 4 a School of Biological Sciences, Royal Holloway, University of London, Egham Hill, Egham, Surrey TW20OEX, 5 UK. 6 b Departamento de Genética, Universidad de Sevilla, Apartado 1095, E-41080 Sevilla, Spain. 7 c King Abdullah University of Science and Technology (KAUST), Biological and Environmental Sciences and 8 Engineering Division, the BioActives lab, Thuwal 23955-6900, Kingdom of Saudi Arabia. 9 d Faculty of Biology, University of Freiburg, Schaenzlestr. 1, 79104 Freiburg, Germany. 10 11 12 E-mail addresses: [email protected], [email protected], [email protected] 13 14 *Corresponding author. 15 16 Abstract 17 18 Mucor circinelloides exhibits the complex sexual behaviour that is induced in other Mucoromycotina by a family 19 of apocarotenoids called trisporoids. The genome of M. circinelloides contains four genes encoding putative 20 carotenoid cleavage dioxygenases. The gene products of two of them were sufficient to convert β-carotene into 21 the precursors of three families of apocarotenoids, both in vitro and in the Escherichia coli heterologous in vivo 22 system. The first one, CarS, cleaved the C40 β-carotene into the C15 precursor of cyclofarnesoids and a C25 23 apocarotenal that was converted by the second enzyme, AcaA, into the C18-precursor of trisporoids and the C7 24 precursor of methylhexanoids. Apocarotenoids were not found in single or mixed cultures of the two strains of 25 opposite sex, whose interaction readily produced zygospores, the sexual fusion cells. 26 27 28 Abbreviations 29 Carotenoid cleavage dioxygenase: CCD 30 —————————— 31 32 Mucor [1] is a large and diverse genus of fungi, the epitome of the Mucorales [2]. M. circinelloides [3], a 33 saprophyte and an opportunistic pathogen, is a convenient laboratory organism with excellent tools for molecular 34 genetics [4], including effective DNA transformation [5–7], gene replacement [8], and gene silencing pathways 35 [9, 10]. Hyphae of opposite sex, (+) and (–), react to the vicinity of each other with complex changes that include 36 cellular differentiation and increased accumulation of β-carotene and culminate in the production of fusion cells, 37 the zygospores. These have not been seen to germinate, so that no sexual cycle is available for research [11]. 38 The sexual interaction in the Mucorales was the first known case of pheromone-mediated signalling [12]. 39 These pheromones derive from β-carotene [13, 14] and a group of apocarotenoids, known as trisporoids, which 40 sexually stimulate single cultures [15–19]. Phycomyces blakesleeanus, another species of the Mucorales, contains 41 three families of apocarotenoids, the C18/C19 trisporoids, the C15 cyclofarnesoids, and the C7 methylhexanoids [20– Alcalde et al 1 1 22]. In this fungus, C40 β-carotene is cleaved sequentially (Fig. 1) into the three precursors of these families by 2 the dioxygenases CarS and AcaA [23, 24]. This cleavage scheme has been extended to the Mucorales Blakeslea 3 trispora and Mucor mucedo [19, 25]. CarS and AcaA are members of a large group of non-heme iron enzymes, 4 the carotenoid cleavage dioxygenases (CCDs), which cut double bonds in carbon chains of carotenes and other 5 substrates in most organisms [26, 27]. 6 The genome of M. circinelloides strain CBS277.49 [28] contains four sequences similar to the 7 Phycomyces genes carS and acaA [23]. Two of them, 146755 and 141273, could encode proteins designated CarS 8 and AcaA, respectively. The amino acid positions of their sequences proved to be identical with those of their 9 Phycomyces orthologues in 72% and 45%, respectively.; they contain the conserved histidine and glutamate or 10 aspartate residues that are required for the enzymatic catalysis [29, 30]; and they resemble carotene-cleaving 11 dioxygenases from a cyanobacterium, a plant, an ascomycete and a mammal, particularly in their terminal regions 12 (Fig. 2). To date no further indications about the functions of the two remaining putative proteins, 114475 and 13 189974, can be made, which contain only two of the four conserved histidine residues. 14 We tested the activity of the encoded proteins by heterologous expression in transgenic Escherichia coli 15 strains that produce β-carotene [31], lycopene [32], or zeaxanthin [33]. For this purpose, we amplified the 16 corresponding cDNAs from total cDNA synthesized using the Superscript III First Strand System for RT-PCR 17 (Invitrogen, Paisley, UK) from total mRNA that was extracted following the protocol of Rodríguez-Romero and 18 Corrochano [34] from two days-old mycelia. For amplification, we used the Expand High Fidelity polymerase 19 (Roche) and the primers carS-F: 5’−CATGATCACTCCCGCTGAAG−3’, carS-R: 5’− 20 TTAATTGACGGCAATGCCTC −3’, acaA-F: 5’− CAAGATGATTGTAGGATTGCTTAC −3’, acaA-R: 5’− 21 CATTTTAATTGATATTGATAGAC −3’, 114475-F: 5’− CATGTCTGATTTGAACAAGGTC −3’, and 22 114475-R: 5’− CTCTAGTTTTCTCGAAGTCG. Amplified fragments were ligated into pGEM−T Easy 23 (Promega), using the T4 DNA ligase (Promega). cDNAs were then re-amplified and inserted into 24 pBAD−Thio−Topo (Invitrogen) that leads to fusion proteins with thioredoxin. The integrity of cloned cDNAs was 25 verified by sequencing. Carotenoid-accumulating E. coli cultures transformed with the obtained plasmids were 26 induced and analyzed by HPLC, following the method described by Medina et al. [23]. Lycopene and -carotene 27 were purchased from Sigma-Aldrich. Zeaxanthin was purified from Synechocystis sp. PCC 6803, according to 28 [35]. Apocarotenoids were kindly provided by the BASF (Ludwigshafen, Germany).The thioredoxin-CarS fusion 29 decolorized the yellow β-carotene-producing cultures and made them accumulate β-apo-12’-carotenal, confirmed 30 by comparison with an authentic standard (Fig. 3 A, D). No activity was detected when the same thioredoxin- 31 CarS fusion was expressed in cells that produced lycopene or zeaxanthin, suggesting specificity for β-carotene. 32 The thioredoxin-AcaA and thioredoxin-114475 fusions did not affect the E. coli cultures accumulating any of the 33 carotenoids tested. 34 The activity of the enzymes was investigated in vitro by incubating cell-free extracts of E. coli BL21 35 cells, which produce the corresponding thioredoxin fusions, with different carotenoid substrates, following the 36 protocol described by Medina et al. [23]. The thioredoxin-CarS fusion cleaved β-carotene to β-apo-12’carotenal 37 (Fig. 3 E) that was further converted by the thioredoxin-AcaA fusion into β-apo-13-carotenone, a C18-ketone 38 (Figure 3 B and F). These reactions predicted the formation of a C15 apocarotenal and a C7 dialdehyde as further 39 products of the cleavage of β-carotene and β-apo-12’carotenal, respectively. Specificity was suggested by the 40 negative results: thioredoxin-CarS did not cleave lycopene; thioredoxin-AcaA did neither cleave lycopene nor the 41 long apocarotenoids β-apo-8′- and β-apo-10′- carotenal; zeaxanthin was not cleaved by any of the investigated 42 enzymes. Thioredoxin-114475 gave negative results with all tested substrates. 43 A distinctive and seemingly universal trait of the Mucorales is the cleavage of β-carotene by the CarS 44 and AcaA dioxygenases into three fragments. The main activities of these enzymes are conserved: CarS cleaves 45 β-carotene, but not β-apo-12´-carotenal (C25), and AcaA the other way around. Mucor and Phycomyces differ in 46 the details [23], as expected from the large differences in their morphology and genome sequences [2, 36]: the 47 CarS of M. circinelloides was active in vitro, while the CarS of Phycomyces was not; the AcaA of Phycomyces 48 cleaves the long straight chains of lycopene, β-apo-8′-carotenal (C30) and β-apo-10′-carotenal (C27), while the 49 AcaA of M. circinelloides did not. Similar to the previous report on Phycomyces apocarotenoid synthesis [23], 50 we could not detect the C15 and C7 apocarotenoids expected to be formed by Mucor CarS and Aca, respectively, 51 which can be explained by the instability of the C15 apocarotenal and limitation of our extraction/analysis method 52 in detecting the C7 dialdehyde . Alcalde et al 2 1 In the present study, we could not detect apocarotenoids in mixed cultures of M. circinelloides strains of 2 opposite sex, CBS277.49 (–) and NRRL3631 (+) or in the corresponding single cultures, albeit abundant 3 production of zygophores, the sexual fusion cells, and the usage of the analytical methods that had previously 4 detected apocarotenoids in Phycomyces [21, 22]. If we have not missed the right conditions, the apocarotenoids 5 of M. circinelloides may be present at very low concentrations and be unstable after extraction. The signalling 6 trisporoids could be rare if their receptors are sufficiently sensitive. 7 8 Acknowledgements 9 We thank Prof Paul Fraser for valuable discussions and Dr. Hansgeorg Ernst for providing carotenoid and 10 apocarotenoid substrates and standards This work was supported by Deutsche Forschungsgemeinschaft grant 11 number AL 892/1-4 and by baseline funding given to S-A from the King Abdullah University of Science and 12 Technology (KAUST). 13 14 The authors declare no conflicts of interests. 15 16 References 17 18 1. Michelius PA. Nova Plantarum Genera. Florentia: Typis Bernardi Paperinii; 1729. 19 2. Hoffmann K, Pawłowska J, Walther G, Wrzosek M, de Hoog GS, et al.