Oocyte Intercommunication

Identification of large molecule transfer in cumulus cell - oocyte intercommunication

Thèse

Angus Macaulay

Doctorat en sciences animales Philosophiae doctor (Ph.D.)

Québec, Canada

Résumé Mes travaux explorent, chez la vache, le transfert entre les cellules du cumulus et l’ovocyte des transcrits d’ARN et d’autres larges molécules qui, selon notre hypothèse, pourraient être exportées des cellules somatiques à l’ovocyte, ceci afin de soutenir sa maturation.

L’étude des projections transzonales (PTZ) reliant les cellules du cumulus à l’ovocyte a révélé qu’elles sont de morphologie irrégulière, qu’elles peuvent contenir des organelles (mitochondries) et des structures cellulaires (ribosomes) et qu’elles se retractent au cours de la maturation ovocytaire. Des microvésicules pouvant transférer de larges molécules ont été identifiées à la jonction entre les cellules.

Pour déterminer si l’ARN est empaqueté préalablement à son transfert entre les cellules, nous avons analysé les transcrits présents dans les PTZ et avons constaté qu’ils se déplacent vers l’ovocyte en maturation. Parmi les transcrits retrouvés dans les PTZ, certains étaient commun à ceux dont l’abondance augmente dans l’ovocyte en cours de maturation de même qu’à ceux retrouvés dans les polyribosomes de l’ovocyte en maturation, suggérant ainsi le transfert et l’utilisation des transcrits provenant des cellules du cumulus. Un transcrit synthétique ajouté aux cellules du cumulus avant qu’elles ne s’attachent à l’ovocyte a été transféré à ce dernier, confirmant ainsi le potentiel des cellules à transférer des ARNm et possiblement leurs protéins associées à l’ovocyte. Nouse avons observé, sur une échelle de temps, que les transcrits sont accumulés dans les PTZ au cours des heures suivant l’abattage de l’animal, mais préalablement à l’aspiration de l’ovocyte. Le retrait des cellules du cumulus et de cette période d’accumulation des transcrits se traduit par un faible taux de maturation des ovocytes.

La nécessité d’avoir des vésicules d’ARN transférées à l’ovocyte a été testée grâce à des inhibiteurs de la synthèse d’ARN, de son transport et de la formation des vésicules. L’inhibition de chacune de ces étapes a compromis la maturation des ovocytes.

III

En se penchant sur les mécanismes impliqués dans le transfert des transcrits, nous avons découvert un candidat potentiel jouant un rôle dans l’insuffisance ovarienne précoce. Cette protéine liant les ARNm, Fragile X mental retardation (FMRP), a été retrouvée dans les cellules folliculaires et dans l’ovocyte tout au long de la folliculogenèse et de l’ovogenèse. Nous avons constaté que FMRP s’associe à la machinerie traductionnelle et aux protéines des granules d’entreposage dans l’ovocyte. L’inhibition de la protéine a significativement réduit le taux de blastocyste.

En démontrant que des transcrits exogènes contribuent au développement de l’ovocyte et influencent sa maturation, nos recherches ajoutent un niveau de compréhension additionnel aux mécanismes de communication intercellulaire menant à la production de gamètes de bonne qualité. De futures expériences axées la caractérisation du transfert des transcrits et des mécanismes spécifiques en jeu contribuera à accroître notre compréhension de la compétence ovocytaire.

Abstract The reports in this thesis explored the potential for large molecule communication between the cumulus cell and the oocyte hypothesizing that large molecules, including RNA, could be transferred to the oocyte for support during maturation.

Exploration of the transzonal projections (TZPs) connecting the cumulus cells to the oocyte revealed that they are irregular in shape, can contain large organelles (mitochondria) and small cellular structures (ribosomes), and that these connections retract during oocyte maturation. Microvesicles were identified at the intercellular articulations capable of sharing large molecules between the cells.

To determine if RNA is transferring as cargo between cells, nascent as well as total transcripts were evaluated in the TZPs and found moving towards the oocyte during maturation. Of the transcripts found in the TZPs during maturation, some were common to those increasing in abundance in the oocyte during maturation, and on the polyribosomes of the maturing oocyte, thus suggesting transfer and use of cumulus cell transcripts. A synthetic transcript provided to some cumulus cells for reconstruction with, and transfer to the oocyte, confirmed the potential to transfer mRNA and possibly proteins. Temporally, RNA transcripts were found to accumulate in TZPs during the hours post slaughter but prior to oocyte aspiration. Removal of the cumulus cells and this period of accumulation resulted in poor oocyte maturation.

The requirement of vesicle mediated RNA transfer to the oocyte was tested. Inhibitors against RNA synthesis, transport, and vesicle formation were explored and found to reduced oocyte maturation.

Focusing on mechanisms that could mediate transference, we assessed an RNA binding protein candidate with implications in premature ovarian insufficiency. Fragile X mental retardation protein (FMRP) was found in follicular cells and the oocyte throughout folliculogenesis and oogenesis. Based on known roles in translation control, FMRP was

shown associated with translational machinery and storage granule proteins in the oocyte. Knockdown of this protein resulted in compromised rates of blastocyst formation.

Knowing that exogenous transcripts contribute to oocyte development, and influence the molecular aspects of oocyte maturation adds another layer to our understanding of intercellular communication in the production of a healthy gamete. Future characterization of the transferred transcripts and the mechanisms in control of this process will improve our understanding of oocyte health and competence. .

Table of contents

Résumé ...... III Abstract ...... V Table of contents ...... VII List of figures ...... XI List of tables ...... XIII List of abbreviations and symbols ...... XV Acknowledgments ...... XXI Foreword ...... XXV 1 Introduction ...... 1 1.1 The oocyte; a cornerstone in reproductive biology ...... 1 1.1.1 Ovarian follicular development and oocyte growth ...... 2 1.1.1.1 Primordial germ cells establish the follicle population ...... 2 1.1.1.2 The primordial follicle ...... 3 1.1.1.3 The primary follicle; morphology and activation ...... 3 1.1.1.4 The secondary follicle ...... 5 1.1.1.5 Antral follicle development ...... 5 1.1.1.6 Follicular Atresia ...... 8 1.2 Intercellular signalling in the cumulus oocyte complex governs growth and maturation of the oocyte ...... 10 1.2.1 Paracrine communication ...... 10 1.2.2 Communication by small molecule transfer ...... 12 1.3 Meiosis Resumption and Oocyte Maturation ...... 14 1.3.1 In vitro maturation and embryo production ...... 16 1.3.2 Maturation of Denuded Oocytes ...... 19 1.3.3 Challenges for In vitro embryo production ...... 21 1.4 RNA is stored by the oocyte ...... 22 1.4.1 Establishing the stores of RNA in the oocyte ...... 23 1.4.2 Oocytes undergo transcriptional arrest ...... 25 1.4.3 The duration of transcriptional silencing is species specific ...... 28 1.5 How the oocyte packages, stores, and later uses RNA ...... 30 1.5.1 Shortening of the polyA tail ...... 31 1.5.2 RNA stabilization through granule formation ...... 32 1.5.3 Recruiting stored RNA for usage ...... 35 1.6 Fragile-X mental retardation protein function and links to reproduction ...... 38 1.6.1 FMRP function in Neurons ...... 39 1.6.2 Repeat expansion impacts transcription and translation causing disease ...... 40 1.6.3 FMRP and Premature ovarian insufficiency ...... 41 1.7 Vesicles and intercellular large molecule transfer...... 42

VII

1.7.1 Vesicle formation and fusion ...... 44 1.7.2 Extracellular Vesicles ...... 47 1.7.3 Roles in somatic cells ...... 48 1.7.4 Roles in sperm ...... 50 1.7.5 Vesicle roles in the oocyte ...... 50 1.8 Objectives of the thesis ...... 51 2 The gametic synapse; RNA transfer to the bovine oocyte ...... 53 2.1 Résumé ...... 55 2.2 Abstract ...... 57 2.3 Introduction ...... 59 2.4 Materials and Methods ...... 60 2.4.1 Oocyte collection and maturation ...... 60 2.4.2 RNA extraction and amplification for RNA-seq ...... 61 2.4.3 Bioinformatics analysis for RNA-seq ...... 62 2.4.4 RT-qPCR ...... 62 2.4.5 Fixation and fluorescent staining...... 62 2.4.6 Immunofluorescence ...... 63 2.4.7 In-situ hybridization ...... 63 2.4.8 Scanning electron microscopy ...... 64 2.4.9 Transmission electron microscopy and autoradiography ...... 64 2.4.10 Cumulus oocyte complex reconstruction with transfected cumulus cells ...... 65 2.4.11 Statistics ...... 65 2.5 Results ...... 66 2.5.1 Transcriptomic comparison of GV and MII oocytes ...... 66 2.5.2 Characterization of the transzonal projection structures ...... 67 2.5.3 Detection of RNA within the TZP ...... 67 2.5.4 Identification of newly transcribed RNA in TZP ...... 68 2.5.5 The gametic synapse ...... 69 2.5.6 Transfer of synthetic RNA in reconstituted cumulus-oocyte complexes ...... 70 2.6 Discussion ...... 70 2.7 Conclusion ...... 74 2.8 Acknowledgements ...... 75 2.9 References ...... 75 2.10 Tables ...... 80 2.11 Figures ...... 81 3 Cumulus cell transcripts transit to the bovine oocyte in preparation for maturation ..... 91 3.1 Résumé ...... 93 3.2 Abstract ...... 95 3.3 Introduction ...... 97 3.4 Materials and Methods ...... 98 3.4.1 Oocyte collection and maturation ...... 98

VIII

3.4.2 Transmission electron microscopy and autoradiography...... 99 3.4.3 Image Analysis: Quantification of Pixel Intensity and Density ...... 100 3.4.4 Live cell imaging of RNA ...... 101 3.4.5 Isolation of oocyte polyribosomes and microarray transcript evaluation ...... 101 3.4.6 RNA-seq libraries preparation and sequencing ...... 102 3.4.7 Bioinformatics analysis of RNA-seq data ...... 103 3.4.8 Inhibitors of cellular function ...... 103 3.4.9 Fixation and fluorescent staining ...... 104 3.4.10 Statistics ...... 104 3.5 Results ...... 105 3.5.1 RNA localization and movement in the cumulus oocyte complex ...... 105 3.5.2 RNA transcripts present in the TZP are also found on the oocyte’s translational machinery ...... 107 3.5.3 Disruption of RNA transfer mechanisms and their impact on oocyte maturation 108 3.5.4 Timing of developmental competence acquisition in relation to RNA accumulation in the TZPs ...... 109 3.6 Discussion ...... 110 3.7 Acknowledgements ...... 116 3.8 References ...... 116 3.9 Figures ...... 123 3.10 Tables ...... 132 4 Characterization of Fragile X mental retardation protein during bovine folliculogenesis, oogenesis and early development...... 135 4.1 Résumé ...... 137 4.2 Abstract ...... 139 4.3 Introduction ...... 141 4.4 Materials and Methods ...... 143 4.4.1 Oocyte collection, maturation, fertilization, and embryo culture ...... 143 4.4.2 Antibodies ...... 144 4.4.3 Western Blot ...... 144 4.4.4 Fixation and fluorescent staining and Image Capture ...... 145 4.4.5 Immunofluorescence ...... 146 4.4.6 RT-qPCR ...... 146 4.4.7 Isolation of oocyte polyribosomes and microarray transcript evaluation ...... 147 4.4.8 Oocyte microinjection ...... 147 4.4.9 Statistics ...... 148 4.5 Results ...... 148 4.5.1 Detection of FMRP, FXR1, and FXR2 in reproductive tissues ...... 148 4.5.2 Detection of Fragile X family transcripts in early embryo development ...... 149 4.5.3 Effect of Fragile X protein family knockdown on early embryo development ... 151

4.6 Discussion ...... 152 4.7 Acknowledgements ...... 158 4.8 References ...... 158 4.9 Tables ...... 166 4.10 Figures ...... 168 General Summary ...... 177 Perspectives ...... 185 Appendix 1. Supplemental figures for chapter two...... 189 Appendix 2. Supplemental figures for chapter three ...... 196 References ...... 229

List of figures Chapter 1 Figure 1-1. The Graafian Follicle ...... 2 Figure 1-2. Different stages of folliculogenesis ...... 8 Figure 1-3. Intercellular communication between the cumulus cells and the oocyte ...... 14 Figure 1-4. Open communication channels between gametes ...... 24 Figure 1-5. Chromatin configurations in mouse (A, B), cow (C-E), and goat (F-H) ...... 26 Figure 1-6. Loop-Model of RNA translation ...... 37 Figure 1-7. Model of RNA processing in the oocyte ...... 38 Figure 1-8. Formation of extracellular vesicles ...... 44 Figure 1-9. Vesicle budding and fusion ...... 45

Chapter 2 Figure 2-1. Evaluation of GV and MII oocyte transcripts ...... 81 Figure 2-2. Transzonal projection structure ...... 82 Figure 2-3. TZPs retraction at the end of oocyte maturation ...... 83 Figure 2-4. Transzonal projections contain RNA ...... 84 Figure 2-5. Evaluation of nascent RNA transcripts in the TZP ...... 85 Figure 2-6. Ultrastructure of the projections ends ...... 87 Figure 2-7. Detection of a synthetic transcript in reconstituted cumulus-oocyte complexes ...... 89

Chapter 3 Figure 3-1. Nascent RNA in the projections moves to the ooplasm ...... 123 Figure 3-2. Detection of nascent RNA within different regions of the COC ...... 124 Figure 3-3. Impact of the presence of cumulus cells on the presence of nascent RNA inside the oocyte ...... 125 Figure 3-4. Time series of moving granules in the cumulus cell projections towards the oocyte ...... 127 Figure 3-5. Transcript identification in the different structural components of the cumulus oocyte complex ...... 128

Figure 3-6. Impact of inhibitors on the oocyte maturation ...... 129 Figure 3-7. Impact of time of intrafollicular pre-maturation and of somatic cell removal on oocyte maturation competence ...... 130 Figure 3-8. Timing of TZPs RNA loading ...... 131

Chapter 4 Figure 4-1. Immunofluorescent detection of FMRP and 60s ribosomal protein L7 and their localization in the different stages of the developing follicle ...... 168 Figure 4-2. Immunofluorescent detection of FMRP and YBX2 proteins and their localization in the different stages of the developing follicle ...... 169 Figure 4-3. Wholemount cumulus oocytes complexes in GV oocytes show FMRP (Green), L7 (Red) and YBX2 (Red) immunofluorescent localization ...... 170 Figure 4-4. Transcript abundance of the fragile X family in oocytes and early embryos .. 171 Figure 4-5. Immunolabelling of FMRP, FXR1 and FXR2 during development...... 172 Figure 4-6. Knockdown of FMRP family transcripts and protein abundance ...... 175

XII

List of tables Chapter 1 Table 1-1. The size of the follicle in which a fully-grown egg can be found, and the size at which the follicle will ovulate by species ...... 6 Table 1-2. Embryo production in different systems ...... 19 Table 1-3. Bovine and murine rates of denuded oocyte development in different culture systems ...... 20 Table 1-4. RNA content and nuclear configuration by species when polymerase II activity ceases ...... 25 Table 1-5. Cell cycle of genome activation by species ...... 28 Table 1-6. Classification of extracellular vesicles ...... 48

Chapter 2 Table 2-1. Top ten GO terms for biological processes and molecular function enriched in the TZPs using the cumulus cells as a background ...... 80

Chapter 3 Table 3-1 Ontology Terms enrichment for Biological Processes for transcripts found on the TZPs and the polyribosomes of GV and MII oocytes ...... 132 Table 3-2. Gene Ontology Terms enrichment for Molecular Functions for transcripts found in the TZPs and polyribosomes of MII and GV oocytes ...... 133

Chapter 4 Table 4-1. Sequences for RT-qPCR and siRNA knockdown ...... 166 Table 4-2. Developmental rates for knockdown of FMRP family proteins in early embryos ...... 167

XIII

List of abbreviations and symbols 17βHSD 17 beta hydroxy steroid dehydrogenase 3'UTR 3’ untranslated region 3H tritium 3βHSD 3 beta hydroxy steroid dehydrogenase 5'UTR 5’ untranslated region A4 androstenedione ADP adenosine diphosphate AGO2 argonaught protein two AKT protein kinase B AMP adenosine monophosphate ARF6 ADP-ribosylation factor 6 ART assisted reproductive technology ATP adenosine triphosphate bed bicoid bFGF basic fibroblast growth factor BMP15 bone morphogenic protein 15 bp base pair BRL buffalo rat liver cells C/EBPβ CAAT enhancing binding protein beta Caf1 chromatin assembly factor cAMP cyclic adenosine monophosphate CASA computer assisted sperm analysis CC cumulus cell CCNB1 cyclin B1 CCR4 chemokine (C-C motif) receptor 4, CD9 a tetraspannin protein commonly referred to as CD9 CDC42 cell division control protein 42 CDK1 cyclin dependent kinase one cGMP cyclic guanosine monophosphate CL corpus luteum

COC cumulus oocyte complex COPa coatamer protein subunit complex alpha COPb coatamer protein subunit complex beta COPI/II coat protein I/II COX2 cyclooxygenase two CPE cytoplasmic polyadenylation element CPEB cytoplasmic polyadenylation element binding protein CPSF cleavage and polyadenylation specificity factor CREB cAMP response element binding CREM cAMP response element modulator cx connexin CYFIP cytoplasmic FMRP interacting protein DAG diacyl glycerol DAZL deleted in azoospermia-like DCP1/2 decapping protein 1/2 DDX6 dead box helicase 6 DEK DEK oncogene (DNA binding) DNA deoxyribonucleic acid DNABP deoxyribonucleic acid binding protein DO denuded oocyte DSR dynasore E2 estradiol EDEN embryo deadenylation element EGA embryonic genome activation EGF epidermal growth factor EGF Like epidermal growth factor like EGFR epidermal growth factor receptor eIF3 eukaryotic initiation factor three eIF4A eukaryotic initiation factor four A eIF4G eukaryotic initiation factor four G EJC exon junctional complex

XVI

ER endoplasmic reticulum ERK1/2 extracellular signal related kinase ESCRT endosomal sorting complex required for transport exu exuperantia FMRP fragile-X mental retardation protein FPKM Fragments per kilobase of transcript per million mapped reads FRGY1/2 Frog Y-box protein 1/2 FSH Follicle stimulating hormone FSHR follicle stimulating hormone receptor FXR1/2 fragile-X relate protein 1/2 G2 growth two G3BP ras GTPase-activating protein-binding protein GDF9 growth differentiation factor 9 GDF9b growth differentiation factor 9 b GDP guanosine diphosphate GnRH gonadotropin releasing hormone GPR3 g coupled protein receptor three GTP guanosine-5'-triphosphate GTPase guanosine-5'-triphosphate catalytic enzyme GV germinal vesicle GVBD germinal vesicle breakdown GW182 TNRC6A dinucleotide repeat containing 6A HAS2 hyaluronin synthase two HCG human chorionic gonadotropin HEX polyadenylation hex nucleotide HIV human immunodeficiency virus hnRNPA2 heterogeneous nuclear ribonucleoproteins A2/B1 HPG axis hypothalamus Pituitary gonad axis IETS international embryo transfer society IGF-I insulin growth factor one IP3 inositol 1,4,5-trisphosphate

XVII

IVF in vitro fertilization IVM in vitro maturation IVP in vitro embryo production JNK c-Jun N-terminal kinase kDa kilodalton LC loosely condensed LH luteinizing hormone LM light microscopy lncRNA long noncoding RNA MAP1B microtubule associated protein 1 B MAPK mitogen activated protein kinase MAPS Maella's protein MDC monodansyl cadaverine MI meiosis One MII meiosis Two miRNA micro RNA Mos moloney murine sarcoma viral oncogene homolog (cytostatic factor component) MPF maturation promoting factor; also cyclin-B-p34-cyclin-dependent-kinase 2 mRISC mRNA induced silencing complex mRNA messenger ribonucleic acid MSY2 mouse y-box protein two mTOR mammalian target of rampramycin MVB multi-vesicular body MZT maternal zygotic transition NCBI National Center for Biotechnology Information Nf1 nuclear factor one NGDN neuroguidin NL net like NMDAR N-methyl-D-aspartate receptor NSN non-surrounded nucleus

XVIII

OPU ovum pick-up OSF oocyte secreted factor P4 progesterone PABP poly-A binding protein PAIP1/2 Poly-A interacting protein 1/2 PAP polyadenyl polymerase PARN poly-A specific ribonuclease PC12 rat pheochromocytoma cells PDE phosphodiesterase PDGF platelet derrived growth factor PGD pre-implantation genetic diagnostic PIP2 phosphatidylinositol 4,5-bisphosphate PKA protein kinase A PKC protein kinase C POI premature ovarian insufficiency pol I RNA polymerase one pol II RNA polymerase two POS polycystic ovarian syndrome PPARγ peroxisome proliferator activator receptor PTEN phosphatase and tensin homologue Rab Ras-related protein RAS rat sarcoma REF recombination enhancement function protein RISC RNA induced silencing complex RNA ribonucleic acid RNABP ribonucleic acid binding protein RNP ribonucleic acid protein complex RNPase RNA-protein catalytic enzyme RNPS1 RNA binding protein, serine rich sar1 small COPII coat GTPase SC singly condensed

XIX

SCRD subcortical RNP domain SEM scanning electron microscopy siRNA small interfering RNA SMAD2/3 SMA (small body size) mothers against decapentaplegic SN surrounded nucleus SNAP/NSF Soluble NSF Attachment Protein / N-ethylmaleimide-sensitive factor SRm160 serine/arginine (SR)-related nuclear matrix protein of 160 kDa SRP signal recognition proteins StAR steroidogenic acute regulatory protein stau Staufin SUMO Small Ubiquitin-like Modifier swa swallow TC tightly condensed TEM transmission electron microscopy TGFβ transforming growth factor β TNF6 tumour necrosis factor six TNT tunnelling nano tube TORC1 target of rampramycin one TRAPP transport protein particule TSC2 tuberons sclerosis 2 TSH thyroid stimulating hormone snare target soluble NSF attachment protein receptor TZP transzonal projection VAMP vesicle associated membrane protein Vanadate sodium Roth vanadate VASA(DDX4) RNA dependant helicase, dead box helicase 4 VERO green monkey kidney cells visnage vesicle soluble NSF attachment protein receptor Y14 RNA binding Y-14 YBX1/2 Y-box protein 1/2 ZP zona pellucida

Acknowledgments First and foremost I wish to extend my sincerest thanks to my director, my mentor for these past five years, Dr. Claude Robert. It seems like not that long ago I was asking about a Ph.D. position in Quebec City, and that we sat down for lunch in Edmonton to talk about a project. I appreciate greatly all the support you have provided me in my time here. You let me chase some fun concepts, and allowed me to develop and sharpen new skill sets. I know I have needed the occasional major course correction to keep things moving forward and to deal with the challenges we have had in this project. I really do appreciate how you have challenged me to think and to integrate new ideas, and how to tell a story well enough that we can then really sell it. I’m happy that my project hasn’t been a walk in the park and that we have been able to sit down and problem solve, come to solutions, and develop strategies to complete experiments and get our ideas out there and published.

I wish to thank Dr. Francois Richard, my co-director who always offered an external perspective to my work and whose door was open if I needed to talk through an idea or a challenge (usually with some inhibitor!). Your advice and guidance was always welcomed. You also challenged me, and your perspectives and interpretations certainly improved my understanding.

I also have the pleasure to thank Dr. Marc Andre Sirard, Dr. Poul Hyttel, and Dr. Edouard Khandjian, all of whom have had long standing interest in this project through collaboration. I have been able to benefit from techniques and resources that would otherwise not be readily available to me. I truly appreciate the encouragement, and scientific input that was amply provided.

I would also like to thank the external evaluators Dr Alberto M. Luciano, who has put the time and effort into reading and evaluating my thesis and myself.

I have had a diverse challenging project that has tied in a number of techniques and I must extend my sincerest thanks to those who have helped me achieve my goals. Isabelle Laflamme thank you for being the “mother hen” over the fertility lab and for helping me

XXI

manage all those oocytes. Isabelle Dufort, thank you for your help with the molecular work, and the radiation study. Dominic Gagne thank you for your help in the lab, I would never have manage my “pico-schnuts” of RNA without you. Alexandre Bastien, thank you for your help in the microscope lab and also for being a social (scotch) accomplice. Eric Fournier, many thanks to you for your help with the bio-informatics work. I know I had some questions that must have seemed trivial, but I appreciate your patience in making sure that I could understand. Liz St. John, in the King lab at Guelph, thank you for your help in managing huge quantities of oocytes when I was pressed for results. Hanne Holm, in the Hyttel lab in Denmark, thank you for your expertise in sample preparation for the TEM, those techniques are invaluable, and I still am still impressed when I think back on how well it went and what we were able to accomplish with it. Julie Nieminin, from the start you were helping me with paperwork and contact for places to live. Thank you for your time and effort with all that administrative hassle I must have caused you.

While working in the lab I interacted with our post-doc Julieta Caballero frequently. Thank you for being a good role model, and for your fresh input. I certainly aspire to your level of productivity in the lab. Isabelle Gilbert, thank you also for everything in our day-to-day routine. Be it a coffee, something technically challenging in the lab, something administrative, or just to listen to me organize my thoughts. You are always willing to help when I’ve needed it.

Numerous students have also had an impact on my time here personally and within the realm of my project. I need to mention Sara Scantland, my first friend here in Quebec. Thank you for helping me adapt to life in Quebec, and understanding when my brain was fully overwhelmed. Gael and Nico, you were always partners in crime in and around Quebec and abroad. That also goes for Gab my roommate, workout go to guy; and Rémi with your calm approach, ever-ready for a “dégustation de scotch”; you guys have been my all around best buddies here in Quebec. Annie thanks for being a very peppy ray of sunshine, and a bad influence on my sweet tooth. Florence, thank you also for the impact you have had, and continue to have on my life. I have my Spanish cultural influence also in Ernesto and Luis, and an Iranian influence from my lab mate Habib. There have been so

XXII

many past students like Anne-Laure, Audrey, Danny, and Elise who made me feel welcome here in Quebec City and kept things interesting. As well the new students and fast friends like Chloe, Rachel, David, and Simon who are still keeping it interesting.

To my Friends and family I say thank you also. Donald, Susan, and Duncan, thank you for your love and support. Thank you for visiting me, and for bringing me home when I needed it. Of course there are the guys Uzair, Dustin, Andrew, Max, and Steve; and the girls Kim, and Laura, all of those whose lives have remained a part of mine. You have kept me filled up, even over some pretty long distances.

XXIII

Foreword Chapter 2 is a published article, while chapter 3 has been accepted for publication. Chapter 4 is soon to be submitted for publication. Parts of sections 1.4 and 1.5 of the introduction have been published as a book chapter, but has been updated and adapted for appropriate inclusion in the literature review portion of this thesis.

Chapter 2 Angus D Macaulay, Isabelle Gilbert, Julieta Caballero, Rodrigo Barreto, Eric Fournier, Prudencio Tossou, Marc-André Sirard, Hugh J Clarke, Édouard W Khandjian, Francois J Richard, Poul Hyttel, Claude Robert. The gametic synapse; RNA transfer to the bovine oocyte. Biology of Reproduction. 2014. 91 (4) 90, 1-12.

Angus Macaulay was responsible for sample collection and preparation of all fluorescent and electron microscopy, he carried out RNAseq, qRT-PCR, and statistical analysis. Isabelle Gilbert assisted with transcriptomic work, but also carried out integral preliminary experiments essential to this papers conceptual realization. Julieta Caballero assisted with sample production particularly isolation of denuded oocytes and zona pellucidas. Rodrigo Barretto was involved in developing the plasmid and transfection protocol for this work. Eric Fournier and Prudencio Tossou were the bioinformatitions that analyzed the RNAseq data. Marc-Andre Sirard provided the radiation suite and technical assistance for the autoradiography work done at Laval University. Poul Hyttel provided the expertise in his lab to complete the auto radiographic and TEM work. Edouard Khandjian provided knowledge and materials related to the FMRP protein used in this project. Hugh Clark, Francois Richard, Marc-Andre Sirard, and Claude Robert developed this research concept and secured funding for this project. Claude Robert managed and directed this research and provided considerable support interpreting the data. All authors read and offered feedback in the preparation of this manuscript.

XXV

Chapter 3 Angus D Macaulay, Isabelle Gilbert, Sara Scantland, Eric Fournier, Faz Ashkar, Alexandre Bastien, Habiballah Sojaeisaadi, Dominic Gagne, Marc-André Sirard, Édouard W Khandjian, Francois J Richard, Poul Hyttel, Claude Robert. Cumulus cell transcripts transit to the bovine oocyte in preparation for maturation. Accepted; Biology of Reproduction

Angus Macaulay was responsible for sample collection and preparation of all fluorescent and electron microscopy, he carried out RNAseq, qRT-PCR, image analysis, statistical analysis, and wrote the draft including the composition of the figures. Isabelle Gilbert assisted with transcriptomic work, but also carried out integral preliminary experiments essential to this papers conceptual realization. Sara Scantland preformed polysome isolation and RNA extraction for RNAseq work. Eric Fournier completed the bioinformatics analysis of the RNAseq data. Alexandre Bastien provided programming for image analysis. Habiballah Sojaeisaadi assisted with material preparation and sample collection. Dominic Gagne was crucial in his role contributing to the RNAseq sample preparation. Marc-Andre Sirard provided the radiation suite and technical assistance for the autoradiography work done at Laval University. Poul Hyttel provided the expertise in his lab to complete the autoradiographic and TEM work. Edouard Khandjian provided knowledge and materials related to the FMRP protein used in this project. Hugh Clark, Francois Richard, Marc-Andre Sirard, and Claude Robert developed this research concept and secured funding for this project. Claude Robert is the managing director of this research. All authors read and offered feedback in the preparation of this manuscript. Édouard W Khandjian provided materials and supportive knowledge regarding the FMRP proteins. Marc-Andre Sirard, Francois Richard, and Claude Robert conceived the initial concept of this research and secured funding for it. Claude Robert managed and directed this research and provided considerable support interpretation the data.

XXVI

Chapter 4 Angus D Macaulay, Sara Scantland, Édouard W Khandjian, Claude Robert. Fragile X mental retardation protein is present in developing bovine follicles and oocytes and is required for early embryogenesis. Still to be submitted.

Angus Macaulay carried out all oocyte maturation experiments, immunofluorescence, image analysis, statistical analysis, and wrote the draft including the composition of the figures. Sara Scantland contributed to transcriptome experiments and sample preparation. Édouard W Khandjian provided materials and knowledge regarding the FMRP proteins. Claude Robert completed some of the molecular analysis in this paper. Claude Robert and Angus Macaulay developed the concept of these experiments. Claude Robert managed and directed this research and provided considerable support interpreting the data. All authors read and assisted in manuscript revision.

Introduction Section 1.4 and 1.5. Portions are adapted with permission from: Angus Macaulay, Sara Scantland and Claude Robert (2011). RNA Processing During Early Embryogenesis: Managing Storage, Utilization and Destruction. RNA Processing. Book Chapter; Paula Grabowski (Ed.), ISBN: 978-953-307-557-0, InTech

Angus Macaulay, Sara Scantland, and Claude Robert all contributed to the writing of this review paper. Each author reviewed literature and completed sections of the book chapter. Claude Robert managed the division of work and the integration of the sections. Each author was involved in the revision process prior to publication.

XXVII

1 Introduction 1.1 The oocyte; a cornerstone in reproductive biology The female reproductive system propagates life by producing an oocyte that will become an embryo when fertilized by the sperm. Some vertebrate species, famously the komodo dragon, and recently identified shark species, are capable of parthenogenesis naturally producing embryos and offspring without male counterparts. Reproductive cloning by somatic cell nuclear transfer (SCNT) for the production of embryos also bypasses the need for sperm, but requires manipulation within a laboratory environment to occur. These occurrences outline the incredible importance centered on the oocyte in that reproduction can ensue without sperm, but requires the egg and its contribution to the embryo and offspring.

Gross control over female reproduction is a result of influence from the hormones of the hypothalamus-pituitary-gonad (HPG) axis, and myriad growth factors that act within the ovary to finely tune, maintain and modulate the reproductive cycle. Each of these regulators is believed to contribute to and influence oocyte quality over the course of follicle recruitment, oocyte growth and development, oocyte maturation, fertilization, and embryogenesis; processes that all naturally occur within the confines of the female reproductive tract.

Modern technology has been developed to satisfy some reproductive functions artificially, and external to the body like in vitro maturation, fertilization, and embryo culture. Work spanning the last century, but particularly the last half of it, resulted in considerable strides understanding female physiology and allowed artificial techniques to become possible. We continue to explore and unravel the finer mechanics of this incredible system with the hopes of bettering our understanding and exercising more control over the success of pregnancy, and the health of newborn offspring.

1.1.1 Ovarian follicular development and oocyte growth The primary role of the follicle is to support the development of the oocyte. The recruited follicle formation requires several cell types such as those of the theca, granulosa, and cumulus cell layers that surround the oocyte (Figure 1-1) (Fair et al. 1997). Their presence arises over the course of folliculogenesis, the activation of primordial oocyte and its growth into small, and eventually into large preovulatory follicles, the cells types contributing to the latter are outlined in Figure 1-1.

Figure 1-1. The Graafian Follicle Reproduced with permission from: Erickson GF. 1983. Primary cultures of ovarian cells in serum-free medium as models of hormone-dependent differentiation. Molecular and Cellular Endocrinology 29: 21-49

1.1.1.1 Primordial germ cells establish the follicle population During the first few weeks of mammalian embryonic development, primordial germ cells migrate to the genital ridge (Skinner 2005; McLaughlin and McIver 2008). They are characterized by the presence of a quiescent immature oocyte that has not completed meiosis (Mermillod and Marchal 1999). In mammals, like bovine, human, and ovine, the assembly of the primordial follicle starts during late foetal development and ends before birth (Baker 1963; Tanaka et al. 2001). In rodents, however, this process is not completed until shortly following birth (Skinner 2005; Pepling et al. 2007). A great majority of

oocytes are lost between the peak of the primordial germ cell population that migrates to the genital ridge, and the population of primordial follicles that are present at birth (Turnbull et al. 1977). Continual decline occurs until puberty and over the reproductive lifespan of the individual until menopause. The primordial germ cells in humans are present in large numbers during gonad formation peaking around 6 million cells, and dwindle to a smaller population of about 1 million primordial follicles by the time of birth (Baker 1963; Stoop 2005), and even further by the time of puberty. In cattle the numbers are lower, roughly 2.7 million at the peak in utero, with an upper limit of 700 000 at birth, and decreasing to a population of one or two hundred thousand at maturity (Erickson 1966a; Erickson 1966b; Tilly 1996).

1.1.1.2 The primordial follicle The primordial or resting follicle in cattle, like human is small, averaging less than 35 m in diameter and consists of a single layer of flattened granulosa cells (Figure 1-2) (Fair et al. 1997). Both gap junctions and intermediate junctions are present between granulosa cells, though only intermediate junctions are present between the granulosa and the oocyte at this stage (Johnson et al. 1999; Hyttel 2012). There is evidence for endocytosis also at this stage by the presence of vesicles and coated pits on the oocyte membrane and in the periphery of the ooplasm (Hyttel 2012). As well there are many villi present on the surface of the oolemma. The nucleus is typically central with the bulk of the organelles existing in the peri-nuclear space. At this point, the nucleolus is also not transcriptionally active as it possesses granular, but not a fibrillar component (Fair 1997).

1.1.1.3 The primary follicle; morphology and activation The primary stage begins when the primordial follicle has been recruited to grow, it is still surrounded by a single layer of granulosa cells, however these cells are now cuboidal instead of squamous (Figure 1-2). At this stage the zona pellucida (ZP) begins to form, the proteins being exocytosed from the oocyte (Hyttel 2012), though new reports also show that some of these proteins arise from the cumulus cells, but origins may be species specific

(Blackmore 2004). The nucleolus displays less dense fibrillar centers suggesting that transcription is resuming in the oocyte (Fair 1997). The pre-antral follicular growth begins with the activation of the primordial follicle until the development of secondary follicle, and proceeds without gonadotropins, and occurs in foetal ovaries on Days 90 (primordial), 140 (primary) and 210 (secondary), respectively (Knight and Glister 2001). Numerous factors have been demonstrated using knockout rodent models to play some role in the activation or repression of recruiting primordial follicles (Coticchio et al. 2013). Anti mullerian hormone (AMH), phosphate and tensin homolog deleted on chromosome ten (PTEN), forkhead box O3a (FOXO3a), mammalian target of rampramycin (mTORC), and pathway like tuberous sclerosis protein (TSC) have been shown to suppress recruitment (Skinner 2005; Knight and Glister 2006). Further, forkhead box L2 (FOXl2), stromal derived factor 1 (SDF-1), and steroid hormone action from estrogen and progesterone have also been implicated in suppressive roles (McLaughlin and McIver 2008). Activators include V-kit Hardy-Zuckerman 4 Feline Sarcoma Viral Oncogene Homolog (Kit) and Kit ligand, insulin signalling, and phosphoinositide 3-kinase (PI3K) signalling, mTORC activation as well as growth factor signalling like that of leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), growth differentiation factor 9 (GDF9), and bone morphogenic factor 4 (BMP4) (Driancourt et al. 2000; Castrillon 2003; Skinner 2005; Kim 2012; Lu et al. 2015). The interplay of these pathways is still not well-understood thought it may be a balance of activating vs. repressing signalling that drives activation. The mTORC pathway is one that integrates a number of signalling pathways and the eukaryotic initiation factors to regulate translation in mammalian cells (Kim 2012). Further signalling that eventually drives local oocyte growth after this early stage has been attributed to activin and c-type natriuretic peptide (CNP). Activin stimulates the production of FSH receptor in cultured granulosa cells in a dose dependent manner (Nakamura et al. 1993), thus allowing the follicle to eventually respond to the systemic FSH. CNP is a member of a family of proteins that signal through natriuretic peptide receptors, that are cyclases of purine derivatives, and specific to CNP is a receptor guanylyl cyclase termed c-type natriuretic receptor B (NPRB) (Sato et al. 2012). It was demonstrated that CNP stimulated the growth of the pre-antral and early antral follicles through FSH independent cGMP signalling, signalling that could begin to take effect in the primary and secondary follicles as the gap

junctions formed between the granulosa cells and in between the granulosa cells and the oocyte (Hyttel 2012).

1.1.1.4 The secondary follicle The secondary follicle is considerably larger than the primary, greater than 100 m in diameter (Fair 2003). There are many layers of cuboidal granulosa cells. The inner most layer of granulosa cells also display processes that project across the ZP towards the oolemma termed transzonal projections (TZPs) that are anchored by adherenes-like junctions, and at this stage gap junctions begin to form between the oocyte and the granulosa cells (Hyttel 2012). Cortical granules are present at this stage, and the nucleolus is very active (Fair 1997). The theca develops as the oocyte grows coinciding with the secondary follicle stage. Chemical signals from the granulosa cells like platelet derived growth factor (PDGF) and basic fibroblast growth factor (bFGF), increase the expression of kit ligand that promotes the acquisition of mesenchymal cells that become the theca layers, to the basil lamina of the follicle (Knight and Glister 2006). The theca cells form two layers, the interna and the externa. The theca interna becomes very vascularized and is useful for clearing waste and transporting nutrients, while the theca externa is a more loosely associated group of cells but contains smooth muscles cells (Magoffin 2005). Interestingly kit ligand is expressed throughout follicle growth and oogenesis, and has been shown to play a role regulating FSH induced estradiol production in response to oocyte factors (Miyoshi et al. 2012).

1.1.1.5 Antral follicle development Small tertiary follicles are approximately 1 mm in diameter and have an oocyte with a complete zona pellucida, and is surrounded by many layers of granulosa cells that can now be divided into closely oocyte associating cumulus cells, the inner most lay of which is referred to as the corona radiata, or more distant granulosa cells (Fair et al. 1995). Encircling the granulosa cells is a basil lamina surrounded by the theca cell layers (Figure 1-1). Further changes to the organization of the oocyte’s organelles are occurring, and

continue to occur in the large tertiary follicle where the oocyte itself is greater than 100 m in diameter (Fair 2003). In bovine oocytes, hooded mitochondria are present at this stage, cortical granules are present in clusters near the periphery of the oocyte (Fair et al. 1997). At this stage the follicular antrum, a fluid filled cavity, begins to form and is present within the follicle (Reese 2004). The granulosa cells by, the production of hyaluronan and versican create an osmotic gradient draw fluid into the follicle to create the antrum (Rodgers and Irving-Rodgers 2010).

As the oocyte approaches full size, the nucleolus begins to form tighter, electron dense foci, suggesting that translation is slowing down (Lodde et al. 2008). Once bovine oocytes have reached full size, greater than 120 m in diameter, and the follicle diameter is about 3 mm, the level of transcriptional activity is miniscule if not completely arrested (Fair et al 1997). This occurrence and its implications will be addressed further in section 4 of this thesis.

Depending upon the species, the fully-grown mammalian oocyte ranges from 70 to 140 μm in diameter and is much larger in reptiles, fish and birds by the time of ovulation and the relationship between the size of the follicle and of the enclosed oocyte in several mammalian species can be found in Table 1-1. The mammalian oocyte typically reaches its full diameter before the follicle has reached full size (Fair et al. 1995).

Table 1-1. The size of the follicle in which a fully-grown egg can be found, and the size at which the follicle will ovulate by species Follicular size at Size of pre- Size of full Specie which full grown ovulatory References grown oocyte oocytes are found follicle Human > 105 μm 5 – 7 mm > 20 mm Gougeon 1986 Mouse 70 μm > 2 mm 4 mm Rose et al. 1999 Sheep > 120 μm ≈ 1.5 mm > 5 mm Turnbull et al. 1977 Bovine > 130 μm > 2 mm 20 – 25 mm Fair et al. 1995 Pig 105 μm > 3 mm > 10 mm Griffin et al. 2006 Žitný et al. 2004 Rabbit 80 - 90 μm 650 – 700 μm > 1.6 mm Osteen and Mills 1980 Hulot and Mariana 1985

Gonadotropins are required for follicular growth at the tertiary stage (Richards 2001). For many mammalian species such as in women, cows, sheep, horse, and goat, follicular development occurs in waves (Webb et al. 1992). Cows cycle with two or three follicular waves during a period of 21 (2 waves)-23 days (three waves), and only one of the waves is ovulatory (Pierson and Ginther 1984; Sirois and Fortune 1988). For recruitment, a rise in FSH allows medium antral follicles (> 5 mm) to undergo further growth. Insulin-like growth factor (IGF) signalling at this stage is also critical, as otherwise large follicle growth cannot proceed (Baker et al. 1996; Monget et al. 2002). Towards the end of the luteal phase, FSH concentrations appear to be higher in one medium sized follicle in comparison to others driving further growth and an earlier transitions to LH responsiveness (Erickson 2008). After this mechanism of selection for one of the largest follicles occurs, that follicle produces estradiol and inhibin to suppress the growth of other follicles, allowing only it to become the preovulatory follicle (Soede et al. 2011). In the case of poly ovulatory species where the many follicles ovulate, the suppression is produced by a number of large follicles that simultaneously arrive at ovulation (Soede et al. 2011). The exact selection mechanism is not fully understood, however, inhibin feedback affects the FSH and allows further growth and the transfer of dependence from FSH to LH occur in several follicles (Russell and Robker 2007), likely by affecting the timing of mRNA expression of LH receptor in granulosa cells that is also involved (Webb et al., 1999). When the biggest follicle of the cohort reaches 8 mm, differences are observed between the future dominant and the other subordinates follicles (Ginther et al. 1996; Driancourt 2001). Follicular growth will continue until the pre-ovulatory stage until the follicle has reached greater than 18 mm of diameter if it is dominant (Turzillo and Fortune 1990). After the ovulation, the follicle luteinizes and transforms into corpus luteum (CL).

During follicular growth, the follicles will produce estradiol (Liu and Hsueh 1986). In the presence of a CL during the luteal phase, progesterone (P4) will inhibit the LH surge and wave regression will occur without ovulation. In the follicular phase, however, the absence of a CL, the increased concentration of estradiol will stimulate the LH peak and the dominant follicle will ovulate (Adams et al. 1994; Fortune 1994). After ovulation, the follicular cells formerly the granulosa and theca, will form a CL that will secrete P4 to

prime the uterus should a pregnancy occur (Reese 2004). It takes 15 days for the cow to recognize pregnancy the agent of recognition being the production of interferon Tau (Kubisch et al. 2001). In humans, chorionic gonadotropin produced by the early implanted placenta is responsible for maternal recognition (Chuan et al. 2014). In the bovine, if no embryo is present, the uterus produces prostaglandin F 2-alpha to cause CL regression in preparation for the next period of estrus (Reese 2004).

Figure 1-2. Different stages of folliculogenesis Reproduced with permission from: Li and Albertini. 2013. The road to maturation; somatic cell interaction and the self-organization of the mammalian oocyte. Nature Reviews Molecular and Cellular Biology 14: 141-152.

1.1.1.6 Follicular Atresia Follicular atresia is the term used to identify the loss of follicles that occurs by apoptotic removal of granulosa cells, oocytes, and ultimately the follicle itself (Tilly 1996; Matwee et al. 2000). Each ovarian cycle sees the recruitment of a number of oocytes to grow but never ovulate even after reaching a significant size within the ovary (Turnbull et al. 1977; Irving- Rodgers et al. 2001). These subordinate follicles regress in favour of the selected dominant follicle in what appears to be a wasteful process that is likely intended to provide a continuous supply of oocytes for the window of ovulation.

Hormones, oxidative stress, and exogenous toxicants like chemotherapy can cause granulosa cell apoptosis (Trapphoff et al. 2010). These factors typically unbalance the growth signalling in the follicle that protects against apoptosis and allows pro-apoptotic signalling to dominate thus resulting in the demise of the follicle (Coticchio et al. 2013). Different patterns of follicular atresia have been identified in the cow depending upon where the apoptosis occurs either antrally, or basally within the granulosa cells (Irving- Rodgers et al. 2001). Basal apoptosis comes the invasion of immune cells and vasculature, while antral apoptosis results in cellular death without eliciting an immune response and is the classically identified pattern of apoptosis in large (>8mm) follicles. Interestingly apoptosis is present in growing follicles (Nivet et al. 2013), and the more proliferation that occurs coincides with a higher apoptotic index (Quirk et al. 2004). The cells are susceptible to apoptosis in the follicle particularly in the G1-S transition of the cell cycle, and are protected by estrogens and growth factors that help to promote a quick transition (Quirk et al. 2004). Apoptosis signalling is often initiated by the tumour necrosis factor family member cytokines that include tumour necrosis factor (TNF), Fas Ligand, and TNF related apoptosis inducing ligand (TRAIL), that will initiate the caspase cascade of signalling leading to cell death (Takai et al. 2007).

Reactive oxygen species (ROS) signalling may also play a role in atresia. Typically ROS accumulates as a by-product of cellular metabolism, and when reaching an excessive point, negatively impacts cells by causing damage to DNA, lipids, and protein (Coticchio et al. 2013). Some observations have suggested that these effects can be counteracted by estradiol (Murdoch 1998; Lund et al. 1999) an indication of what may be advantageous for the dominant follicle. It is interesting, however, that even the dominant follicle eventually displays some level of atresia in the granulosa cells (Nivet et al. 2013; Girard et al. 2015). Further, follicular coasting, a method of ovarian stimulation to produce higher quality oocytes from large follicles seems to provide a small push in the direction of apoptosis, or at least cause a cessation in growth and proliferation, in large follicles resulting in exceptional rates of oocyte quality upon ovarian pick-up (OPU) and embryo production (Nivet et al. 2012; Labrecque et al. 2014).

1.2 Intercellular signalling in the cumulus oocyte complex governs growth and maturation of the oocyte It was long believed that the gamete’s growth was governed by signalling from the outside- in, allowing the gamete to passively benefit (Biggers et al. 1967). It is now, however, established that a collaboration of cumulus cells and oocyte signals are essential to the growth and maturation of the gamete (Eppig 1991; Hussein et al. 2006). Currently, two main modes of communication are established: the first, where paracrine factors from one cell target a receptor that is found on the target cell (Hussein et al. 2006), and the second where small molecules are transferred between cells via gap junctions (Tsafriri et al. 1972).

Since the cumulus cells are anchored to the oocyte by adherens-like junctions, catenin and cadherin proteins are present and also interact with the actin cytoskeleton (Meng and Takeichi 2009). Recent exploration of mechanical signalling events through the cytoskeletal network and interacting proteins may also be at play in the oocyte, an example being WNT-Beta Catenin signalling and adhesion formation (Wang et al. 2009). The impact and extent of this mechanical signalling is unknown though significant remodelling of the GV and oocyte cytoskeleton occurs whilst the cumulus retract and lose their connectivity with the oolemma (Hyttel et al. 1997; La Fuente 2006). This signalling may also have a role in fertilization events (Caballero, et al. 2014).

1.2.1 Paracrine communication Cumulus cells are subject to the physiological signals from the pituitary that reach the oocyte, however, also are subject to signals generated from the oocyte (Hussein et al. 2006). The control of oocyte maturation is a complex chain of events that includes gonadotropins, steroid intermediates, like meiosis activating sterol (Faerge et al. 2001), and other signalling peptides like Kit ligand and the EGF-like peptides, and influences cellular levels of second messengers from the granulosa and theca cells, like cAMP, cGMP, IP3, DAG, and calcium which are involved in the resumption of meiosis (Park 2004). These signals and the events they trigger are carefully coordinated, and involve systemic signals

and responses, as well as local input like those from oocyte-secreted factors (OSFs) to generate the synchrony required for appropriate and simultaneous follicle and oocyte growth (Hussein et al. 2006). Disruption of these pathways can result in a block to complete meiotic resumption. The most recognized OSFs are growth differentiation factor nine (GDF9) and GDF9b, often referred to as bone morphogenic factor fifteen (BMP15) and are part of the transforming growth factor beta family (TGF) (Hussein et al. 2006; Gilchrist 2011). Their role in communication acts a as a signal to stimulate the granulosa and cumulus cells proliferation (Hickey 2005). They also function to prevent luteinisation of the granulosa cells, inhibit apoptosis, and regulate metabolism. These factors transmit their signals through SMAD2/3 and EGFR-ERK1/2 signalling pathways to alter gene expression and cell function (Gilchrist 2011).

There is a notable gradient of transcript differences present in the cumulus cells near to the oocyte in comparison to those approaching the mural layers of granulosa cells, and it is believed that this is due to signalling OSF and FSH gradients present in the follicle (Wigglesworth et al. 2015). EGF was initially found to initiate oocyte maturation in vitro and then, (Dekel and Sherizly 1985; La Fuente et al. 1999) EGF-like peptides, amphiregulin, epiregulin, and beta-cellulin, were found to stimulate the EGF receptor in the follicle in response to LH (Park 2004). These molecules bind surface receptors that then signal MAPK and other pathways like Akt and JNK to affect transcription and translation within the target cells or oocyte (Oda et al. 2005; Richani et al. 2013).

It should be noted that the cumulus cells are not the only cells involved in the control of meiosis resumption. The theca cells also have been shown to act to inhibit germinal vesicle breakdown (GVBD) (Richard and Sirard 1996a). A soluble 214 kDa factor was proposed to be secreted from the theca cells and was shown to inhibit oocyte maturation by action through the granulosa cell (Richard and Sirard 1998). This process appears to function through small molecular weight protein from the theca cells, affecting processes of the cumulus cell, and subsequently the oocyte. Without the cumulus cells, there was no effect on the oocyte (Richard and Sirard 1998).

1.2.2 Communication by small molecule transfer Gap junctions are present within the cells of the COC (Kidder and Mhawi 2002). This signalling is accredited with the prevention of meiosis resumption once the oocyte is fully grown (Conti et al. 2002). They are hexameric junctional pores made up of connexin (cx) subunits. Typically, gap junctions permit the passing of small molecules, like cyclic nucleotides, (less than 1kDa) between their openings (Simpson et al. 1977). In mice, the oocyte produces cx37 while the cumulus cells and granulosa cells produce cx43 (Simon et al. 1997; Kidder and Mhawi 2002), while in cattle cx43 is also produced in the oocyte (Calder et al. 2003; Fair 2003). The different proteins determine the size of the pore creating heterotypic junctions in between the cumulus cells and the oocyte when the junctions are made of a mix of proteins as seen in mice, and homotypic junctions with the same proteins more common in cow (Sutovský et al. 1993; Granot and Dekel 2002). In swine, the cx43 connexin protein is regulated by gonadotropins in maturation, primarily by the LH effects that can be reproduced using equine chorionic gonadotropin in vitro, while other connexins remain unaffected (Santiquet et al. 2013). In mice a similar LH signal causes a closure of gap junctions (Norris et al. 2010), while in cattle there is a disassociation of gap junctions that begins post germinal vesicle breakdown (GVBD) (Hyttel 1987), and gap junction signalling until this point may aid in chromatin remodelling (Luciano et al. 2011), thought the complete signalling pathway is not fully understood,

Two cyclic nucleotides, cGMP and cAMP dictate oocyte meiosis resumption (Norris et al. 2009). Levels of cAMP within the oocyte are kept high by open transit through the gap junctions keeping the oocyte arrested (Gilchrist 2011). Eventually, inhibition of phosphodiesterase 3 (PDE3) function within the oocyte by cGMP transfer to the oocyte in the same manner causes degradation of cAMP and allows meiosis progression to occur (Norris et al. 2009). Energy substrates like pyruvate and NADPH, and amino acids, and purine substrates like phosphorybosalpyrophosphate (PRPP), are also transferred via gap junctions between the cumulus cells and the oocyte to satisfy the large metabolic demand of the oocyte that is necessary for embryogenesis (Sutton-McDowall et al. 2010). This need of external substrates are also addressed by the usage of alternative means of energy production like the adenosine salvage pathway that utilizes phosphocreatine in a system to

produce ATP has recently been shown in oocytes during their maturation (Scantland et al. 2014). It appears also that these adenosine salvage pathway (ASP) substrates can even diffuse in the media between oocyte complexes to help denuded oocytes maintain a higher level of ATP.

New reports provide a different perspective as to what communication could be mediated by gap junctions. A previous observation (Valiunas et al. 2005) saw siRNA pass through gap junctions implicating exogenous transcripts as potential signalling molecules. The researchers utilized morpholino probes to show passage through gap junctions made of cx43 but not cx32/cx26 and successfully used siRNA for the knockdown of polymerase beta function. Of note, cx43-cx37 heterodimers present in the oocyte have not been tested. They also showed that shorter sequences worked better and faster for RNA interference, and that longer sequences (>24 bp) were less likely to pass perhaps because they form secondary structures. Another observation showed that functional microRNA transfer could occur between glioma cells and neighbouring cell populations (Katakowski et al. 2010). A luciferase reporter signal in the receptor cells was shown depleted by the transfer of microRNA from transfected glioma cells in co-culture. This function was disrupted by carbonoxolone (a gap junction disruptor). Loss of gap junctions between the TZPs and oolemma was found to be an early feature in the process of meiotic resumption in cattle COCs (Hyttel et al. 1986). So activity and transfer of material through this manner would need to be completed by this point. In the closely controlled syncytium of follicle cells and oocyte where there is an abundance of gap junctional communication, it would be possible that some regulation of cellular function could be affected by exogenous transcripts like short siRNA being shuttled between cells. Intercellular RNA exchange would be a novel concept if identified in the COC and follicle.

Figure 1-3. Intercellular communication between the cumulus cells and the oocyte

1.3 Meiosis Resumption and Oocyte Maturation The oocyte begins maturation as a cell that has been arrested at prophase one of meiosis for a long time. This awakening is a release from suppressive factors in the follicle, and is the beginning of the final step towards becoming haploid and creating the opportunity to fertilize and propagate life (Reese 2004). As maturation occurs, a major feature is germinal vesicle breakdown (GVBD) (Reese 2004; Coticchio et al. 2013). The process of GVBD in vivo begins with the LH surge, and is visible through nuclear changes in the oocyte that commence with the dissolution of the nuclear envelope into tubules of smooth endoplasmic reticulum and with the condensation of the chromosomes (Hyttel 2012). Visible cytoplasmic events during maturation result in a consistent phenotype in cattle oocytes

where cortical granules are found moving to the periphery of the ooplasm, the mitochondria and lipid droplets are central in the oocyte, and the Golgi apparatus has disappeared, leaving an area in between with very few organelles except for a large network of smooth endoplasmic reticulum (Hyttel 2012).

In pre-ovulatory follicles, the same CNP function in the presence of FSH is a part of the stimulus that drives follicle growth, while preventing the oocyte from undergoing meiosis (Santiquet et al. 2014). Further, the LH surge is known to decrease the expression of CNP in mural granulosa cells via EGF-like factor signalling (Wang et al. 2013). Simultaneously, EGF-like signalling affets the cumulus cells to cause a decrease in their expression of the CNP receptor, so that both less substrate and receptor result in decreased levels of cGMP within the cumulus cells. The cumulus cells therefore cannot sustain cGMP transfer to the oocyte that would inhibit PDE3 function permitting the oocyte to resume meisosis as cAMP levels fall (Franciosi et al. 2014).

The coordinated hormonal and molecular signals acting through the cumulus cells on the oocyte to decrease cyclic nucleotides ultimately release phosphorylation inhibition of cyclin-B- CDK1 (p34-cyclin-dependent-kinase 2) a complex that is also called M-phase promoting factor (MPF), responsible for maturation resumption (Kishimoto 2003; Dekel 2005). This is a classic example of gene expression control operating at both the translational and post-translational levels (Masui 2001). First, both CDK1 and CCNB1 have to be present (Polanski et al. 1998; Kotani et al. 2013). Depending on the species, one of the two proteins is usually present in the cytoplasm whereas the other has to be translated in a time-specific manner to allow meiosis resumption (Chesnel and Eppig 1995; Fair et al. 1995). Second, the complex must be activated. MPF is dephosphorylated when the oocyte’s cAMP levels drop at the LH surge (Schultz et al. 1983; Sela-Abramovich et al. 2006), and becomes active causing high levels of mitogen activated protein kinase (MAPK) activation. MAPK in turn drives protein function including phosphorylating connexion 43 closing gap junctions (Norris et al. 2008), and cytoskeletal events that separate the chromosomes and extrude the first polar body. For further cell cycle steps to occur allowing the oocyte to reach metaphase two, MPF must be degraded by proteasomes (Tokumoto et

al. 1997; Dekel et al. 2000; Dekel 2005). Further regulation occurs by the same LH signal through the PKA pathway using an intermediate cdc25 phosphatase that removes the phosphorylation from CDK1 activating it and causing further protein action driving the cell cycle forward (Jaffe and Norris 2010).

1.3.1 In vitro maturation and embryo production Assisted reproductive technologies (ARTs) particularly in vitro embryo production are in frequent use today and are the result of considerable research efforts that spanned the 20th century (Betteridge 2003). The successful application of in vitro maturation (IVM) and in vitro fertilization (IVF) also permits the propagation of desirable genetics in livestock worldwide, assists many men and women to overcome challenges to their fertility, and most fundamentally has advanced our understanding of our reproductive physiology. In 2011 alone, 6381 infants were born with the help of ART in Canada, an increase of 30% over the year before (Canadian Assisted Reproductive Technologies Registry data) When oocytes are collected from small antral follicles the oocytes must be matured, as they have not yet resumed meiosis. This step is critical to bring an oocyte to metaphase two where it can be fertilized, and if maturation can be done efficiently it significantly amplifies the number of potential embryos that can be produced by an individual and is thus used as a tool to propagate valuable genetics from certain individuals in livestock (Bousquet et al. 2003). This strategy of IVM can also be used in Humans to improve the number of oocytes collected, but rates of maturation remain poor (Guzman et al. 2012).

When oocytes are collected for maturation in vitro many differences are present compared to those that develop in vivo including their ability to produce embryos (Mermillod and Marchal 1999). Oocytes collected for in vitro maturation from slaughtered cattle are taken from follicles between two and six millimeters in diameter (Sirard and Blondin 1996; Nivet et al. 2012), while ovulated oocytes come from >20 mm follicles (Reese 2004), and often ovum pick up (OPU) oocytes are coming from larger antral follicles greater than 5-10 mm in diameter (Plourde et al. 2012). Most of the 2-6mm follicles used for in vitro work would normally not ovulate, however if they were to do so, would stay in the ovary for another 6-

8 days (Fair 2003; Adams et al. 2008). This period is replaced by a 24-hour incubation in vitro. When the oocytes are removed from the follicle and placed in maturation media, nuclear maturation progresses spontaneously (Pincus and Enzmann 1935; Edwards 1965; Sirard et al. 1989). This is a result of a release from meiotic inhibition previously mediated by the follicle (Richard and Sirard 1996b; Richard and Sirard 1996a). Inhibitory release in vivo coincides with the LH surge, so that the ovulated oocyte has already undergone its nuclear maturation. A major challenge is understanding the differences between these two pools of oocytes, that are both able to mature fertilize and produce embryos, albeit at very different rates, 40% at best for in vitro transfer and up to 100% for in vivo transfer after stimulation and OPU depending upon the animal (Mermillod and Marchal 1999; Bunel et al. 2014). The factors contributing to the differences in success with each type of oocyte is based upon interactions within the ovary and the ability of the oocytes to mature in cytoplasmic or molecular fashion that would not be permitted under in vitro conditions and subsequent differences in transcription are detectable (Plourde et al. 2012). That said, fertilization and embryo production in vitro is still possible, and efforts to homogenize the quality of the oocytes used in this process are under investigation.

An interesting observation in vitro is the existence of a period of spontaneous ex vivo events where unknown cytoplasmic factors affect oocyte quality (Blondin et al. 1995). These events occur several hours after the animal has been slaughtered, with the optimal range for oocyte collection from these ovaries is actually 3.5-4.5 hours post mortem (Blondin et al. 1995). These results showed significantly poorer blastocyst rates occurring in oocytes collected less than three hours and more than five hours post mortem. While no mechanism was reported, effects of the hypoxic conditions of the follicles in these oocytes were thought to have a potential role influencing the oocyte.

Nuclear progression, once begun, proceeds at nearly the same rate in vitro compared to in vivo produced oocytes. The process takes approximately 18 hours in cattle oocytes with oocytes averaging 6.5 hours to GVBD, 10.5 hours to meiosis one begins, 16 hours until body extrusion, and between 18 and 22 hours to reach MII (Sirard et al. 1989). As not all oocytes follow this timing precisely, maturation in vitro is performed for 22-24 hours

allotting for slower oocytes to “catch up”. At MII arrest, oocytes are prepared to extrude their second polar body upon fertilization (Coticchio et al. 2013).

Complex media are used to aid oocytes for maturation, for fertilization, and for development during in vitro culture, with differences existing based on reproductive technique (Mastromonaco et al. 2004). The goal is to mimic the environment that occurs in vivo. Maturation media is typically a pH buffered salt balanced solution, with a pH indicator, and is conditioned for the environment of the incubator. Serum, a biological extract, is often present and introduces undefined elements to media (Rizos 2002). Commonly maturation media contains added estradiol, FSH, and LH to mediate the events of maturation so that the oocyte can arrive at MII stage and be fertilized. There is also pyruvate, an energy substrate to help support the metabolism (Biggers et al. 1967). Numerous studies focused to improve maturation, the most important step of the in vitro processes since if the oocyte cannot mature properly, fertilization and complete embryonic development would not occur (Rizos et al. 2002). Many different systems have been tested with supplemented amounts of different hormones, with different cell types as feeder layers like green monkey kidney cells (VERO) or buffalo rat liver cells (BRL), with different energy substrates, and with a matrix layer; (Table 1-2). While some increases in embryo production were found significant, there seems to only be an attainable plateau of success reaching to 40-50% as a rate of cleaved embryos in the bovine model. Regardless of the many variations on the oocyte maturation and embryo production system, embryos can be produced at these satisfactory rates and of sufficient quality for embryo transfer and research.

Table 1-2. Embryo production in different systems Blastocyst rate Blastocyst rate Species and Treatment control (%) treatment (%) references Addition of T (42.6 ng/mL) 59.1 ± 8.7 46.6 ± 6.2 Bovine Addition of A4 (562.5 ng/mL) (of cleaved oocytes) 55.5 ± 8.3 Macaulay et al. 2013 (to maturation media) Thyroid hormone 28.0 42.0 * Added to IVM (of cleaved oocytes) Bovine Thyroid hormone 36.0 Ashkar et al. 2010 45.0 * Added to IVC (of cleaved oocytes) T 100 nmol/L 20.0 ± 2.0 (to maturation media) 19.0 ± 3.0 Bovine DHT 100 nmol/L (of total oocytes) Silva 2000 20.0 ± 3.0 (to maturation media) IGF 1 100ng/mL 27.9 ± 1.3 Bovine 29.4 ± 1.3 (added to culture) (of total oocytes) Block 2008 5.56 mMol glucose 27.0 Bovine 17.5 (added to culture) (of total oocytes) Gutierrez-Adan 2001 1mM phosphocreatine 32.0 Bovine 32.0 ** added to culture (of total oocytes) Scantland 2014 Co-Culture with fibroblasts 33.0 Human on production of transferable 40.0 * (of cleaved oocytes) Wetzels 1998 embryos 34.0 Murine Co-Culture with VERO cells 59.0 (of cleaved oocytes) Lee 2001 30.4% Bovine VERO cells Vs. VERO+BRL 42.9% (of cleaved oocytes) Duszewska 2007

With BSA vs Defined 0 25.0 15.0 Bovine 3mM PVA (of total oocytes) 35.0 Keskintepe 1996b

Serum substitute 29.1 28.5 Bovine Serum substitute + EGF (of total oocytes) 29.15 Sagirkaya 2007 (10 ng/mL) with 10% FCS Human tubal fluid (HTF) vs 32.0 Murine 51.7 HTF + matrigel (of cleaved oocytes) Lazzaroni 1999 5.7 Human Control vs matrigel 36.4 (of cleaved oocytes) Novin 2007

*Resulted in improved development rates ** Resulted in improved blastocyst hatching rates

1.3.2 Maturation of Denuded Oocytes Some oocytes can progress through nuclear maturation in vitro when denuded, though at a rate about 50% lower than in cumulus oocyte complexes (Sirard 1988; Luciano et al. 2005). The most notable impact appears when the oocytes fail to develop to the blastocyst stage

(Sirard 1988; Luciano et al. 2005). This decreased developmental potential can be improved by co-culturing the oocytes with intact COCs, in cumulus cell pre-conditioned media, or with the presence of free cumulus cells suspended in media (Luciano et al. 2005). There is evidence that the oocytes and cumulus cells are capable of re-establishing gap junction connections (Feng et al. 2012). Certainly the importance of the cumulus cells for improved embryogenesis is clear. They are a necessity for the signal transduction to the oocyte. A summary of several studies presenting results for various denuded culture, and co culture is shown in Table 1-3.

Table 1-3. Bovine and murine rates of denuded oocyte development in different culture systems

Early Maturation Late Embryo Embryo Conditions Specie Efficiency Development Reference Cleavage (%) (%) rate (%) Maturation of 84-90 85 34 (Avery and Greve 2000) Cumulus enclose Bovine Not Reported 94 34.8 (Luciano et al. 2005) oocytes 70.8 76.7 26.7 (Dey et al. 2012)

52.3 45.5 11.1 (Dey et al. 2012) Maturation of Bovine Not reported 85 8.6 (Luciano et al. 2005) Denuded Oocytes Not reported 45.14 15.97 (Feng et al. 2012) (Buffalo) Maturation of denuded oocytes 68.5 50.9 20.5 (Dey et al. 2012) Bovine with cumulus Not reported 93 22.7 (Luciano et al. 2005) enclosed oocytes

Bovine Not reported 78 5.8 (Luciano et al. 2005) Maturation of 54.35 Denuded oocytes ~ 60 21.74 (monolayer) (Feng et al. 2012) with cumulus Bovine (with “loose” 56.89 (Buffalo) cells cells) 25.75 (cell clumps)

Maturation of (Chang 2005) cumulus oocyte Murine 95 86 67 *PMSG group complexes (Dey et al. 2012) Maturation of 52.3 45 11.1 Murine (Chang 2005) denuded oocytes 84 78 25 *PMSG group Maturation of denuded oocytes Murine 68.5 50.9 20.5 (Dey et al. 2012) with cumulus oocyte complexes

1.3.3 Challenges for In vitro embryo production In vitro systems do not recapitulate the in vivo environment (Rizos et al. 2002). It appears that the challenges with the in vitro systems arise from two sources: firstly from suboptimal materials like media, hardware, and handling techniques do not adequately simulate the in vivo situation; and secondly from the intrinsic quality of the gametes themselves as they are often removed during maturation, and as stringent identification methods for quality are currently limited to morphology that cannot always be used to identify optimal conditions (Blondin and Sirard 1995). In oocytes, scoring criteria exist to rate the oocytes by their visual appearance including the colour and granulation of the cytoplasm, the number of cumulus cells, and the state of expansion or atresia of those cumulus cells, however, these are not always indicative of oocyte competence (Blondin and Sirard 1995; De Bem et al. 2014). There is continued exploration in search of inexpensive non-invasive quality markers for gamete selection. Examples include the evaluation of the cumulus cells (Bunel et al. 2014), and brilliant cresyl blue staining of oocytes as a G6PDH sensor to detect metabolically “silent” or “prepared” oocytes that are believed to be of better quality for embryo production (Bhojwani et al. 2007). Even after this careful selection not all oocytes are capable of sustaining embryonic development. The best rates of in vitro embryo production in cattle without hormonal regimens reach 45% embryos of oocytes collected. Maturation rates of oocytes from small antral follicles from healthy reproductive aged animals are often between 80-90% (Avery and Greve 2000). Similar morphological scoring exists for embryos (IETS guidelines), and correlations to their speed of development have been made to quality (Orozco-Lucero et al. 2014). Further when dealing with embryos, more invasive blastomere biopsy and evaluation is possible for a more comprehensive preimplantation genetic diagnostic (PGD). Caution is required as elaborate evaluation of genetics can be technically challenging, error prone, expensive, and involves a perturbation to the embryo (Tsafrir et al. 2010). Other studies to evaluate the metabolism in early embryos and their media have been done with the objective of correlating metabolism to embryo quality (Baumann et al. 2007; Leese et al. 2007). Some correlations have been drawn to good pregnancy outcome (Brison et al. 2004), however the resulting theory suggests that a good quality embryo is unperturbed, unreactive, and “quiet” in its metabolism.

1.4 RNA is stored by the oocyte Usually, in somatic cells, the existence of a transcript is brief (Yu and Russell 2001). Beginning with transcription, the molecule can then be processed, edited, and transported prior to translation, and ultimately ending with its degradation (Lodish et al. 2012). The production of RNA begins inside the nucleus transcribed from the template DNA. Strand synthesis is followed by the splicing of introns to generate a sequence with the appropriate code (Lodish et al. 2012). Then the 5’ cap and 3’ polyA tail are added to the mature RNA, that complexes with proteins to mediate export from the nucleus through its pore structure into the cytoplasm where the RNA will interact with ribosomes and be translated into protein (Lodish et al. 2012). After the RNA has been utilized it is deadenylated and destroyed in the processing bodies (p-bodies) composed of RNA binding proteins, associated nucleases, and decapping enzymes within the cytoplasm (Eulalio et al. 2007; Zheng et al. 2008; Flemr et al. 2010).

This cycle would occur for most mRNA transcripts in the aforementioned pattern, except that there are occasions, particularly in neurons, where the transcripts are stabilized and shuttled throughout the cell for distal translation with a temporal delay (Park 2004; Antar et al. 2005). It is more efficient to move a transcript and then generate large volumes of protein, than it is to relocate large amounts of protein to a specific region of the cell (Lodish et al. 2012). This movement also creates specific subcellular regions capable of interacting in different and unique ways with their surrounding tissue, or behaving differently in developmental fate (Ferrandon et al. 1994; Irion et al. 2006; Lodish et al. 2012).

In the egg, this exception is more the norm as transcripts are produced but stored for long periods of time while the gamete exists in a state of transcriptional suppression so that it may undergo chromatin remodelling to prepare for the continuation of meiosis and transition into the first mitotic divisions of the early embryo (Fair, et al. 2008).

1.4.1 Establishing the stores of RNA in the oocyte The oocyte’s cytoplasm represents a rich source of messenger (Gilbert et al. 2009) and non- coding RNA (Caballero et al. 2014). Although some reports indicate a potential role of the spermatic RNA molecules (Lalancette et al. 2008), the resources accumulated in the egg during oogenesis undisputedly support the vast majority of early embryonic development.

Oocyte growth is accompanied with the accumulation of large amounts of RNA observable in the early growth phase. In mice, by about 65% of growth to full size, 95% of the RNA has accumulated, the remaining 5% occurs over the final stages of growth (Pedersen and Peters 1968). The build-up of maternal RNA stores is driven by transcriptional activity of the gamete’s genome (Tomek et al. 2002). In most mammalian species, this transcriptional activity is however; greatly reduced or completely shut down once the oocyte reaches its full size (Table 1-3). Some studies show clear patterns of transcription shutdown like in the pig and in cattle (Fair et al. 1995). By measuring the rate of 3H-uridine incorporation it was shown that RNA synthesis is fully active during early oogenesis, but as the oocyte grows, this activity shuts down, and by the time the oocyte is full size, activity that remains is limited to the nucleolus (Moore and Lintern-Moore 1978). In the mouse, however, the shutdown of transcription is very brief and occurs just before meiosis resumption (Rodman and Bachvarova 1976).

In non-mammalian species, aside from endogenous transcription, accumulation of maternal RNA is also known to occur through RNA transfer from the surrounding somatic cells. In C. elegans, Drosophila, and Notonecta, maternal mRNAs are transferred to the oocytes through translocation channels or cell–cell bridges that connect nurse cells and the oocytes (Figure 1-4) (Hurst et al. 1999). As germ cells divide to become oocytes in the Drosophila, they remain directly connected to each other by connections termed ring canals (Figure 1-4) (Deng and Lin 1997). Aggregates of RNA move from the other germ cells, or from supporting cells to the oocyte in an ordered method (Hurst et al. 1999). The transfer of mRNA between cells may be motor protein mediated as mRNA can associate to form a ribonucleoparticle (RNP) with motor-like proteins, or proteins that associate with dyneins (Hurst et al. 1999; Schnorrer et al. 2000). This RNA accumulation through endogenous

transcription and/or transfer from surrounding somatic cells and oocytes makes the immature oocyte the most RNA rich cell of the body. Although numbers differ between studies, total RNA content differs importantly between species (Table 1-3).

Figure 1-4. Open communication channels between gametes Figures reproduced with permission from Wolke, Jezuit and Priess (2007) and Deng and Lin (1997). Top panel (M) shows open cellular channels in c. elegans; Wolke, Jezuit, and Priess. 2007. Actin-dependent cytoplasmic streaming in C. elegans oogenesis. Development 134:2227–2236. Bottom panel (B) shows drosophila gametes with intercellular bridges; Deng and Lin. 1997. Spectrosomes and Fusomes Anchor Mitotic Spindles during Asymmetric Germ Cell Divisions and Facilitate the Formation of a Polarized Microtubule Array for Oocyte Specification in Drosophila. Developmental Biology 189:79–94).

Table 1-4. RNA content and nuclear configuration by species when polymerase II activity ceases

1.4.2 Oocytes undergo transcriptional arrest In some species, transcriptional arrest is observed by the presence of a non-permissive state of chromatin and/or the depletion of RNA polymerase (Fair et al. 1997; Lodde et al. 2008; Barnetova et al. 2012). The decrease in transcriptional activity is mediated by gonadotropin influence on the supporting granulosa cells (La Fuente and Eppig 2001). Chromatin state changes are indicative of transcriptional arrest when the chromatin becomes condensed. Concurrently, there is a depletion of RNA polymerases in oocytes that have undergone DNA condensation (Bouniol-Baly et al. 1999; Miyara et al. 2003). Most pre-ovulatory

oocytes in the mouse exhibit a chromatin configuration termed “surrounded nucleus” (SN). Alternatively, non-surrounded nucleus (NSN) configuration can also exist. Condensed DNA associating closely with the nucleolus characterizes SN configuration (Miyara et al. 2003). SN configuration is also related to RNA polymerase I and II activity. In SN chromatin configuration, polymerase activity is arrested (Bouniol-Baly et al. 1999). When other species are taken into account, the conformation change in chromatin is not the same as in mice. In rabbits, sheep, humans, and cows, conformation changes are significant, but not characterized solely by SN or NSN characteristics. The DNA still typically condenses, and can be labeled as surrounding or non-surrounding, but more descriptive stages that take into account related morphological changes have been described (Figure 1-5) (Tan et al. 2009).

Figure 1-5. Chromatin configurations in mouse (A, B), cow (C-E), and goat (F-H) Reproduced with permission from: Tan et al. 2009. Chromatin configurations in the germinal vesicle of mammalian oocytes. Molecular Human Reproduction 15:1–9.

In rabbits, there are more terms to describe oocyte chromatin configuration as the oocyte matures. As described previously the progression observed in the rabbit oocyte is as follows: net-like (NL), loosely condensed (LC), tightly condensed (TC), and singly condensed (SC) chromatin configurations. Transcription shuts down at the tightly condensed stage (Wang et al. 2006).

Described in humans are four states of chromatin related to maturation and the ability to fertilize (Combelles et al. 2002). In the first class, class A, the oocyte is smaller in diameter and has a partially surrounded nucleolus and fibrillar chromatin distributed in the nucleoplasm. The three other classes (B, C and D) have peri-nuclear condensed chromatin and resemble the surrounded nucleolus conformation of the mouse, the difference being that oocyte diameter is larger and the chromatin is less widely distributed in the nucleoplasm. Class B has very compact chromatin and no distribution of chromatin in the nucleoplasm. Class C is the largest in oocyte diameter, and large masses of chromatin surround the nucleolus. In class D there are threads of chromatin extending in the nucleoplasm (Combelles et al. 2002). These reports are similar to Miyara and colleagues who propose an oocyte size dependent chromatin configuration, where in larger oocytes there is a decrease in nuclear polymerase activity and a more condensed nuclear configuration (Miyara et al. 2003).

In bovine oocyte maturation, the terms GV0-GV3 are predominantly used (Fair et al. 1997; Lodde et al. 2008), though SN and Non SN configurations are also referred to in literature (Tan et al. 2009) (Figure 1-5 C-D). In GV0 oocytes, there is much transcription in the nucleolus and a number of morphological differences exist that distinguish the bovine oocyte from later GV stages that include erected microvilli, small clusters of immature mitochondria, few ooplasmic vesicles, the presence of a Golgi apparatus, and scattered cortical granules (Lodde et al. 2008). In the later GV stages, the nucleus becomes peripheral, microvilli become bent, mitochondria become hooded, there are increasing numbers of ooplasmic vesicles, and the Golgi begins to disassociate and the cortical granules become clustered before moving to the periphery of the oocyte. Intense transcriptional activity is seen in the GV0 oocyte, and then in the GV1 oocyte the activity is sparsely detected by H3-Uridine such that by GV3 stage no transcriptional activity exists (Lodde et al. 2008).

In porcine oocytes similar chromatin configuration nomenclature exists, with the exception that there is a GV4 stage, and that the later stages (GV3 and GV4) are associated with more

atretic follicles (Sun et al. 2004). Overall, preovulatory oocytes largely exhibit, some form of condensed transcriptionally inactive chromatin status and a lack of polymerase activity (Bouniol-Baly et al. 1999).

188 RNA Processing

1.4.3mor e tThehan duration30 hours .of In transcriptional large mamma lsilencings, the du risat speciesion of R specificNA stor age may be extended when considering that in the bovine, fully grown oocytes are typically found in follicles of 3 mm Theand duration a prop ofor t theion periodof th o ofse transcriptionaloocytes alrea d silencey har b variesor tra betweennscriptio n speciesally in (Tablactivee, 1h-i4).gh ly Whilecond ebeingnsed shortchrom ina tthein ( mouseGV3 st aoocyte,ge) (A kthehta silentr and periodVeens tcanra 2last009 )several. Oocy tdayse gro inw tmanyh to f otherull si ze involves transcriptional silencing and includes the time for the 3 mm follicle to reach speciespreovu (Schultzlatory si z1993)e wh.i cIndeed,h requi rthees 4mouse to 8 d genomeays dep eisn dactivateding on a astw oearly or t hasre thee w aendve cofyc thele. In addition there is the time taken to reach the other key developmental steps that are, the zygotic stage. According to previous work while a period of minor gene activation occurs duration from the LH surge up to ovulation (1 day), the time for fertilization to occur, and duringthe ti mG2e finor thethe 1z-ycellgot eembryo, to reac hthe th majore EGA activation 3-4 days loccursater. C duringonside rtheing 2 t-hcellis t istagemelin (Schultze and th at some of the maternal RNA present in these oocytes may have been stored during early 1993). Thus, in the mouse, the maternal contribution is only required to support a single stages of oocyte recruitment, and will not be enlisted for translation until the time of EGA, cellthe cycle.se RN AThiss w ilisl hanav eimportant necessita differenceted storage with for m otherore t hmammalsan two w elikeeks humans,before th epigs,y ar erabbits, used. Interestingly, the number of cell cycles undergone before EGA and the duration of the cattle and sheep where the embryonic genome activation occurs later, at the end of the third transcriptional silence are two uncorrelated factors. Indeed, the number of cells at EGA may orb efourth sever cellal th cycleousan (Tabled in D r1o-5).sop hila and Xenopus, but transcriptional silence only lasts 3 and 7 hours in each of these species respectively, as the first cell cycles are extremely rapid

(Newport and Kirschner 1982; Schultz 1993). Similarly, the chicken embryo reaches the 16th Tablecell c y1c-l5.e (Cell30,00 cycle0-50,0 of00 genome cells) a m activationere 24 hou byrs pspeciesost-fer tilization (Elis et al. 2008).

Specie Developmental Number of cell References stage cycles Mouse 1-cell 0 (Schultz 1993) Pig 4-6 cells 2-3 (Anderson et al. 2001) Human 4-8 cells 2-3 (Braude et al. 1988) Bovine 8-16 cells 3-4 (Memili et al. 1998) Rabbit 8-16 cells 3-4 (Henrion et al. 1997) Sheep 8-16 cells 3-4 (Crosby et al. 1988) Zebrafish 512-1,024 cells 9-10 (Kane and Kimmel 1993) Xenopus 4,096-8,192 cells 12-13 (Newport and Kirschner 1982) Drosophila 8,192-16,384 cells 13-14 (McCleland et al. 2009) Chicken 30,000-50,000 cells 15-16 (Elis et al. 2008)

Table 3. Developmental stage at which the embryonic genome gets activated

In5 .other Stor i modelng RN organisms,A for late r the maternal stores can support up to 16 cell cycles, which correspondsAs mentio n toed , approximatelythe oocyte co n 65,536tains a l cellsl the (Elismate r etial s al. n ee 2008)ded .t oThere carry isou t an e a importantrly embry o development up to the stage at which the genome activates. This is exemplified by the fact that the duration of the embryonic program is determined by the stage at which the developmental block occurs when in the presence of alpha-amanitin, an RNA polymerase II 28sp ecific inhibitor. Distinctly from the textbook processes through which mRNA s are matured in the nucleus and exported, capped, and polyadenylated, to the cytoplasm where they are readily translated and then sent for destruction, these essential maternal RNA molecules involve additional steps for transcript stabilization to render them physiologically

difference between mammals and non-mammal species such as fish, amphibians, insects and birds. In zebra fish, the activation of transcription begins at cell cycle 10 (512 to 1,024 cells). The first nine cycles are controlled by a 15 minute oscillator that allows perfectly synchronous cleavage (Kane and Kimmel 1993). In Xenopus, the embryo undergoes 12 rapid 35 minute long synchronous cleavages (4,096-8,192 cells) before detectable transcription is observed (Newport and Kirschner 1982). In Drosophila, the bulk of embryo transcription begins during the 14th cell cycle (8,192-16,384 cells) (McCleland et al. 2009). Finally, the chicken represents an extreme model of embryonic program activation, with its first transcriptional activity detected after 16 cell cycles, when the embryo consists of between 30 to 50 thousand cells (Elis et al. 2008). The large variability in the number of cell cycles and the number of cells required to achieve the maternal to embryo transition in different animal species is remarkable and is a tribute to the vast amount of resources that can be stably accumulated during oogenesis.

The total time elapsed (in hours) before the EGA is also impressive in its own right. Even though the mouse reaches the point of EGA, also referred to as the maternal to zygotic transition (MZT), due to the stage during which it occurs, it still transpires 23 hours after fertilization (Schultz 1993). By adding the time from meiosis resumption and the MII stage arrest, which lasts around 10 hours, the total period of transcriptional silence lasts more than 30 hours. In large mammals, the duration of RNA storage may be extended when considering that in the bovine, fully grown oocytes are typically found in follicles of 3 mm and a large portion of those oocytes already harbour transcriptionally inactive, highly condensed chromatin (GV3 stage) (Fair et al. 1997). Oocyte growth to full size involves transcriptional silencing and includes the time for the 3 mm follicle to reach pre-ovulatory size which requires 4 to 8 days depending on a two or three wave cycle (Fair 2003; Adams et al. 2008). In addition there is the time taken to reach the other key developmental steps that are, the duration from the LH surge up to ovulation (1 day), the time for fertilization to occur, and the time for the zygote to reach the EGA 3-4 days later. Considering this timeline and that some of the maternal RNA present in these oocytes may have been stored during early stages of oocyte recruitment, and will not be enlisted for translation until the time of EGA, these RNAs will have necessitated storage for more than two weeks before

they are used. Interestingly, the number of cell cycles undergone before EGA and the duration of the transcriptional silence are two uncorrelated factors. Indeed, the number of cells at EGA may be several thousand in Drosophila and Xenopus, but transcriptional silence only lasts 3 and 7 hours in each of these species respectively, as the first cell cycles are extremely rapid (Newport and Kirschner 1982; Schultz 1993). Similarly, the chicken embryo reaches the 16th cell cycle (30,000-50,000 cells) a mere 24 hours post-fertilization (Elis et al. 2008).

1.5 How the oocyte packages, stores, and later uses RNA The classic portrayal of RNA is its role as the intermediate between the DNA code and the functional proteins that compose cells and mediate their processes; a concept, that is now changing (Lodish et al. 2012). The RNA does not function in isolation and has many associated proteins that carefully mediate transcription, transport, and translation (Sossin and Lacaille 2010). Also, as we learn more about RNA we learn that its functions are expanding to include transcript and protein regulation, modification of epigenetic status and even enhancement of ligand binding, all without translation into protein (Clark and Mattick 2011). The transcriptome is composed of diverse types of RNA molecules, including messenger RNA (mRNA) and non-coding RNA (ncRNA; such as tRNA, rRNA, miRNA, siRNA, snRNA, piRNA, and long ncRNA). Due to advances in RNA sequencing technologies, it was found that 83.5 % of the genome is transcribed but only 1-3 % will encode proteins (Djebali et al., 2012). The majority of the transcriptome is therefore constituted of ncRNA (Derrien et al. 2012) playing diverse biological functions in the cells. After their transcription lncRNA can remain within the nucleus, or be exported to the cytoplasm (Derrien et al. 2012; Caballero et al. 2014). The best known of these is Xist and the role it has in X-chromosome inactivation (Penny et al. 1996; Dimond and Fraser 2013).

Micro RNAs are also an expanding topic in current literature with some acting as mediators of cell function or as interfering RNA (Davis-Dusenbery and Hata 2014). These short transcripts are created from the mRISC (microRNA induced silencing complex) and its formation is mediated by a protein called Argonaut (Turchinovich et al. 2012). The short

RNA produced interferes with a sequence of longer RNA limiting the ability of that transcript to translate (Marson et al. 2008). In oocytes and early developing embryos miR- 21 and miR-130a are present and increasing over the course of early development, however their exact role is unclear but is expected to have a role in gene regulation during early development prior to the EGA (Mondou et al. 2012).

There is now also evidence for the involvement of non-coding RNAs in the regulation of translation. lncRNA has been found to sequester and store RNA into granules among other processes related to growth and differentiation, and transcriptional regulation (Eulalio et al. 2007; Williams 2007; Ma et al. 2010). Some lncRNA that has a profound effect on embryogenesis has been found to associate with the polyribosomes indicating a potential role in translation control (Caballero et al. 2014). The extent of these interactions is still being explored, but it appears that a number of long and short non-coding RNA may play an important role in storage granule formation and stability, and also in translational machinery function.

1.5.1 Shortening of the polyA tail In the context of the oocyte, the mechanisms by which the transcripts must be stabilized are slowly being unravelled. A close relationship exists between factors involved in RNA storage and in RNA decay. For instance, it has been reported in numerous species that stored mRNAs are found in a deadenylated state (Eulalio et al. 2007; Zheng et al. 2008), and deadenylation is the first step in the mRNA decay pathway (Cougot 2004). Therefore, some storage granules contain components for mRNA decay, like decapping factors 1 and 2 (DCP1 and DCP2) (Cougot 2004; Kedersha et al. 2005 Jun 20). The collection of these different protein aggregates with various cellular functions is often referred under the general terminology of processing bodies (p-bodies) (Flemr et al. 2010). Several key proteins and complexes have been identified to mitigate the poly(A) tail shortening (Zheng et al. 2008). Such key players involve the poly(A) ribonuclease PARN in some species while in others, it can also be mediated by the Pumilio protein, which in turn interacts with the CCR4–Pop2–Not deadenylase complex (Radford et al. 2008). In Drosophila the mRNA

adenylation state is determined by a balance between the polyadenyl polymerase (PAP) involved in poly(A) tail lengthening and proteins with nuclease activity like the Caf1-Ccr4 complex (Eulalio et al. 2007). So far, the mammalian Ccr4 homolog has been localized in p-bodies and also acts to remove the poly(A) repeats (Zheng et al. 2008). Following this action, the length of the polyA tail of stored RNA has been estimated to be of less than 100 nucleotides reduced from over 200 nucleotides (Zheng et al. 2008). Other reports suggested that the extent of deadenylation is driven by sequence specific structures namely found in 3’ untranslated region (3’UTR) of mRNAs (Barckmann and Simonelig 2013). For example, it has been reported that the presence of a Cytoplasmic Polyadenylation Element (CPE) motif can influence the length of the remaining poly(A) tail where deadenylation of the poly A tail from 300-400 repeats down to 40 in absence of it or preserving a length of 40- 100 when the CPE motif is present (Paynton and Bachvarova 1994). In all, poly(A) tail length of stored maternal mRNAs is still vaguely characterized as it is extremely difficult to clearly fractionate the mRNA pools to isolate the ones that are stored from the others that have been recruited. So far the extent of knowledge is restricted to general means in poly(A) tail fluctuations observed between developmental stages (Paynton and Bachvarova 1994; Gandolfi and Gandolfi 2001).

1.5.2 RNA stabilization through granule formation Once bearing a shorter poly(A) tail, messenger storage requires stabilization to prevent destruction and this is conducted by the binding of proteins to form stable RNPs that aggregate in the oocyte’s cytoplasm (Flemr et al. 2010). It has been suggested that as an oocyte approaches full size, there is a decrease in size of p-bodies and there is an increase in abundance of mRNA binding proteins in the cytoplasm (Flemr et al. 2010). Transcript storage during oogenesis involves the binding of proteins, especially those of the Y-box family. These proteins called FRGY1 and FRGY2 were first studied in Xenopus (Bouvet and Wolffe 1994). These conserved factors are germ cell specific nucleic acid binding proteins and are homologous to the mouse MSY2 (Gu et al. 1998). In a fully-grown murine oocyte, it has been estimated that MSY2 alone accounts for about 2% of the total protein content (Yu et al. 2001). These proteins are nuclease sensitive binding elements and have

high sequence homology between mammalian species where identities match from 98% to 100% when using NCBI database Blast comparison. These proteins are conserved through evolution as nucleotide sequence identity between YPS in D. Melanogaster and the YBX2 protein in Human is still 79%. The full perspective on how these proteins are involved in maternal RNA storage is still under investigation.

In the mouse oocyte it was recently reported that there is a novel protein storing body that localizes in the subcortical region of the oocyte (Flemr et al. 2010). This storage form termed subcortical RNP domain (SCRD) is related to the components of a p-body as it shares similar protein components. Flemr and colleagues reported components that include “unidentified 18033 antibody- interacting protein”, DDX6, YBX2, CPEB, and the exon junction complex or EJC, which is a variable complex based around 5 proteins (SRm160, DEK, RNPS1, Y14 and REF) that have a number of other interactions and are involved in enhancing nucleocytoplasmic shuttling of mRNAs (Le Hir et al. 2001). In a similar fashion to the storage mechanisms described in other cell types, two DCP1 containing bodies were proposed to be active in the mouse oocyte (Swetloff et al. 2009). Likewise, responsiveness to chemical treatments like cycloheximide and RNase A treatments (Lin et al. 2008) also helps to define the different granule types, with p-bodies being sensitive to the chemicals, unlike decapping bodies.

The makeup of storage sites is better described in other model organisms especially in Drosophila and C. Elegans where distinct protein granule populations have been identified; this bringing into question the evolutionary conservation of these mechanisms (Nguyen-Chi and Morello 2011; Wang and Seydoux 2014). Perhaps these divergences may be due to the marked differences in the embryonic program duration and the number of cell cycles that must be conducted prior to the EGA. In Drosophila, storage is highly organized with protein sorting and delivering of the mRNA to a specific position allowing for polarity in the oocyte that helps set up the organization on the body and determines cell fate in the early embryo (Bashirullah et al. 1998). For instance, in Drosophila, Bicoid (bcd) polarity is mediated through several proteins such as exuperantia (exu), swallow (swa) and staufen (stau) (Schnorrer et al. 2000). Polarity is created in this case by the swa protein that

interacts with a dynein light chain (and therefore microtubules), and exu protein that is required for appropriate localization (de Heredia and Jansen 2004). Exu is also suspected to localize differently depending upon the mRNA it forms an RNP with (Jansen 2001). The polarity of stau containing complexes requires bcd polarity (Schnorrer et al. 2000). A staufen-like protein has also been shown to have motor protein properties though association with cytoskeletal components (Hurst et al. 1999).

In complement, transcript localization in this highly organized structure is encoded in the nucleotide sequence itself where zip codes are part of the untranslated regions (UTR) (Jansen 2001; de Heredia and Jansen 2004; Shahbabian and Chartrand 2011). RNA binding proteins called signal recognition proteins (SRP) can attach to this region and assist in the translocation (Redzic et al. 2014 May 15). This interaction results in the formation of a RNP with specific cellular or cytoplasmic “address” for region specific signalling and delivery of proteins to their site of intended action. It has been proposed that this process of RNA movement is potentially less energetically demanding than protein translocation (Jansen 2001). As mentioned the Drosophila oocyte cytoplasm is compartmentalized by protein gradients determined by the SRP-mRNA interaction creating a polarity that drives cell fate. These observations depict the cytoplasm has been highly structured for RNP storage where the cytoskeleton serves to anchor the RNPs awaiting to be used in the appropriate spatio-temporal manner. Unfortunately, Stau and other polarity related proteins have not been shown to function with the same effect in mammalian oocytes (Calder et al. 2008). In fact, Stau abundance has been shown to be homogeneously distributed thus raising doubts on its role in spatial organization in mammals. So far, the mammalian oocyte has not been shown to be highly and specifically compartmentalized as observed in non- mammalian models with the exception being the organization of the actin cytoskeleton that is responsible for the asymmetrical cellular division of the maturing oocyte that extrudes its polar body (Coticchio et al. 2014). This may result in stored transcript localization differences as they are sequestered and stored on the cytoskeleton.

1.5.3 Recruiting stored RNA for usage The temporal and quantitative recruitment of RNA from storage granules is a current topic of interest. For the stored RNA to undergo translation, it must released from inhibiting proteins, be re-adenylated, and not have interfering secondary structures (Cao and Richter 2002; Brengues 2005; Kotani et al. 2013). The mediators of this process are many and some are the same as those involved in the initial packaging and storage of the transcripts; the proteins present within the particles, the RNA sequence itself, and the RNA structure (Tremblay 2004; Piqué et al. 2008).

Many of the RNPs contain initiation factors, however, initiation of translation has been found to commence in different ways and often includes the eIF4 family of initiation factors, their eIF4 binding proteins, internal ribosome entry sites, and also through AU-rich elements that, depending upon the transcript can confer stability suitable for initiation (Kahvejian et al. 2001). Helicases are also present to aid in the re-initiation of protein synthesis ensuring no persistence of secondary structure (Silverman et al. 2003). The helicases come from a large family of proteins that includes EIF4A, and functions as a helicase, unwindase, and RNPase (Linder 2006; Naarmann et al. 2010). The helicases due to their diversity are involved in nearly all aspects of RNA processing mediating transcription, splicing, transport, and decay (Cordin et al. 2006; Srivastava et al. 2010; Montpetit et al. 2011). VASA (DDX4) has been found in storage granules in the C. elegans and is present in mammalian oocytes (Bezares-Calderón et al. 2010; Updike and Strome 2010), so in this way they can also act as chaperones between RNA, DNA and protein interactions (Linder 2006).

The first step of re-initiation is polyadenylation and two known 3’UTR elements are well known to support this. The two elements are the cytoplasmic polyadenylation element (CPE; UUUAUU) and polyadenylation hexanucleotide (HEX) also referred to as nuclear polyadenylation sequence (AAUAAA) (Charlesworth et al. 2004; Piqué et al. 2008). These elements interact with the binding protein CPEB, and the cleavage and polyadenylation specificity factor (CPSF) respectively (Radford et al. 2008). Poly-adenyl polymerase can then bind and interact with the proteins attached to the initiation elements and extend the

poly(A) tail back to >200 bases in length and translation can commence (Piqué et al. 2008). Evidence from Xenopus suggests that CPEB can also interact with poly-A ribonuclease (PARN), however when it is phosphorylated, the interaction cannot continue (Radford et al. 2008). There is some evidence to support that this process is dependent upon cyclins that are present during the different stages of the cell cycle, and may provide one feasible explanation as to how these RNA are recruited temporally (Kim and Richter 2006).

There is further, what is referred to as the combinatorial code, key sequences that exist in the 3’ and 5’ UTRs and recruit CPE and Hex, as well as embryo deadenylation element (EDEN), an AU-rich element (Piqué et al. 2008). EDEN can recruit its binding protein and also PARN or the CR4-pop2-not complex to remove the poly a tail (Cosson et al. 2012). The code implies a balance of adenylation and deadenylation factors that depending upon their relative location and interacting protein status, can assist in the elongation of the polyA tail (Cosson et al. 2012). One example outlines that if the CPE overlaps the HEX sequence, the mRNA is silenced, that is until Mos is synthesized and phosphorylation of CPEB by CDK1 occurs (Kishimoto 2003). It is at this point that the CPSF can finally bind the region and translation can proceed (Piqué et al. 2008). Downstream sequences and their protein interactions (with things like FMRP, pumilo, staufen, and hnRNPA2) may also have a role in the control through direct or indirect interactions with the polyadenylation machinery and the exit of the RNA from the granule (Vardy and Orr-Weaver 2007; Sossin and Lacaille 2010). Recent evidence points to other sequences that have been found enriched in RNA with short poly-A tails in the bovine oocyte (Gohin et al. 2014). In this study, another potential polyadenylation sequence termed MAPS was discovered after analysis of the 3’ UTR of these RNA with tails of 30-50 adenosines. How this motif interacts with proteins and other UTR regions remains to be determined.

Once the poly-A tail has been elongated, mediation of translation control begins. Key to this regulation is the poly a binding protein (PABP), and it’s interacting proteins PAIP1 and PAIP2 that act as regulators (Craig et al. 1998). PAIP1 has interacting domains that allow for initiation and EIF4G recruitment while PAIP2 does not making it a repressor of initiation (Martineau et al. 2008; Craig et al. 2011). PABP interacts directly with the 5’ cap

and EIF4G and EIF4E proteins of the RNA allowing circularization ribosomal recruitment (Kahvejian et al. 2001). This closed loop model (Figure 1-6) is appealing as a model of translation, due to the requirement of fully intact RNA for circularization (Kahvejian et al. 2001).

Figure 1-6. Loop-Model of RNA translation Reproduced with permission from: Vardy and Orr-Weaver. 2007. Regulating translation of maternal messages: multiple repression mechanisms. Trends in Cell Biology 14: 547- 554

There are many other interacting proteins that help to regulate translation in the oocyte, well known is the CPEB-Maskin model where Maskin interferes with the formation eukaryotic initiation complex, at least in Xenopus where aurora A kinase phosphorylates maskin resulting in it’s removal from the complex (Stebbins-Boaz et al. 1999; Groisman et al. 2001). There is apparently no mammalian maskin (Cai et al. 2010), however, a number of similar eIF4E interacting proteins do exist and can affect translation (Sossin and Lacaille 2010). They include proteins like Fragile-X mental retardation protein (FMRP), target of rampramycin (TORC1) and neuroguidin (NGDN) (Sossin and Lacaille 2010) as well as BRUNO, SMAUG and PUM (Vardy and Orr-Weaver 2007). These proteins are well

studied in neuronal granules and in control of translation, but are also found in the mammalian oocyte. Another protein is deleted in azoospermia-like (DAZL) that has been found in mammalian oocytes, and interacts with PABP to stimulate translation by recruiting the 80s ribosomal subunit (Collier et al. 2005). The authors observed that the DAZL protein could stabilize RNA with EIF4G even if the poly-A tail was short resulting in the translation of both adenylated and deadenylated transcripts.

Figure 1-7. Model of RNA processing in the oocyte

1.6 Fragile-X mental retardation protein function and links to reproduction Fragile-X mental retardation is also referred to as Martin-Bell syndrome or Marker X syndrome, and more commonly affects males (1 in 4000) as it is an X-linked disease for

which females have two X chromosomes, one affected and one unaffected and able to produce the protein, while males have only the affected copy (National Centre of Biotechnology Information). The FMR1 gene maps to Xq27.3 (Bardoni et al. 2006; Persani et al. 2009), though it’s interacting proteins FXR1 and FXR2 map to autosomal sites 3q28 and 17p13.1 respectively (Bardoni et al. 2006). These proteins are found highly abundant in neurons and in the gonads (Khandjian et al. 1996). The phenotype of Fragile-X is described in infants by delays in early development like crawling and walking, cognitive impairment, and delay in language and speech development. Further physical characteristics include flexible joints with low body tone, large body size, and facial features that include a large forehead ears, or a prominent jaw (Bardoni et al. 2006). The pathology of affected individuals often falls into the group of autism spectrum disorders (Pinto et al. 2010).

Fragile X mental retardation protein (FMRP) sequences include repeated CGG sequence in the 5’ UTR of DNA coding for FMR1 protein (Gleicher and Barad 2010). When repeats expand to reach a number greater than 200, the typical FMRP phenotype is realized. There are also pre-expansion carriers (55-200 repeats) who are susceptible to fragile X tremor ataxia (FXTAS) later in life, and whom are also at elevated risk of premature ovarian insufficiency (POI) (Persani et al. 2009).

1.6.1 FMRP function in Neurons FMRP is a RNA binding protein with broad ability to target RNA transcripts and has previously been shown to have 163 904 different unique RNA sequence targets (Darnell et al. 2011). Darnell et al. used high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) to determine that FMRP binds to one third of the mRNA sequences coding the presynaptic proteome (Darnell et al. 2011). Responsible for this target diversity are two K homology domains, and an RGG domain that confer “RNA kissing complex” and g-quadruplex binding respectively (Bardoni et al. 2006; Melko and Bardoni 2010). Further FMRP’s transcript target sequences, though having diverse targets were found enriched for transcripts whose proteins have roles in activity-dependent synaptic plasticity. This included mGluR5 (metabotropic glutamate receptor 5 –group1 -

phospholipase c activator), NMDAR N-methyl D-aspartic acid receptor, a glutamate receptor, components of ERK and mTOR signalling, like ERK1, Pten, Nf1, Tsc2 (Darnell et al. 2011; Ascano et al. 2012). While other interactions of some importance affect microtubule associated proteins like MAP1B and actin associated proteins like CYFIP, a rho GTPase (Bardoni et al. 2006). There is a nuclear localization signal and nuclear export signal sequences are both present on the FMRP sequence indicating potential involvement in shuttling transcripts to and from the nucleus (Bardoni et al. 1997).

FXR1 and FXR2 proteins are autologous to FMRP in that they contain the same important RNA interacting domains as well as nuclear localization and export signals (Bardoni et al. 2006). Interestingly FXR1 knockouts in mice show early infant mortality due to cardiac and respiratory failure, but when this protein is knocked down in neonatal mice the severity of the phenotype is less with shorter lifespans, and underdeveloped musculature (Mientjes 2004). The FXR2 knockout mouse shows more signs of behavioural neuro-developmental disorders (Bontekoe et al. 2002; Spencer 2006). So while similar, there are differences in the manifestation and severity of the protein knockouts for the related FXR1 and FXR2 proteins.

The ability of FMRP to bind, and transfer RNA down long neurons makes it an exciting protein for the study of RNA transport and localization (Davidovic et al. 2007). FMRP interacts with RISC and has been be involved in stress granules (Didiot et al. 2009) on top of its more widely accepted roles as a translational repressor/regulator and RNA transport molecule (Darnell et al. 2011). The diversity of protein function and capacity to target diverse RNA species makes FMRP an interesting candidate of study.

1.6.2 Repeat expansion impacts transcription and translation causing disease The expanded repeats found in the FMR1 genes are susceptible to hypermethylation and are not readily transcribed (Dolzhanskaya et al. 2006). This occurs because the expanded CGG repeat is susceptible to hypermethylation that interferes with promoter function and transcription, and ultimately results in less protein translation (Pretto et al. 2014; Okray et

al. 2015). Other sources of variable FMR1 protein expression stem from the presence of multiple transcriptional start sites, and post-translational histone modification like chromatin compaction around the gene allele (Schuettler et al. 2011). The elevated number of repeats are also permissive of a newly recognized occurrence in RNA translation: non- AUG (RAN) translation (Reddy and Pearson 2013; Kearse and Todd 2014), that is a non- canonical translation mechanism that is caused by initiation in the repeated sequence. The major problem is that without a traditional start site, there can be frameshifts and improper protein translation. In the case of FMRP the CGG repeats normally codes for poly-arginine, however, frame shifts would result in GCG or GGC, coding for poly-alanine and poly- glycine respectively (Reddy and Pearson 2013; Buijsen et al. 2014; Kearse and Todd 2014). The improperly formed proteins can cause a gain of function within the protein that results in cytotoxicity, a result described with compromised FMRP protein levels and impaired cellular function (Cleary and Ranum 2013; Oh et al. 2015), as well as formation of intranuclear inclusions in FXTAS individuals (Buijsen et al. 2014). When this RNA binding protein is absent, it impacts the neuronal developmental pathways as it targets RNA coding for neuronal and synaptic transmission including small GTPase signalling (Darnell et al. 2011).

1.6.3 FMRP and Premature ovarian insufficiency Premature ovarian insufficiency (POI) has previously been associated with decreased levels of FMRP in the ovary (Gleicher and Barad 2010). Repeats of CGG in the DNA have also been associated with age of menopause onset in women in a non-linear fashion (Sullivan 2004), and they suggest that much variation of age at menopause exists in women with less than 60 repeats, and that the risk increases significantly with more than 80 repeats into the range where CGG repeat expansion is much more likely, and finally that when repeats are greater than 100, the risk begins to plateau. These higher repetition individuals without the FMRP phenotype are typically referred to as having a pre-expansion genotype and have a POI risk increase of up to 20 X greater than normal (Hogström and Mark 2007; Persani et al. 2009). Individuals affected by the FMRP full mutation are at the same risk of the non- carrier population for ovarian pathology (Gleicher and Barad 2010). The unaffected group

with high numbers of CGG repeats are hypothesized to be at higher risk for ovarian dysfunction due to a lowered ability to translate the FMRP pre-expanded mRNA sequence to protein, a result of decreased transcriptional efficiency (Persani et al. 2009). The hypothesis that CGG repeats are solely responsible for POI is not fully accepted and it was suggested that on top of FMRP’s role as a translational repressor that would be critical to oocyte and early embryo development, that an FMRP contribution to RISC also contributes as multiple transcripts that would strongly affect fertility would be dysregulated (Schuettler et al. 2011).

Finally, some links to hormonal regulation of FMRP have been made. The methylation status of the FMR1 gene has been shown altered in response to 17beta-estradiol (Singh and Prasad 2008), and the overall expression of the gene was shown augmented by the levels of testosterone (Prasad and Singh 2014). Both of these conditions were found in older animals, suggesting that the maintenance of FMRP function with respect to fertility may be hormonally regulated and contribute to age related declines in fertility (Prasad and Singh 2014).

1.7 Vesicles and intercellular large molecule transfer Vesicles are small organelles surrounded by a membrane bilayer to move materials around and in between cells (Lodish et al. 2012). They utilize the cytoskeleton as a highway within the cell for transport and localize specific contents like enzymes, substrates, antigens, proteins, receptors, and RNA to various regions or membranes of the cell (Lodish et al. 2012). Newly synthesized proteins in the endoplasmic reticulum (ER) that are destined for the plasma membrane leave the ER exit sites within COPII protein coats for transfer to the Golgi endoplasmic reticulum intermediate complex and then to the Golgi Complex, a process termed anterograde transport (Lodish et al. 2012). Retrograde transport of vesicles to the ER also occurs (Bonifacino and Glick 2004). Clathrin and COP vesicles mediate the bulk of the vesicle movement between the Golgi and the plasma membrane, and may merge with endosomes and secretory granules before reaching their final destination (see Figure 1.8) (Robinson 1997). Vesicles cycle through the cell being sorted to the Golgi, endosomes,

and plasma membrane, with one end result of this process being the replenishment of functional membrane proteins where they are required, and also permiting the transfer of unwanted material to lysosomes for degradation, or expulsion to the extracellular space (Bonifacino and Glick 2004). Multivesicular bodies (MVBs) form vesicles in their lumen and contain them prior to extracellular release by merging with the plasma membrane of the cell into the surrounding environment (Figure 1-8). MVBs are also responsible for protein recycling, and can become lysosomes, or (Bartheld and Altick 2011). Cellular membranes can also bud outwards to create exosomes that will target other cells facilitating material transfer (Simons and Raposo 2009; Bartheld and Altick 2011). These intracellular and extracellular vesicles are diverse in their cellular relationships, and are mediated by many proteins and can contain number cargos including viruses (also shown in Figure 1-8). Here, some major classes will be addressed, but due to their numerous sizes and roles it is worthwhile to keep in mind the vesicles function and their classification is a fluid continuum.

The classification of vesicles is complex. As will be discussed, they are classified based on their location as extracellular vesicles, or intracellular vesicles, by the proteins markers that exist on their surface like tetraspanins, or the coat proteins I and II (COPI, and COPII), clathrin dependent, and clathrin independent (Mayor and Pagano 2007) varieties. They can be generalized based on their directionality as in anterograde or retrograde movement, or endocytic or exocytic vesicles. Also, they can be named for their size, or their function, as is the case with extracellular microvesicles and apoptotic vesicles respectively; these vesicles can also be identified by cell surface marker populations (Théry et al. 2009). Clathrin independent vesicles are further subdivided into two categories. Dynamin dependent mechanisms include caveolar and Rho A regulated small GTPase or uncoated vesicles (Mayor and Pagano 2007). Dynamin independent categories include vesicles regulated by the GTPases CDC42 and ARF6 (Mayor and Pagano 2007). Figure 1-9 contains a brief description of the formation of extracellular vesicles.

Figure 1-8. Formation of extracellular vesicles Reproduced with permission from: Thery et al. 2009. Membrane vesicles as conveyors of immune responses. Nature Reviews Immunology. 9: 581-593.

1.7.1 Vesicle formation and fusion The typical life of a vesicle is defined by a series of events: initiation, budding, scission, uncoating, tethering, docking, and fusion (Figure 1-9) (Robinson 1997; Whyte and Munro 2002; Faini et al. 2013 Mar 14). The vesicle proteins and the complexes they form determine these events. Vesicle contents are also determined by protein interactions either directly interacting with the vesicle associated membrane proteins (VAMPs), or with indirect protein-complex associations to the VAMPs or with other soluble N- ethylmaleimide-sensitive factor attachment protein receptor proteins (SNARES) (Lodish et al. 2012).

Receptors on the plasma membrane are often involved in the endocytic pathway (Davies et al. 1980; Lunov et al. 2011). These receptors are in a complex with adaptor proteins, v-

SNARE proteins, ADP-ribosylation factors (ARFs), and other membrane cargo proteins to initiate vesicle formation (Théry et al. 2009). The ARF proteins are GTP binding proteins capable of catalyzing GTP to GDP, and facilitate the coat formation that causes membrane budding. The clathrin proteins are triskelion in shape composed of three heavy and three light chains, and form a concave structure over the plasma membrane resulting in the indentation that leads to a vesicle (Kirchhausen et al. 2012; Lodish et al. 2012). The protein coats appear as a dark protein dense region on the cytoplasmic side of a membrane in TEM images (Fair et al. 1997). They are a lattice structure of light and heavy protein chains that interlink forming the vesicle coat (Lodish et al. 2012). As the coat fully forms, dynamin, another GTPase is involved in the scission process as it acts to pinch off the vesicle (Lodish et al. 2012). Once the vesicle is free of the membrane, the coat proteins can disassociate in a step termed “uncoating”. Simply, the ARFs do not remain active and the result is the shedding of the coat proteins that can then be recycled for later use by the cell (Faini et al. 2013). Caveolae are an exception to the receptor dependent mechanisms of vesicle function due to the function of caveolin protein on the membrane that provides a structural propensity to form a vesicle (Mayor and Pagano 2007).

Figure 1-9. Vesicle budding and fusion Reproduced with permission from: Bonifacino and Glick. 2004. The mechanisms of vesicle budding and fusion. Cell 116: 153-166

Tethering of the vesicle to the acceptor compartment is the first contact between the two membranes, and leads to vesicle docking (Whyte and Munro 2002; Lodish et al. 2012). This process involves Rab GTPase activity, and possibly a number of quatrefoil proteins that extend out from the membrane and function in conjunction with transport protein particles (TRAPP) proteins that aid in this interaction (Whyte and Munro 2002; Bonifacino and Glick 2004). Docking of the target membrane and vesicle is mediate by SNARE interactions and further Rab GTPase activity (Rodman and Wandinger-Ness 2000). The v- SNARE of the vesicle interacts with the t-SNARE of the target membrane (Bonifacino and Glick 2004; Lodish et al. 2012). The GTPase activity draws the two membranes into close enough proximity that they are able to fuse and the contents of the vesicle lumen are released to the extracellular matrix, and the proteins of the membrane remain as a part of the plasma membrane (Rodman and Wandinger-Ness 2000; Bonifacino and Glick 2004; Lodish et al. 2012). After fusion, SNARE complexes disassociate from the membrane by SNAP/ NSF complexes and ATPase activity (Bonifacino and Glick 2004).

In some cases of vesicle transfer, membrane fusion between the vesicle and receptor membrane is not complete. This phenomenon is called the kiss and run hypothesis, and dictates that the membranes fuse enough to open up the vesicle creating the “kiss” and the deliverance of the proteins, hormones, or small molecules (Palfrey and Artalejo 2003; Rizzoli and Jahn 2007). This mechanism has been observed in synaptic vesicles and is believed to be a beneficial means of partial signal propagation delivering enough but not all of a signal, meaning the vesicles can be reused at a later time (Aoki et al. 2010). This action is more useful for quickly diffusible contents, however the duration of the “kiss” and kinetics of the vesicle contents would determine what is capable of being transferred.

COPI and COPII vesicles function in very much the same way as the clathrin vesicles. The subtle differences are in the adaptor proteins that associate with COPI and COPII. COPII complexes form with Sec23/Sec24 and Sec13/Sec31 proteins and utilize a different GTPase, Sar1, instead of ARF (Barlowe et al. 1994). COPI utilizes ARF function, however this complex contains a number of different proteins and has been described as a hexameric complex (Nickel et al. 2002) and includes COPa, COPb, archain, and several

interchangeable proteins (Todd et al. 2013). It is the coat proteins and their interacting proteins that determine the localization of the vesicle, at least in part (Faini et al. 2012). Some sorting signals, amino acid sequences, have been elucidated and assist in guiding the vesicle to the membrane bearing a matching receptor (Bonifacino and Glick 2004)

1.7.2 Extracellular Vesicles The extracellular vesicles fall into three classes that are largely determined by size: exosomes, micro-vesicles, and apoptotic bodies (Théry et al. 2009; Tetta et al. 2012). Exosomes, the smallest ranging from 30 -120 nm in diameter form within the multivesicular bodies of the cells and are secreted when the MVB makes contact with the cell’s plasma membrane (Valadi et al. 2007; Théry et al. 2009; Zomer et al. 2014). The micro-vesicles are outward protrusions of the plasma membrane that are anywhere from 50- 1000 nm in diameter (Valadi et al. 2007; Théry et al. 2009; Zomer et al. 2014). Finally, the largest of the extracellular vesicles (100-2000 nm), apoptotic bodies are produced when dying cells fragment following cell death (Théry et al. 2009). These vesicles are difficult to screen and identify as they share many similar surface markers and exist within an overlapping continuum of sizes, and also due to the other smaller classes of vesicles (summarized in table 1-6). Typically fractionation by centrifugation, in combination with flow sorting or immunoprecipitation are the methods for isolation and identification (Valadi et al. 2007; Théry et al. 2009; Zomer et al. 2014).

Exosomes typically bear tetraspanins like CD9, CD43 and CD81 (Yeh Yeo et al. 2013) (Table 1-6), but the membrane components are incredibly diverse as illustrated by Atay et al. where the vesicles contain a number of metabolic, structural, and signalling proteins (Atay et al. 2011). Exosomes have also been shown to rely on a number of different rab GTPases, primarily rab27a/b (Ostrowski et al. 2009; Abd El Naby et al. 2011; Zomer et al. 2014) and rab35 (Kouranti et al. 2006; Hsu et al. 2010; Abd El Naby et al. 2011; Zomer et al. 2014) among others (Rodman and Wandinger-Ness 2000). These GTPases have been the target of siRNA knockdown in some recent studies (Ostrowski et al. 2009; Bobrie et al. 2012) in an effort to overcome the collateral effects of inhibitors and the redundancy of

vesicle formation created by the many mechanisms of formation (Ivanov 2008) and also by the vast family of the rab GTPases, greater than 60 members in humans (Stein et al. 2012).

Table 1-6. Classification of extracellular vesicles

Membrane Exosome-like Apoptotic Feature Exosomes Microvesicles Ectosomes particles vesicles vesicles

Size 50–100 nm 100–1,000 nm 50–200 nm 50–80 nm 20–50 nm 50–500 nm

Density in 1.04–1.07 1.13–1.19 g/ml ND ND 1.1 g/ml 1.16–1.28 g/ml sucrose g/ml Appearance Irregular shape and Bilamellar round by electron Cup shape Round Irregular shape Heterogeneous electron-dense structures microscopy 100,000– 1,200g, 10,000 Sedimentation 100,000 g 10,000 g 160,000–200,000 g 175,000 g 200,000 g g or 100,000 g Enriched in Enriched in cholesterol, cholesterol and Lipid sphingomyelin and Expose Do not contain diacylglycerol; ND ND composition ceramide; contain phosphatidylserine lipid rafts expose lipid rafts; expose phosphatidylserine phosphatidylserine Tetraspanins CR1 and Main protein Integrins, selectins CD133; no (CD63, CD9), Alix proteolytic TNFRI Histones markers and CD40 ligand CD63 and TSg101 enzymes; no CD63 Internal Intracellular Plasma Internal compartments Plasma membrane Plasma membrane ND origin membrane compartments? (endosomes) Heijnen, H. F., Marzesco, Schiel, A. E., A. M. et al. Hawari, F. I. et Thery, C. et al. Fijnheer, R., Release of al. Release of Proteomic Thery, C., Geuze, H. J. & extracellular full-length 55- analysis of Amigorena, S., Sixma, J. J. membrane kDa TNF dendritic cell- Raposo, G. & Activated platelets Gasser, O. et al. particles receptor 1 in derived Clayton, A. release two types Characterisation carrying the exosome-like exosomes: a Isolation and of membrane and properties of stem cell vesicles: a secreted characterization of vesicles: ectosomes released marker Main mechanism for subcellular exosomes from microvesicles by by human prominin-1 reference generation of compartment cell culture surface shedding polymorphonuclear (CD133) soluble distinct from supernatants and and exosomes neutrophils. Exp. from neural cytokine apoptotic biological fluids. derived from Cell Res. 285, 243– progenitors receptors. vesicles. J. Curr Protoc. Cell exocytosis of 257 (2003). and other Proc. Natl Immunol. 166, Biol. Chapter 3, multivesicular epithelial Acad. Sci. USA 7309–7318 Unit 3 22 (2006). bodies and α- cells. J. Cell 101, 1297– granules. Blood Sci. 118, (2001). 94, 3791–3799 2849–2858 1302 (2004). (1999). (2005). Reproduced with permission from: Thery et al. 2009. Membrane vesicles as conveyors of immune responses. Nature Reviews: Immunology. 9: 581-593.

1.7.3 Roles in somatic cells Packaging of specific cellular contents for intercellular signalling is a new and rapidly expanding field of cell biology research (Théry et al. 2009). Some insight into these

processes comes from pathology like HIV transmission between cells (Fang et al. 2007) as well as tumorigenic factors (Takahashi et al. 2014) that use vesicles to spread. Extracellular RNA is often found in vesicles as they confer RNAse protection, and may be a part of a natural signalling dialogue that occurs throughout the body (Turchinovich et al. 2012). Recent study has suggested that secreted micro-vesicles containing exogenous miRNA can be delivered to recipient cells and cause an effect (Pegtel et al. 2010; Zhang et al. 2010). The same has been said of siRNA in micro-vesicles released from cancer cells that selectively secrete anti-oncogenic siRNA (Ohshima et al. 2010). In addition to miRNA and siRNA it has been proposed that exosomes could contain mRNA for intercellular transfer resulting in direct protein product in a recipient cell (Valiunas et al. 2005). It has been recognized that in a similar manner to endo/exosomes or micro-vesicles, tubule connections between cells may achieve the same endpoints by potentially transferring siRNA or miRNA (Belting and Wittrup 2008). This transfer of material could even be a mechanism to propagate immune response from dead or dying cells (Belting and Wittrup 2008).

How does RNA get into the vesicles? The complexes formed by COPI, COPII, and clathrin permit the incorporation of the vesicular contents (Todd et al. 2013). The vesicle associated membrane proteins associate further with intermediate adaptor proteins that directly and indirectly incorporate RNA binding proteins and other components to transfer (Todd et al. 2013). Some examples found in MVB associated fractions include AGO2 and GW182, components of the RISC complex that are involved in miRNA utilization (Gibbings et al. 2009). The endosomal-sorting complex required for transport (ESCRT) and ceramide- dependent mechanisms of vesicle formation are two of many identified mechanisms in MVB formation that also include SNAREs and small GTPases of clathrin independent pathways (Bartheld and Altick 2011). The ESCRT recognizes ubiquitination of proteins for incorporation into the endosomes of a MVB. SUMOylation of proteins has also been shown to result in vesicle targeting within MVBs (Villarroya-Beltri et al. 2013). In the COPI vesicles, the COPa protein has been shown to have a g-quadruplex binding domain, similar to that found on FMRP, that targets a great variety of RNA (Todd et al. 2013). Interfering with the COPI proteins in yeast have been shown to lead to inappropriate RNA trafficking. Interestingly the formation of the exosomes within a MVB, or the formation of

micro-vesicles on the surface of the plasma membrane, results in vesicles sharing the same coat proteins (integrins and tetraspanins) as the parent cell, so that when they are released they can easily interact with the cells of the surrounding environment, or possibly with a specific subset of cells within a tissue. This is in apposition to the endocytic vesicles that display the “outer” coat on their interior.

1.7.4 Roles in sperm An occurrence known as trogocytosis in immune cells, and now identified as microvesicle fusion (Belleannee et al. 2013; Caballero et al. 2013) resulting in the transfer of membrane fragments to the sperm that includes CD9, on the surface of exosomes to the sperm(Barraud-Lange et al. 2012). A series of experiments illustrated the need for CD9 to be present and active in mouse fertilization events(Kaji et al. 2000; Miyado 2000; Barraud- Lange et al. 2012). Without CD9 expression on the oocytes of CD9-/- mice, fertilization rates dropped significantly, to less than 2% (Kaji et al. 2000; Miyado 2000), though offspring appeared to develop normally (confirmed with ICSI in the Miyado study). Sperm were found to interact with the cell surfaces, but not fuse. A similar, yet less effective method of inducing the observation was found when oocytes were treated with anti-CD9 antibodies suggesting a direct role in the mechanism of gamete fusion (Miyado 2000). CD9 has also been shown to associate with alpha-6B1, an integrin referred to as a sperm receptor that binds to fertilin and permits gamete fusion (Xiang and MacLaren 2002).

1.7.5 Vesicle roles in the oocyte In the case of the oocyte, it was mentioned that the growing oocytes form a great number of coated pits during their growth period (Hyttel et al 1997). The importance of endocytosis to oocyte maturation is outlined in a study in mouse oocytes (Lowther et al. 2011). This study utilized mono-dansyl cadaverine (MDC) and dynasore to inhibit the formation of the early endosome in denuded mouse oocytes, indicated by a membrane stain (FM 1-43) that kept its fluorescence after endocytosis. Receptor mediated endocytosis was inhibited and resulted in increased cAMP levels and an accumulation of G protein receptor three (GPR3)

on the surface of the oolemma. Oocytes could not undergo spontaneous resumption of meiosis in the presence of these two inhibitors.

1.8 Objectives of the thesis To reiterate, the close communication between the cells of the follicle and the oocyte permits finely tuned control over oocyte growth and maturation with the cumulus cells nurturing the oocyte in response to systemic and local regulatory signals. The close apposition of the corona radiata cells with the oocyte creates considerable potential for the external regulation and modification of the oocyte’s transcriptome. We know well already the gap junction transference of small molecules, and signalling of soluble secreted factors play important roles in oocyte development (Richard and Sirard 1996b; Hussein et al. 2006; Sutton-McDowall et al. 2010). The unique ability for the oocyte to store RNA for use days or even weeks after synthesis together with observations of some transcript increases in the oocytes during maturation (Mamo et al. 2011), a time when oocytes are transcriptionally silenced, begs the question of possible exogenous material transfer including RNA. Interestingly, large molecule transfer in the COC has not been widely explored, and the potential for novel signalling events may exist. Here we hypothesize that there is external synthesis and transference of long coding RNA transcripts from the cumulus cells to the oocyte.

Our first objective is to characterize the intercellular connection between the oocyte and the corona cells. We wish to describe the nature of this connection, meaning its structural components, contents, and the extent of its connectivity over the course of oocyte maturation in vitro.

We then wish to evaluate if this structure contains RNA, and what transcripts would be found there. An extension of this would be to see what RNA interacting proteins are also present in the TZP structure.

Finally, we wish to determine what large molecule signalling mechanisms are present at the TZP-oocyte interaction. If they can be identified, we would like to determine what contents are carried to the oocyte, and what impact may be found on oocyte maturation.

In the scheme of embryo production, oocyte maturation remains the key contributing factor, and potentially the area where most improvement to quality outcome can be made. Overall this work is anticipated to improve our understanding of how the cumulus cells intercommunicate with the oocyte, and to identify molecular components within the COC that are required for oocyte maturation. Exploration of these concepts will advance our understanding of oocyte quality and advance our perspective to improve the in vitro process of oocyte maturation.

2 The gametic synapse; RNA transfer to the bovine oocyte

Angus D Macaulay1, Isabelle Gilbert1, Julieta Caballero1, Rodrigo Barreto2, Eric Fournier1, Prudencio Tossou1, Marc-André Sirard1, Hugh J Clarke3, Édouard W Khandjian4, Francois J Richard1, Poul Hyttel5, Claude Robert1

1 Département des sciences animales, Centre de recherche en biologie de la reproduction, Institut sur la nutrition et les aliments fonctionnels, Université Laval, Québec, QC, Canada. 2 Veterinarian Medicine Department, Sao Paulo University, Brazil. 3 Department of Obstetrics and Gynaecology, McGill University Health Centre, Montréal, QC, Canada. 4 Département de Psychiatrie et Neurosciences, Institut universitaire en santé mentale de Québec, Université Laval, Québec, QC, Canada. 5 Department of Veterinary Clinical and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen Denmark.

2.1 Résumé Malgré quelques décennies d’entreposage dans l’ovaire, les cellules germinales femelles sont en mesure de remettre en fonction la transcription et de construire une réserve de transcrits afin de soutenir le développement embryonnaire précoce. Dans le modèle courant d’ovogenèse chez les mammifères, on reconnait l’existence d’une communication bilatérale entre le gamète et les cellules somatiques qui l’entourent se limitant toutefois à des signaux paracrines et à des transferts de molécules de petites taillesvia les jonctions ouvertes de type « gap ». Le but de cette étude est d’explorer le rôle des projections des cellules du cumulus dans le transfert de larges molécules, incluant les ARNm, à l’ovocyte. En analysant les ARN naissants à l’aide du microscope confocal et du microscope électronique à transmission, nous avons montré que, en transférant de larges molécules à l’ovocyte bovin dont des ARNm et des longs ARN non-codants, les cellules du cumulus contribuent à accroître la réserve de transcrits maternels de l’ovocyte. Ce transfert a ultérieurement été démontré suivant la reconstruction du complexe ovocyte-cumulus et le transfert à l’ovocyte d’un transcrit synthétique ayant été transfecté dans les cellules du cumulus. Nous proposons l’existence d’un transfert vésiculaire de transcrits supporté par des connections similaires à des synapses entre l’ovocyte et les cellules du cumulus. Cette surprenante contribution extra-ovocytaire à la réserve maternelle d’ARN offre une nouvelle perspective sur les déterminants de la fertilité femelle.

2.2 Abstract Even after several decades of quiescent storage in the ovary, the female germ cell is capable of reinitiating transcription to build its reserves that are essential to support early embryonic development. In the current model of mammalian oogenesis, there exists bilateral communication between the gamete and the surrounding cells that is limited to paracrine signalling and direct transfer of small molecules via gap junctions existing at the end of the somatic cells’ projections that are in contact with the oolemma. The purpose of this work was to explore the role of cumulus cell projections as a means of conductance of large molecules including RNA to the mammalian oocyte. By studying nascent RNA with confocal and transmission electron microscopy in combination with transcript detection, we show that the somatic cells surrounding the fully grown bovine oocyte contribute to the maternal reserves by actively transferring large cargo, including mRNA and long non- coding RNA. This occurrence was further demonstrated by the re-construction of cumulus oocyte complexes with transfected cumulus cells transferring a synthetic transcript. We propose selective transfer of transcripts occurs which delivery is supported by a remarkable synapse-like vesicular trafficking connection between the cumulus cells and the gamete. This unexpected exogenous contribution to the maternal stores offers a new perspective to the determinants of female fertility.

2.3 Introduction From the ground-breaking work of Dr. Edwards on in vitro fertilization (Edwards 1965) to the development of the most striking modern reproductive technologies such as somatic cell nuclear transfer or parthenogenic reproduction, there exists a common link as they all rely on the quality of the oocyte. The efficiencies of these technologies are modest to very low, and it is believed that much of the success rate relies upon the intrinsic nature of the egg at the outset of the manipulations. Even after a century of modern research on oocyte physiology, the nature of the cytoplasmic determinants characterizing the oocyte’s developmental potential is still unknown. It is accepted that the embryonic program is embedded during oogenesis in part in the form of accumulated reserves that will support early embryogenesis.

The current model of mammalian oogenesis dictates that the cytoplasmic reserves of RNA are produced intrinsically and accumulate until the oocyte reaches full size (Bouniol-Baly et al. 1999; Lodde et al. 2008). The mRNAs that are stored in the cytoplasm are stabilized and packaged as ribonucleoprotein particles. Afterwards, chromatin condenses leading to cessation of transcription and these stored provisions sustain embryogenesis until the genome reactivates (Cowden 1962; Gurdon and Woodland 1968; Sternlicht and Schultz 1981). The duration of transcriptional suppression during embryonic development is species-specific, lasting from several hours to days (Ram and Schultz 1993; Memili and First 1998). This is a contrast to many invertebrates where a free flow of cellular material exists between the cytoplasm of the oocytes and of specialized nurse cells within the egg chambers (Wolke et al. 2007; Hurtig et al. 2010).

In mammals, analogous to these nurse cells are the innermost layers of the cumulus cells called the corona radiata that are in close contact with the oocyte through their cellular projections that reach across the zona pellucida and contact the oolemma. These aptly named transzonal projections (TZPs) are however not open-ended structures and material exchange between these somatic cells and the gamete is believed to be by means of the gap junctions existing at the contact point between both cells which only permit the passage of small molecule (<1 kDa) (Bouniol-Baly et al. 1999; Hussein et al. 2006; Gilchrist et al.

2008; Lodde et al. 2008; Yeo et al. 2009). In the current views of mammalian oogenesis, it is well accepted that the oocyte does not uptake large molecules (Moor et al. 1980).

More recently, unexpected exchange of cellular material between cells from proteins and viruses, to larger structures like organelles has been reported in many cell types namely through the discovery of intercellular structures called tunnelling nanotubes (TNT) (Sun et al. 2004; Bukoreshtliev et al. 2009; Hurtig et al. 2010). Similar to other cellular extensions, the TZPs have a potential to act as intracellular highways to deliver material at their distal point of contact. Given the current model of mammalian oogenesis, this potential has not been explored yet. We postulated that during the long period of transcriptional incompetence, oocytes of large mammals impart their transcriptional functions to the numerous surrounding somatic cells that have direct physical contacts through their TZPs enabling them to deliver large RNA molecules to the gamete. The description of the structures and detection of the presence of RNA within the TZPs and means of delivery was investigated. RNA transfer from the somatic cells to the gamete could be important for the constitution of the maternal reserves that are pivotal to the understanding of oocyte quality.

2.4 Materials and Methods 2.4.1 Oocyte collection and maturation All animals used in this study were handled according to the guidelines of the Canadian Council on Animal Care and also in accordance with the SSR’s specific guidelines and standards. These were followed strictly at the local abattoir, which provided the ovaries. No animals were handled on university premises. Bovine oocytes were collected from 2-6 mm follicles from abattoir ovaries. Oocytes were matured for 3, 9, or 22 h in standard maturation media as previously described (Nivet et al. 2012). Good-quality oocytes displaying homogenous cytoplasm, a complete cumulus cloud with no signs of atresia, and a fully-grown size greater than 120 m were selected.

2.4.2 RNA extraction and amplification for RNA-seq Two RNA-seq experiments were conducted. For the first one, total RNA transcriptome analysis of three pools containing 20 oocytes each, were collected for both maturation stages (e.g. GV and MII). The synthetic transcriptome ERCC (Life Technologies, Burlington ON, Canada) was spiked in the extraction buffer that was distributed in all samples. Total RNA extraction and DNAse treatment were performed using PicoPure columns (Life Technologies). Next, cDNA first and second strand synthesis was carried out using NuGen’s Ovation kit. cDNA (San Carlos, CA, USA) was then amplified with NuGen’s SPIA system. The final cDNA product was fragmented, ligated, and primed for RNA-seq using the Encore kit (NuGen). An exogenous RNA spike-in control for normalization was including before the next-generation sequencing (ERCC RNA spike-in mix, Life Technologies). For the second RNA-seq experiment, sequencing of nascent RNA found in the TZPs was done using 110 oocytes. In order to isolate the RNA in TZPs, oocytes were cut into unequal hemi-sections with micro-dissection blades (Bioniche, Pointe Claire, QC, Canada) afterwards the section containing the nucleus was removed leaving the ZP, some ooplasm, and the cumulus cells. Nuclear staining with Hoechst 33342 and brief epifluorescent imaging confirmed removal of oocyte nuclear material. Isolation of new RNA transcripts was performed using the Click-iT nascent RNA extraction kit (Life Technologies) where enucleated COCs were incubated for 9 h in maturation media supplemented with modified uridine (Click-iT nascent RNA extraction kit, Life Technologies). Untreated COCs were used as controls. Zonas were then mechanically stripped of their CCs. Total RNA was extracted using the TRIzol method (Life Technologies), followed by isolation of the de novo RNA using the protocol accompanying the nascent RNA Capture Kit (Life Technologies). RNA-seq library preparation was conducted as described above. All sequencing reactions were carried out on a HiSeq2000 system (Illumina) for 200 cycles (services provided by Genome Québec Innovation Center, McGill University, Montréal, QC, Canada and the Institut de Recherche en Immunologie et Cancérologie, Université de Montréal, Montréal, QC, Canada).

2.4.3 Bioinformatics analysis for RNA-seq RNA-seq reads were processed prior to analysis. To remove read-through Illumina primers and low quality end of sequences, all libraries were processed with Cutadapt software. Cleaned sequences with a length smaller than 30 bp were then removed using sickle (https://github.com/ucdavis-bioinformatics/sickle/). Only paired-end reads where both reads were longer than 30 nucleotides were kept. Sequences were then aligned to the UMD3.1 assembly of the bovine genome using TopHat2 software. Alignments were quantified against a reference transcriptome using Cufflinks2. For transcriptomic analysis of total RNA from GV and MII stages, normalization was conducted on the exogenous transcriptome (ERCC) and for all contrast, differential expression was evaluated using Cuffdiff. Comparison at the top (CAT) plots were produced using the MatchBox Bioconductor software package. Further expression analysis of gene ontology and pathway enrichment was completed using DAVID software online using the cumulus cells nascent transcriptome as background.

2.4.4 RT-qPCR Five pools of five oocytes at germinal vesicle (GV) stage or that reached meiosis two (MII) stage with and without their cumulus cells were prepared. The synthetic transcriptome ERCC (Life Technologies) was spiked in the extraction buffer that was distributed in all samples. Total RNA extraction and DNAse treatment were performed using PicoPure columns (Life Technologies). Reverse transcription was performed using qScript cDNA Synthesis kit priming the reaction with the included random primers (Quanta Biosciences, Gaithersburg, MD, USA). PCR was performed on a LightCycler 2.0 system (Roche) using the LightCycler Faststart DNA master Syber Green I kit (Roche). Primer sequences and amplification details can be found in supplemental Table 2-1.

2.4.5 Fixation and fluorescent staining When using labile direct stains, oocytes were imaged as un-fixed specimens to preserve native structures. When fixation was necessary, oocytes were placed in 4%

paraformaldehyde (PFA, Sigma-Aldrich) in PBS at pH 7.2-7.4 for 30 min at room temperature. All stains were purchased from Life technologies, with the exception of rhodamine phalloidin, which was purchased from Cytoskeleton Incorporated (Denver, CO, USA) and were used to specification. DNA was detected in oocytes after Hoechst 33342 staining (Life Technologies). Actin filaments were detected with rhodamine phalloidin (Cytoskeleton Incorporated, Denver, CO, USA). Membranes were detected using GM1 stain (cholera-toxin subunit beta conjugated to Alexafluor 488 (Life Technologies) or with FM 4-64 (Life Technologies). The SYTO RNASelect (Life Technologies) was used for RNA staining and 5-ethyl uridine Click-iT kit was used for isolation of newly transcribed RNA (Life Technologies) and used to specification. RNAse cocktail (Life Technologies,) was used to remove the signal from fluorescent RNA staining. Fluorescent microscopy was carried out on the Zeiss LSM 740 confocal microscope using ZEN capture and image analysis software (Karl Zeiss, Toronto, ON, Canada).

2.4.6 Immunofluorescence Immunofluorescence was carried out using an established protocol (Doyle et al. 2009), on 4% PFA fixed COCs that were partially denuded and sectioned with micro-scalpel blades (Bioniche). One difference was an initial heat induced antigen retrieval in a solution of Tris-EDTA for 90 min at 60°C. Primary antibody, rabbit anti-PABP (Abcam, Toronto ON, Canada) was applied at a dilution of 1 in 40 overnight at 4°C. Alexafluor 488 anti-rabbit (Life Technologies) secondary was used at a concentration of 1 in 1,000 for 1 h at room temperature. Appropriate non-immune IgG primary and secondary only controls were carried out on the samples concurrently. Samples were visualized on the Zeiss LSM 740 confocal microscope using ZEN capture and image analysis software.

2.4.7 In-situ hybridization Identification of poly-A transcripts in the oocytes was carried out using a poly-A in situ hybridization kit (Leica, Concord ON, Canada) to the manufacturer’s specification with little modification. Briefly, COCs were fixed in 4 % PFA, followed by a post-fixation

gradient of methanol (10% to 90% v/v). Oocytes were then washed and rehydrated in PBS, placed on a slide, and incubated with the probe for 2 h at 37°C in a humidified chamber. Samples were visualized on the Zeiss LSM 740 confocal microscope using ZEN software.

2.4.8 Scanning electron microscopy Samples were deposited on coverslips coated with 0.5% gelatin (Roche, Laval, QC, Canada) in distilled water. Cells were fixed for 30 min with 2.5% (v/v) glutaraldehyde in PBS, washed, and dehydrated in an ethanol gradient (10 to 90% v/v) followed by absolute ethanol for two hours. After completing the critical point drying, samples were subjected to carbon sputter coating. Images were photographed using a JEOL (JSM6360LV, Tokyo, Japan) scanning electron microscope.

2.4.9 Transmission electron microscopy and autoradiography Collected oocytes were placed into equilibrated maturation media under oil for maturation. Oocytes were exposed to 30 min pulses with [3H]-uridine prior to either 3, 9, or 22 h of maturation, or for long pulses from 0-3, 0-9, or 0-22 h of maturation. Exposed oocytes were transferred into media with a concentration of [3H]-uridine (Perkin-Elmer, Woodbridge, ON, Canada) of 200 µCi/ml. All COCs were washed twice for 15 min in PBS supplemented with 10% fetal calf serum (FCS) at 4oC. Oocytes were fixed in freshly prepared 3% glutaraldehyde (Electron Microscope Solutions, Ft. Washington PA, USA) in 0.1 M PBS for 1 h at 4oC. Prior to embedding the oocytes were stored in 0.1 M PBS. Osmium tetroxide post fixation, uranyl acetate and Reynolds’s lead citrate staining, Epon embedding, sectioning and autoradiographic exposure of the samples using L4 emulsion (Ilford Nuclear Research Emulsion) and D19 developer (Kodak) was carried out as described previously (Faerge et al. 2001). Grids were viewed with transmission electron microscopy (JEM-1200 EX, Jeol, Tokyo, Japan).

2.4.10 Cumulus oocyte complex reconstruction with transfected cumulus cells Cumulus cells matured intact as COCs for 22 h were stripped by pipetting gently and plated in six well plates at a concentration of 1.5-2 million cells per mL in DMEM (Life Technologies) supplemented with sodium bicarbonate (MP Biomedical, Santa Anna, CA, USA), bovine albumin (Sigma), Fugizone (Life Technologies), penicillin-streptomycin (Life Technologies), and MEM non essential amino acids (Life Technologies). The cells were allowed to establish for 3-5 days prior to two transfections, two days prior to co- culture with denuded oocytes. Transfection of the cumulus cells was carried out with the TransIT X2 delivery system from Mirus (Madison, WI, USA) and the pcDNA 3.1 (+) plasmid (Life Technologies) containing eGFP and FMRP sequences. Co-culture with denuded oocytes was conducted only if >25% of the cells expressed the eGFP.

To “rebuild” cumulus oocyte complexes, oocytes were gently stripped of their cumulus cells prior to maturation. At the same time, the cell lines were scraped from the bottom of the plate in 1 mL per well of IVM media. Oocytes and 500 µL of the media containing transfected cells were placed into 1.5 mL tubes and placed with lids open into the incubator for 22 h of maturation. After this period oocytes were recovered, briefly imaged using fluorescent confocal microscope for the GFP signal, stripped of all cumulus cells, zona pellucidae were removed with acid Tyrode’s and frozen for RT-PCR analysis.

RNA isolation and reverse transcription were carried out as described above for RT-qPCR. The targets were then amplified through 30 cycles (for -actin) and 40 cycles (for GFP and plasmid) of 98°C for 10 s, 59°C for 30 s, and 72°C for 30 s using TaKaRa ExTaq (Clonetech, Mountain View, CA USA). For PCR primers refer to supplemental Table 1. Amplicons were then run on a 2% agarose gel and visualized with ethidium bromide under UV light with a Bio-DocIt imaging system (UVP, Upland CA, USA).

2.4.11 Statistics Oocytes were collected from abattoir ovaries, washed, and pooled together for morphological selection of quality gametes. Random sorting was carried out to create

treated and control groups for all assays including RNA and protein detection, RNAseq library construction, RT-qPCR measurements, and functional assessments on rate of maturation in the presence of inhibitors. Comparison of means was carried out by t-test with significance attained at p < 0.05. In the case of the RT-qPCR, data was normalized to the exogenous transcriptome (ERCC) using geNorm software, prior to log2 transformation and one-tailed t-tests to determine significant differences between means in Prism 5 (Graphpad software, La Jolla, CA, USA).

2.5 Results 2.5.1 Transcriptomic comparison of GV and MII oocytes As a first step, the potential for transcript accumulation during oocyte maturation when the gamete’s transcriptional activity is believed to be silenced was investigated. A transcriptome survey of follicle-enclosed full-size germinal vesicle stage (GV) bovine oocytes was compared with mature (MII) oocytes that developed in vitro. Considering the total RNA content at MII is representative of the net balance from the loss of transcripts due to translation and degradation in relation to what is stored within the oocyte at the outset of maturation, identifying transcripts for which abundance would be higher at MII is unexpected.

Data analysis revealed that overall RNA content was not significantly different between stages of maturation (Figure 2-1A). However, specific analyses showed increases in the abundance in 1.8% of transcripts in the MII stage oocyte. Comparative RNA levels of three of these candidates (RASL11B, KIF5B and AFF4) are illustrated in Figure 2-1B. The requirement for the presence of cumulus cells for this increase was determined by measuring the abundance of these candidate gene transcripts in oocytes matured with their full complement of cells or completely stripped of them. For all three gene candidates, transcripts accumulated during oocyte maturation but only when the cumulus cells are present (Figure 2-1C) suggesting that the cumulus cells can act as an exogenous source of RNA for the oocyte.

2.5.2 Characterization of the transzonal projection structures The role of these TZPs was investigated in the perspective of potential for extensive cargo exchange through structures such as observed in other cell types forming tunnelling nanotubes (TNTs). Compared to these fine intercellular structures (20 to 500 nm in diameter) (Abounit and Zurzolo 2012), the TZPs are much larger with a diameter in the order of 2 µm (Figure 2-2A). Figure 2-2B demonstrates that TZPs invaginate inside the oocyte without membrane fusion and are held in place by adherens-like structures on the oocyte membrane and its extending microvilli that envelop the projection bulb. As such, TZPs differ from TNTs by not being open-ended, as their somatic cell membrane does not fuse with the oocyte membrane (Figure 2-2B). An electron dense material can also be observed in the antrum of the TZP end potentially indicative of protein aggregates (Figure 2-2B). Confocal fluorescence microscopy imaging shows that similar to the TNT, the TZPs are composed of a strong backbone made of actin filaments (Figure 2-2C) that are necessary for the intracellular transport of cellular components such as endoplasmic reticulum, Golgi, mitochondria or endosomes. Figure 2-2D highlights the high number of TZPs surrounding an oocyte (Figure 2-2D).

At the outset of maturation, the TZPs were in close contact with the oolemma, and were noticeably detaching at 9 h of maturation (Figure 2-3). This continued until 22 h when the connections were completely broken creating the perivitellin space. This delineated the time window for the potential direct transfer of material from the cumulus cell to the oocyte.

2.5.3 Detection of RNA within the TZP The presence of RNA in the TZPs was studied using different approaches (Figure 2-4). Confocal microscopy with specific labeling of all RNA molecules and imaging within the cumulus cells cloud confirmed the presence of RNA-containing particles distributed within the cells’ projections (Figure 2-4A). Detection of the presence of mRNA in the TZPs was done using in situ hybridization for poly-A bearing RNA (Figure 2-4B). Labeling was strong in the cumulus cell cytoplasm and was clearly visible along the entire length of the

TZPs. Further confirmation of the presence of mRNAs in the TZPs was shown by detection of the poly-A binding protein (PABP). Defined clusters of PABP proteins were observed in the TZPs spanning across the oocyte’s zona pellucida (Figure 2-4C-E). Together these results confirm that polyadenylated transcripts can be sent toward the oocyte through the protrusions of the cumulus cells.

2.5.4 Identification of newly transcribed RNA in TZP To determine if cumulus cell transcripts could be sent to the TZPs during oocyte maturation, de novo synthesized RNA was labeled and detected by fluorescence microscopy. Particles containing newly synthesized RNA were detected along the length of the TZPs (Figure 2-5). These particles were detected in absence of detectable transcriptional activity from the condensed chromatin of the oocyte (Figure 2-5 B, D). The specificity of the RNA staining assays was confirmed by RNAse cocktail treatment (Supplemental Figure 2-1). These results support the transport of newly synthesized RNA molecules through the zona pellucida.

Capture and identification of newly synthesized RNA within the TZPs was performed by micro-dissecting the cumulus-oocyte complexes. Since oocyte populations are heterogeneous with oocytes bearing chromatin at diverse degrees of condensation resulting in residual transcriptional activity, precautionary steps were taken. The gametes nuclei were removed from the assay by hemi-sectioning the cumulus-oocytes complexes prior to labeling and eliminating the DNA containing fragments (Supplemental Figure 2-2A). Following modified uridine incubation, cumulus cells were stripped from the zona pellucidae that were then thoroughly washed to remove any contaminating somatic cells. DNA labeling enabled detection and removal of contamination, even with a single cell (Supplemental Figure 2-2B). After these steps, the newly synthesized transcripts sent to the projections and present in the zona were pulled down using the incorporated labeled nucleotide and subjected to RNA-seq.

Comparative analysis of the transcriptomes of nascent RNA found in the cumulus cells and in the TZPs indicates an overlap of only 55% between both gene lists (Figure 2-5E). This supports the idea that selective transport of a considerable number of transcripts to the TZPs occurs. Transcript distribution showed similar RNA categories except that novel transcribed elements that have not been reported so far were less abundant in the TZPs (Figure 2-5F). Amongst known long non-coding RNAs found in the TZPs were H19 and Xist transcripts. The first is a maternally imprinted gene whereas the second controls transcriptional inactivation of one X-chromosome in females. Functional analysis of the gene list of nascent RNA found in the TZPs using the cumulus cell nascent transcriptome as background showed an enrichment in transcripts associated with known key molecular functions and biological processes of oocyte physiology; namely, nucleotide/ ribonucleotide binding, ion transport and translation control (Table 2-1). The list of the top 100 nascent RNA found in the TZP ranked by the number of fragments per kilobase of transcript per million mapped reads (FPKM) can be found in supplemental Table 2-2.

2.5.5 The gametic synapse To understand how large material might cross from the cumulus cells to the oocyte, electron microscopy was used in conjunction with 3H uridine labeling and autoradiographic exposure. Vesicles approximately 50 to 80 nm in diameter were observed between the oolemma and cumulus cell membranes (Figure 2-6A). At the same interaction the oolemma presented invaginations (coated pits), a possible indication of their propensity to incorporate secreted material. Autoradiography exposure of pulse-chase experiments confirmed that RNA molecules produced from the somatic nuclei are sent through the TZPs, and labeled RNA molecules and vesicles were observed at the junction of the two membranes (Figure 2-6 B-D). A longer pulse lead to very dense and messy signals (data not shown).

2.5.6 Transfer of synthetic RNA in reconstituted cumulus-oocyte complexes To provide a definite proof of large cargo delivery from the cumulus cells to the oocyte, a primary cumulus cell line was established and transfected with a FMRP-GFP plasmid prior to co-culture with denuded oocytes (Figure 2-7 A). The GFP-FMRP transfected cumulus cells re-associated with many of the denuded oocytes. After maturation, the oocytes were imaged and some presented GFP protein signal within their cytoplasm (Figure 2-7 B). The oocytes that had re-associated with the GFP cells were then stripped of all cumulus cells and their zona pellucida were removed to eliminate contamination for RNA analysis. The GFP-FMRP transcript was found in these oocytes demonstrating the transfer of not only protein to the oocyte, but also of RNA (Figure 2-7C). In all of the samples, there was no detection of the construct (data not shown).

2.6 Discussion Although Although it was demonstrated in invertebrates that extensive material transfer of RNA, proteins and organelles transit to the oocyte through specialized structures like translocation channels or cell-cell bridges (Wolke et al. 2007) the current model of mammalian oogenesis limits the exchange and communication between the somatic cells and the gamete to small molecule and paracrine signalling (Moor et al. 1981; Wigglesworth et al. 2013). Recent data shows that somatic cells can exchange cellular components by establishing physical contacts with neighbouring cells and sometimes even with distant cells through the growth of cellular protrusions that reach and fuse with the target cell’s plasma membrane (Bukoreshtliev et al. 2009). This has considerably broadened the traditional view of intercellular communication which was mainly based on the formation of small channels between juxtaposed membranes (Hurtig et al. 2010). In light of these recent findings, we postulated that the TZPs could also be involved in the shuttling and delivery of large cargo to the oocyte.

At the structural level, compared to TNTs, TZPs are composed of a similar backbone of actin filaments but are much larger. Contrarily to TNTs, TZPs are not open ended where the adjacent membranes do not fuse. The TNT structures are fine and transient, lasting a

few minutes up to several hours (Rustom 2004; Bukoreshtliev et al. 2009). More specifically, the TZPs are much larger having a diameter of 2 µm that would be sufficient for the transit of intact mitochondria. Also, the TZPs that are formed during early oogenesis concomitantly with the secretory formation of the zona pellucida initiated during preantral development, and persist for days to weeks depending on the species. TZPs last until meiosis resumption that involves terminating communications between the oocyte and the gamete and inducing the signalling cascade and enzymatic reactions that reduce the oocyte’s cAMP content (Richard et al. 1997; Conti et al. 2002; Norris et al. 2009). At this point, the two cell types gradually dissociate as cumulus cells projections are released creating the perivitellin space between the zona pellucida and the oolemma. Therefore, in bovine the potential for large cargo transfer from the cumulus cells to the oocyte via the TZPs terminates around 9 h after induction of meiosis resumption.

In the present study, focus was given for the potential of the TZPs to transfer large cargo in the form of long RNA molecules as a novel perspective to complement the maternal reserves which are an essential part of the early embryonic program embedded in the maternal gamete (de Moor and Richter 1999; Hurst et al. 1999; Schnorrer et al. 2000). Observing transcript abundance difference between matured oocytes cultured either denuded or in intact COCs could arise from a shift in transcript stability induced by an unknown factor from the cumulus cells. However, transcript stability cannot explain the increase in abundance when compared to a preceding stage, as it is the case for GV to MII stage oocyte. Accumulation of transcripts during oocyte maturation would support the potential for transfer given the endogenous transcription of the oocyte is silenced. Previous work reported increases in some transcripts during oocyte maturation but this was attributed to endogenous transcription in the oocyte itself as the use of α-amanitin to inhibit RNA synthesis ablated the increase (Mamo et al. 2011). However, inhibiting the polymerase II complex confirmed the contribution of new transcriptional events to the oocyte stores but did not identify its origin, as α-amanitin treatment would have affected cumulus cell transcription as well. Our results confirm some transcripts increase in abundance during maturation and that this increase is dependent on the presence of cumulus cells.

Amongst the transcripts found to be over-abundant in MII stage compared to GV stage oocytes, three were chosen for validation on the basis of their top position in the gene list. Interestingly, these candidates have been mainly described in the brain with functions in neurons and at the level of the synapse. Although still little is known, RASL11B (RAS- Like, Family 11, Member B) protein is a member of small GTPase protein family and works as a switch in diverse signalling pathways (Stolle et al. 2007) and is associated to glioblastoma, a malignant brain tumour (Holtkamp et al. 2007). The Kinesin superfamily, of which KIF5B (kinesin family member 5B) is a member, has been extensively associated to axon and dendrite physiology as they are responsible for neuronal transport of large cargo such as mitochondria along the cytoskeleton (Pilling et al. 2006; Ma et al. 2009). Recently their cargo has been extended to include RNA granules (Kanai et al. 2004). In other cell types, they were found to drive polarized transport in epithelial cells (Jaulin et al. 2007). In mouse, RNAi silencing of KIF5b induces a delay in germinal vesicle breakdown and causes a failure in extrusion of the first polar body (Kidane et al. 2013). In pig, KIF5b is implicated in oocyte maturation through its role in cytoplasmic microtubule organization (Brevini et al. 2007). Although no function of AFF4 (AF4/FMR2 family, member 4) has been so far associated to oocyte physiology, it has been found that this protein is a member of the transcription elongating factor in cancer and neurons (Komori et al. 2012; Luo et al. 2012). Taken together, the role of these candidates is a little clearer in the brain where transport mechanisms are better characterized but organelle transport and control of translation are known important aspects of oocyte maturation.

Using different approaches our results confirm the presence RNA containing granules along the entire length of the TZPs. However, the presence of RNA in TZPs and potential transfer to the oocyte has previously been proposed for miRNAs transiting across gap junctions (Katakowski et al. 2010; Assou et al. 2013). To delineate miRNAs from long transcripts, detection of polyadenylation complemented with the presence of its binding protein PABP was conducted and clearly shows the presence of mRNAs in these granules found in the TZPs. This was further confirmed by surveying the nascent transcript population of the TZPs. Our results also demonstrate that newly transcribed mRNAs from the cumulus cells are sent to their projections. Comparative analysis of the transcript

populations from the cell body or their TZPs strongly support a selection of mRNAs to be transported in the TZPs again with functions associated with molecular transport and control of translation.

Since the TZPs are not open ended and gap junctions do not permit the transfer of long transcripts (Valiunas et al. 2005), the mode of delivery for this cargo to the oocyte remained unknown. Imaging the articulation between the TZPs and the oolemma highlighted the presence of vesicular secretion from the TZP ends that allows transfer of transcripts to the gamete. This type of cellular communication is usually found for long distance interactions; however, we show that communication through vesicular secretion can occur for closely associated cells. During the initial 3H-uridine labeling of RNA experiment, the presence of many unlabeled vesicles was expected given the short duration of the pulse (30 min) and that the average time for the production of an mRNA in eukaryotic cells averages 20 min (Kimura 2002; Darzacq et al. 2007). The labeling thus detected immediate transcriptional activity. Also, due to irregular trajectory taken by the beta particles and the thickness of the emulsion, the size of the RNA cannot be appreciated from the detected mark and the exact position could have shifted slightly thus not excluding that the signals could originate from the nearby vesicles. Overall, the observed structures were reminiscent of neuronal synapses that communicate and exchange neurotransmitters through vesicular secretion. The observed TZP structures agree with cytological descriptions of synaptic structures (Wolke et al. 2007; Tarakanov and Goncharova 2009; Hurtig et al. 2010).

To demonstrate RNA transfer from the somatic cells to the gamete, COC reconstruction was conducted in light of recent evidence where cumulus cells were proven capable of re- attaching and re-establishing connections with stripped oocytes (Feng et al. 2012). The transfected construct coded for a GFP-FMRP fusion protein. The transcript of the FMR1 gene was found in the TZPs RNA population making it a good candidate to be selectively transported in the TZPs. In addition, FMRP is a RNA binding protein with a very broad range of possible targets making it a good candidate for ribonucleoparticle formation and intercellular transfer (Darnell et al. 2011). From these reconstructed COCs, both GFP

mRNA and protein were detected in the egg confirming transfer from the somatic cells. At this point, it is not known if the GFP signal arose from protein transfer or from translating the transcript in the ooplasm.

From these observations, we propose that contrary to what is currently accepted, the somatic cells surrounding the mammalian oocyte actively transfer long RNA molecules to the oocyte using their TZPs. By doing so, the somatic cells continue to nurture the gamete after it becomes transcriptionally quiescent. This new insight of the interconnection between the mammalian gamete and somatic cells is significant since it provides a new perspective to integrate how the mammalian gamete acquires its full potential to develop into an embryo. It is interesting to consider that follicular “preparation” controlled by hormonal regimen administered to large follicles, can have a major impact on the developmental competence of the enclosed gamete even if it is already fully grown at the time of the treatment (Blondin et al. 2002; Luciano et al. 2005; Nivet et al. 2012). Also, denuded fully grown oocytes exhibit extremely poor developmental potential which can be rescued when incubated with intact cumulus-oocyte complexes (Luciano et al. 2005; Dey et al. 2012). These reports provide clear evidence of the pivotal role played by the somatic compartment on the oocyte developmental potential. The transfer of material to the gamete could be at the basis of these observations.

2.7 Conclusion These results propose that our current concept for the process that constitutes the maternal RNA reserves in the mammalian oocytes should be revisited taking into consideration this new contribution from the surrounding somatic cells through intercellular vesicle-mediated transfer. Although further work is needed to determine the physiological roles played by this transfer, this unexpected delivery of large cargo from the supporting cells to the mammalian egg provides a new perspective as to the determinants of egg quality and maternal fertility.

2.8 Acknowledgements We thank D. Gagné, I. Dufort, I. Laflamme, and H. Holm for their technical assistance during this project. We also thank Dr. Watson (Western University, London Ontario) for his critical review of our manuscript.

2.9 References Abounit S, Zurzolo C. 2012. Wiring through tunneling nanotubes - from electrical signals to organelle transfer. Journal of Cell Science 125:1089–1098. Assou S, Al-edani T, Haouzi D, Philippe N, Lecellier CH, Piquemal D, Commes T, Ait- Ahmed O, Déchaud H, Hamamah S. 2013. MicroRNAs: new candidates for the regulation of the human cumulus-oocyte complex. Human Reproduction 28:3038– 3049. Blondin P, Bousquet D, Twagiramungu H, Barnes F, Sirard M-A. 2002. Manipulation of follicular development to produce developmentally competent bovine oocytes. Biology of Reproduction 66:38–43. Bouniol-Baly C, Hamraoui L, Guibert J, Beaujean N, Szöllösi MS, Debey P. 1999. Differential transcriptional activity associated with chromatin configuration in fully grown mouse germinal vesicle oocytes. Biology of Reproduction 60:580–587. Brevini TAL, Cillo F, Antonini S, Gandolfi F. 2007. Cytoplasmic remodelling and the acquisition of developmental competence in pig oocytes. Animal Reproduction Science 98:23–38. Bukoreshtliev NV, Wang X, Hodneland E, Gurke S, Barroso JFV, Gerdes H-H. 2009. Selective block of tunneling nanotube (TNT) formation inhibits intercellular organelle transfer between PC12 cells. FEBS Letters 583:1481–1488. Conti M, Andersen CB, Richard F, Mehats C, Chun SY, Horner K, Jin C, Tsafriri A. 2002. Role of cyclic nucleotide signaling in oocyte maturation. Molecular and Cellular Endocrinology 187:153–159. Cowden RR. 1962. RNA and yolk synthesis in growing oocytes of the sea urchin, Lytechinus verigatus. Experimental Cell Research 28:600–604. Darnell JC, Van Driesche SJ, Zhang C, Hung KYS, Mele A, Fraser CE, Stone EF, Chen C, Fak JJ, Chi SW, et al. 2011. FMRP Stalls Ribosomal Translocation on mRNAs Linked

to Synaptic Function and Autism. Cell 146:247–261. Darzacq X, Shav-Tal Y, de Turris V, Brody Y, Shenoy SM, Phair RD, Singer RH. 2007. In vivo dynamics of RNA polymerase II transcription. Nature Structural and Molecular Biology 14:796–806. de Moor CH, Richter JD. 1999. Cytoplasmic polyadenylation elements mediate masking and unmasking of cyclin B1 mRNA. The EMBO Journal 18:2294–2303. Dey SR, Deb GK, Ha AN, Lee JI, Bang JI, Lee KL, Kong IK. 2012. Coculturing denuded oocytes during the in vitro maturation of bovine cumulus oocyte complexes exerts a synergistic effect on embryo development. Theriogenology 77:1064–1077. Doyle J, Ellis SA, O’Gorman GM, Aparicio Donoso IM, Lonergan P, Fair T. 2009. Classical and non-classical Major Histocompatibility Complex class I gene expression in in vitro derived bovine embryos. Journal of Reproductive Immunology 82:48–56. Edwards RG. 1965. Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and human ovarian oocytes. Nature 208:349–351. Faerge I, Grondahl C, Ottesen JL, Hyttel P. 2001. Autoradiographic localization of specific binding of meiosis-activating sterol to cumulus-oocyte complexes from marmoset, cow, and mouse. Biology of Reproduction 64:527–536. Feng G, Shi D, Yang S, Wang X. 2012. Co-culture embedded in cumulus clumps promotes maturation of denuded oocytes and reconstructs gap junctions between oocytes and cumulus cells. Zygote 21:231–237. Gilchrist RB, Lane M, Thompson JG. 2008. Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Human Reproduction Update 14:159–177. Gurdon JB, Woodland HR. 1968. The cytoplasmic control of nuclear activity in animal development. Biological Reviews of the Cambridge Philosophical Society 43:233–267. Holtkamp N, Ziegenhagen N, Malzer E, Hartmann C, Giese A, Deimling von A. 2007. Characterization of the amplicon on chromosomal segment 4q12 in glioblastoma multiforme. Neuro-oncology 9:291–297. Hurst S, Talbot NJ, Stebbings H. 1999. A staufen-like RNA-binding protein in translocation channels linking nurse cells to oocytes in Notonecta shows nucleotide- dependent attachment to microtubules. Journal of Cell Science 112 ( Pt 17):2947–2955. Hurtig J, Chiu DT, Önfelt B. 2010. Intercellular nanotubes: insights from imaging studies

and beyond. WIREs Nanomed Nanobiotechnol 2:260–276. Hussein TS, Thompson JG, Gilchrist RB. 2006. Oocyte-secreted factors enhance oocyte developmental competence. Developmental Biology 296:514–521. Jaulin F, Xue X, Rodriguez-Boulan E, Kreitzer G. 2007. Polarization-Dependent Selective Transport to the Apical Membrane by KIF5B in MDCK Cells. Developmental Cell 13:511–522. Kanai Y, Dohmae N, Hirokawa N. 2004. Kinesin transports RNA: isolation and characterization of an RNA-transporting granule. Neuron 43:513–525. Katakowski M, Buller B, Wang X, Rogers T, Chopp M. 2010. Functional MicroRNA Is Transferred between Glioma Cells. Cancer Research 70:8259–8263. Kimura H. 2002. The transcription cycle of RNA polymerase II in living cells. The Journal of Cell Biology 159:777–782. Komori T, Doi A, Nosaka T, Furuta H, Akamizu T, Kitamura T, Senba E, Morikawa Y. 2012. Regulation of AMP-activated Protein Kinase Signaling by AFF4 Protein, Member of AF4 (ALL1-fused Gene from Chromosome 4) Family of Transcription Factors, in Hypothalamic Neurons. Journal of Biological Chemistry 287:19985–19996. Lodde V, Modina S, Maddox-Hyttel P, Franciosi F, Lauria A, Luciano AM. 2008. Oocyte morphology and transcriptional silencing in relation to chromatin remodeling during the final phases of bovine oocyte growth. Molecular Reproduction and Development 75:915–924. Luciano AM, Lodde V, Beretta MS, Colleoni S, Lauria A, Modina S. 2005. Developmental capability of denuded bovine oocyte in a Co-culture system with intact cumulus-oocyte complexes: Role of cumulus cells, cyclic adenosine 3',5'-monophosphate, and glutathione. Molecular Reproduction and Development 71:389–397. Luo Z, Lin C, Guest E, Garrett AS, Mohaghegh N, Swanson S, Marshall S, Florens L, Washburn MP, Shilatifard A. 2012. The Super Elongation Complex Family of RNA Polymerase II Elongation Factors: Gene Target Specificity and Transcriptional Output. Molecular and Cellular Biology 32:2608–2617. Ma H, Cai Q, Lu W, Sheng ZH, Mochida S. 2009. KIF5B Motor Adaptor Syntabulin Maintains Synaptic Transmission in Sympathetic Neurons. Journal of Neuroscience 29:13019–13029.

Mamo S, Carter F, Lonergan P, Leal CL, Naib Al A, McGettigan P, Mehta JP, Evans AC, Fair T. 2011. Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation. BMC Genomics 12:151-165. Memili E, First NL. 1998. Developmental changes in RNA polymerase II in bovine

oocytes, early embryos, and effect of α‐amanitin on embryo development. Molecular Reproduction and Development 51:381–389. Moor RM, Osborn JC, Cran DG, Walters DE. 1981. Selective effect of gonadotrophins on cell coupling, nuclear maturation and protein synthesis in mammalian oocytes. Journal of Embryology and Experimental Morphology 61:347–365. Moor RM, Smith MW, Dawson RM. 1980. Measurement of intercellular coupling between oocytes and cumulus cells using intracellular markers. Experimental Cell Research 126:15–29. Nivet A-L, Bunel A, Labrecque R, Belanger J, Vigneault C, Blondin P, Sirard M-A. 2012. FSH withdrawal improves developmental competence of oocytes in the bovine model. Reproduction 143:165–171. Norris RP, Ratzan WJ, Freudzon M, Mehlmann LM, Krall J, Movsesian MA, Wang H, Ke H, Nikolaev VO, Jaffe LA. 2009. Cyclic GMP from the surrounding somatic cells regulates cyclic AMP and meiosis in the mouse oocyte. Development 136:1869–1878. Pilling AD, Horiuchi D, Lively CM, Saxton WM. 2006. Kinesin-1 and Dynein Are the Primary Motors for Fast Transport of Mitochondria in Drosophila Motor Axons. Molecular and Biological Cell 17:2057–2068. Ram PT, Schultz RM. 1993. Reporter gene expression in G2 of the 1-cell mouse embryo. Developmental Biology 156:552–556. Richard FJ, Fortier MA, Sirard MA. 1997. Role of the cyclic adenosine monophosphate- dependent protein kinase in the control of meiotic resumption in bovine oocytes cultured with thecal cell monolayers. Biology of Reproduction 56:1363–1369. Rustom A. 2004. Nanotubular Highways for Intercellular Organelle Transport. Science 303:1007–1010. Schnorrer F, Bohmann K, Nüsslein-Volhard C. 2000. The molecular motor dynein is involved in targeting swallow and bicoid RNA to the anterior pole of Drosophila

oocytes. Nature Cell Biology 2:185–190. Sternlicht AL, Schultz RM. 1981. Biochemical studies of mammalian oogenesis: Kinetics

of accumulation of total and poly (A)‐containing RNA during growth of the mouse oocyte. Journal of Experimental Zoology 215:191–200. Stolle K, Schnoor M, Fuellen G, Spitzer M, Cullen P, Lorkowski S. 2007. Cloning, genomic organization, and tissue-specific expression of the RASL11B gene. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1769:514–524. Sun X-S, Liu Y, Yue K-Z, Ma S-F, Tan J-H. 2004. Changes in germinal vesicle (GV) chromatin configurations during growth and maturation of porcine oocytes. Molecular Reproduction and Development 69:228–234. Tarakanov AO, Goncharova LB. 2009. Cell-cell nanotubes: Tunneling through several types of synapses. Communicative & Integrative Biology 2:359–361. Valiunas V, Polosina YY, Miller H, Potapova IA, Valiuniene L, Doronin S, Mathias RT, Robinson RB, Rosen MR, Cohen IS, et al. 2005. Connexin-specific cell-to-cell transfer of short interfering RNA by gap junctions. The Journal of Physiology 568:459–468. Wigglesworth K, Lee KB, O'Brien MJ, Peng J, Matzuk MM, Eppig JJ. 2013. Bidirectional communication between oocytes and ovarian follicular somatic cells is required for meiotic arrest of mammalian oocytes. Proceedings of the National Academy of Sciences 110:E3723–E3729. Wolke U, Jezuit EA, Priess JR. 2007. Actin-dependent cytoplasmic streaming in C. elegans oogenesis. Development 134:2227–2236. Yeo CX, Gilchrist RB, Lane M. 2009. Disruption of Bidirectional Oocyte-Cumulus Paracrine Signaling During In Vitro Maturation Reduces Subsequent Mouse Oocyte Developmental Competence. Biology of Reproduction 80:1072–1080.

2.10 Tables Table 2-1. Top ten GO terms for biological processes and molecular function enriched in the TZPs using the cumulus cells as a background

2.11 Figures

Figure 2-1. Evaluation of GV and MII oocyte transcripts (A) RNA transcript levels in oocytes at the GV and MII stage determined by RNA-seq, pools of 20 oocytes at both GV and MII stage were analyzed in triplicate. (B) Histograms of candidates more abundantly expressed in the MII stage oocyte compared to the GV stage oocyte as determined by RNA-seq. (C) For the same transcripts, RT-qPCR results showed higher transcript levels in oocytes after maturation with cumulus cells than oocytes matured without, when compared to immature GV oocytes. Data are presented as means with standard error, with significance marked by a * (p < 0.05) as determined by one-tailed t- tests after ΔΔ CT evaluation and Log2 transformation. Five pools of five oocytes were used for each experiment.

Figure 2-2. Transzonal projection structure (A) Scanning electron micrograph of a cumulus cell (CC) and its TZP interaction with the zona pellucida (ZP). (B) A TZP that penetrates the ZP and interacts with the microvilli (Mv) extensions of the oocyte’s (Oo) oolemma. (C, D) Numerous actin microfilaments in projections revealed by rhodamine phalloidin (red) of cumulus cells with stained nuclear material (Hoechst 33342 stain, blue) interact with the oocyte membrane (GM1 stain, green). Scale bars are 20 µm.

Figure 2-3. TZPs retraction at the end of oocyte maturation TZPs withdrawal from contact with the oolemma during oocyte maturation. At 0 h the connections are in close contact. By 9 h of maturation and coinciding with GVBD, the connections begin to break, so that by the end of maturation at 22 h there is no longer intermembranous connection. DNA (Hoechst33342, blue), Membrane (GM1 stain, green), Actin (rhodamine phalloidin stain, red). Scale bars are 20 µm.

Figure 2-4. Transzonal projections contain RNA (A) Total RNA staining (green) reveals strong signal through the cumulus cells, and also foci (arrows) within the TZPs extending towards the ZP of the oocyte, nuclear DNA (blue). (B) In situ hybridization against the poly-A tail of RNA transcripts provides the white signal in the cumulus cells and the TZPs (arrow). (C) Immunofluorescent detection of PABP. (D) TZPs membranes. (E) Overlay of C and D. All scales bars are 20 µm, C-E are the same scale.

Figure 2-5. Evaluation of nascent RNA transcripts in the TZP

(A) Nascent RNA (Click-it nascent RNA, green) (B) membrane (FM 4-64, red) (C) DNA (Hoechst 33342) (D) Overlay of A, B and C showing that de novo RNA is synthesized during oocyte maturation and localizes in foci to the TZPs (arrows). (E) A comparison at the top plot demonstrating the commonality of the most abundant transcripts between the cumulus cells and TZPs. (F) The populations of RNA and their quantities as determined by RNA-seq analysis of de novo synthesized RNA present in the cumulus cells and the TZPs. Scale bar for A-D found on D is 20 µm.

Figure 2-6. Ultrastructure of the projections ends

(A) The TZP spans the ZP and interacts with mircrovilli (Mv) and the oolemma of the oocyte (Oo). It is anchored by zonula adherens like junctions (ZA) that appear as dark regions at the periphery of the TZP. Numerous membrane vesicles (V) exist in the cleft formed between the two interacting cells. A coated pit (Cp) is present on the oocyte side of the junction. (B) 3H-labeled RNA detection after autoradiography. A TZP with protrudes into the oocyte and visible de novo RNA signal created by the autoradiographic deposition of silver grains are present in the TZP (arrow) and in the ooplasm. (C) A TZP also bearing staining for de novo RNA is seen in close contact with the oocyte. The grains corresponding to RNA signal are present in the cleft, and the bordering ooplasm, and near to vesicles at the projections. (D) A TZP section that spans the zona and invaginates in the oolemma. RNA signal can been seen in the length of the TZP, it’s bulb, and also in the ooplasm (arrows). Scale bars A and C: 500 nm, in B: 1 µm, in D: 5 µm.

Figure 2-7. Detection of a synthetic transcript in reconstituted cumulus-oocyte complexes Cumulus cells were collected, placed in culture and transfected with a plasmid expressing an FMRP-GFP fusion protein (A). Following the detection of GFP signal confirming transcript production, denuded fresh oocytes were overlaid on the cell culture and allowed to mature (B). After incubation GFP-FMRP was detected in the oocyte (arrows). The oocytes were denuded again, the zona pellucida was dissolved to remove TZPs and detection of GFP transcript was done by RT-PCR on single oocyte (C). Lanes 1-5 single oocyte from reconstructed COCs, Lane 6 is an untreated pool of oocytes, lane 7 is a positive control of transfected cumulus cells, and lane 8 is a no-template control. Beta-actin (ACTB) was used as a positive control for each sample. The scale in A is equivalent to the scale in B, bar: 20 µm.

3 Cumulus cell transcripts transit to the bovine oocyte in preparation for maturation

Angus D Macaulay1, Isabelle Gilbert1, Sara Scantland1, Eric Fournier1, Fazl Ashkar2, Alexandre Bastien1, Habib A. Shojaei Saadi1, Dominic Gagne1, Marc-André Sirard1, Édouard W Khandjian3, Francois J Richard1, Poul Hyttel4, Claude Robert1*

1 Département des sciences animales, Centre de recherche en biologie de la reproduction, Institut sur la nutrition et les aliments fonctionnels, Université Laval, Québec, QC, Canada. 2 Department of Biomedical Sciences, Reproductive biology lab, University of Guelph, Guelph, ON. 3 Département de Psychiatrie et Neurosciences, Institut universitaire en santé mentale de Québec, Université Laval, Québec City, Québec, Canada 4 Department of Veterinary Clinical and Animal Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen Denmark.

3.1 Résumé Encore aujourd’hui, les caractéristiques d’un ovocyte de bonne qualité restent nébuleuses, tout comme la nature des signaux physiologiques, cellulaires et moléculaires menant à sa production tant in vivo que in vitro. Nous savons néanmoins qu’il existe une interdépendance forte et complexe entre les cellules folliculaires et le gamète. Des facteurs sécrétés induisent différentes réponses dans les cellules folliculaires et l’échange direct de petites molécules via des jonctions gap entre l’ovocyte et les cellules du cumulus régule l’arrêt méiotique. En nous penchant sur les connections entre les cellules du cumulus et l’ovocyte, nous avons précédemment démontré que les cellules somatiques alimentent la réserve de transcrits maternels dans l’ovocyte. Dans la présente étude, nous montrons le déplacement de ces transcrits dans les projections transzonales (PTZ) et jusqu’à l’ovocyte. L’analyse de ces transcrits nous montre qu’ils s’accumulent progressivement dans les PTZ, indiquant que le transfert d’ARN a lieu préalablement à la reprise de la méiose. En analysant et en comparant les transcrits présents dans les PTZ, ceux dont l’abondance augmente dans l’ovocyte et ceux qu’on retrouve dans les polyribosomes de l’ovocyte, nous avons montré l’existence de transcrits communs à chacune de ces fractions. Ceci suggère qu’il y a un transfert de transcrits entre les cellules et que ceux-ci sont traduits. De plus, le retrait des cellules du cumulus, tout comme l’inhibition successive de la transcription, du transport des vésicules et de leurs fonctions ont significativement réduit le taux de maturation des ovocytes, montrant ainsi la nécessité d’avoir un transfert d’ARN vers l’ovocyte. Ces résultats offrent une nouvelle perspective sur les déterminants de la qualité ovocytaire et de la fertilité femelle et suggère une piste de recherche afin d’améliorer les conditions de maturation in vitro.

3.2 Abstract So far, the characteristics of a good quality egg have been elusive, similar to the nature of the physiological, cellular, and molecular cues leading to its production both in vivo and in vitro. Current understanding highlights a strong and complex interdependence between the follicular cells and the gamete. Secreted factors induce cellular responses in the follicular cells, and direct exchange of small molecules from the cumulus cells to the oocyte through gap-junctions control meiotic arrest. Studying the interconnection between the cumulus cells and the oocyte, we previously demonstrated that the somatic cells also contribute transcripts to the gamete. Here we show that these transcripts can be visualized moving down the transzonal projections (TZPs) to the oocyte, and that a time course analysis revealed progressive RNA accumulation in the TZPs, indicating that RNA transfer occurs before the initiation of meiosis resumption under a time table fitting with the acquisition of developmental competence. A comparison of the identity of the nascent transcripts trafficking in the TZPs, to those in the oocyte increasing in abundance during maturation, and that are present on the oocyte’s polyribosomes, revealed transcripts common to all three fractions suggesting the utilization of transferred transcripts for translation. Furthermore, the removal of potential RNA trafficking by stripping the cumulus cells caused a significant reduction in maturation rates indicating the need for the cumulus cell RNA transfer to the oocyte. These results offer a new perspective to the determinants of oocyte quality and female fertility, as well as provide insight that may eventually be used to improve IVM conditions.

3.3 Introduction It is known that mammalian oocytes spontaneously resume meiosis once extracted from their follicular environment and are placed in in vitro culture (Edwards 1965). Despite 35 years of in vitro fertilization research we still have a limited understanding of the involved processes. In all mammalian species, in vitro maturation (IVM) of fully-grown oocytes from small follicles translates into lower embryonic developmental rates compared to in vivo matured counterparts (Trounson et al. 2001; Rizos et al. 2002). Human oocytes matured in vitro typically do so at rates between 50-70%, and often less than half of those matured oocytes reach blastocyst stage (Trounson et al. 2001; Guzman et al. 2012), though recent work has shown that this is improving in FSH stimulated women, whose cohors included small follicles (Walls et al. 2014). Cattle represent a good model being a mono- ovular species, typically having about 80% of oocytes reaching metaphase two (MII) and comparable to human (≈35%) blastocyst development after IVM (Rizos 2002; Albuz et al. 2010). This diminished performance of in vitro versus in vivo conditions on oocyte maturation and development has been imputed to a lack of understanding oocyte requirements (Gad et al. 2012). These suboptimal success rates indicate that events within the follicle are not recapitulated by in vitro conditions, leaving the oocyte less prepared for embryogenesis (Rizos et al. 2002). It has been shown that oocyte quality prior to maturation is the most influential factor to the developmental potential required to reach blastocyst stage and that in vivo conditions are heavily influenced by the hormonal regime given for ovarian stimulation (Blondin et al. 2002; Rizos et al. 2002; Nivet et al. 2012; Plourde et al. 2012). Manipulation of the conditions both in vivo through control over hormonal regimen (Blondin et al. 2002; Nivet et al. 2012) as well as in vitro by monitoring the time of oocyte collection following slaughter (Blondin and Sirard 1995), or by controlling meiosis resumption have been described to increase developmental competence (Albuz et al. 2010). From this arose the concept of oocyte pre-maturation, where IVM conditions can be manipulated to prevent spontaneous meiotic resumption with the objective of improving the oocyte’s developmental competence (Le Beux et al. 2003; Albuz et al. 2010). The current model of mammalian oogenesis is known to involve bidirectional communication between the surrounding cumulus cells and the oocyte orchestrating growth

and maturation of both the gamete and follicular compartments. The existing model for this bilateral communication involves paracrine signaling and small molecule (<1 kDa) exchange via gap junctions (Hussein et al. 2006; Gilchrist et al. 2008; Yeo et al. 2009). Direct transfer of small molecules is permitted through the cumulus cell projections that penetrate the zona pellucida and make contact with the oolemma (TZPs). At the edge of the projection, intermediate junctions (zonula adherens-like junctions) keep the cytoplasmic membranes of both cells in close contact and gap junctions allow the exchange of the small molecules, namely cAMP and cGMP (Hyttel et al. 1997; Albertini and Barrett 2004). Though these large macro channels are present, uptake of large molecules by the oocyte is not believed to occur (Moor et al. 1980). We have recently shown that contrarily to what has been previously observed, exchange of large cargo including de novo synthesized long RNA, defined as longer than 200 base pairs in length, molecules can occur between the cumulus cells and the oocyte through the TZPs (Macaulay et al. 2014). The aim of this study is to determine, based on our previous observations, the potential roles played by these transferred RNA in oocyte maturation. We hypothesized that the cumulus cells transfer mRNAs benefitting oocyte maturation in an orchestrated fashion. We further explore our recently identified mechanism by which cumulus cells contribute to oocyte development and maturation by providing large RNA molecules. A better knowledge of this transfer could be pivotal to the definition of egg quality and its intrinsic potential to undertake and sustain early embryonic development.

3.4 Materials and Methods All chemicals were purchased from Sigma, Chemical Co. (Oakville, Ontario, Canada) unless otherwise indicated.

3.4.1 Oocyte collection and maturation All animals were slaughtered in accordance with the Canadian Food Inspection Agency (CFIA) standards. Their regulations were followed strictly at the local abattoir that provided the ovaries. No animals were handled on university premises. Bovine oocytes were collected from 2-6 mm follicles from abattoir ovaries. Good-quality oocytes

displaying homogenous cytoplasm, a complete cumulus cloud with no signs of atresia, and a fully-grown size greater than 120 m were selected. Cumulus oocyte complexes (COCs) were typically matured in standard maturation medium as previously described (Nivet et al. 2012). If oocytes were denuded, it was done so by gentle mechanical pipetting for one minute in a 4-well dish followed by further media washing prior to maturation. Maturation medium was composed of TCM199 (Gibco 11150059, Life Technologies, Burlington, ON, Canada), 10% fetal bovine serum (FBS), 0.2 mM pyruvate, 50 μg/ml gentamicin, 5 μg/ml

FSH (Serono, Mississauga ON, Canada), and 1 μg/ml E2. Oocytes were matured in groups of 50 in 500 μl of media at 38.5 8C with 5% CO2 in air with maximal humidity. However, in the timing of TZPs RNA loading experiment, oocytes were collected from ovaries at the abattoir at specific time points (0, 2, 4, and 6 h) following slaughter, maturation was conducted in a proprietary maturation medium with 10 oocytes per 500 μl in a 0.6 ml eppendorf tube (Boviteq Inc., St-Hyacinthe, QC, Canada) suitable for atmospheric gas in a portable incubator (Micro Q Technologies, Scottsdale, AZ, USA).

3.4.2 Transmission electron microscopy and autoradiography Collected COCs were placed into equilibrated maturation media under oil for maturation. Oocytes were exposed to [3H]-uridine during the first three hours of maturation. Transmission electron microscopy was carried out as described previously (Faerge et al. 2001). Briefly, exposed oocytes were transferred into media with a concentration of 200 µCi/ml of [3H]-uridine (Perkin-Elmer, Woodbridge, ON, Canada). All COCs were washed twice in PBS supplemented with 10% fetal calf serum (FCS) for 15 min at 4ºC. Oocytes were fixed in freshly prepared 3% glutaraldehyde (Electron Microscope Solutions, Ft. Washington, PA, USA) in 1 X PBS for 1 h at 4ºC. Prior to embedding the oocytes were stored in 1 X PBS. Then, samples were post-fixed in 1% osmium tetroxide (Alfa Aesar, Germany) in Na-phosphate buffer (pH = 7.4) for 60 min, and rapidly dehydrated in increasing ethanol concentration and embedded in epoxy resin (TAAB 812 Epon, TAAB, United Kingdom). Ultra thin sections were cut using an ultramicrotome and sample sections were stained with uranyl acetate (Ultrastain, Laurylab Saint-Fons Cedex, France) and with Reynolds ‘s lead citrate (Ampliqon, Skovlunde, Denmark). Autoradiographic

exposure was performed using L4 emulsion (Ilford Nuclear Research Emulsion, Mobberley, United Kingdom) and D19 developer (Kodak, Brøndby, Denmark). Grids were viewed with transmission electron microscopy (JEM-1200 EX, Jeol, Tokyo, Japan).

3.4.3 Image Analysis: Quantification of Pixel Intensity and Density Pixel counting and density measurements were made using ImageJ (version 2.0.0). The threshold function allowed for the identification of pixels resulting from the autoradiographic signal. In the ultra-thin sections, pixle density was measured as a percentage above threshold in defined areas: the zona pellucida, TZPs, cumulus cells, ooplasm, and intercellular regions like the perivitellin space, and the spaces between cumulus cells to provide an assessment of the level of intercellular background. A total of 12 COCs including some partially denuded ones were processed and evaluated. Treated and exposed grids were also produced without cellular sections to provide another measure of background (9 images from 6 different control grids). The signal in the ultra-thin sections was evaluated by region, i.e. pinwheel segments were created on the image designated within the ooplasm. A similar analysis of RNA by fluorescent labeling of nascent RNA was done using the 5-ethyl uridine Click-iT Kit (Life Technologies). Each maximum intensity projection composite image was taken at the equator of the oocyte, n = 9 cumulus enclosed oocytes, n = 11 partially denuded oocytes, and n = 12 denuded oocytes, and contained 11 sections spanning 10 μm of depth. Rhodamine phalloidin counterstaining of the actin cytoskeleton was also preformed and evaluated to produce an RNA:Actin ratio to normalize for the areas of the oocyte obstructed by the cumulus cells and cytoplasm during confocal acquisition. A further background correction was made based on extracellular regions and subtracted from the ratio values to provide an average corrected intensity. ImageJ and MatLab software were used for image analysis. The same pinwheel overlay was produced to fit the oocyte’s shape and to divide the oocyte into planes for regional analysis of the ooplasm in denuded, partially denuded, and cumulus-enclosed oocytes. Images of RNAse treated COCs incubated with the 5-ethyl uridine were also made to confirm the signal is from detected RNA.

100

3.4.4 Live cell imaging of RNA Immediately following aspiration, the RNA within the oocytes was stained using Syto RNA Select (1:1000 dilution, Life Technologies, Burlington, ON, Canada) for 30 min and washed. For live cell imaging, oocytes were placed in maturation media in an interchangeable coverslip dish (Bioptechs, Butler, PA, USA) including a custom made chamber containing 60 wells of 280 µm diameter each. The dish was laid into the microscope custom-made chamber at 37°C in a humidified atmosphere at 37 °C. Confocal images of a single plane were taken using a Zeiss LSM 740 confocal live-cell system (Karl Zeiss, Toronto, ON, Canada) at intervals ranging between 1.5 and 8 seconds.

3.4.5 Isolation of oocyte polyribosomes and microarray transcript evaluation Polyribosomes were isolated using pools of 75 germinal vesicle (GV) and MII oocytes using a previously described procedure (Scantland et al. 2011). Three biological replicates were performed for each maturation state. Briefly, the oocyte samples were spiked with drosophila polyribosomes that had been chemically cross-linked and neutralized. These exogenous polyribosomes acted as a carrier and allowed for polyribosome detection during fractioning on a sucrose gradient. Proven polyribosomal fractions were isolated and the bulk of drosophila RNA was eliminated during total RNA extraction. Polyribosomal transcripts were identified by microarray hybridization (EmbryoGENE bovine 44 k oligo array printed by Agilent) as described previously (Robert et al. 2011). Microarray raw data are available at Gene Expression Omnibus (GEO) under accession number #GSE56603. Since all samples were spiked with the same batch of carrier polyribosomes, drosophila transcripts for which oligos were present on the microarrays served as internal standards for data normalization accounting for sample loss during the procedures and also preserving the natural differences in polyribosomal RNA contents between both states of oocyte maturity.

101

3.4.6 RNA-seq libraries preparation and sequencing Two RNA-seq analyses were conducted. In the first one, total RNA transcriptome analysis of three pools each containing 20 oocytes were collected for each maturation stage (e.g. GV and MII). Total RNA extraction and DNAse I treatment was performed using PicoPure columns (Life Technologies). The synthetic transcriptome ERCC (Life Technologies) was spiked in the extraction buffer that was distributed equally in all samples. Next, cDNA first and second strand synthesis was carried out using NuGen’s Ovation kit. The cDNA was then amplified with NuGen’s SPIA system (NuGen, San Carlos, CA, USA). The final cDNA product was fragmented, ligated, and primed with barcoded adaptors for RNA-seq using the Encore kit (NuGen). The exogenous RNA spike-in control mix was used for normalization to account for sample loss during sample processing and to recapitulate the natural difference in total RNA content found between the two states of maturation.

In the second RNA-seq experiment, sequencing of nascent RNA found in the TZPs was done using 110 COCs. Following oocyte collection, COCs were carefully hemi-sectioned using microdisection blades (Bioniche, Pointe Claire, QC, Canada) so that the section containing the GV could be removed. This was confirmed with Hoechst 33342 (Life Technologies) labeling and brief epifluorescent imaging of DNA. Hemi-sectioned COCs were then matured in the presence of modified ethyl uridine (from the nascent RNA extraction kit, Life Technologies) for 9 h, a time coinciding with normal germinal vesicle breakdown. Following this period of maturation, ZPs were then mechanically stripped of their cumulus cells (CCs) and checked for contaminating CCs using Hoechst staining. Total RNA was extracted from the isolated ZPs using the TRIzol method (Life Technologies), followed by isolation of the de novo RNA using the protocol accompanying the nascent RNA Capture Kit (Life Technologies). RNA-seq library preparation was conducted as described above. All sequencing reactions were carried out on a HiSeq2000 system (Illumina) for 200 cycles (services provided by Genome Québec Innovation Center, McGill University, Montréal, QC, Canada and the Institut de Recherche en Immunologie et Cancérologie, Université de Montréal, Montréal, QC, Canada).

102

3.4.7 Bioinformatics analysis of RNA-seq data To remove read-through Illumina primers and low quality end of sequences, all libraries were processed with the Cutadapt software. Cleaned sequences with a length smaller than 30 bp were then removed using Sickle (https://github.com/ucdavis-bioinformatics/sickle/). Only paired-end reads where both reads were longer than 30 nucleotides were kept. Average read length after clean up and removal of read-through adaptors was 77 bp. Sequences were then aligned to the UMD3.1 assembly (Zimin et al. 2009) of the bovine genome using TopHat2 software (Kim et al. 2013). Alignments were quantified against a reference transcriptome using Cufflinks2 (Roberts et al. 2011). For the analysis of total RNA from the GV and MII stages, normalization was conducted on the exogenous transcriptome (ERCC). Differential expression was assessed using t-tests. Further expression analysis of gene ontology and pathway enrichment was completed using DAVID (Huang et al. 2008; Huang et al. 2009) using the cumulus cells nascent transcriptome as background.

3.4.8 Inhibitors of cellular function All the different inhibitors used were dissolved to the targeted final concentration in maturation media using a stock solution that was prepared in milli-q water for all inhibitors except for Mono-dansylcadaverine (MDC) that was dissolved in dimethylsulphoxide (DMSO). Nuclear maturation to MII stage was assessed as the endpoint in denuded and cumulus enclosed oocytes. Alpha-amanitin, a transcription inhibitor, was utilized at a final concentration of 100 g/mL (Motlík et al. 1989). Inhibitors of motor proteins erythro-9-(2- hydroxy-3-nonyl)adenine (EHNA) and sodium othro-vanadate (vanadate) were used at 1 mM and 2 mM respectively (Chernov et al. 2009; Schliwa et al. 1984; Solomon et al. 1990). Inhibitors of vesicle formation by MDC was utilized at a final concentration of 100 M (Lowther et al. 2011). Controls represent non-treated COCs and denuded oocytes (DOs). Each treatment was done in a minimum of 6 replicates with at least 40 oocytes per replicate and included DMSO vehicle controls.

103

3.4.9 Fixation and fluorescent staining Labile direct stains were used to detect RNA and actin filaments. As often as possible, live oocytes were imaged as un-fixed specimens to preserve their native structures. Actin staining was performed on oocytes fixed in 4% paraformaldehyde (Sigma-Aldrich) using rhodamine phalloidin (1:500 dilution, Cytoskeleton Incorporated Denver, CO, USA) and was used to specification. DNA was detected in oocytes after Hoechst 33342 staining (1:1000 dilution, Life Technologies). The SYTO RNAselect dye (1:1000 dilution, Life Technologies) was used for total RNA staining on either live oocytes, or those fixed with methanol as was required for oocyte collection in the specific time periods post slaughter. After fixation and RNA staining, image analysis was conducted on maximum intensity projections of equal thickness, 10 image slices per oocyte, taken at the largest diameter of each oocyte. TZPs bearing RNA were then counted within each maximum intensity projection. RNAse treatments and untreated oocytes were imaged to ensure specificity of RNA labeling and a lack of confounding autofluorescence (Supplemental figure 1.) Fluorescent microscopy was carried out on a Zeiss LSM 740 confocal microscope using ZEN capture and image analysis software (Carl Zeiss Canada, Toronto, ON, Canada).

3.4.10 Statistics Oocytes were collected from abattoir ovaries, washed, and pooled together for morphological selection of quality gametes. Random sorting was carried out to create treated and control groups for all inhibitor work, RNAseq library construction, and functional assessments on rate of maturation in the presence of inhibitors. Comparison of means was carried out by either one-way ANOVA with Dunnett’s post-hoc test when comparing treatments to controls only, by bonferonni’s post-hoc test when comparing multiple treatments, or by t-test comparing pairs of observations with significance attained at p < 0.05. Prism 5, Graphpad software (La Jolla, CA, USA) was used for analysis.

104

3.5 Results

3.5.1 RNA localization and movement in the cumulus oocyte complex To demonstrate the localization of de novo RNA transcripts, [3H]-uridine was incorporated into maturing COCs. As shown in Figure 3-1, nascent RNA was detected within the TZPs of treated cumulus oocyte complexes (COCs). Abundant silver deposition was observed in the transcriptionally active nucleus of the cumulus cells, and also within other regions of their cytoplasm including the TZP (Figure 3-1A). A 3 h period of exposure to [3H]-uridine during early oocyte maturation resulted in the presence of labeling in the bulb of the projection (Figure 3-1B). The signal exists in the tip of the TZP, and also across the membranous interaction in the ooplasm of the oocyte. Higher magnification imaging was taken and small vesicles were detected in the cleft between the two membranes (Figure 3- 1C).

Regional analysis of images for silver grain deposition as a percentage of total area (Figure 3-2A-D) demonstrated a significantly higher localization of signal in the cumulus cells (n = 10 images of different oocytes) with a mean detection value of 24.53 ± 3.1% SEM and in TZPs (n = 11 images of different oocytes) with 3.87 ± 0.71% compared to the values obtained in the entire zona pellucida (n = 9 images of different oocytes), 0.42 ± 0.05% and in the ooplasm (n = 9), 0.41 ± 0.06%. By comparison, the mean background found in “non- cellular” regions of the images (n = 7) was 0.28 ± 0.06%. All groups were significantly higher than control mean values from exposed slides without cellular material submitted to autoradiographic exposure (Control BKG (n = 9), 0.09 ± 0.01 %) (Suplemental Figure 3-2). These results support nascent RNA accumulation in the TZPs.

Evidence of active transfer of RNA from the cumulus cells to the oocyte was found by comparing signal distribution of labeled nascent RNA within a fully enclosed oocyte to the signal detected in a partially denuded oocyte (Figure 3-3A,B). While signals were homogenously distributed in the oocyte surrounded by cumulus cells, a clear gradient was detected in the partially denuded counterpart where concentrated RNA signal was observed proximal to the cumulus-bearing portion of the oocyte, while the distal and denuded portion

105

of the oocyte contained sparse signal (Figure 3-3A, B). Signal detection in the GVs of similar sections was negligible and did not radiate outwards into the ooplasm. To confirm this gradient occurrence, a second approach was used by fluorescently labeling nascent transcription followed by detection in cumulus enclosed and partially denuded oocytes. None of the cumulus enclosed oocytes (n = 9 oocytes) showed any trend in regional signal difference (Figure 3-3C) whereas of the 11 partially denuded oocytes evaluated, 8 demonstrated a significantly higher RNA signal in the regions of ooplasm proximal to the cumulus cells compared to their distal regions (p < 0.05). When the gradient plane was rotated 180˚ the differences in signal intensity was lost (Figure 3-3D). From both methodological approaches, results show presence of nascent RNA from the cumulus cells inside the ooplasm.

Additionally, to confirm and visualize RNA movement from the cumulus cell towards the oocyte, total RNA staining in living COCs was carried out using confocal live-cell imaging and revealed the displacement of RNA granules in TZPs (Figure 3-4). While some granules remained stationary, others moved either very quickly (micrometers per minute) or very slowly (micrometers per hour) within the cumulus cells (Figure 3-4A, B). The speed and direction of the moving granules was not always constant: some stopped or even changed direction for a short distance. A number of the particles, both fast (Figure 3-4A) and slow (Figure 3-4B) moving, transferred down the TZP towards the oocyte. Quantification of granule trafficking was done by time-lapse imaging of a static region near the zona pellucida. From 7.0 ± 1.0 min video recordings (n =14) each enabling to monitor an average of 41.6 ± 3.3 projections, 12.1 ± 1.9 granules were found to move towards the oocyte while 6.8 ± 1.0 granules displayed a retrograde progression. This occurrence and distribution of RNA granules within the TZPs is consistent with the results of the autoradiographic evaluation showing the extent of RNA granules distribution from the de novo RNA synthesis. .

106

3.5.2 RNA transcripts present in the TZP are also found on the oocyte’s translational machinery By identifying the transcripts synthesized by the cumulus cells during the first 9 h post- extraction from the follicular environment, we recently reported that as much as 45% of the nascent transcripts found in the TZPs are specifically more abundant to this region of the cumulus cells compared to the nascent RNA population found in the cumulus cell body (Macaulay et al. 2014). This selective distribution of long RNA molecules in the TZPs suggests potential roles of these transcripts in supporting cumulus-oocyte interactions as well as oocyte functions once transferred to the gamete. The transcriptome of three subcompartments were analyzed namely the newly synthesized transcripts found in TZPs, the oocyte contents at GV and MII stages and the transcripts associated with the polyribosomes within the oocytes at the same developmental stages. The polyribosomal mRNAs represent the subfraction actively being translated to proteins (Figure 3-5A). To evaluate the global potential for the TZP transcripts to be utilized by the oocyte, an analysis was done to generate a list of transcripts increasing in abundance within the oocyte during maturation. These transcripts found to be accumulating during maturation have potentially an exogenous origin considering the cessation of oocyte transcription due to chromatin condensation (Lodde et al. 2008).

Comparing this list to those found associated with the polyribosomes (polyribosome datasets published previously in {Scantland:2011ch}), 1,226 transcripts intersected (Figure 5B). From the transcripts identified, 624 were known mRNAs or long non-coding RNAs, while the remaining corresponded to uncharacterized transcripts (Supplemental Table 3-1). Gene list analysis showed enrichment for biological processes such as transcript regulation, protein localization, protein transport, and RNA processing (Table 3-1) and molecular functions such as nucleoside binding, ATP binding, RNA binding, and transcription factor binding (Table 3-2). A second more stringent analysis was done limiting the first list to include only transcripts from the ones identified in the TZPs following a pulse labeling of de novo transcription representing transcripts synthesized in the cumulus cells and sent to the TZPs. The genelist was reduced to 63 transcripts that was analyzed and showed enrichment for actin and cytoskeleton related biological processes (GO:0030036: actin

107

cytoskeleton organization (p-value 0.0024); GO:0030029 actin filament-based process (p- value 0.0026); GO:0007010 cytoskeleton organization (p-value 0.0093). These gene list analyses support a potential contribution from the cumulus cells in supplying the gamete with mRNAs coding for proteins involved in maturation related processes.

3.5.3 Disruption of RNA transfer mechanisms and their impact on oocyte maturation To provide further evidence for the requirement of long RNA molecule transfer for oocyte function, the effects of inhibitors impacting transcript production (transcription), ribonucleoparticle transport (motor proteins) and their transfer through vesicular secretion on the ability of the oocyte to undergo nuclear maturation to the MII stage was measured in both cumulus enclosed oocytes and in denuded oocytes. All inhibitors were observed to significantly reduce the ability of the oocyte to mature to MII (Figure 3-6). Cumulus enclosed controls reached MII at a rate of 78.4 ± 1.7 %, better than denuded oocytes (55.3 ± 4.1%) confirming the positive effect from the presence of the somatic cells on oocyte maturation. Vehicle control (DMSO) treated cumulus enclosed and denuded oocytes reached MII stage at a rate of 81.0 ± 2.9% and 52.8 ± 14.9% respectively, similar to non- treated samples.

Inhibiting RNA transcription using α-amanitin negatively affected oocyte maturation reducing success rate to 32.0 ± 7.7 %. Intriguingly, the impact of the transcriptional inhibitor was alleviated when oocytes were stripped resulting in a mean maturation rate (50.3 ± 2.2%) similar to untreated denuded oocyte controls. Considering that once synthesized, transcripts must be delivered to the oocyte, inhibition of motor proteins using either erythro-9-(2-hydroxy-3-nonyl) adenine (EHNA) and sodium Roth-vanadate (vanadate) resulted in low maturation rates with respectively 9.3 ± 2.7 % and 11.0 ± 3.5 %. Furthermore, inhibiting vesicular secretion and internalization to prevent transcript delivery to the oocyte also significantly reduced oocyte maturation. Oocytes matured in the presence of the exosome specific rab27a GTPase inhibitor FTY720 impacting vesicular mobility and secretion lead to a significant reduction in maturation rate to 24.8 ± 3.9%. Conversely, inhibiting endocytosis using monodansyl cadaverine (MDC) reduced oocyte maturation by

108

half (37.3 ± 4.8 %). The maturation inhibiting effect was also seen in denuded oocytes exposed to these inhibitors: EHNA (16.2 ± 4.5%), vanadate (23.4 ± 5.1%), MDC (30.0 ± 4.6%), and FTY720 (16.6 ± 2.0%). Stripping the cumulus cells did not significantly influence the impact of most inhibitors since TZPs remain present in the zona pellucida. These results suggest contribution of RNA trafficking and transfer via vesicular secretion between the cumulus cells and the oocyte to support maturation.

3.5.4 Timing of developmental competence acquisition in relation to RNA accumulation in the TZPs The optimal intrafollicular preparation or pre-maturation time following animal slaughter for the acquisition of developmental competence was previously shown to be 4 h post slaughter (Blondin et al. 1995). This model of developmental competence acquisition was used to further study the potential role that TZP RNAs could play in oocyte quality and explore the temporal interaction between the oocyte and cumulus cells. COCs were collected from the ovarian follicles and prepared for maturation either immediately or 4 h following slaughter (pre-matured groups). In addition, GV stage oocytes were also stripped from their cumulus cells to determine the impact of the presence of the somatic cells on the rate of maturation (Figure 3-7). As expected, the best maturation rate was obtained from the control treatment comprised of intact COCs submitted to the 4 h post mortem incubation (79.5 ± 2.6 %). This rate is not significantly different from our standard maturation system used in the previous experiments (78.4 ± 1.7 %). Without the intrafollicular pre-maturation period, the rate of maturation of intact COCs significantly dropped (49.3 ± 4.0 %). Comparable results were found when the COCs were allowed to pre-mature in vivo followed by removal of the cumulus cells before IVM (52.3 ± 3.1 %). The lowest maturation rates were obtained from oocytes collected without the pre-maturation period and immediately denuded and submitted to IVM (35.4 ± 4.6 %).

Considering these results where the impact of the cumulus cells on the oocyte was partly mitigated by their removal following the pre-maturation period, detection of total RNA in the TZPs was conducted following a time series starting at the time of slaughter until 6 h

109

post-slaughter (Figure 3-8). Oocytes demonstrated an increasing number of RNA bearing TZPs over time, significantly increasing between 0 h (35.8 ± 3.0%, n= 22), 2 h (44.4 ± 3.5%, n = 25) and 4 h (78.0 ± 4.4%, n = 26) post slaughter and appearing to plateau by 6 h (91.6 ± 4.9%, n = 28) (Figure 3-8A, B). The number of TZPs did not change over time as determined by actin staining from 0 h (165.1 ± 14.4%, n = 14), to 2 h (201.7 ± 33.4%, n = 6), to 4 h (213.6 ± 18.2%, n = 14), and to 6 h (192.6 ± 13.1%, n = 14) (Figure 3-8A-C). This shows a post slaughter accumulation of transcripts in the TZPs under a time table fitting with the positive effect of the pre-maturation period.

3.6 Discussion The presented results highlight the additional contribution of the cumulus cells to the oocyte in the form of large cargo transfer. We focused on RNA transfer from the cumulus cells, and its importance for gamete maturation. The current understanding of folliculogenesis and oogenesis involves a close interdependence between the cumulus cells and the oocyte, mediated through the extensive intercommunication that exists between these two compartments. The oocyte contributes to cumulus cell function via paracrine signaling with secreted proteins like GDF9 and BMP15 (Hussein et al. 2006), while the cumulus cells transfer small molecules like cGMP and cAMP (Richard et al. 1997; Wigglesworth et al. 2013), and energy sources like lactate, pyruvate, and phosphocreatine to the oocyte (Sutton-McDowall et al. 2010; Scantland et al. 2014). We previously demonstrated that a synthetic transcript expressed in the cumulus cells could be transferred to the oocyte. The presence of the GFP fusion protein in the oocyte cytoplasm indicated translational activity but it was not possible to determine if the fusion protein was translated in the cumulus cell and then transferred, or translated in the oocyte (Macaulay et al. 2014). This type of large cargo transfer is not well documented in mammalian oocytes, but is present under different forms in other animal models like c. elegans and drosophila where there are stages of material sharing during oocyte development either from canals bridging oocytes together or from supporting nurse cells (Wolke et al. 2007; Nicolas et al. 2009).

110

The data from nascent autoradiographic RNA labeling shows abundant RNA signal inside the oocyte and that presence of cumulus cells influenced signal distribution. These results were confirmed by fluorescent labeling of de novo transcription. The rate at which transfers occurs is still undetermined. However, due to the great number, likely over three thousand actin based TZPs per COC by our estimates, a large effect can be created on the oocyte’s internal content even if particle transfer per TZP is not frequently abundant. From the ultra- thin sections it was shown that some vesicles present at the junction of the projection end and the oolemma are not labeled which is indicative that some of these secreted bodies either harbor non-RNA material or RNA that was produced prior to the labeling pulse. It is also noteworthy to mention that when detecting autoradiographic signal, the exact position and particle size may be shifted (in the order of a few nanometers) due to radiation and emulsion thickness. The large grain size can also possibly obscures the cellular structure in the section beneath the grain. Together, the data support directional transfer of RNA to the oocyte. The live-cell imaging confirmed that many RNA containing granules remain stationary while others move down the projections. The speed and direction (both anterograde and retrograde) of the particles that were tracked is not constant, an observation similar to findings observed in neurons where RNA particles move down the axon to be translated in the synapse (Davidovic et al. 2007).

Investigating the mechanisms and importance for oocyte function was conducted using inhibitors dissecting the different steps that would require a transcript to be synthesized in the cumulus cells then shuttled and transferred to the oocyte via vesicular secretion. To investigate the requirement for the presence of the cumulus cells, fully enclosed and denuded oocytes were compared. Although widely used for targeting the studied cellular functions, there are also known collateral effects for some of the inhibitors. Alpha-amanitin is widely accepted to suppress transcription by targeting RNA polymerase II responsible for mRNA synthesis however it has also been shown to interfere with protein phosphorylation impeding cell cycle progression (Kastrop et al. 1991). Here, however, denuded oocytes treated with 훼-amanitin were able to progress to MII at a rate comparable with denuded controls indicating no off target effects on oocyte maturation. These results are similar to those obtained by Motlik and colleagues where 훼-amanitin only affected the

111

ability of rabbit oocytes to reach MII stage if their cumulus cells were intact (Motlík et al. 1989).

Two inhibitors of motor proteins were used since EHNA has also been shown to inhibit phosphodiesterase type 2 (PDE) activity (Haynes et al. 1996), fortunately this PDE is not active in bovine oocytes which rely predominantly on PDE3 for maturation resumption (Sasseville et al. 2009). Conversely, the inhibitor vanadate affects tyrosine and alkaline phosphatases and ATPases generally increasing protein phosphorylation that would impact numerous cellular functions including PDE3 activity required for oocyte maturation (Haynes et al. 1996; Watanabe et al. 2004), and maturation promoting factor activity (Hainaut et al. 1991), thus doubly inhibiting oocyte maturation. Further there is some evidence that Vanadate affects chromosomes undergoing mitosis, and decondenses chromatin structure (Cande and Wolniak 1978). Although targeting different aspects of motor protein functions, both inhibitors had similar impacts. Overall, intact COCs, in the presence of all the inhibitors suffered decreased maturation rates suggesting that impairing RNA synthesis, granule transport, vesicular formation, secretion and internalization are important for maturation. In the presence of these inhibitors, the denuded oocytes did not behave differently aside from the transcriptional inhibitor, which did not have a negative impact in the absence of the cumulus cells nuclei. It was expected that if new transcription from the somatic cells were required for a positive effect on maturation, inhibiting transcription would thus result in similar effect than removing the nuclei. This divergence in response to 훼-amanitin is unexplained but could suggest the existence of transcription dependent maturation suppressing factors originating from the cumulus cells. The fact the inhibition of the other targeted functions had the same maturation repressive effect on denuded oocytes was expected since stripping the cumulus cells does not remove TZPs leaving all material contained within the leftover structures available for transfer to the oocyte.

Identification of the transcripts potentially transferred from the cumulus cells to the oocyte, in support to the maturation processes, was done by surveying the transcriptomes of different compartments of the COCs. At this stage, the oocyte is already rich in maternal

112

RNA reserves making it uncertain that transferred transcripts would significantly add to the oocyte endowment. Maternal reserves are known to be stored under a stabilized form of ribonucleoprotein particles (Swetloff et al. 2009; Flemr et al. 2010). Transcripts from the cumulus cells could be more readily available for translation than stored ones that require dissociation of the protein complex and re-adenylation of their poly(A) tails. We focused on a subset of transcripts shown to be common between the messengers enriched in the TZPs and those found on the oocyte’s translational machinery. The function of the candidate mRNA fits with the known cellular functions associated with the control of meiosis resumption, namely nucleotide management, transcriptional and translation control. In addition, several zinc finger mRNAs were found (ZNF773, ZNF689, ZNF75A, ZNF664, and ZNF395) all of which are known to bind DNA and regulate transcription in somatic cells (Laity et al. 2001; Burdach et al. 2012). These DNA binding protein could be important for interactions during chromatin remodeling during meiosis. A number of gene pathways found in our analysis are common to those previously identified in the surveys of the transcripts found during mouse oocyte maturation (Su et al. 2007).

A more stringent sorting identified the subset of transcripts common to the TZPs and polyribosomes but that also increased in abundance in the oocyte during maturation. This last criterion represents transcripts that are increasing in abundance when the oocyte’s transcription is believed to be silenced (Fair et al. 1997; Lodde et al. 2008), thus providing good candidates to be originating from the cumulus cells. This limited gene list is associated with the organization of the cytoskeleton, particularly with the actin filaments and canonical beta-catenin signaling. It is known that actin filaments create polarity in the oocytes as the polar body is extruded (Coticchio et al. 2014) and that they are responsible for enabling the asymmetric cellular division (Yi et al. 2013). Specifically, the FAM21 (family with sequence similarity 21, member C) and WASF2 (WAS protein family, member 2) transcript were present in our list and are member of the WASH complex (Wiskott Aldrich Syndrome protein and scar homologue complex) that regulates the actin regulating protein complexes (Arp1/2)(Wang et al. 2014). Canonical beta catenin signaling components like paxillin (PXN) that facilitates actin – membrane attachment and behaves as a signal integrator (Hammes and Levin 2011; Sen et al. 2011), and frizzled class receptor

113

3 (FZD3) a frizzled family member that encodes a 7-transmembrane domain protein that is involved in wingless-type MMTV integration site family member 2 (WNT2) signaling(H.X. Wang et al. 2009), were also present. These genes have been associated with oocyte quality in aging women (Coticchio et al. 2014). A final transcript of interest is the transcriptional repressor spen family transcriptional repressor (SPEN, also known as SHARP). This mRNA codes for a hormone inducible transcription repressor that contains RNA recognition motifs that confer steroid receptor RNA coactivation (Hatchell et al. 2006). SPEN also allows for interaction with the nucleosome remodeling deacetylase complex (NuRD complex) that may confer epigenetic regulation to the oocyte (Ariyoshi and Schwabe 2003). At this time, further study is needed to provide the full proof specific to each of these mRNAs that are produced by the somatic cells and transferred to the oocyte. Our results do provide a body of evidence that supports the transfer of these candidates.

If these transcripts are supporting maturation and oocyte quality, given that TZPs are established early during folliculogenesis, the next question to be asked is if the RNA content in these structures stays constant or fluctuates during folliculogenesis. The initial survey done during the in vitro incubation period starting post-aspiration from the ovarian follicles up to the disconnection that occurs during maturation did not show evidence of total RNA content fluctuation (Macaulay et al. 2014). However, it is believed that at the time of aspiration, oocyte quality expressed as developmental competence is already established from unknown cues occurring earlier inside the follicle. As a model of oocyte quality, we used observations from a previous study showing that oocytes collected from medium size antral follicles from ovaries collected post-mortem displayed a progressive acquisition of developmental competence according to the duration before the oocytes were extracted from the follicles (Blondin and Sirard 1995). It was noticed that oocytes collected immediately post-mortem display poor developmental competence whereas a 4 h post- mortem incubation of the ovaries maximized developmental rates (Blondin and Sirard 1995). At this point it was not known if the reduced developmental capacity of a COC removed from the follicle immediately after animal death was caused by an impairment to complete maturation or by impairment to sustain early development. We confirmed that

114

the oocyte’s capacity to reach MII is affected by the timing of intra-follicular incubation prior to COC retrieval. Collecting the COCs immediately significantly reduced the potential to mature. Using this system we show that TZPs contain little RNA before the onset of the unknown initiating events following which the gamete improves its ability to mature. RNA accumulates in the TZPs following a time table similar to the acquisition of developmental competence previously published (Blondin et al. 1995).

The nature of the mechanisms underlying this positive effect on oocyte quality is still unknown. Several conditions have been shown to increase oocyte developmental competence: the LH surge, the timing before oocyte aspiration following animal death (Blondin and Sirard 1995), and the removal of the growth support demonstrated in FSH coasting protocols (Blondin et al. 2002; Nivet et al. 2012). LH triggers disconnection between the follicular cells that will induce differentiation and corpus luteum formation (Park 2004). Animal death or loss of hormonal support can also initiate the disconnection associated with follicle demise (Blondin et al. 2002; Nivet et al. 2012). Signaling pathways common to these events could explain why stressors induce competence in the oocyte. In the present study, we called “pre-maturation” this period where the oocyte benefits from these unknown cues within the follicle to increase its developmental competence still under meiotic arrest. The TZP RNA loading not only fit well with the timing of the acquisition of developmental competence as described in this situation of post-mortem incubation before oocyte aspiration, it was also shown that preventing the RNA accumulation by maturing the COCs in vitro immediately after slaughter significantly reduced their capacity to reach MII. The cumulus contribution is known to be important and denuded oocytes mature at rates much lower than their enclosed counterparts, and co-culturing COCs with DOs can recover some of the potential lost with denudation (Luciano et al. 2005; Dey et al. 2012; Scantland et al. 2014). In this study, the worst-case scenario was achieved when oocytes were immediately collected from the follicle post-mortem and stripped of their cumulus cells to remove the contribution from the cumulus cells. Based on the results, this quick removal from the follicular environment prevented TZP loading and stripping the cumulus cells removed any potential to do so even for a short period during the onset of maturation in

115

vitro. Removing both of these opportunities for cumulus cell contribution reduced the oocyte’s potential to mature.

In conclusion, we propose a new contribution from the cumulus cells to the oocyte that is important to maturation. We show that TZP loading with RNA mainly occurs within the follicles prior to oocyte extraction thus a physiological event is responsible for the mobilization of RNA. This transfer of RNA to the oocyte complements the maturation control mediated by cAMP signaling in the COC. This opens new avenues to the concept of oocyte quality as the mechanisms initiating and controlling TZP transcript accumulation remain to be described. Yet at this point, we can only associate the contribution of the cumulus cells to the oocyte’s capacity to mature. Any contribution to embryo development remains to be further investigated. This new concept offers novel perspectives about female fertility and potential for IVM improvement by better understanding what intrafollicular communication affects the oocyte.

3.7 Acknowledgements The authors wish to ackdowledge Dr. Melanie Hamel who generated results directing us to some of these research questions. We thank L. St. John, I. Dufort, I. Laflamme, and H. Holm for their technical assistance during this project. We thank Dr. Allan King for providing laboratory space to complete the data on inhibitors. We also thank Boviteq Inc. for their support for providing the medium and portable incubator for off-site oocyte maturation.

3.8 References Albertini DF, Barrett SL. 2004. The developmental origins of mammalian oocyte polarity. Seminars in Cell and Developmental Biology 15:599–606. Albuz FK, Sasseville M, Lane M, Armstrong DT, Thompson JG, Gilchrist RB. 2010. Simulated physiological oocyte maturation (SPOM): a novel in vitro maturation system that substantially improves embryo yield and pregnancy outcomes. Human

116

Reproduction 25:2999–3011. Ariyoshi M, Schwabe JWR. 2003. A conserved structural motif reveals the essential transcriptional repression function of Spen proteins and their role in developmental signaling. Genes & Development 17:1909–1920. Blondin P, Bousquet D, Twagiramungu H, Barnes F, Sirard M-A. 2002. Manipulation of follicular development to produce developmentally competent bovine oocytes. Biology of Reproduction 66:38–43. Blondin P, Guilbault LA, Sirard MA. 1995. In vitro production of bovine embryos: Developmental competence is acquired before maturation. Theriogenology 43:168. Blondin P, Sirard MA. 1995. Oocyte and follicular morphology as determining characteristics for developmental competence in bovine oocytes. Molecular Reproduction and Development 41:54–62. Burdach J, O’Connell MR, Mackay JP, Crossley M. 2012. Two-timing zinc finger transcription factors liaising with RNA. Trends in Biochemical Sciences 37:199–205. Cande WZ, Wolniak SM. 1978. Chromosome movement in lysed mitotic cells is inhibited by vanadate. The Journal of Cell Biology 79:573–580. Chernov KG, Barbet A, Hamon L, Ovchinnikov LP, Curmi PA, Pastre D. 2009. Role of Microtubules in Stress Granule Assembly: Microtubule Dynamical Instability Favours The Formation Of Micrometric Sress Granules In Cells. Journal of Biological Chemistry 284:36569–36580. Coticchio G, Guglielmo MC, Albertini DF, Dal Canto M, Mignini Renzini M, De Ponti E, Fadini R. 2014. Contributions of the actin cytoskeleton to the emergence of polarity during maturation in human oocytes. Molecular Human Reproduction 20:200–207. Davidovic L, Jaglin XH, Lepagnol-Bestel A-M, Tremblay S, Simonneau M, Bardoni B, Khandjian EW. 2007. The fragile X mental retardation protein is a molecular adaptor between the neurospecific KIF3C kinesin and dendritic RNA granules. Human Molecular Genetics 16:3047–3058. Dey SR, Deb GK, Ha AN, Lee JI, Bang JI, Lee KL, Kong IK. 2012. Coculturing denuded oocytes during the in vitro maturation of bovine cumulus oocyte complexes exerts a synergistic effect on embryo development. Theriogenology 77:1064–1077. Edwards RG. 1965. Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and

117

human ovarian oocytes. Nature 208:349–351. Faerge I, Grondahl C, Ottesen JL, Hyttel P. 2001. Autoradiographic localization of specific binding of meiosis-activating sterol to cumulus-oocyte complexes from marmoset, cow, and mouse. Biology of Reproduction 64:527–536. Fair T, Hulshof S, Hyttel P, Greve T. 1997. Nucleus ultrastructure and transcriptional activity of bovine oocytes in preantral and early antral follicles. Molecular Reproduction and Development 46:208–215. Flemr M, Ma J, Schultz RM, Svoboda P. 2010. P-Body Loss Is Concomitant with Formation of a Messenger RNA Storage Domain in Mouse Oocytes. Biology of Reproduction 82:1008–1017. Gad A, Hoelker M, Besenfelder U. 2012. Molecular mechanisms and pathways involved in bovine embryonic genome activation and their regulation by alternative in vivo and in vitro culture conditions. Biology of Reproduction 87:1-13 Gilchrist RB, Lane M, Thompson JG. 2008. Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Human Reproduction Update 14:159–177. Guzman LM, Ortega-Hrepich C, Albuz F, Verheyen G, Devroey P, Smitz J, De Vos M. 2012. Developmental capacity of in vitro–matured human oocytes retrieved from polycystic ovary syndrome ovaries containing no follicles larger than 6 mm. Fertility and Sterility 98:503–507.e2. Hainaut P, Giorgetti S, Kowalski A, Van Obberghen E. 1991. Insulin-like effects of vanadate on glucose uptake and on maturation in Xenopus laevis oocytes. Cell Regulation. 2:317–327. Hammes SR, Levin ER. 2011. Minireview: Recent Advances in Extranuclear Steroid Receptor Actions. Endocrinology 152:4489–4495. Hatchell EC, Colley SM, Beveridge DJ, Epis MR, Stuart LM, Giles KM, Redfern AD, Miles LEC, Barker A, MacDonald LM, et al. 2006. SLIRP, a Small SRA Binding Protein, Is a Nuclear Receptor Corepressor. Molecular Cell 22:657–668. Huang DW, Sherman BT, Lempicki RA. 2008. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols 4:44–57. Huang DW, Sherman BT, Lempicki RA. 2009. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids

118

Research 37:1–13. Hussein TS, Thompson JG, Gilchrist RB. 2006. Oocyte-secreted factors enhance oocyte developmental competence. Developmental Biology 296:514–521. Hyttel P, Fair T, Callesen H, Greve T. 1997. Oocyte growth, capacitation and final maturation in cattle. Theriogenology 47:23–32. Kastrop PMM, Hulshof SCJ, Bevers MM, Destrée OHJ, Kruip TAM. 1991. The effects of

α‐amanitin and cycloheximide on nuclear progression, protein synthesis, and phosphorylation during bovine oocyte maturation in vitro. Molecular Reproduction and Development 28:249–254. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. 2013. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biology 14:R36. Laity JH, Lee BM, Wright PE. 2001. Zinc finger proteins: new insights into structural and functional diversity. Current Opinion in Structural Biology 11:39–46. Le Beux G, Richard FJ, Sirard M-A. 2003. Effect of cycloheximide, 6-DMAP, roscovitine and butyrolactone I on resumption of meiosis in porcine oocytes. Theriogenology 60:1049–1058. Lodde V, Modina S, Maddox-Hyttel P, Franciosi F, Lauria A, Luciano AM. 2008. Oocyte morphology and transcriptional silencing in relation to chromatin remodeling during the final phases of bovine oocyte growth. Mol. Reprod. Dev. 75:915–924. Lowther KM, Nikolaev VO, Mehlmann LM. 2011. Endocytosis in the mouse oocyte and its contribution to cAMP signaling during meiotic arrest. Reproduction 141:737–747. Luciano AM, Lodde V, Beretta MS, Colleoni S, Lauria A, Modina S. 2005. Developmental capability of denuded bovine oocyte in a Co-culture system with intact cumulus-oocyte complexes: Role of cumulus cells, cyclic adenosine 3',5'-monophosphate, and glutathione. Molecular Reproduction and Development 71:389–397. Macaulay AD, Gilbert I, Caballero J, Barreto R, Fournier E, Tossou P, Sirard M-A, Clarke HJ, Khandjian EW, Richard FJ, et al. 2014. The gametic synapse: RNA transfer to the bovine oocyte. Biology of Reproduction 91:90–90. Moor RM, Smith MW, Dawson RM. 1980. Measurement of intercellular coupling between oocytes and cumulus cells using intracellular markers. Experimental Cell Research

119

126:15–29. Motlik J, Fulka J, Procházka R, Rimkevicová Z, Kubelka M. 1989. RNA and protein synthesis requirements for the resumption of meiosis in rabbit oocytes: the role of cumulus cells. Reproduction Nutrition and Devopment 29:601–609. Nicolas E, Chenouard N, Olivo-Marin J-C, Guichet A. 2009. A Dual Role for Actin and Microtubule Cytoskeleton in the Transport of Golgi Units from the Nurse Cells to the Oocyte Across Ring Canals. Molecular Biology of the Cell 20:556–568. Nivet A-L, Bunel A, Labrecque R, Belanger J, Vigneault C, Blondin P, Sirard M-A. 2012. FSH withdrawal improves developmental competence of oocytes in the bovine model. Reproduction 143:165–171. Park JY. 2004. EGF-Like Growth Factors As Mediators of LH Action in the Ovulatory Follicle. Science 303:682–684. Plourde D, Vigneault C, Lemay A, Breton L, Gagné D, Laflamme I, Blondin P, Robert C. 2012. Contribution of oocyte source and culture conditions to phenotypic and transcriptomic variation in commercially produced bovine blastocysts. Theriogenology 78:116–131.e3. Richard FJ, Fortier MA, Sirard MA. 1997. Role of the cyclic adenosine monophosphate- dependent protein kinase in the control of meiotic resumption in bovine oocytes cultured with thecal cell monolayers. Biology of Reproduction 56:1363–1369. Rizos D. 2002. Bovine Embryo Culture in the Presence or Absence of Serum: Implications for Blastocyst Development, Cryotolerance, and Messenger RNA Expression. Biology of Reproduction 68:236–243. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. 2002. Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: Implications for blastocyst yield and blastocyst quality. Molecular Reproduction and Development 61:234–248. Robert C, Nieminen J, Dufort I, Gagné D, Grant JR, Cagnone G, Plourde D, Nivet A-L, Fournier E, Paquet É, et al. 2011. Combining resources to obtain a comprehensive survey of the bovine embryo transcriptome through deep sequencing and microarrays. Molecular Reproduction and Development 78:651–664. Roberts A, Pimentel H, Trapnell C, Pachter L. 2011. Identification of novel transcripts in

120

annotated genomes using RNA-Seq. Bioinformatics 27:2325–2329. Sasseville M, Albuz FK, Cote N, Guillemette C, Gilchrist RB, Richard FJ. 2009. Characterization of Novel Phosphodiesterases in the Bovine Ovarian Follicle. Biology of Reproduction 81:415–425. Scantland S, Grenon J-P, Desrochers M-H, Sirard M-A, Khandjian EW, Robert C. 2011. Method to isolate polyribosomal mRNA from scarce samples such as mammalian oocytes and early embryos. BMC Developmental Biology 11:8. Scantland S, Tessaro I, Macabelli CH, Macaulay AD, Cagnone G, Fournier E, Luciano AM, Robert C. 2014. The adenosine salvage pathway as an alternative to mitochondrial production of ATP in maturing mammalian oocytes. Biology of Reproduction 91:75– 75. Sen A, Prizant H, Hammes SR. 2011. Understanding extranuclear (nongenomic) androgen signaling: What a frog oocyte can tell us about human biology. Steroids 76:822–828. Solomon MJ, Glotzer M, Lee TH, Philippe M, Kirschner MW. 1990. Cyclin activation of p34cdc2. Cell 63:1013–1024. Su Y-Q, Sugiura K, Woo Y, Wigglesworth K, Kamdar S, Affourtit J, Eppig JJ. 2007. Selective degradation of transcripts during meiotic maturation of mouse oocytes. Developmental Biology 302:104–117. Sutton-McDowall ML, Gilchrist RB, Thompson JG. 2010. The pivotal role of glucose metabolism in determining oocyte developmental competence. Reproduction 139:685– 695. Swetloff A, Conne B, Huarte J, Pitetti J-L, Nef S, Vassalli J-D. 2009. Dcp1-bodies in mouse oocytes. Mol. Biol. Cell 20:4951–4961. Trounson A, Anderiesz C, Jones G. 2001. Maturation of human oocytes in vitro and their developmental competence. Reproduction 121:51–75. Walls ML, Hunter T, Ryan JP, Keelan JA, Nathan E, Hart RJ. 2014. In vitro maturation as an alternative to standard in vitro fertilization for patients diagnosed with polycystic ovaries: a comparative analysis of fresh, frozen and cumulative cycle outcomes. Human Reproduction 30:88–96. Wang F, Zhang L, Zhang G-L, Wang Z-B, Cui X-S, Kim N-H, Sun S-C. 2014. WASH complex regulates Arp2/3 complex for actin-based polar body extrusion in mouse

121

oocytes. Scientific Reports 4:1–8. Wang HX, Tekpetey FR, Kidder GM. 2009. Identification of WNT/ -CATENIN signaling pathway components in human cumulus cells. Molecular Human Reproduction 15:11– 17. Watanabe T, Satoo H, Kohara K, Takami R, Motoyashiki T, Morita T, Ueki H. 2004. Orthovanadate stimulates cAMP phosphodiesterase 3 activity in isolated rat hepatocytes through mitogen-activated protein kinase activation dependent on cAMP- dependent protein kinase. Biological and Pharmaceutical Bulletin 27:789–796. Wigglesworth K, Lee KB, O'Brien MJ, Peng J, Matzuk MM, Eppig JJ. 2013. Bidirectional communication between oocytes and ovarian follicular somatic cells is required for meiotic arrest of mammalian oocytes. Proceedings of the National Academy of Sciences 110:E3723–E3729. Wolke U, Jezuit EA, Priess JR. 2007. Actin-dependent cytoplasmic streaming in C. elegans oogenesis. Development 134:2227–2236. Yeo CX, Gilchrist RB, Lane M. 2009. Disruption of Bidirectional Oocyte-Cumulus Paracrine Signaling During In Vitro Maturation Reduces Subsequent Mouse Oocyte Developmental Competence. Biology of Reproduction 80:1072–1080. Yi K, Rubinstein B, Unruh JR, Guo F, Slaughter BD, Li R. 2013. Sequential actin-based pushing forces drive meiosis I chromosome migration and symmetry breaking in oocytes. The Journal of Cell Biology 200:567–576. Zimin AV, Delcher AL, Florea L, Kelley DR, Schatz MC, Puiu D, Hanrahan F, Pertea G, Van Tassell CP, Sonstegard TS, et al. 2009. A whole-genome assembly of the domestic cow, Bos taurus. Genome Biology 10:R42.

122

3.9 Figures

Figure 3-1. Nascent RNA in the projections moves to the ooplasm A) Autoradiographic signal from a 3h exposure showing nascent RNA localization accumulating in the cumulus cell (CC) and directed down the transzonal projections (TZP) through the zona pellucida (ZP) into the oocyte (Oo). B) Projection bulging end underneath the ZP and in contact with the oocyte. Strong RNA signal is present in the projection bulb and in the ooplasm opposed to the TZP. C) Magnified inset highlighted in B; Microvilli (Mv) enveloping the TZP. The arrow indicates a vesicle.

123

Figure 3-2. Detection of nascent RNA within different regions of the COC A) Original image of a semithin section after 3 h autoradiographic incorporation and exposure. B) Threshold detection of autoradiographic signal for analysis (red signal). C) RNA signal corresponding to the TZP’s outlined in yellow within the ZP. D) Quantification of RNA associated signal for each of the regions of interest. BKG: background. Significance between groups was achieved at p < 0.05.

124

Figure 3-3. Impact of the presence of cumulus cells on the presence of nascent RNA inside the oocyte

125

Comparison of nascent RNA detection levels between cumulus-enclosed oocytes and partly denuded ones. A, B) Quantification of autoradiographic signals from de novo RNA synthesis labeled by [3H]-uridine incorporation. (50 X magnification). C, D) Nascent RNA was labeled by incorporation of 5-ethynyl-2'-deoxyuridine to which a fluorescent dye was chemically bound (green signal). Pixel intensity was measured in regions (yellow boxes) proximal to distal from the cumulus cells in the ooplasm. Average regional signal intensity was corrected to actin detected by rhodamine phalloidin. For all analyses, the ooplasm was divided into left, right, upper, and lower planes based upon the fitted pinwheel. Statistical significance was attained at p < 0.05.

126

Figure 3-4. Time series of moving granules in the cumulus cell projections towards the oocyte A) Fast moving granules present in sections taken 20 s apart from each other. B) Slow moving granules in frames taken 2 min apart from each other. Numerous other granules are present but move only slightly or remain stationary. The granules begin near the cumulus cell (CC) and move towards the oocyte (Oo) along the TZPs. Scale bars are 20 μm.

127

Figure 3-5. Transcript identification in the different structural components of the cumulus oocyte complex A) Sucrose density gradient profile outlining the fractionation of cellular extracts and position of polyribosomes. The profiles are generated from the spiked-in drosophila polyribosomes used as a carrier, which allows identification of the proper fractions for confirmed polyribosomal RNAs. B) Venn diagram of identified bovine transcripts found in the TZP, increasing in abundance during the period of maturation, and present on the polyribosomes both in GV and MII oocytes.

128

Figure 3-6. Impact of inhibitors on the oocyte maturation Impact of cumulus cell removal on the oocyte maturation to MII (A). Inhibitors that affect the processes of RNA synthesis (α-amanitin), particle transport (EHNA and vanadate) and vesicular functions (FTY720 for vesicular trafficking-exocytosis and MDC for endocytosis) were tested on oocytes during maturation. To determine the contribution of cumulus cells, treatment were applied both to cumulus-enclosed oocytes (B), and denuded oocytes (C). Statistical significance represented by different lettering was attained at p < 0.05.

129

Figure 3-7. Impact of time of intrafollicular pre-maturation and of somatic cell removal on oocyte maturation competence Cumulus-oocyte complexes (COCs) were aspirated from the follicular environment either immediately after slaughter (No PreMat) or following a 4 h post-mortem incubation of the ovaries before COC collection (PreMat). The requirement of the presence of the cumulus cells for the beneficial effect from the pre-maturation incubation was tested by denuding the oocytes (DOs). Maturation rates were collected following in vitro culture of COCs and DOs. Statistical significance is indicated when letters differ between treatments (p < 0.05).

130

Figure 3-8. Timing of TZPs RNA loading A) Maximum intensity projections of the equatorial cross sections of the oocytes stained for RNA (SytoRNA select) and F-Actin (rhodamine phalloidin) after recovery from ovaries 0 h, 2 h, 4 h, and 6 h post mortem, the intrafollicular prematuration periods. B) Quantification of projections containing detectable RNA signals along the post mortem wait before oocyte recovery from the ovaries. C) Total number of actin stained TZP structures at each time point. Statistical significance is indicated when letters differ between treatments (p < 0.05).

131

3.10 Tables Table 3-1 Ontology Terms enrichment for Biological Processes for transcripts found on the TZPs and the polyribosomes of GV and MII oocytes

GO Identification Biological Process Count % P Value GO:0045449 regulation of transcription 29 10.1399 0.0497 GO:0006355 regulation of transcription, DNA-dependent 24 8.3916 0.0217 GO:0051252 regulation of RNA metabolic process 24 8.3916 0.0261 GO:0008104 protein localization 19 6.6434 0.0008 GO:0015031 protein transport 17 5.9441 0.0018 GO:0045184 establishment of protein localization 17 5.9441 0.0019 GO:0006396 RNA processing 13 4.5455 0.0024 GO:0046907 intracellular transport 12 4.1958 0.0104 GO:0006412 translation 11 3.8462 0.0270 GO:0007049 cell cycle 10 3.4965 0.0399 GO:0007010 cytoskeleton organization 9 3.1469 0.0090 GO:0022403 cell cycle phase 8 2.7972 0.0110 GO:0043009 chordate embryonic development 8 2.7972 0.0237 GO:0009792 embryonic development ending in birth or egg hatching 8 2.7972 0.0244 GO:0032268 regulation of cellular protein metabolic process 8 2.7972 0.0259 GO:0010629 negative regulation of gene expression 8 2.7972 0.0298

132

Table 3-2. Gene Ontology Terms enrichment for Molecular Functions for transcripts found in the TZPs and polyribosomes of MII and GV oocytes

GO Identification Molecular Function Count % P Value GO:0001882 nucleoside binding 30 10.4895 0.0241 GO:0005524 ATP binding 29 10.1399 0.0162 GO:0032559 adenyl ribonucleotide binding 29 10.1399 0.0180 GO:0030554 adenyl nucleotide binding 29 10.1399 0.0335 GO:0001883 purine nucleoside binding 29 10.1399 0.0371 GO:0003723 RNA binding 13 4.5455 0.0228 GO:0008134 transcription factor binding 11 3.8462 0.0001 GO:0008092 cytoskeletal protein binding 9 3.1469 0.0461 GO:0004386 helicase activity 7 2.4476 0.0072 GO:0019904 protein domain specific binding 6 2.0979 0.0340 GO:0008022 protein C-terminus binding 5 1.7483 0.0058 GO:0008135 translation factor activity, nucleic acid binding 5 1.7483 0.0365 GO:0003712 transcription cofactor activity 5 1.7483 0.0472

133

4 Characterization of Fragile X mental retardation protein during bovine folliculogenesis, oogenesis and early development.

Macaulay, A.D.1 Scantland, S.1 Khandjian, E.W.2 Robert, C.1

1 Département des sciences animales, Centre de recherche en biologie de la reproduction, Institut sur la nutrition et les aliments fonctionnels, Université Laval, Québec, QC, Canada. 2 Département de Psychiatrie et Neurosciences, Institut universitaire en santé mentale de Québec, Université Laval, Québec City, Québec, Canada

135

4.1 Résumé La protéine “Fragile-X mental retardation” (FMRP) est connue pour son rôle prépondérant dans les synapses neuronales où elle régule la traduction des ARNm ainsi que la formation et le transport des granules d’ARNm. Cette protéine est également responsable d’un phénotype d’ordre reproducteur chez certaines femmes porteuses de la pré-mutation qui accroit considérablement le risque de développer une insuffisance ovarienne primaire. La présence de FMRP dans les ovaires et les testicules est bien établie, mais le rôle qu’elle y joue est méconnu. Dans la présente étude basée sur le modèle bovin, nous démontrons l’expression protéique dans l’ovocyte ainsi que dans les cellules de granulosa et de cumulus de FMRP et de deux autres protéines analogues, FXR1 et FXR2. Nous montrons également que la présence de ces protéines persiste tout au long du développement embryonnaire. FMRP a été identifiée dans les follicules préantraux et antraux de même que dans les ovocytes. Dans les gamètes femelles, FMRP colocalise fortement avec la protéine ribosomale L7 ainsi qu’avec YBX2, une protéine impliquée dans la formation des granules ovocytaires d’entreposage d’ARNm. Il est intéressant de noter que, bien que les transcrits de FMRP, FXR1 et FXR2 sont normalement polyadénylés dans l’embryon précoce, seul FXR1 a été retrouvé lié aux polyribosomes pendant l’embryogenèse. L’inhibition de FMRP a résulté en un faible taux de formation de blastocyste tandis que l’inhibition simultanée de FMRP, FXR1 et FXR2 a plutôt mené à l’arrêt du développement au stade morula. En somme, FMRP s’associe aux protéines d’entreposage des transcrits d’ARN dans le follicule et la famille de protéines qu’il forme avec ses analogues est cruciale pour le développement embryonnaire.

137

4.2 Abstract Fragile-X mental retardation protein (FMRP) is best known for its roles supporting neuronal synapse function by providing translational regulation, and RNA granule formation and trafficking to distal regions. This protein is also responsible for a reproductive phenotype in some women who carry the pre-mutation, resulting in a considerably elevated risk of primary ovarian insufficiency. FMRP is known to be present in the ovary and testis, but its role there is poorly understood. Here we show in the bovine model, that there is protein expression of FMRP and two of its closely related analogous proteins FXR1 and FXR2 in the granulosa and cumulus cells, as well as in the oocyte, and the proteins persisted throughout pre-hatching embryonic development. FMRP was detected in both pre-antral and antral follicles and in oocytes. In the gamete, FMRP colocalized strongly with L7 ribosomal protein, as well as with YBX2, a protein involved in oocyte RNA storage granule formation. Interestingly, FMRP, FXR1, and FXR2 transcripts are typically polyadenylated in the early embryo, yet only FXR1 was found on the polyribosomes in early embryogenesis. Knockdown of FMRP resulted in significantly reduced rates of blastocyst formation. Knockdown of FXR1 and FXR2 transcripts together resulted in a similar phenotype to the FMRP knockdown. Depletion of all three resulted in an early developmental compromise at the morula stage, but not a significantly lower rate of blastocyst formation compared to other knockdown treatments. No developmental effects were seen prior to the embryonic genome activation suggesting that FMRP family transcripts are not relied upon until after the embryo resumes transcription. Ultimately, FMRP associates with translation and RNA storage proteins in the follicle, and this family of proteins is crucial for early embryonic development.

139

4.3 Introduction Premature ovarian insufficiency (POI) affects 1% of women before the age of 40 (Persani et al. 2010; Fortuño and Labarta 2014). Much of this disease is not well understood with the majority of cases caused by unknown factors (De Vos et al. 2010; Kodaman 2010), however in up to 15% of POI cases, affected women are carriers of the fragile X mental retardation (FMRP) pre-mutation (Wittenberger et al. 2007). The prevalence of the FMRP pre-mutation is about 1 in 249 women, all of whom are at increased risk of POI (Rousseau et al. 1995; Bardoni et al. 2006; Hogström and Mark 2007; Persani et al. 2009). Further complicating the etiology of this disease is the fact that X-inactivation could leave some women with mosaicism in their ovarian tissue affecting follicles and oocytes differently leaving some affected and others not (Jin and Warren 2000).

Fragile X mental retardation protein is best known for cognitive impairment classified in the autism spectrum affecting 1 in 4,000 males, and 1 in 6,000 females (Macaulay et al. 2013). The FMR1 gene that codes this protein resides on the X chromosome, and contains a repeated CGG region in the 5’ untranslated region (UTR). The repeat numbers result in three classifications: normal individuals have less than 54 repeats, pre-mutation carriers have between 55-200 repeats, and affected individuals with the full mutation contain greater than 200 repeats (Rousseau et al. 1995; Darnell et al. 2011). The high number of repeats in the mutated individuals causes impaired transcription and translation, thus limiting protein synthesis (Pretto et al. 2014; Okray et al. 2015). The full mutation does not render the affected individuals infertile, and FMRP function may be partly compensated for by the autologous FXR1 and FXR2 proteins, however their knockdown does not result in the same POI phenotype. It may be that in the FMRP full mutation that other RNA binding proteins make up for the mechanism. Many pre-mutation carriers do not show any fragile X phenotypic alterations (Rousseau et al. 1995), however, these individuals with the premutation are also at risk of fragile X tremor ataxia later in life showing that the pre-mutated impact is slow to develop (Buijsen et al. 2014).

The FMRP protein functions as an RNA binding protein (RNABP) and in neurons, visible differences exist in FMRP mutations pertaining to neuronal synaptic formation (Darnell et

141

al. 2011). FMRP functions to regulate translational control, and is also involved in RNA stress and neuronal granule formation (Mazroui et al. 2002; Antar et al. 2005). FMRP interacts with a number of proteins that regulate translation and interfere with the ability of polyribosomes to translate protein (Khandjian et al. 1996; Corbin et al. 1997; Laggerbauer et al. 2001). Stalled ribosomes are suspected to form ribonucleoproteins or granules that can then be transported throughout the cytoplasm for translation in a new location and possibly at a later time. In the oocyte, roles of transcript storage and careful translational control are important for oocyte growth and embryonic development (Medvedev et al. 2008) Stored transcripts are linked to oocyte competence by making up the maternal program, stored RNA in the oocyte that is retained for early embryogenesis and that is translated in a temporally controlled manner. The bovine model in this instance is a useful tool as the maternal program is carried out over several cell divisions in the early embryo until after the 8-16 cell stage when the embryonic genome can activate (Memili et al. 1998).

One known RNABP found in the gamete is Y-box binding protein 2 (YBX2), analogous to MSY2 in the mouse (Vigneault et al. 2009). YBX2 is involved in the maternal program coordination and RNA storage within the oocyte and early embryo. This protein is associated with a subcortical RNP domain in mouse oocytes (Flemr et al. 2010), and has a role in the stability and regulation of the maternal program (Yu et al. 2001). This protein is also gamete specific and is highly abundant (Yu et al. 2001). Loss of function study has shown deregulation in both spermatogenesis and oogenesis (Yang et al. 2005), likewise potentiating the value of proper MSY2 and RNABP function in gametes.

Few studies have characterized FMRP in the developing follicles and early embryos in rodents (Hoffman et al. 2012; Lu et al. 2012; Ferder et al. 2013). This is less studied in large monovulatory mammalian models where only a few investigations exist that confirm transcript expression in early embryos in the monkey (Mtango et al. 2009), or show protein expression in fetal ovarian tissues in humans (Rif et al. 2003). Here we investigate FMRP in the developing oocyte and early bovine embryo. We hypothesize that FMRP in the follicle and oocyte is associated with the machinery responsible for translation control and

142

RNA granule formation, and that this protein is important to early embryogenesis. We characterized FMRP protein localization within the ovarian follicles and oocytes, and identified interacting protein partners, and evaluated the requirement for FMRP expression during early embryogenesis.

4.4 Materials and Methods All chemicals were purchased from Sigma, Chemical Co. (Oakville, Ontario, Canada) unless otherwise indicated.

4.4.1 Oocyte collection, maturation, fertilization, and embryo culture All animals were slaughtered in accordance with the Canadian Food Inspection Agency (CFIA) standards. Their regulations were followed strictly at the local abattoir that provided the ovaries. No animals were handled on university premises. Bovine oocytes were collected from 3-6 mm follicles from abattoir ovaries. Good-quality oocytes displaying homogenous cytoplasm, a complete cumulus cloud with no signs of atresia, and a fully-grown size greater than 120 m were selected. Oocytes were typically matured in standard maturation medium composed of TCM199 (Gibco 11150059, Invitrogen Life Technologies), 10% fetal bovine serum (FBS), 0.2 mM pyruvate, 50 μg/ml gentamicin, 5 μg/ml FSH (Serono, Mississauga ON, Canada), and 1 mg/ml E2. Oocytes were matured in groups of 50 in 500 μl of media at 38.5 8C with 5% CO2 in maximal humidity.

After IVM, cumulus oocyte complexes (COCs) were washed in TLH and transferred to 50 mL fertilisation medium (Tyrode’s lactate medium supplemented with 0.6% fatty acid-free bovine serum albumin (BSA), 0.2 mM pyruvic acid, 50 mg/mL gentamicin, 2 mg/mL heparin, 1 mM hypotaurine, 2 mM penicillamine, 250 mM adrenaline) containing 1 X 106 spermatozoa per mL and incubated at 38.5°C in 5% CO2 in humidified air for 17 h. The semen used consisted of a cryopreserved mixture of ejaculates from three bulls of known fertility (Centre d’Insemination Artificielle du Quebec, St-Hyacinthe, Canada). A discontinuous Percoll gradient was used to select a population enriched in motile spermatozoa.

143

After fertilization, groups of 10 denuded oocytes were placed in 10 μL drops of synthetic oviductal fluid (SOF) and incubated at 38.5°C in a humidified 5% CO2 reduced oxygen (to 7%) atmosphere. After 72 h, the medium was replaced with SOF2 supplemented with 0.4% fatty acid-free BSA, essential and non-essential amino acids (Gibco), 1.5 mM glycine, 0.5 mM glutamine, 0.5 mM L-alanine, 0.4 mM taurine, 0.1 mM pyruvic acid, 1 mM sodium L- lactate, 0.5 mM D-glucose, 1.5 mM D-fructose, 25 mg/mL gentamicin and 0.5 mM

MgSO4. On Day 6 of embryo culture, this medium was replaced with SOF3 supplemented with 0.4% fatty acid-free BSA, essential and non-essential amino acids, 1.5 mM glycine, 1 mM glutamine, 0.5 mM L-alanine, 0.4 mM taurine, 0.1 mM pyruvic acid, 1 mM sodium L- lactate, 1 mM D-glucose, 2.5 mM D-fructose, 25 mg/mL gentamicin and 0.5 mM MgSO4, which supported embryo development until Day 8.

4.4.2 Antibodies The FMRP C10 (Fatimy et al. 2012) antibody was used for Western blotting and immunofluorescence (IF). The anti FXR1 ML13 raised in rabbit (Mazroui et al. 2002) was used in Western blot application along with the mouse monoclonal anti FXR2 A42 (Novus, Burlington, ON Canada). Ribosomes were detected in IF with Rabbit anti-ribosomal protein L7 (Novus). The anti YBX2 pAB rabbit antibody was also used for IF application (Abcam, Cambridge, MA). Secondary fluorescent Alexafluor antibodies were purchased from Life technologies and used at a concentration of 1 in 1000 in TBST with 2.5% BSA and ImageIt signal enhancer at one drop per mL (Life technologies, Burlington, ON, Canada).

4.4.3 Western Blot Bovine oocytes (n = 100) were denuded, washed in PBS then frozen at -80°C. Fifteen μg of each extract or 100 oocytes were lysed in 2× SDS loading buffer containing 6% β- mercaptoethanol at 95°C for 5 min. Similarily preparation occurred for pools of 2, 4, 8- cell, morula, and blastocysts as previously described (McGraw et al. 2006). Proteins were

144

resolved on standard 6% SDS-PAGE gels and transferred onto nitrocellulose membranes (Osmonics, Minnetonka, MN) using a semi-dry transfer apparatus (BioRad, Hercules, CA). Blotted membranes were blocked in TBST (25 mM Tris-HCl pH 7.6, 125 mM NaCl and 0.1% Tween-20) containing 5% ECL Advance Blocking Agent (Amersham Biosciences, Piscataway, NJ) for 1 hr at room temperature. Membranes were then incubated with a 1 in 5000 dilution of primary antibody with 3% ECL Advance Blocking Agent in TBST overnight at 4°C. The membranes were washed 1 × 15 min and 4 × 5 min in TBST, then incubated with a peroxidase-conjugated antibody (Molecular Probes, Burlington, ON, Canada) diluted 1:200 000 in TBST-3% ECL Advance Blocking Agent for 45 min. Finally, membranes were washed 4 × 5 min in TBST followed by a 1 × 15 min wash in TBS before the chemiluminescent signal was revealed using ECL Advance Reagent (Amersham). The same protocol was used with the β-actin antibody (Cell Signalling). Briefly, 15 μg of each extract were resolved on a 15% gel. A 1:10,000 dilution of β-actin antibody was incubated with the blotted membrane before being probed with the peroxidase-conjugated secondary antibody. Relative quantification was carried out using imageJ software (Miller 2011) with normalization to the actin expression.

4.4.4 Fixation and fluorescent staining and Image Capture Oocytes were placed in 4% paraformaldehyde (PFA, Sigma-Aldrich) in PBS at pH 7.2-7.4 for 30 min at room temperature for fixation. Rhodamine phalloidin for the detection of F- actin was purchased from Cytoskeleton Incorporated (Denver, CO, USA) and was used to specification. Fluorescent microscopy was carried out on the Zeiss LSM 740 confocal microscope using ZEN capture and image analysis software (Carl Zeiss, Toronto, ON, Canada). Channels were excited and detected independently of each other to avoid crosstalk and bleed through for colocalization analysis. Signal threshold values were also determined for each image using the ZEN software (Carl Zeiss), by evaluating background pixel intensity for each channel, and subtracted from the overall image this further eliminated low background noise, and bleed through that could obscure colocalization evaluation.

145

4.4.5 Immunofluorescence Immunofluorescence was based on an established protocol (Doyle et al. 2009), using 4% PFA fixed COCs that were partially denuded and hemi-sectioned with micro-scalpel blades (Bioniche). One difference was an initial heat induced antigen retrieval in a solution of Tris-EDTA for 25 min at 80°C using a decloaking chamber (Biocare Medical, Concord CA, USA). Primary antibody, anti FMRP (C10) antibody, anti L7 ribosomal protein (Novus), and anti-YBX2 (Abcam) were applied at a dilution of 1 in 40 overnight at 4°C in TBST with 5% BSA and 1 drop per mL of ImageIT signal enhancer. After 4 x 15 minute washes in TBST, Alexafluor 488 or 568 anti-rabbit or anti-chicken (Life Technologies) secondary was applied at a concentration of 1 in 1,000 for 1 h at room temperature in TBST with 2.5% BSA and ImageIT signal enhancer (Life Technologies). For negative and specificity controls, matching animal non-immune IgG or IgY primary, and secondary antibody only controls were carried out on the samples concurrently. Samples were visualized on the Zeiss LSM 740 confocal microscope using ZEN capture and image analysis software.

4.4.6 RT-qPCR Pools of five oocytes or embryos at each stage were prepared in quadruplicate. A synthetic GFP transcript was spiked into the extraction buffer that was distributed in all samples for normalization as previously described (Vigneault 2004). Total RNA extraction and DNAse treatment were performed using PicoPure columns (Life Technologies). Reverse transcription was performed using qScript cDNA Synthesis kit (Quanta Biosciences, Gaithersburg, MD, USA). PCR was performed on a LightCycler 2.0 system (Roche) using the LightCycler Faststart DNA master Syber Green I kit (Roche). Primer sequences and amplification details can be found in Table 4-1. When comparisons were made between total RNA and polyadenylated RNA, samples were divided into two prior to reverse transcription where one half was reverse transcribed with oligo-dT while the other half was reverse transcribed with the random decamers, using a protocol published previously (Gilbert et al. 2009)

146

4.4.7 Isolation of oocyte polyribosomes and microarray transcript evaluation Polyribosomes were isolated using pools of 75 germinal vesicle (GV), MII oocytes, and early or late 8-cell embryos using a previously described procedure (Scantland et al. 2011). Three biological replicates were performed for each developmental stage. Briefly, the oocyte samples were spiked with drosophila polyribosomes that had been chemically cross- linked and neutralized. These exogenous polyribosomes acted as a carrier and allowed for polyribosome detection during fractioning on a sucrose gradient. Proven polyribosomal fractions were isolated and the bulk of drosophila RNA was eliminated during total RNA extraction. Polyribosomal transcripts were identified by microarray hybridization (EmbryoGENE bovine 44 k oligo array printed by Agilent) as described previously (Robert et al. 2011). Microarray raw data are available at Gene Expression Omnibus (GEO) under accession number #GSE56603. Since all samples were spiked with the same batch of carrier polyribosomes, drosophila transcripts for which oligos were present on the microarrays served as internal standards for data normalization accounting for sample loss during the procedures and also preserving the natural differences in polyribosomal RNA contents between both states of oocyte maturity.

4.4.8 Oocyte microinjection Knockdown of selected candidates was achieved using siRNA custom designed using the silence select kit (Life Technologies, Burlington ON). SiRNA transcript target sequences can be found in Table 4-1. Aspirated COCs were collected and washed three times in hepes buffered maturation media. Microinjection pipettes with an outer diameter of 1.5 μm were loaded by capillarity with specific target siRNA or negative control duplex dissolved in RNase-free duplex buffer (Integrated DNA Technologies) and oocytes were microinjected using a Narishige joystick micromanipulator prior to IVM using our standard protocol (Paradis et al. 2004). Injection was performed through the cumulus cloud, with the detection of the injection being done by cytoplasmic swelling. On the next day lysed oocytes were discarded while the remaining COCs washed three times in TLH and fertilized in vitro.

147

4.4.9 Statistics Oocytes were collected from abattoir ovaries, washed, and pooled together for morphological selection of quality gametes. Random sorting was carried out to create treated and control groups. Comparison of means was carried out by either one-way ANOVA with Dunnett’s post-hoc test, or by t-test when appropriate with significance attained at p < 0.05 (Prism 5, Graphpad software, La Jolla, CA, USA).

4.5 Results 4.5.1 Detection of FMRP, FXR1, and FXR2 in reproductive tissues Confirmation of the Fragile X family proteins being present in ovarian tissues in the bovine model was done by immunofluorescence. Ovarian sections were evaluated to see if FMRP could be visualized throughout the stages of follicular development and oocyte growth. FMRP was found in primordial, primary, secondary, early antral, and large follicles and localized primarily to the cytoplasm of granulosa cells and oocytes (Figures 4-1, 4-2). FMRP appears more abundant within the granulosa cells and the oocyte in comparison to the surrounding theca layers and stromal cells of the ovary that show low, or no signal respectively. There was not an evident visual difference between the stages of development and the quantity of FMRP present in the granulosa cells.

To assess FMRP association with the translational machinery in the follicle, L7 ribosomal protein was labeled at these same follicular stages and found present in all cells of the ovary. Multiplexed staining of L7 and FMRP shows strong colocalization to the two proteins in the follicle and the oocyte, a trend present in all evaluated stages of development (Figure 4-1). Colocalization coefficients taken from all follicle sizes indicated that the oocyte FMRP signal colocalized to L7 signal with a frequency of 87.8 ± 0.05 % (n = 48). The inverse relationship saw L7 colocalize to FMRP foci with a frequency of 65.0 ± 0.03%. This indicates that when FMRP is present in the follicle and the oocyte that it frequently associates with the ribosomes yet that nearly a third or ribosomal signal does not partner with FMRP signal. The aforementioned RNABP associated with storage granules in the

148

oocyte is YBX2. It was also evaluated by immunofluorescence in the ovarian sections and was found only in the oocyte, but is present at each stage of follicle development. FMRP was found as before, concentrated in both the granulosa cells and in the oocyte in the ovarian follicle tissue sections (Figure 4-3). The relationship FMRP has with YBX2 protein in the follicles similar to that of L7 (Figure 4-3). Like L7, strong colocalization coefficients were found for the signals produced by the two proteins. In the oocyte, FMRP localized to YBX2 with a frequency of 78.9 ± 0.03%, while YBX2 colocalized to FMRP signal with a frequency of 70.0 ± 0.03% (n = 53).

Further evaluation in wholemount oocytes to more closely evaluate the proteins in the COC, identified the presence of FMRP in the transzonal projections that link the cumulus cells and the oocyte (Figure 4-3). Projections were detectable with actin staining. The L7 ribosomal protein is also present in the transzonal projections that link the cumulus cells and the oocyte (Figure 4-3). In the wholemount preparations, the L7 protein colocalizes well with FMRP within the oocyte and cumulus cells (FMRP:L7 88.4 ± 2.7 %, L7:FMRP 80.34 ± 6.9%; n = 21). Granules that were double labeled with FMRP and L7 were nanometers in diameter and seemed to form slightly larger aggregates that were distributed throughout the cytoplasm of the cumulus cell and ooplasm. This association might implicate FMRP with a role influencing the translation of protein within the TZP, or assisting in RNP formation and RNA shuttling. Wholemount analysis to focus on the COC was also made for the YBX2 protein. YBX2 strongly colocalized with FMRP in the oocyte (FMRP:YBX2 70.4 ± 1.2%, YBX2:FMRP 61.8 ± 2.3%; n = 32), and appeared as small nano-scale foci. They were either smaller particles or were present in small aggregate clusters. These foci are seemingly homogenous in the oocyte, not localizing to particular regions.

4.5.2 Detection of Fragile X family transcripts in early embryo development Transcript abundance in each stage of oocyte maturation and embryogenesis was carried out by RT-qPCR, evaluating transcript levels for each of the FMRP, FXR1, and FXR2 transcripts (Figure 4-4 A, B, C). Transcript abundance was completed for total transcript

149

and poly A bearing transcript populations. Total FMRP transcript levels remained steady throughout oocyte maturation and were then depleted at the 2-cell embryo stage, but were depleted late in the 8-cell stage and morula stage, before increasing in abundance at the blastocyst stage. FXR1 transcripts were the most constant across development, however a statistically significant (p<0.05) increase was found at the MII stage. FXR2 transcript expression held steady in early divisions, but at the 4-cell stage it was significantly decreased and remained so through until blastocyst stage.

Interestingly, by dividing the RNA for RT-qPCR for total and polyA content analysis and comparison in abundance revealed few differences in populations of total transcripts and polyA transcripts. No significant differences between total and polyA transcript levels were found except for two cases in the FXR1 transcript levels. The FXR1 transcript had a greater total RNA population at the MII stage in comparison to the polyA transcript population (p < 0.05), an occurrence also seen at the 2-cell stage. Polyribosome fractions were made in our lab previously for GV and MII oocytes (Scantland et al. 2011), and also for 8-cell embryos that developed early, or late in culture. The FXR2 and FMRP transcripts were not found on the polyribosomes of these stages of development. Their absence from the transcriptional machinery would indicate that no newly synthesized proteins arise at these time points. The FXR1 transcript, however, was found in the polyribosomes of the 8- cell embryos and significantly increased more than 1.5 fold, (p < 0.05) between early and late 8-cell populations indicating a translational demand for this transcript.

Transcripts used as a part of the maternal program are highly abundant in the oocyte and steadily decrease over the course of embryogenesis until EGA (Gilbert et al. 2009). The fragile X family member transcripts typically follow this pattern. Often, transcripts are depleted from oocyte stages over the course of early embryogenesis; many transcripts are simply degraded, while others are translated into protein and then degraded. If the transcript is required post EGA occurring at the 8-cell stage in the cow, then newly synthesized transcripts increase in abundance after this point to support the morula and blastocyst. FMRP and FXR1 both follow this pattern of expression. FXR2 differs in that there is not an apparent renewal of transcription in the morula or blastocyst.

150

Protein abundance of each of the FMRP, FXR1, and FXR2 proteins was detected at each stage of early embryogenesis. Protein detection was done using Western blotting, on oocytes at GV and MII stage, as well as on embryos at the zygote through 2-cell, 4-cell, 8- cell, morula, and blastocyst stage embryos (Figure 4-5). Using actin abundance as a reference, FMRP and FXR2 proteins remained relatively stable over the course of early embryogenesis in opposition with their transcriptional profiles, and determined absence from translational machinery. They did appear to decrease in abundance around blastocyst stage. In contrast, FXR1 that is found on the polyribosomes at the 8-cell stage, and did appear to have higher protein abundance based upon the Western blot profile at the ensuing morula stages. With the detection of these proteins confirmed in oocyte and early embryos, their utility to embryogenesis remained to be tested, so further study determined the impact of these proteins on early development.

4.5.3 Effect of Fragile X protein family knockdown on early embryo development To test the impact of FMRP in embryonic development, knockdown was done by microinjecting siRNA and confirmed using RT-qPCR to measure the abundance of the transcripts of the FMRP, FXR1 and FXR2 transcripts in knockdown, control, and injected control developing embryos at all stages (Figure 4-6 A-C). Knockdown efficiency at the zygote stage for FMRP was 89.9%, for FXR1 was 67.7%, and for FXR2 was 72.4%.

The FMRP knockdown did not result in changes in developmental rates compared to controls or injected controls in early, 2-cell through morula, stage embryos. The blastocyst stage, however, was different and development was only 14.4% in the FMRP knockdown group in comparison to controls (34.8%) and negative injected controls (31.9%) accounting for a developmental decrease of nearly 60%. All numerical values for developmental rates can be found in Table 4-2. The embryonic development that occurred in spite of the single knockdown of FMRP led us to consider the autologous interacting proteins FXR1 and FXR2. Subsequently, the two autologous proteins FXR1 and FXR2 were knocked down together and found to have a similar and significant impact on embryonic development

151

allowing a rate of only 20.6% of blastocysts. Finally, all three transcripts were knocked down in unison. This resulted in the first indication of a significantly different trend in development shown by significantly decreased development to the morula stage at 29.2% vs. 41.4% in controls. The rate of blastocyst development in the triple knockdown was only 12.9%, significantly decreased from controls and injected controls.

Blastocysts that did develop from the triple knockdown injected groups showed recovered protein levels of FMRP, but decreased FXR1 and FXR2 levels ruling out mis-injection (Figure 4-6 D, E). A possible recovery of protein levels after embryonic genome activation may have occurred sufficiently in the small population of developed blastocysts. The FMRP, FXR1, and FXR2 protein levels in the triple knockdown morula and blastocysts were assessed by Western blot and compared to control and non-injected control levels. Blocked morula showed depleted protein abundance following microinjection, while those morula and blastocysts that did not block were found to express the FMRP at levels similar to controls. The FXR1, and FXR2 proteins were found present yet less abundant than in control and injected control blastocysts.

4.6 Discussion Roles of FMRP in neurons are primarily for the suppression of translation, and distal localization of mRNA to the processes of the neurons supporting the establishment and maintenance of synaptic connectivity (Dictenberg et al. 2008). The RNA binding function of FMRP and interactions with motor proteins (Davidovic et al. 2007), translational initiation machinery (Sossin and Lacaille 2010), and ribosomes (Khandjian et al. 1996; Corbin et al. 1997), are characteristic of this protein and are common to other identified granule forming RNABPs. We wish to better understand the role of FMRP in the ovary, as there is highly abundant tissue expression of its transcripts and proteins, and a strong association with POI (Persani et al. 2010). The role of FMRP has not yet been characterized in a large animal, mono-ovulant model within the context of reproduction. In mouse there exist knockdown and mutant models, however, the extent of the knowledge pertaining to the link between FMRP and ovarian function is still relatively topical but

152

indicated reduced follicle counts on the ovaries with higher levels of atresia, decreased fertility, and smaller litter sizes (Sherman et al. 2014). Recently there was some profiling of FMRP protein expression done mice (Hoffman et al. 2012; Lu et al. 2012), and in rats (Takahashi et al. 2015).

We show that there is a close association of FMRP in the follicle and oocyte with proteins that function in translation and RNA granule formation, similar to FMRP’s associations in brain tissue. The limited knowledge over the critical control of RNA usage in the early embryo led to the exploration of FMRP within the oocyte in relation to other proteins of interest with functions in RNA management and potential control over the maternal program. This program allows the oocyte and early embryo to temporally utilize their stores of RNA (Meirelles et al. 2004; Kotani et al. 2013) until the 8-cell stage in cattle when the embryonic genome takes over (Memili et al. 1998). By full growth, the maternal program is established in the oocyte (Fair et al. 1997; Lodde et al. 2008), and numerous RNABPs are present to implement this program (Beshore et al. 2011; Baumann 2013). .

Previous study of the maternal reserves that are required to sustain protein synthesis in period of transcriptional silence have pointed to YBX2 protein involved in maternal program storage in mice, and indicated that this protein is found in a subcortical RNP domain (Flemr et al. 2010). When this protein is not present in mice, oocyte growth was severely compromised leaving the animals infertile (Medvedev et al. 2011). Here, it was identified that YBX2 was present in each follicle stage during follicular development, confirming previous reports that it is found only in the oocyte, while FMRP was identified throughout the oocyte and its granulosa cell layers. Both were found during development from the primordial follicle stage up until the large antral follicle stage. From our ovarian sections with oocytes from large follicles, YBX2 appeared to be homogenous throughout the cytoplasm, while previous reports in cattle and mouse have pointed to a cortical distribution (Vigneault et al. 2009; Flemr et al. 2010). The distribution of RNABPs has been shown important to development particularly in insect models. In drosophila, bicoid and oskar proteins localize to the anterior and posterior axis of the zygote, a process that is dependent upon the RNA binding protein staufen and its localization to the posterior axis

153

(Schnorrer et al. 2000; Irion et al. 2006). This localization is responsible for axis formation, and further RNABPs are responsible for later segmentation. In mammalian oocytes, RNABPs like staufen 1 and 2 proteins (STAU1/2), and ELAVL 1 and 2 (embryonic lethal, abnormal vision, drosophila-like 1/2) have been found, but have not been shown to create the same gradients though ELAVL2 changes from a cytoplasmic to nuclear distribution after embryonic genome activation (Calder et al. 2008). The first evidence of a protein gradient in the mammalian oocyte is the actin cytoskeleton remodeling to allow polar body extrusion (Coticchio et al. 2014; Wang et al. 2014). Our findings for the pattern of FMRP distribution in the bovine oocyte are similar to other findings in rodent models, and do not show any kind of gradient (Hoffman et al. 2012; Lu et al. 2012; Ferder et al. 2013). We also show a strong colocalization of FMRP with YBX2 during the development of the oocyte. This close interaction of these proteins indicates a role for FMRP in oocyte granule formation and RNA storage in the oocyte. A better understanding of FMRPs role in the granular storage compartments for RNA within the oocyte will help us understand the control of temporal expression of maternal transcripts in the developing embryo (Barckmann and Simonelig 2013).

The 60s ribosomal protein L7 was also assessed and found throughout all cells of the follicle and at all developmental stages. The colocalization of FMRP with L7 was strong in the oocyte and follicle cells. Based upon neuronal roles of FMRP one interpretation of this may be that FMRP plays a similar role in the oocyte as in neurons where it associates closely with ribosomes to control translation. There is some evidence to suggest that the RNA granules in neurons are in fact stalled polyribosomes that await reactivation to initiate protein synthesis (Darnell et al. 2011; Graber et al. 2013). Stress granules have also been shown to contain FMRP (Dolzhanskaya et al. 2006), and have many similarities with processing-bodies (Kedersha et al. 2005 Jun 20). These different varieties of granules all contain some similar groups of proteins such as RNABPs, helicases, and transcriptional machinery, however they serve in different functions, either to store RNA or to cause its degradation as is the case with P-bodies (Zheng et al. 2008). Each of these granules are potentially present within the follicle and COCs and likely interact with each other, however there is little clear evidence to irrefutably identify stress granules in oocytes

154

(Schisa 2012). More study of the nature of the RNA granules in mammalian oocytes will help to distinguish between granule types and also allow a better comprehension of how the maternal program is stored and utilized.

During early embryogenesis, it was found that the FMRP, FXR1 and FXR2 proteins and transcripts in all stages of development from the GV stage oocyte, through to the blastocyst stage. Interestingly previous work identified each of the FMRP, FXR1 and FXR2 protein transcripts as nascently synthesized transcripts present in the cumulus cells localizing to the TZPs during the first hours of oocyte maturation (Macaulay et al. 2014). The transcript abundance show here follows an interesting pattern during the course of embryonic development being highest in GV-MII stages and decreasing over early embryogenesis. This is a common pattern of transcript expression in early embryogenesis (Vigneault 2004), and indicates the occurrence of transcript depletion until embryonic genome activation that occurs at the 8-cell stage in cattle when new transcripts are synthesized (Memili et al. 1998). Most interestingly, FMRP shows a renewed transcriptional abundance in the blastocyst, and a similar trend is found in FXR1 transcripts, while FXR2 persists at low levels. Interestingly in other mammalian species, evidence exists that all the maternal transcripts must be degraded prior to the EGA (Telford et al. 1990; Schultz 2002).

The polyadenylation status of these transcripts in comparison to the total RNA content provides clues about their activity. The FMRP, FXR1 and FXR2 transcripts are found to have a population of polyadenylated transcripts at each stage of development that would indicate that these transcripts were ready to be translated into protein, however the polyribosome data suggested otherwise showing no presence of these transcripts on polyribosomes at the GV and MII stage or at the 8-cell stage, except for the FXR1 transcript that was present at the 8-cell stage. While other stages of embryonic development prior to EGA remain to be explored in future polyribosome evaluation, it might be possible that the proteins present at the outset of maturation persist for quite some time, thought the half life of FMRP has been shown in in vitro cultured cells to be about 30 hours (Ceman 2003), and stress granules in other cultured cell types persist for up to 48 hours (Moutaoufik et al. 2014). While the stability of FMRP in oocyte granules may be

155

quite different from other examples, there would still appear to be indications of a need for some protein turnover and the possibility of stored transcript translation.

FMRP was also shown to have a critical role in the development of the early embryo and the requirement for FMRP protein at the morula and embryo stage was exemplified by the knockdown data that was presented. The knockdown of FMRP led to a developmental block at the blastocyst stage. This was also seen in the knockdown pairing of FXR1 and FXR2, while the triple-knockdown of FMRP with FXR1 and FXR2 resulted in an earlier developmental compromise detected at the morula stage. Interestingly, the protein depletion in the arrested morula for FMRP was minimal for FMRP though the transcript levels were heavily depleted indicating a sufficient protein stability and function during this sensitive period. Recent work has shown that RNA granules can differ by carrying one, two, or all three of the FMRP proteins (Gareau et al. 2013). If this is indeed the case in the oocyte, our knockdown data removed the RNA binding components of the FMRP granules individually, in pairs (FXR1 and FXR2), or all together where the greatest effect was found. Of interest, it has previously been suggested in other granule knockdown study (Wang et al. 2014), that a diversity of granules may compensate and allow certain embryos to survive (Nguyen-Chi and Morello 2011; Shahbabian and Chartrand 2011). This granular diversity would be an advantage in eggs for their storage and utilization of maternal transcripts. In this work, however, for embryos to reach the blastocyst stage they required a certain level of level of FMRP, FXR1, and FXR2 protein.

One expectation was that the knockdowns would affect the management of the maternal program and result in a disruption in embryonic development occurring prior to the 8-cell stage as the developing embryos lack sufficient control of the maternal program and cease development. The normal development we observed in the embryos to the point of genome activation indicated that translation of these proteins was, in fact not the limiting factor in the recruitment of maternal stores and control over protein synthesis. The developmental block did, however, occur after the EGA as a result of continued knockdown suppression of transcripts limiting further development, suggesting a mechanism of action related to FMRP in the now transcriptionally active blastomeres of the early embryo. This could be

156

due to FMRP function in regulating the protein synthesis of the embryonic genome post activation. Alternatively, there could be a role for FMRP in the nucleus of the blastomeres after the EGA. It was recently shown that FMRP localizes to the Cajal bodies within the nucleus possibly having a role in nuclear post-transcriptional metabolism, and could have a profound effect upon embryonic cells re-initiating their transcriptional functionality (Dury et al. 2013).

As mentioned FMRP functions in neurons to maintain proper synaptic connectivity (Dictenberg et al. 2008; Cook et al. 2011; Nolze et al. 2013). There are also reports that poor quality oocytes having an insufficient TZP network (de Bruin 2004; Coticchio et al. 2012), and observations made in polycystic ovarian syndrome (PCOS) saw oocytes where intermediate filaments were affected (Kenigsberg et al. 2008). Previously parallels were drawn between neurons and the TZP network having shown that exogenous FMRP functions within the COC trafficking RNA from the cumulus cells to the oocyte down the transzonal projections (TZPs) interconnecting the two cells (Macaulay et al. 2014). A GFP-FMRP plasmid was transfected into a population of cumulus cells to re-establish connections to oocytes, and pass GFP RNA and potentially even protein to the egg. In this study, endogenous FMRP granules were present in the TZPs as identified in wholemount preparations of COCs. This could indicate a similar transport of RNA granules to the TZPs and oocyte, but also be indicative of a support mechanism for the intercellular network present within the COCs possibly mediating intercellular connectivity. The TZPs also were shown to contain ribosomes becoming a potential site of transcription that actively supports the intercellular connectivity.

In conclusion, FMRP family proteins were detected in the granulosa cells and in the oocytes as well as in early embryos. It was shown that FMRP localizes with an RNA granule forming protein critical for embryonic development, and the translational machinery within the COC. The knockdown of FMRP alone demonstrated a critical need in early embryonic development to the blastocyst stage, while knockdown of the whole FMRP family resulted in a morula-stage developmental arrest. This post EGA developmental demise indicated that FMRP was not a critical mediator of the maternal

157

program as these embryos developed past the EGA, and is suggestive of a role for FMRP as a critical mediator of the newly established embryonic genome that is required for blastocyst formation.

4.7 Acknowledgements We wish to thank Qili Q. for her technical support for the RNAi portion of this study. We also thank I. Laflamme and A Bastien for their technical assistance during this project.

4.8 References A Schisa J. 2012. New Insights into the Regulation of RNP Granule Assembly in Oocytes. International Review of Cell and Molecular Biology 295: 233–289. Antar LN, Dictenberg JB, Plociniak M, Afroz R, Bassell GJ. 2005. Localization of FMRP- associated mRNA granules and requirement of microtubules for activity-dependent trafficking in hippocampal neurons. Genes Brain and Behavior 4:350–359. Barckmann B, Simonelig M. 2013. Control of maternal mRNA stability in germ cells and early embryos. Biochimica et Biophysica Acata: Gene Regulatory Mechanisms 1829:714–724. Bardoni B, Davidovic L, Bensaid M, Khandjian EW. 2006. The fragile X syndrome: exploring its molecular basis and seeking a treatment. Expert Reviews in Molecular Medicine 8:1–16. Baumann K. 2013 Oct 9. Gene expression: RNA granules: the clock within. Nature Reviews Molecular Cell Biology 14:1. Beshore EL, McEwen TJ, Jud MC, Marshall JK, Schisa JA, Bennett KL. 2011. C. elegans Dicer interacts with the P-granule component GLH-1 and both regulate germline RNPs. Developmental Biology 350:370–381. Buijsen RAM, Sellier C, Severijnen L-AWFM, Oulad-Abdelghani M, Verhagen RFM, Berman RF, Charlet-Berguerand N, Willemsen R, Hukema RK. 2014. FMRpolyG- positive inclusions in CNS and non-CNS organs of a fragile X premutation carrier with fragile X-associated tremor/ataxia syndrome. Acta Neuropathology Communications

158

2:162. Calder MD, Madan P, Watson AJ. 2008. Bovine oocytes and early embryos express Staufen and ELAVL RNA-binding proteins. Zygote 16:1–8. Ceman S. 2003. Phosphorylation influences the translation state of FMRP-associated polyribosomes. Human Molecular Genetics 12:3295–3305. Cook D, Sanchez-Carbente MDR, Lachance C, Radzioch D, Tremblay S, Khandjian EW, DesGroseillers L, Murai KK. 2011. Fragile X related protein 1 clusters with ribosomes and messenger RNAs at a subset of dendritic spines in the mouse hippocampus. PLoS ONE 6:e26120. Corbin F, Bouillon M, Fortin A, Morin S, Rousseau F, Khandjian EW. 1997. The fragile X mental retardation protein is associated with poly(A)+ mRNA in actively translating polyribosomes. Human Molecular Genetics 6:1465–1472. Coticchio G, Dal-Canto M, Guglielmo M-C, Mignini-Renzini M, Fadini R. 2012. Human oocyte maturation in vitro. International Journal of Developmental Biology. 56:909– 918. Coticchio G, Guglielmo MC, Albertini DF, Dal Canto M, Mignini Renzini M, De Ponti E, Fadini R. 2014. Contributions of the actin cytoskeleton to the emergence of polarity during maturation in human oocytes. Molecular Human Reproduction 20:200–207. Darnell JC, Van Driesche SJ, Zhang C, Hung KYS, Mele A, Fraser CE, Stone EF, Chen C, Fak JJ, Chi SW, et al. 2011. FMRP Stalls Ribosomal Translocation on mRNAs Linked to Synaptic Function and Autism. Cell 146:247–261. Davidovic L, Jaglin XH, Lepagnol-Bestel A-M, Tremblay S, Simonneau M, Bardoni B, Khandjian EW. 2007. The fragile X mental retardation protein is a molecular adaptor between the neurospecific KIF3C kinesin and dendritic RNA granules. Human Molecular Genetics 16:3047–3058. de Bruin JP. 2004. Age-Related Changes in the Ultrastructure of the Resting Follicle Pool in Human Ovaries. Biology of Reproduction 70:419–424. De Vos M, Devroey P, Fauser BCJM. 2010. Primary ovarian insufficiency. Lancet 376:911–921. Dictenberg JB, Swanger SA, Antar LN, Singer RH, Bassell GJ. 2008. A Direct Role for FMRP in Activity-Dependent Dendritic mRNA Transport Links Filopodial-Spine

159

Morphogenesis to Fragile X Syndrome. Developmental Cell 14:926–939. Dolzhanskaya N, Merz G, Denman RB. 2006. Oxidative stress reveals heterogeneity of FMRP granules in PC12 cell neurites. Brain Research 1112:56–64. Doyle J, Ellis SA, O’Gorman GM, Aparicio Donoso IM, Lonergan P, Fair T. 2009. Classical and non-classical Major Histocompatibility Complex class I gene expression in in vitro derived bovine embryos. Journal of Reproductive Immunology 82:48–56. Dury AY, Fatimy El R, Tremblay S, Rose TM, CÃ tÃ J, De Koninck P, Khandjian EW. 2013. Nuclear Fragile X Mental Retardation Protein Is localized to Cajal Bodies. Barsh GS, editor. PLoS Genetics 9:e1003890–14. Fair T, Hulshof S, Hyttel P, Greve T. 1997. Nucleus ultrastructure and transcriptional activity of bovine oocytes in preantral and early antral follicles. Molecular Reproduction and Development 46:208–215. Fatimy El R, Tremblay S, Dury AY, Solomon S, De Koninck P, Schrader JW, Khandjian EW. 2012. Fragile X mental retardation protein interacts with the RNA-binding protein Caprin1 in neuronal RiboNucleoProtein complexes [corrected]. PLoS ONE 7:e39338. Ferder I, Parborell F, Sundblad V, Chiauzzi V, Gomez K, Charreau EH, Tesone M, Dain L. 2013. Expression of fragile X mental retardation protein and Fmr1 mRNA during folliculogenesis in the rat. Reproduction 145:335–343. Flemr M, Ma J, Schultz RM, Svoboda P. 2010. P-Body Loss Is Concomitant with Formation of a Messenger RNA Storage Domain in Mouse Oocytes. Biology of Reproduction 82:1008–1017. Fortuño C, Labarta E. 2014. Genetics of primary ovarian insufficiency: a review. Journal of Assisted Reproduction and Genetics 31:1573–1585. Gareau C, Martel D, Coudert L, Mellaoui S, Mazroui R. 2013. Characterization of Fragile X Mental Retardation Protein granules formation and dynamics in Drosophila. Biology Open 2:68–81. Gilbert I, Scantland S, Sylvestre E-L, Gravel C, Laflamme I, Sirard M-A, Robert C. 2009. The dynamics of gene products fluctuation during bovine pre-hatching development. Molecular Reproduction and Development 76:762–772. Graber TE, Hebert-Seropian S, Khoutorsky A, David A, Yewdell JW, Lacaille JC, Sossin WS. 2013. Reactivation of stalled polyribosomes in synaptic plasticity. Proceedings of

160

the National Acad Sciences. 110:16205–16210. Hoffman GE, Le WW, Entezam A, Otsuka N, Tong ZB, Nelson L, Flaws JA, McDonald JH, Jafar S, Usdin K. 2012. Ovarian Abnormalities in a Mouse Model of Fragile X Primary Ovarian Insufficiency. Journal of Histochemistry & Cytochemistry 60:439– 456. Hogström L, Mark J. 2007. Fragile X syndrome: relation to premature ovarian failure and infertility treatment. Acta Obstet Gynecol Scand 86:244–246. Irion U, Adams J, Chang C-W, St Johnston D. 2006. Miranda couples oskar mRNA/Staufen complexes to the bicoid mRNA localization pathway. Developmental Biology 297:522–533. Jin P, Warren ST. 2000. Understanding the molecular basis of fragile X syndrome. Human Molecular Genetics 9:901–908. Kedersha N, Stoecklin G, Ayodele M, Yacono P, Lykke-Andersen J, Fritzler MJ, Scheuner D, Kaufman RJ, Golan DE, Anderson P. 2005 Jun 20. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. The Journal of Cell Biology:871–884. Kenigsberg S, Bentov Y, Chalifa-Caspi V, Potashnik G, Ofir R, Birk OS. 2008. Gene expression microarray profiles of cumulus cells in lean and overweight-obese polycystic ovary syndrome patients. Molecular Human Reproduction 15:89–103. Khandjian EW, Corbin F, Woerly S, Rousseau F. 1996. The fragile X mental retardation protein is associated with ribosomes. Nat Genet 12:91–93. Kodaman P. 2010. Early Menopause: Primary Ovarian Insufficiency and Surgical Menopause. Seminars in Reproductive Medicine 28:360–369. Kotani T, Yasuda K, Ota R, Yamashita M. 2013. Cyclin B1 mRNA translation is temporally controlled through formation and disassembly of RNA granules. The Journal of Cell Biology 202:1041–1055. Laggerbauer B, Ostareck D, Keidel EM, Ostareck-Lederer A, Fischer U. 2001. Evidence that fragile X mental retardation protein is a negative regulator of translation. Human Molecular Genetics 10:329–338. Lodde V, Modina S, Maddox-Hyttel P, Franciosi F, Lauria A, Luciano AM. 2008. Oocyte morphology and transcriptional silencing in relation to chromatin remodeling during

161

the final phases of bovine oocyte growth. Molecular Reproduction and Development 75:915–924. Lu C, Lin L, Tan H, Wu H, Sherman SL, Gao F, Jin P, Chen D. 2012. Fragile X premutation RNA is sufficient to cause primary ovarian insufficiency in mice. Human Molecular Genetics 21:5039–5047. Macaulay AD, Gilbert I, Caballero J, Barreto R, Fournier E, Tossou P, Sirard M-A, Clarke HJ, Khandjian EW, Richard FJ, et al. 2014. The gametic synapse: RNA transfer to the bovine oocyte. Biology of Reproduction 91:90–90. Macaulay AD, Hamilton CK, King WA, Bartlewski PM. 2013. Influence of physiological concentrations of androgens on the developmental competence and sex ratio of in vitro produced bovine embryos. Reproduction Biology 13:41–50. Mazroui R, Huot M-E, Tremblay S, Filion C, Labelle Y, Khandjian EW. 2002. Trapping of messenger RNA by Fragile X Mental Retardation protein into cytoplasmic granules induces translation repression. Human Molecular Genetics 11:3007–3017. McGraw S, Vigneault C, Tremblay K, Sirard M-A. 2006. Characterization of linker histone H1FOO during bovine in vitro embryo development. Molecular Reproduction and Development 73:692–699. Medvedev S, Pan H, Schultz RM. 2011. Absence of MSY2 in Mouse Oocytes Perturbs Oocyte Growth and Maturation, RNA Stability, and the Transcriptome. Biology of Reproduction 85:575–583. Medvedev S, Yang J, Hecht NB, Schultz RM. 2008. CDC2A (CDK1)-mediated phosphorylation of MSY2 triggers maternal mRNA degradation during mouse oocyte maturation. Developmental Biology 321:205–215. Meirelles FV, Caetano AR, Watanabe YF, Ripamonte P, Carambula SF, Merighe GK, Garcia SM. 2004. Genome activation and developmental block in bovine embryos. Animal Reproduction Science 82-83:13–20. Memili E, Dominko T, First NL. 1998. Onset of transcription in bovine oocytes and preimplantation embryos. Molecular Reproduction and Development 51:36–41. Miller L. 2011. Analyzing gels and Western blots with ImageJ. Available Online: httplukemiller.orgindex.phpanalyzing-gels-and-western-blots-with-image-j. [accessed 2015 Nov 20]

162

Moutaoufik MT, Fatimy El R, Nassour H, Gareau C, Lang J, Tanguay RM, Mazroui R, Khandjian EW. 2014. UVC-induced stress granules in mammalian cells. PLoS ONE 9:e112742. Mtango NR, Potireddy S, Latham KE. 2009. Expression of microRNA processing machinery genes in rhesus monkey oocytes and embryos of different developmental potentials. Molecular Reproduction and Development 76:255–269. Nguyen-Chi M, Morello D. 2011. RNA-binding proteins, RNA granules, and gametes: is unity strength? Reproduction 142:803–817. Nolze A, Schneider J, Keil R, Lederer M, Huttelmaier S, Kessels MM, Qualmann B, Hatzfeld M. 2013. FMRP regulates actin filament organization via the armadillo protein p0071. RNA 19:1483–1496. Okray Z, de Esch CE, Van Esch H, Devriendt K, Claeys A, Yan J, Verbeeck J, Froyen G, Willemsen R, de Vrij FM, et al. 2015. A novel fragile X syndrome mutation reveals a conserved role for the carboxy-terminus in FMRP localization and function. EMBO Molecular Medicine 7:423–437. Paradis FO, Vigneault C, Robert C, Sirard M-A. 2004. RNA interference as a tool to study gene function in bovine oocytes. Molecular Reproduction and Development 70:111– 121. Persani L, Rossetti R, Cacciatore C. 2010. Genes involved in human premature ovarian failure. Journal of Molecular Endocrinology 45:257–279. Persani L, Rossetti R, Cacciatore C, Bonomi M. 2009. Primary ovarian insufficiency: X chromosome defects and autoimmunity. Journal of Autoimmunity 33:35–41. Pretto DI, Mendoza-Morales G, Lo J, Cao R, Hadd A, Latham GJ, Durbin-Johnson B, Hagerman R, Tassone F. 2014. CGG allele size somatic mosaicism and methylation in FMR1 premutation alleles. Journal of Medical Genetics 51:309–318. Rif M, Nadal A, Mil M, Willemsen R. 2003. Immunohistochemical FMRP studies in a full mutated female fetus. American Journal of Medical Genetics 124A:129–132. Robert C, Nieminen J, Dufort I, Gagné D, Grant JR, Cagnone G, Plourde D, Nivet A-L, Fournier E, Paquet É, et al. 2011. Combining resources to obtain a comprehensive survey of the bovine embryo transcriptome through deep sequencing and microarrays. Molecular Reproduction and Development 78:651–664.

163

Rousseau F, Rouillard P, Morel ML, Khandjian EW, Morgan K. 1995. Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome. American Journal of Human Genetics 57:1006–1018. Scantland S, Grenon J-P, Desrochers M-H, Sirard M-A, Khandjian EW, Robert C. 2011. Method to isolate polyribosomal mRNA from scarce samples such as mammalian oocytes and early embryos. BMC Developmental Biology 11:8. Schnorrer F, Bohmann K, Nüsslein-Volhard C. 2000. The molecular motor dynein is involved in targeting swallow and bicoid RNA to the anterior pole of Drosophila oocytes. Nature Cell Biology 2:185–190. Schultz RM. 2002. The molecular foundations of the maternal to zygotic transition in the preimplantation embryo. Human Reproduction Update 8:323–331. Shahbabian K, Chartrand P. 2011. Control of cytoplasmic mRNA localization. Cellular and Mollecular Life Sciences 69:535–552. Sherman SL, Curnow EC, Easley CA, Jin P, Hukema RK, Tejada MI, Willemsen R, Usdin K. 2014. Use of model systems to understand the etiology of fragile X-associated primary ovarian insufficiency (FXPOI). Journal of Neurodevelopmental Disorders 6:26. Sossin WS, Lacaille J-C. 2010. Mechanisms of translational regulation in synaptic plasticity. Current Opinion in Neurobiology 20:450–456. Takahashi N, Tarumi W, Itoh MT, Ishizuka B. 2015 Jun 2. The Stage- and Cell Type- Specific Localization of Fragile X Mental Retardation Protein in Rat Ovaries. Reproductive Sciences 1–6. Telford NA, Watson AJ, Schultz GA. 1990. Transition from maternal to embryonic control in early mammalian development: a comparison of several species. Molecular Reproduction and Development 26:90–100. Vigneault C. 2004. Transcription Factor Expression Patterns in Bovine In Vitro-Derived Embryos Priorto Maternal-Zygotic Transition. Biology of Reproduction 70:1701–1709. Vigneault C, McGraw S, Sirard M-A. 2009. Spatiotemporal expression of transcriptional regulators in concert with the maternal-to-embryonic transition during bovine in vitro embryogenesis. Reproduction 137:13–21.

164

Wang F, Zhang L, Zhang G-L, Wang Z-B, Cui X-S, Kim N-H, Sun S-C. 2014. WASH complex regulates Arp2/3 complex for actin-based polar body extrusion in mouse oocytes. Scientific Reports. 4:1–8. Wang JT, Smith J, Chen B-C, Schmidt H, Rasoloson D, Paix A, Lambrus BG, Calidas D, Betzig E, Seydoux G. 2014. Regulation of RNA granule dynamics by phosphorylation of serine-rich, intrinsically disordered proteins in C. elegans. Elife 3:e04591. Wittenberger MD, Hagerman RJ, Sherman SL, McConkie-Rosell A, Welt CK, Rebar RW, Corrigan EC, Simpson JL, Nelson LM. 2007. The FMR1 premutation and reproduction. Fertility and Sterility 87:456–465. Yang J, Medvedev S, Reddi PP, Schultz RM, Hecht NB. 2005. The DNA/RNA-binding protein MSY2 marks specific transcripts for cytoplasmic storage in mouse male germ cells. Proceedings of the National Academy of Sciences 102:1513–1518. Yu J, Hecht NB, Schultz RM. 2001. Expression of MSY2 in mouse oocytes and preimplantation embryos. Biology of Reproduction 65:1260–1270. Zheng D, Ezzeddine N, Chen CYA, Zhu W, He X, Shyu AB. 2008. Deadenylation is prerequisite for P-body formation and mRNA decay in mammalian cells. The Journal of Cell Biology 182:89–101.

165

4.9 Tables Table 4-1. Sequences for RT-qPCR and siRNA knockdown

Target Sequence RT-qPCR Reverse Primer Forward Primer GAPDH 5’CCA ACG TGT CTG TTG TGG ATC TGA 5’ GAG CTT GAC AAA GTG GTC GTT GAGA

FXR1 5’ TGT CTG CCA GTG AAG CAA CTG TGA 5’ ATT CTC ACC CGA ACC ACA CCA GAT

FXR2 5’ TCC TTG ACC CAC CCA GAT TTG ACA 5’ TAC GCC TTC TCA TCC ACC AGA CAA

FMRP 5’ TGG ATG CAG AGT TCA GGG AAG A 5’ GCA GGC GTA TCC TACT AA CTT TCG Microinjection Anti-sense Sense FMRP 5’ AAT TAC GTG GAC GAT TAT CTG CCT GTC TC 5’ AAC AGA TAA TCG TCC ACG TA ACCT GTC TC

FXR1 5’ AAT TCC AAG AAA CCT CTA GCC CCT GTC TC 5’ AAG GCT AGA GGT TTC TTG GA ACCT GTC TC

FXR2 5’ AAT GAG CTA ATC GAT GAA GAG CCT GTC TC 5’ AAC TCT TCA TCG ATT AGC TCA CCT GTC TC

166

Table 4-2. Developmental rates for knockdown of FMRP family proteins in early embryos

Treatment 2-cell 8-16-cell Morula Blastocyst Control 74.3 ± 3.7 49.0 ± 8.0 41.4 ± 7.2 34.8 ± 6.4 Neg. Inj. 74.4 ± 6.3 49.8 ± 7.9 41.7 ± 6.5 31.9 ± 5.5 FMRP 71.5 ± 5.0 43.7 ± 8.9 30.9 ± 3.7 14.4 ± 3.8* FXR1+FXR2 70.4 ± 8.6 44.3 ± 8.9 34.0 ± 8.1 20.6 ± 4.1* FMRP+FXR1+FXR2 74.58 ± 8.0 40.6 ± 4.2 29.2 ± 2.4* 12.9 ± 8.7* *indicates significant decrease in comparison to control group (p < 0.05)

167

4.10 Figures

Figure 4-1. Immunofluorescent detection of FMRP and 60s ribosomal protein L7 and their localization in the different stages of the developing follicle Ovarian tissue sections were labelled with anti-FMRP (green) and anti-L7 (red) antibodies. Follicles label strongly with FMRP while the entirety of the ovarian tissue shows strong L7 ribosomal protein staining.

168

Figure 4-2. Immunofluorescent detection of FMRP and YBX2 proteins and their localization in the different stages of the developing follicle Ovarian tissue sections were labeled with anti-FMRP (green) and anti YBX2 (red). The cells of the follicles label strongly for FMRP while only the oocyte’s cytoplasm shows labelling for MSY2.

169

Figure 4-3. Wholemount cumulus oocytes complexes in GV oocytes show FMRP (Green), L7 (Red) and YBX2 (Red) immunofluorescent localization F-actin in the TZPs labels with rhodamine phalloidin (red). L7 can be seen to overlay with FMRP in the oocyte and cumulus cells and their projections while, YBX2 is only found in the oocyte. All scale bars are 10 μm. CCs: Cumulus Cells, ZP: Zona Pellucida, Oo: Oocyte.

170

Figure 4-4. Transcript abundance of the fragile X family in oocytes and early embryos RNAseq results (A, C, E) provided patterns of expression for the transcripts of the FMRP, FXR1, and FXR2 transcripts across the different stages of early embryo development. The RT-qPCR results (B, D, F) follow a similar but not identical trend to the RNAseq across the same stages of development. qRT-PCR was also separated into total (black bars) and polyA RNA (white bars) quantification. The asterix (*) denotes significant differences from the GV stage transcript abundance (p < 0.05).

171

Figure 4-5. Immunolabelling of FMRP, FXR1 and FXR2 during development. A) Western blot of FMRP and its two associating proteins FXR1 and FXR2 detected protein expression of each in germinal vesicle stage and metaphase two oocytes, as well as in cleaved zygotes from 2-cells through to the blastocyst stage. B) Relative protein abundance of FMRP, FXR1, and FXR2 during early embryonic development

172

173

174

Figure 4-6. Knockdown of FMRP family transcripts and protein abundance A-C) RT-qPCR data indicates a significant depletion of transcripts for FMRP, FXR1, and FXR2 respectively. Significant differences (marked with *) were found as early as the 2- cell stage, and persisted until morula and blastocyst stages (p < 0.05). All three transcripts were knocked down together and protein analysis on arrested morula, healthy morula, and blastocysts was performed. D) Western blots showing the few blastocysts that were produced expressed normal FMRP, but depleted FXR1, and FXR2. Morula showed depletion of all proteins E) Relative protein abundance comparison, normalized to actin is shown for the Western blot analysis.

175

General Summary The growing oocyte within the follicle behaves a bit like a sponge, soaking up considerable resources from the surrounding environment, and gaining stores that will support it through maturation, fertilization, and embryogenesis. In the primary follicle, the oocyte uses endocytosis to import lipids and proteins from its surroundings and the same mechanisms seem to exist in later follicular stages (Grant and Hirsh 1999; Lowther et al. 2011; Paulini et al. 2014). Coated pits are present in the oocytes’ membrane during growth and maturation phases (Hyttel et al. 1997) indicating the need and continued import of materials. Ultimately, the oocyte nearly doubles in diameter from the re-initiation of growth to the outset of maturation. This growth amounts to an increase of well over 5 x greater volume from 180 000 μm3 for a 70 μm diameter oocyte, to 905 000 μm3 for an oocyte of 120 μm diameter. Considerable effort has been made to characterize small molecule signalling between the cumulus cells and the oocyte, but large molecule transfer has largely remained unstudied (Sutton-McDowall et al. 2010; Scantland et al. 2014). Our goals were to characterize the intercellular connections and to explore the potential for large molecule signalling between the cumulus cells and the oocyte, and then assess any contribution this signalling might have on maturation if found present, and finally to look into the mechanisms responsible. In light of other species development (Wolke et al. 2007), new findings in intercellular signalling carrying RNA between cells (Dinger et al. 2008; Takahashi et al. 2014), and some of our own preliminary results, we hypothesized that RNA was a part of the cargo being transferred.

We began our investigations with structural and ultrastructural evaluation of the TZPs that bridge the cumulus cells and the oocyte, and revealed vesicles in between the membranes of the cumulus cell TZPs and the oocyte membrane. Further investigation revealed that the connectivity between the cumulus cells and the oocyte ended around the time of GVBD. This observation left us with two questions: what cargo do these vesicles carry, and do they have a significant impact upon oocyte maturation?

At the same time we began exploring the different transcript populations present in GV and MII oocytes. RNAseq allowed us to take a broad survey of these two stages and identified

177

a number of transcripts increasing in abundance during maturation. This result was highly counter-intuitive given previous literature that explains how full size oocytes from 3mm follicles or greater in size are transcriptionally inactive because of highly condensed chromatin formations (Fair et al. 1997; Lodde et al. 2008). We then wanted to identify where populations of RNA were found within the COCs, so a number of RNA staining techniques were employed with confocal microscopy to show that nascent and total RNA transcripts accumulated in the projections. Live cell imaging even allowed us to track RNA granules moving into and along the TZPs. We did see bidirectional movement within the projections an occurrence similar to movement in neurons, but about twice as many granules were moving towards the oocyte rather than away from it. It may be that the oocyte is able to send transcripts back to the cumulus cells, however, considering the number of cumulus cells and their role supporting the growing and maturing oocyte, it would seem much more logical that the eggs requirements merit considerable support from the cumulus cells and that transfer of materials particularly of RNA, is biased in the direction of the oocyte. The oocyte secreted factors (OSFs) certainly indicate the oocyte is active in communicating and coordinating with the cumulus cells, however, if transcripts are transferred back to the cumulus cells, they would arise prior to oocyte transcriptional arrest limiting how responsive this form of communication might be. Unfortunately, our resolution with the confocal microscope in the live cell system does not allow us to resolve the transference of this RNA across the membrane into the oocyte due to interference and the projections being irregular in the pathway to the oocyte.

After identifying these transcripts in the TZPs, we proceeded to label and isolate nascent transcripts from the TZPs that allowed identification of potential transcripts being transferred to the oocyte. This list was compared with those found increasing in the oocyte during maturation, and also to transcripts isolated from the polyribosomes in the oocytes at GV and MII stages. A number of transcripts were found common to all criteria suggesting transfer and accumulation of transcripts in the oocyte along with their use by the oocyte for translation into protein. If this work were to be expanded upon, it would be interesting to label nascent transcripts in cumulus cells in primary culture independently of the oocytes, allow for reconnection with the oocytes to occur. Then follow through with evaluation of

178

the oocyte’s polyribosomes and the nascently produced, transferred, and incorporated transcripts could be completed. This would rule out doubt that the oocyte itself is transcriptionally active, and would identify transfer and usage of specific transcripts by the oocyte.

During in vitro culture with live-cell imaging we observed some of the cumulus cells forming long projections with other cells and oocytes. Thinking this might be something we could take advantage of, the cumulus cells from a pool of oocytes were striped and put into primary culture so they could be transfected with a plasmid coding a known RNA binding protein, FMRP. This protein is well known for RNA granule formation and localization in neurons. The plasmid also coded a GFP sequence allowing us to detect both the transcript by qRT-PCR, and the protein by confocal microscopy. Upon reconstruction of these transfected cumulus cells with the oocyte the projections reformed and both the GFP transcript and protein were found in the oocyte. Whether the transcript was transferred and then translated, or both the transcript and protein were transferred remains in question, however, to accomplish this a form of large molecule transfer like the vesicles we found would be required. Interestingly this may explain, at least in part some other observations where denuded oocyte co-culture with COCs aided the developmental potential of the denuded oocytes (Luciano et al. 2005). Similarly where oocytes were placed into cumulus clouds and gap junctions re-established (Feng et al. 2012). It is possible that reforming projections, even temporarily would support oocyte competence, however in these experiments there are also cumulus cells secreted factors that would help the oocyte improve in quality.

We wished to determine if vesicle mediated transfer of RNA could influence oocyte maturation. We selected a number of commonly used inhibitors against transcription (alpha amanitin), granule transport (vanadate, EHNA), and vesicle formation (MDC, FTY720) to see what impact could be seen on oocyte maturation. Nearly every inhibitor used prevented oocyte maturation significantly in COCs. The effects of these inhibitors acted on denuded oocytes in a very similar way. We believe that the transcripts were already accumulated in the projections, and knew that the TZPs could not have been

179

removed with the cumulus cells. Ultimately, transcripts left in the TZPs retained their functionality, and the transfer to the oocyte occurred.

To confirm our suspicions that transcripts would be present before the outset of oocyte maturation, we explored RNA transfer in the context of previous observations related to intra-follicular pre-maturation of the oocyte (Blondin et al. 1995). We found that the TZPs became enriched with RNA during the hours post slaughter with the number of TZPs bearing RNA increasing significantly between 0 hours post slaughter and 4 hours post slaughter in accordance with the previous observations of oocyte competence acquisition. This may be a means for the corona cells to prepare themselves for oocyte maturation by bringing the required transcripts into the projections to implement signals to the oocyte. To build on this experiment, we removed both the cumulus cells and the period of oocyte pre- maturation or both, from the oocytes. The effect was additive in that removal of either the intra-follicular pre-maturation period or the cumulus cells decreased rates of oocyte maturation, while the removal of both resulted in even further decreased rates.

Considering what occurs to a tissue upon removal from the animal may help identify why this intra-follicular pre-maturation occurs. Loss of circulation and continued metabolism in the tissues may result in elevated levels of reactive oxygen species, nitric oxide (NO), and metabolic waste products that would cause stress in the ovary (Van Blerkom et al. 1997). Reactive oxygen species have been shown to be beneficial to oocytes during the onset of maturation with superoxide exposure in the first hour resulting in an increase in ensuing embryonic development (Blondin et al. 1997). They are also known to be required as a part of the downstream LH signalling pathway that results in ovulation and are capable of inducing cumulus cell muscification and expansion (Shkolnik et al. 2011). There is also evidence for the role of NO, a strong vasodilator that may be released by the ovarian cells in response to the loss of blood supply after removal from the cow, as a promoter of oocyte quality in small and mid-antral follicles (Tessaro et al. 2011). Interestingly, low levels of NO are positive to the developing follicle and oocyte helping drive meiotic progression, while higher levels appear to be detrimental to the oocyte (Bu et al. 2004). Such pathways

180

that mimic LH signalling may be plausible candidates to initiate cumulus cell large molecule transfer to the oocyte.

The next step was to implicate the potential involvement of RNA binding proteins that could be involved in the transference of RNA between cells. These proteins are already known to be critical to RNA management as they impose translational repression, and mediate RNA granule storage. As a part of our determination of mRNA in the projections we immunofluorescently labeled PABP and found it within the TZPs, cumulus cells, and oocyte, confirming our RNAseq results that polyA mRNA was in the projections. L7 ribosomal protein is best known for its role in translation (Hemmerich et al. 1993), but is also involved in RNA granules, and in neuronal granules is associated with FMRP. This protein was also found in all three compartments suggesting that the TZP could be a site of transcription, but also that RNA granule transport may arrive or originate there. We already used FMRP as a mechanism to transfer exogenous transcripts, and found it naturally present in all three cellular compartments, and that it closely associated with L7. Another protein of interest is YBX2. This protein is specific to oocyte RNA granules and is believed to be involved in transcript storage of the maternal program that governs early embryogenesis (Flemr et al. 2010). This protein closely associated with FMRP in the oocyte implicating FMRP with a role in RNA storage granules and involvement in the maternal program. These proteins are likely just a few of many that are involved in a great orchestration of RNA management in the cumulus oocyte complex, and it may be a considerable advantage to an oocyte to have a diverse population of RNABPs to store and temporally control the usage of the maternal program. The use of immunoprecipitation of the populations of granules followed by an RNAseq technique might help identify a critical subset of transcripts destined for the oocyte and may become a viable method of cumulus cells for determining egg quality. This method would be similar to work that has been done with FMRP granules in mouse brain extracts and is a process termed HITS-CLIP for high- throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (Darnell et al. 2011). Other knockdown studies in oocytes and early embryos against RNABPs will help identify further candidates of interest.

181

Finally, due to the potentially valuable nature of FMRP interactions in the COC taking on roles in RNA transport and translational control, we wanted to explore the impact of FMRP and its potential requirement to embryogenesis. Transcript expression analysis revealed a “U” shaped pattern of expression consistent with degradation over the course of maternal program utilization with renewed abundance occurring at the morula and blastocyst stages after EGA. The knockdown of the FMRP transcripts resulted in significantly decreased rates of embryo development. Combined knockdown of FMRP with its autologous FXR1 and FXR2 interacting proteins resulted in developmental blockage occurring at the morula stage. Protein levels were lower in the embryos after knockdown, and only FXR1 was found on the polyribosomes after the 8-cell stage when there is re-establishment of transcription prior to differentiation into the inner cell mass and trophectoderm. The knockdown prevention of embryogenesis at these stages indicated a need for FMRP protein function, and a larger need for translation control mechanisms at the stage when maternal RNA are no longer needed.

In these works, we placed considerable value on FMRP because of its RNA interactions, and also because of the primary ovarian insufficiency (POI) phenotype associated with carriers of the pre-expansion genotype. Interestingly the observation has been made that poor quality oocytes have an insufficient TZP network (de Bruin 2004; Coticchio et al. 2012). This is also true in polycystic ovarian syndrome (PCOS) oocytes where intermediate filaments are affected (Kenigsberg et al. 2008). In neurons FMRP is involved in distal translation control, and has a semaphorin 3A (SEMA 3A) responsive function for axonal outgrowth (Li 2009), and has been shown to modulate actin filaments in fibroblasts (Nolze et al. 2013). Recent evidence shows that SEMA 3A is influenced by ovarian hormones, and in turn affects the GnRH producing neurons of the hypothalamus (Giacobini et al. 2014). SEMA 3A affects the NRP1/2 (neurophilin) proteins to induce the outgrowth, and interestingly, VEGF also binds the same NRP proteins that result in synaptic maintenance (Tillo et al. 2014). NRP1 expression was found to increase in cumulus cells during FSH coasting protocols in cattle (Bunel et al. 2014) as well as in the granulosa cells (Nivet et al. 2013), possibly driving changes in cellular structure, but also acting in upstream of VEGF to alter angiogenesis in the follicle (Yamamizu et al. 2011; Tillo et al.

182

2014). It may be that hormonal regulation of follicle and COC dictates intercellular connectivity and communication by modulating the number of TZPs and other cellular outgrowths. It could be that signals causing follicular growth and vasculature remodelling in the ovary also enhance intercellular connectivity between the oocyte and cumulus cells to improve molecular and cytoplasmic maturation events. FSH has been shown to affect the expression of structural and transport genes (Grieshaber et al. 2003). Thought the literature is less expansive with respect to the effects on the cytoskeleton. Also increasing were maculae adherens connections between the oocyte and the follicle cells. That said, it has been shown that high concentrations of FSH decreased intercellular coupling (Moor et al. 1981). Granot and Dekel repeated these observations, and they added that LH decreased gap junction expression and trafficking (Granot and Dekel 2002). Smedt and Szollosi found that after 6-7 hours of maturation in sheep with FSH exposure that there were not intercellular junctions, however this was not the case in oocytes treated with cytochalasin D, a disrupter of actin filaments, suggesting a dependence upon proper cytoskeletal function within the oocyte is required (De Smedt and Szöllösi 1991). It may be that circulating hormone levels within the follicle could influence the disconnection between the cumulus cells and the oocyte, an occurrence we found in vitro to be around the time of GVBD (Granot and Dekel 2002).

183

Perspectives Our reports fit well with recent emerging concepts in intercellular communication implicating exosomes and microvesicle transfer of RNA between cells. In sperm we know that a number of their surface membrane proteins are collected from exosomes secreted in the epididymis, and that this affects their function (Caballero et al. 2013). In cancer cells exosomes carry miRNA to the circulation and can act as biomarkers or initiators if oncogenesis (Tang and Wong 2015). In the COC, there appears to be transfer of RNA from the cumulus cells to the oocyte, and the mechanisms that would support transfer when encumbered have a negative effect on maturation and may have further implications in later embryonic development. The role of RNABPs in managing RNA within the COCs appears to also have an impact on oocyte quality and embryogenesis.

The objectives of industry and research are to improve oocyte selection or competence to ensure the best potential reproductive outcomes. Vesicle secreted markers are being explored in the follicular fluid (da Silveira et al. 2012), but perhaps through micromanipulation vesicles could be collected from the pervitellin space for characterization, and be correlated to oocyte development.

Much investigation has been done with respect to “holding” oocytes from undergoing nuclear maturation, to allow the cytoplasmic compartment to “catch up” or “sync” for oocyte competence to be obtained. A good example of this is the SPOM system (Albuz et al. 2010). Oocytes were held with the inhibitor cilostimide, from undergoing nuclear maturation for several hours but allowing cytoplasmic maturation of the oocyte to continue. This was shown to improve oocyte competence, but oocytes were collected prior to the completion of the pre-maturation period (2-3 h post mortem). At this point the TZPs would be well, but not fully loaded with RNA. The SPOM results may help correct for what our findings of an intra-follicular pre-maturation period show to be a loading of TZPs with RNA for transfer to the oocyte. It would be interesting to see if utilization of the four-hour average time point post slaughter with the SPOM or similar nuclear maturation “holding” techniques could further improve quality, or if the pre-maturation was in fact the limiting requirement. In contrast, we could attempt to reversibly hold both the transfer of RNA with

185

one of the inhibitors we tested simultaneously with a nuclear maturation inhibitor, to see if optimizing RNA loading to the TZPs while preventing transfer for coordinated maturation resumption is necessary for oocyte competence. It appears likely that there is an appropriate level of synchrony between RNA transfer kinetics that is linked to optimal nuclear maturation.

In our research we evaluated the TZP RNA content in the zona pellucidas of COCs from 3- 6mm follicles matured in vitro. A valuable continuation of this work would be to assess the transcripts within large pre-ovulatory follicles, and also in follicles that have been hormonally stimulated, ie FSH coasting. Nascent transcript labelling at this phase would be difficult if no in vitro period for RNA labelling is present, though advances in laparoscopic surgery might allow for some form of labelled uridine insertion. Further analysis of the polyribosomal transcripts found in oocytes from preovulatory follicles and coasted follicles may also be a worthwhile comparison to make allowing for a more comprehensive transcriptome analysis to identify markers related to oocyte quality.

Another interesting occurrence related to our FMRP results was that optimal FSH coasting protocols produced medium sized follicles with significantly higher levels of FMRP transcript abundance in comparison the 3 mm follicle control groups (Labrecque et al. 2014). It may be that the accumulation of the transcript for this RNABP will aid in managing the maternal program. It would be interesting to find out if oocyte RNABP protein content increased between oocytes of different sized follicles, particularly in the dominant follicle. Understanding the diversity and quantity of RNABP protein content may indicate how well an oocyte is prepared to mature and undergo embryogenesis. If indeed these transcripts are being transferred from the CCs, it may be possible to non- invasively evaluate the preparedness of the oocyte to develop by evaluating the cumulus cells, or the content of the RNA present within the TZPs.

The cumulus cells being able to re-establish connections with the oocyte is a very interesting finding in itself. This technique could be adapted to create a feeder layer, or cellular supplement to oocyte maturation by providing more specific resources to the

186

oocyte, and could be used to try and rescue less competent oocytes by improving maturation. Other methods of material delivery besides plasmid transfection could also be optimized. Electroporation, optical transfection, or synthetic exosomal delivery of material to a population of cumulus cells could be carried out prior to COC reconstruction. Of course transgenic models could be used and cells mixed with oocytes of non-transgenic animals for further reconstruction work and possibly in combination with photo-activated proteins to allow live cell and localization study.

The field of intercellular RNA signalling is still young, but its implications thus far have been profound with links in the propagation of cancer, viral transmittance, and in RNA interference (Belting and Wittrup 2008; Pegtel et al. 2010). Nanotubules between cells have been shown to carry a diversity of materials including organelles and RNA between cells (Gerdes and Carvalho 2008; Hurtig et al. 2010; Abounit and Zurzolo 2012; Marzo et al. 2012). Extracellular vesicles also achieve the same end carrying RNA between cells and have been found in nearly every fluid of the body including the follicular and seminal fluids (Valadi et al. 2007; da Silveira et al. 2012; Caballero et al. 2013). The realization that these vesicles are involved in diseases lead to the development of vesicle mediated technology for research and therapeutics and several studies have attempted to restore function to cell models or limit various disease progression like cancer (Andaloussi et al. 2013; Gutiérrez- Vázquez et al. 2013; Suntres et al. 2013). Certainly this research places RNA as an endocrine molecule, a cause of cellular pathology, and a potential therapeutic. Given the behaviour of the cumulus cells in culture, they may prove an excellent model for the study of micro and nanotubule interconnectivity as well as provide clues about intercellular vesicle function.

The realization that this form of intercellular signalling exists invites us to re-assess our knowledge of what it required by the oocyte to become capable of maturation and develop. In light of our findings further experiments could be carried out evaluating RNA and protein content changes during IVM with respect to vesicular mediated RNA transfer. Further exploration would ultimately improve our understanding of exogenous transcriptional support directed to the oocyte in the current context of maturation helping to

187

understand these subtle yet critical contributions to the quality of the oocyte and ultimately the embryo.

188

Appendix 1. Supplemental figures for chapter two.

Supplemental Figure 2-1. Controls for fluorescent staining and immunofluorescent protocols (A) RNAse treatments of oocytes stained for total RNA. Overlay of bright field and fluorescent images. Only two cells display green RNA fluorescence signal (arrows). (B) Controls for de novo synthesized RNA study: (I) RNAse eliminated the staining (green), with membranes (red) and DNA (blue), (II) technical control without incorporation of ethyl-uridine into RNA with membrane (red) and DNA (blue) staining. (C) Overlay of bright field and fluorescent images for RNAse treated poly-A RNA-ISH staining eliminates the green RNA signal.

189

(D) Controls for immunofluorescence include: (I) non-immune IgG control with membrane counterstain (red), and (II) The absence of any primary antibody counterstained for membranes (red). All scale bars are 20 µm.

Supplemental Figure 2-2. Enucleation of oocytes and isolation of zona pellucida for de novo RNA pulldown and RNA-seq (A) Hemisectioning of COCs to remove the oocyte nuclear material using Hoechst as a DNA stain. (B) Zona pellucida clean-up prior to RNA extraction for RNA-seq also using Hoechst allows the removal of contamination down to a single nucleus (arrow). Magnification in (A) and (B): 100x

190

Supplemental Table 2-1. RT q-PCR and PCR primer sequences

Primer Sequences Annealing Acquisition Genes Forward Primer Reverse Primer (°C) (°C) 5’-3’ 5’-3’

AFF4 CTGAAGCCCAGCAGTAAA GGTGTATGAATAGCCGTTAGAG 54 80

KIF5B GCCTCTAAGGAAGAAGTAAAGG CTTGCTAAACTTGCCGATTCC 53 79

RASL11B CAGCGAGAACTACGAAGATGTG AAAAGGAGATGAGTCAAGCAGC 56 88

(Extension°C)

GFP GCAGAAGAACGGCATCAAGGTGAA TGGGTGCTCAGGTAGTGGTTGT 59 72

Beta Actin ATCGTCCACCGCAAATGCTTCT GCCATGCCAATCTCATCTCGTT 59 72

191

Supplemental Table 2-2. Top 100 RNA found in the TZP ranked by FPKM. TZPs_ RNA Description FPKM Bos taurus ferritin, heavy polypeptide 1 (FTH1), mRNA. 97.97 Bos taurus glutathione S-transferase alpha 3 (GSTA3), mRNA. 96.84 Bos taurus nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), 96.61 mRNA. Bos taurus family with sequence similarity 26, member D (FAM26D), 96.55 Bos taurus 28S ribosomal RNA (RN28S1), ribosomal RNA. 94.97 Bos taurus cellular retinoic acid binding protein 2 (CRABP2), mRNA. 94.82 PREDICTED: Bos taurus uncharacterized LOC100296593 (LOC100296593), 92.36 Bos taurus B-cell translocation gene 1, anti-proliferative (BTG1), 91.35 Bos taurus heat shock protein 90kDa alpha (cytosolic), class B 91.02 Bos taurus golgi reassembly stacking protein 2, 55kDa (GORASP2), 9.98 Bos taurus hook homolog 3 (Drosophila) (HOOK3), mRNA. 9.98 Bos taurus integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3), 9.95 mRNA. Bos taurus actinin, alpha 4 (ACTN4), mRNA. 9.95 Bos taurus vimentin (VIM), mRNA. 9.94 PREDICTED: Bos taurus cytoskeleton-associated protein 4, transcript variant 9.94 2 (CKAP4), mRNA. Bos taurus ubiquitin-conjugating enzyme E2, J1, U (UBE2J1), mRNA. 9.92 Bos taurus heat shock transcription factor 1 (HSF1), mRNA. 9.90 Bos taurus reticulon 4 (RTN4), transcript variant 2, mRNA. 9.88 Bos taurus chloride intracellular channel 2 (CLIC2), mRNA. 9.87 Bos taurus phosphofructokinase, liver (PFKL), mRNA. 9.87 Bos taurus family with sequence similarity 32, member A (FAM32A), 9.87 Bos taurus phosphatidylinositol glycan anchor biosynthesis, class C (PIGC), 9.86 mRNA. Bos taurus ATPase, Ca++ transporting, plasma membrane 1 (ATP2B1), 9.86 Bos taurus karyopherin (importin) beta 1 (KPNB1), mRNA. 9.84 Bos taurus ribosomal protein L23a (RPL23A), mRNA. 9.80 Bos taurus activity-dependent neuroprotector homeobox (ADNP), mRNA. 9.79 Bos taurus torsin A interacting protein 2 (TOR1AIP2), transcript 9.79

192

Bos taurus proteasome (prosome, macropain) subunit, beta type, 2 (PSMB2), 9.78 mRNA. Bos taurus family with sequence similarity 168, member B (FAM168B), 9.78 Bos taurus zinc finger protein 24 (ZNF24), mRNA. 9.77 PREDICTED: Bos taurus protein phosphatase, EF-hand calcium binding 9.76 domain 1 (PPEF1), mRNA. Bos taurus glutamate-ammonia ligase (GLUL), mRNA. 9.76 PREDICTED: Bos taurus WW and C2 domain containing 2 (WWC2), mRNA. 9.75 Bos taurus splicing factor 3b, subunit 5, 10kDa (SF3B5), mRNA. 9.74 Bos taurus high mobility group box 2 (HMGB2), mRNA. 9.74 Bos taurus ATX1 antioxidant protein 1 homolog (yeast) (ATOX1), 9.72 Bos taurus cell division cycle associated 8 (CDCA8), mRNA. 9.71 PREDICTED: Bos taurus deleted in colorectal carcinoma (DCC), mRNA. 9.71 Bos taurus farnesyl diphosphate synthase (FDPS), mRNA. 9.71 PREDICTED: Bos taurus chordin-like 1 (CHRDL1), mRNA. 9.70 Bos taurus ADP-ribosylation factor 4 (ARF4), mRNA. 9.69 Bos taurus ERGIC and golgi 3 (ERGIC3), mRNA. 9.69 PREDICTED: Bos taurus ectonucleoside triphosphate diphosphohydrolase 7 9.68 (ENTPD7), mRNA. PREDICTED: Bos taurus La ribonucleoprotein domain family, member 1 9.68 (LARP1), mRNA. Bos taurus protein phosphatase 2, regulatory subunit A, alpha (PPP2R1A), 9.67 mRNA. Bos taurus histone deacetylase 6 (HDAC6), mRNA. 9.67 Bos taurus glutamate receptor, ionotropic, kainate 2 (GRIK2), mRNA. 9.66 Bos taurus interferon induced transmembrane protein 1 (9-27) (IFITM1), 9.66 transcript variant 1, mRNA. PREDICTED: Bos taurus methyltransferase like 20 (METTL20), mRNA. 9.66 Bos taurus AF4/FMR2 family, member 4 (AFF4), mRNA. 9.66 Bos taurus eukaryotic translation initiation factor 4E (EIF4E), 9.63 Bos taurus putative ISG12(a) protein (IFI27), mRNA. 9.62 Bos taurus FK506 binding protein 4, 59kDa (FKBP4), mRNA. 9.62 Bos taurus proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 9.62 (PSMD14), mRNA. Bos taurus slit homolog 3 (Drosophila) (SLIT3), mRNA. 9.61

193

Bos taurus ectodermal-neural cortex 1 (with BTB-like domain) (ENC1), 9.60 mRNA. Bos taurus GATA zinc finger domain containing 2A (GATAD2A), mRNA. 9.60 Bos taurus zinc finger protein 397 (ZNF397), mRNA. 9.59 PREDICTED: Bos taurus ankyrin repeat domain 26-like (LOC507891), 9.58 Bos taurus carbonyl reductase 1 (CBR1), mRNA. 9.57 Bos taurus RAB10, member RAS oncogene family (RAB10), mRNA. 9.56 Bos taurus SWI/SNF related, matrix associated, actin dependent regulator of 9.56 chromatin, subfamily a, member 4 (SMARCA4), mRNA. Bos taurus triple functional domain (PTPRF interacting) (TRIO), 9.56 Bos taurus karyopherin alpha 7 (importin alpha 8) (KPNA7), mRNA. 9.54 Bos taurus cAMP responsive element modulator (CREM), mRNA. 9.52 PREDICTED: Bos taurus hydroxysteroid (17-beta) dehydrogenase 1-like 9.52 (HSD17B1), mRNA. Bos taurus matrin 3 (MATR3), mRNA. 9.52 Bos taurus SLAIN motif family, member 2 (SLAIN2), mRNA. 9.52 Bos taurus high mobility group box 1 (HMGB1), mRNA. 9.52 Bos taurus charged multivesicular body protein 2A (CHMP2A), mRNA. 9.50 Bos taurus bone morphogenetic protein 15 (BMP15), mRNA. 9.50 Bos taurus COX14 cytochrome c oxidase assembly homolog (S. cerevisiae) 9.49 (COX14), nuclear gene encoding mitochondrial protein, Bos taurus phosphatidylinositol glycan anchor biosynthesis, class S (PIGS), 9.49 mRNA. Bos taurus NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 9.49 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, Bos taurus sirtuin 1 (SIRT1), mRNA. 9.49 Bos taurus fizzy/cell division cycle 20 related 1 (Drosophila) (FZR1), mRNA. 9.48 Bos taurus chloride channel CLIC-like 1 (CLCC1), mRNA. 9.47 Bos taurus histone cluster 1, H2bk (HIST1H2BN), mRNA. 9.47 Bos taurus parkinson protein 7 (PARK7), mRNA. 9.47 Bos taurus translocation associated membrane protein 2 (TRAM2), 9.46 Bos taurus Ewing sarcoma breakpoint region 1 (EWSR1), mRNA. 9.45 Bos taurus BUD31 homolog (S. cerevisiae) (BUD31), mRNA. 9.44 Bos taurus praja ring finger 2 (PJA2), mRNA. 9.44 Bos taurus brain protein I3 (BRI3), mRNA. 9.43

194

Bos taurus myeloid leukemia factor 2 (MLF2), mRNA. 9.43 PREDICTED: Bos taurus RAB GTPase activating protein 1-like 9.43 (RABGAP1L), mRNA. Bos taurus GTP binding protein 1 (GTPBP1), mRNA. 9.41 PREDICTED: Bos taurus olfactory receptor, family 5, subfamily D, member 9.40 13-like (LOC100297422), mRNA. Bos taurus oculocerebrorenal syndrome of Lowe (OCRL), mRNA. 9.36 Bos taurus NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 9.35 8kDa (NDUFAB1), nuclear gene encoding mitochondrial Bos taurus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa 9.35 (NDUFA1), nuclear gene encoding mitochondrial protein, mRNA. Bos taurus destrin (actin depolymerizing factor) (DSTN), mRNA. 9.35 Bos taurus SEC11 homolog A (S. cerevisiae) (SEC11A), mRNA. 9.34 PREDICTED: Bos taurus Golgi to ER traffic protein 4 homolog 9.34 (LOC100847639), mRNA. Bos taurus superoxide dismutase 1, soluble (SOD1), mRNA. 9.33 Bos taurus tetratricopeptide repeat domain 27 (TTC27), mRNA. 9.32 Bos taurus translocase of inner mitochondrial membrane 8 homolog B (yeast) 9.30 (TIMM8B), nuclear gene encoding mitochondrial protein, Bos taurus proline-rich coiled-coil 2A (PRRC2A), mRNA. 9.29 PREDICTED: Bos taurus nephronectin, transcript variant 4 (NPNT), 9.29 Bos taurus APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), 9.28 mRNA.

195

Appendix 2. Supplemental figures for chapter three

Supplemental Figure 3-1. RNAse treatment controls for fluorescent EUincorporation assay used to detect nascent RNA and for SytoRNA Select binding used to detect total RNA. Also fixed and unstained control testing for autofluorescence.

196

Supplemental Figure 3-2. Assesment of background level for [3H]-uridine incorporation assay using an autoradiographic negative slide exposed for silver bromide grain deposition.

197

Supplemental Table 3-1. List of all transcripts found in the TZPs and also associated to the oocyte’s translational machinery.

MainRNA_Refseq MainRNA_Symbol MainRNA_Desc PREDICTED: Bos taurus listerin E3 ubiquitin protein ligase 1 (LTN1), transcript variant X1, XM_005201120 LTN1 mRNA. NM_001192509 LTN1 Bos taurus listerin E3 ubiquitin protein ligase 1 (LTN1), mRNA. XM_002684708 TBC1D23 PREDICTED: Bos taurus TBC1 domain family, member 23 (TBC1D23), XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XM_005201392 KIAA0226 PREDICTED: Bos taurus KIAA0226 ortholog (KIAA0226), transcript XM_003581707 SENP5 PREDICTED: Bos taurus SUMO1/sentrin specific peptidase 5 (SENP5), XM_002684824 SENP5 PREDICTED: Bos taurus SUMO1/sentrin specific peptidase 5 (SENP5), NM_001035392 PPP1R2 Bos taurus protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), mRNA. NM_001035392 PPP1R2 Bos taurus protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), mRNA. NM_001035392 PPP1R2 Bos taurus protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2), mRNA. XR_233337 LOC101907353 PREDICTED: Bos taurus uncharacterized LOC101907353 (LOC101907353), XM_005201660 ZMAT3 PREDICTED: Bos taurus zinc finger, matrin-type 3 (ZMAT3), XM_005208073 ART3 PREDICTED: Bos taurus ADP-ribosyltransferase 3 (ART3), transcript XM_005201894 XRN1 PREDICTED: Bos taurus 5'-3' exoribonuclease 1 (XRN1), transcript NM_001192153 EAF1 Bos taurus ELL associated factor 1 (EAF1), mRNA. NM_001192153 EAF1 Bos taurus ELL associated factor 1 (EAF1), mRNA. NM_174298 CXADR Bos taurus coxsackie virus and adenovirus receptor (CXADR), mRNA. PREDICTED: Bos taurus CGG triplet repeat-binding protein 1-like (LOC100851231), XM_003581673 LOC100851231 transcript variant 1, mRNA. PREDICTED: Bos taurus CGG triplet repeat-binding protein 1-like (LOC100851231), XM_003581673 LOC100851231 transcript variant 1, mRNA. PREDICTED: Bos taurus CGG triplet repeat-binding protein 1-like (LOC100851231), XM_003581673 LOC100851231 transcript variant 1, mRNA. PREDICTED: Bos taurus CGG triplet repeat-binding protein 1-like (LOC100851231), XM_003581673 LOC100851231 transcript variant 1, mRNA. NM_001191137 CGGBP1 Bos taurus CGG triplet repeat binding protein 1 (CGGBP1), mRNA. XM_005201339 KIAA1524 PREDICTED: Bos taurus KIAA1524 ortholog (KIAA1524), transcript XM_005201339 KIAA1524 PREDICTED: Bos taurus KIAA1524 ortholog (KIAA1524), transcript NM_001103284 KIAA1524 Bos taurus KIAA1524 ortholog (KIAA1524), mRNA. NM_001101310 GSK3B Bos taurus glycogen synthase kinase 3 beta (GSK3B), mRNA. PREDICTED: Bos taurus leishmanolysin-like (metallopeptidase M8 family) (LMLN), transcript XM_002684816 LMLN variant X1, mRNA. NM_001206577 TFRC Bos taurus transferrin receptor (p90, CD71) (TFRC), mRNA. XM_003581707 SENP5 PREDICTED: Bos taurus SUMO1/sentrin specific peptidase 5 (SENP5), XM_003581707 SENP5 PREDICTED: Bos taurus SUMO1/sentrin specific peptidase 5 (SENP5), NM_001034396 NCBP2 Bos taurus nuclear cap binding protein subunit 2, 20kDa (NCBP2), XM_005201810 MED12L PREDICTED: Bos taurus mediator complex subunit 12-like (MED12L), XM_003585701 SRPRB PREDICTED: Bos taurus signal recognition particle receptor, B subunit (SRPRB), mRNA.

198

PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_231044 LOC100848024 PREDICTED: Bos taurus uncharacterized LOC100848024 (LOC100848024), PREDICTED: Bos taurus erythrocyte membrane protein band 4.1 like 4A (EPB41L4A), XM_005211191 EPB41L4A transcript variant X1, mRNA. XM_005211340 PAPD4 PREDICTED: Bos taurus PAP associated domain containing 4 (PAPD4), XM_005211340 PAPD4 PREDICTED: Bos taurus PAP associated domain containing 4 (PAPD4), XM_005211251 GLCE PREDICTED: Bos taurus glucuronic acid epimerase (GLCE), transcript NM_001192392 SUPT16H Bos taurus suppressor of Ty 16 homolog (S. cerevisiae) (SUPT16H), NM_001102188 SGCB Bos taurus sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) (SGCB), mRNA. XM_005211625 LOC101905957 PREDICTED: Bos taurus proline-rich protein 24-like (LOC101905957), XM_001790629 CASC5 PREDICTED: Bos taurus cancer susceptibility candidate 5 (CASC5), XM_001790629 CASC5 PREDICTED: Bos taurus cancer susceptibility candidate 5 (CASC5), XM_001790629 CASC5 PREDICTED: Bos taurus cancer susceptibility candidate 5 (CASC5), XM_005211582 MGA PREDICTED: Bos taurus MAX gene associated (MGA), transcript variant XM_005211582 MGA PREDICTED: Bos taurus MAX gene associated (MGA), transcript variant XM_005211582 MGA PREDICTED: Bos taurus MAX gene associated (MGA), transcript variant NM_001191402 MGA Bos taurus MAX gene associated (MGA), mRNA. PREDICTED: Bos taurus mitogen-activated protein kinase binding protein 1 (MAPKBP1), XM_001255448 MAPKBP1 transcript variant X1, mRNA. NM_174496 ADAM10 Bos taurus ADAM metallopeptidase domain 10 (ADAM10), mRNA. NM_001113255 ARPP19 Bos taurus cAMP-regulated phosphoprotein, 19kDa (ARPP19), PREDICTED: Bos taurus cAMP-regulated phosphoprotein, 19kDa (ARPP19), transcript XM_005211788 ARPP19 variant X1, mRNA. PREDICTED: Bos taurus cAMP-regulated phosphoprotein, 19kDa (ARPP19), transcript XM_005211788 ARPP19 variant X1, mRNA. PREDICTED: Bos taurus cAMP-regulated phosphoprotein, 19kDa (ARPP19), transcript XM_005211788 ARPP19 variant X1, mRNA. NM_174705 ARPP19 Bos taurus cAMP-regulated phosphoprotein, 19kDa (ARPP19), XM_003586573 CEP152 PREDICTED: Bos taurus centrosomal protein 152kDa (CEP152), XM_005211897 CEP152 PREDICTED: Bos taurus centrosomal protein 152kDa (CEP152), NM_001101191 zinc transporter Bos taurus solute carrier family 39 (zinc transporter), member 9 XR_236252 LOC101905627 PREDICTED: Bos taurus uncharacterized LOC101905627 (LOC101905627),

199

XR_138783 LOC100848296 PREDICTED: Bos taurus uncharacterized LOC100848296 (LOC100848296), XR_138783 LOC100848296 PREDICTED: Bos taurus uncharacterized LOC100848296 (LOC100848296), PREDICTED: Bos taurus transmembrane emp24 protein transport domain containing 7 XM_005211176 TMED7 (TMED7), transcript variant X1, mRNA. PREDICTED: Bos taurus transmembrane emp24 protein transport domain containing 7 XM_005211176 TMED7 (TMED7), transcript variant X1, mRNA. PREDICTED: Bos taurus transmembrane emp24 protein transport domain containing 7 XM_005211176 TMED7 (TMED7), transcript variant X1, mRNA. NM_001105496 TMED7 Bos taurus transmembrane emp24 protein transport domain containing 7 (TMED7), mRNA. XM_005193572 SERINC5 PREDICTED: Bos taurus serine incorporator 5 (SERINC5), transcript XM_005193572 SERINC5 PREDICTED: Bos taurus serine incorporator 5 (SERINC5), transcript PREDICTED: Bos taurus retinitis pigmentosa GTPase regulator interacting protein 1 XM_005211466 RPGRIP1 (RPGRIP1), transcript variant X1, mRNA. XM_005211881 MAPK6 PREDICTED: Bos taurus mitogen-activated protein kinase 6 (MAPK6), XM_002706554 MAPK6 PREDICTED: Bos taurus mitogen-activated protein kinase 6 (MAPK6), NM_001075987 TMOD3 Bos taurus tropomodulin 3 (ubiquitous) (TMOD3), mRNA. NM_001075987 TMOD3 Bos taurus tropomodulin 3 (ubiquitous) (TMOD3), mRNA. NM_001075987 TMOD3 Bos taurus tropomodulin 3 (ubiquitous) (TMOD3), mRNA. XM_005212199 POMT2 PREDICTED: Bos taurus protein-O-mannosyltransferase 2 (POMT2), PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus non-SMC condensin I complex, subunit H (NCAPH), transcript XM_005212293 NCAPH variant X2, mRNA. PREDICTED: Bos taurus non-SMC condensin I complex, subunit H (NCAPH), transcript XM_005212294 NCAPH variant X3, mRNA. PREDICTED: Bos taurus non-SMC condensin I complex, subunit H (NCAPH), transcript XM_005212292 NCAPH variant X1, mRNA. XM_003586607 EIF5B PREDICTED: Bos taurus eukaryotic translation initiation factor 5B (EIF5B), mRNA. XM_003586607 EIF5B PREDICTED: Bos taurus eukaryotic translation initiation factor 5B (EIF5B), mRNA. NM_001192869 RAB11FIP5 Bos taurus RAB11 family interacting protein 5 (class I) (RAB11FIP5), mRNA. NM_001081591 SPAST Bos taurus spastin (SPAST), mRNA. XM_005212636 PAPOLG PREDICTED: Bos taurus poly(A) polymerase gamma (PAPOLG), transcript NM_001098066 PAPOLG Bos taurus poly(A) polymerase gamma (PAPOLG), mRNA. NM_174066 GGCX Bos taurus gamma-glutamyl carboxylase (GGCX), mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), PREDICTED: Bos taurus intraflagellar transport 172 homolog (Chlamydomonas) (IFT172), XM_003582802 IFT172 transcript variant X1, mRNA.

200

XM_864456 PUM2 PREDICTED: Bos taurus pumilio homolog 2 (Drosophila) (PUM2), XM_005193973 PUM2 PREDICTED: Bos taurus pumilio homolog 2 (Drosophila) (PUM2), XM_005193970 PUM2 PREDICTED: Bos taurus pumilio homolog 2 (Drosophila) (PUM2), NM_001144082 DAB2IP Bos taurus DAB2 interacting protein (DAB2IP), mRNA. NM_001206860 ABL1 Bos taurus c-abl oncogene 1, non-receptor tyrosine kinase (ABL1), NM_001206860 ABL1 Bos taurus c-abl oncogene 1, non-receptor tyrosine kinase (ABL1), XM_868350 PRRC2B PREDICTED: Bos taurus proline-rich coiled-coil 2B (PRRC2B), XM_868350 PRRC2B PREDICTED: Bos taurus proline-rich coiled-coil 2B (PRRC2B), XM_868350 PRRC2B PREDICTED: Bos taurus proline-rich coiled-coil 2B (PRRC2B), XM_868350 PRRC2B PREDICTED: Bos taurus proline-rich coiled-coil 2B (PRRC2B), XM_868350 PRRC2B PREDICTED: Bos taurus proline-rich coiled-coil 2B (PRRC2B), XM_003585149 LOC100850176 PREDICTED: Bos taurus transmembrane protein 127-like (LOC100850176), mRNA. NM_001034046 COX5B Bos taurus cytochrome c oxidase subunit Vb (COX5B), mRNA. NM_001034046 COX5B Bos taurus cytochrome c oxidase subunit Vb (COX5B), mRNA. XM_003586611 REV1 PREDICTED: Bos taurus REV1, polymerase (DNA directed) (REV1), mRNA. XM_003586611 REV1 PREDICTED: Bos taurus REV1, polymerase (DNA directed) (REV1), mRNA. XM_002691189 HK2 PREDICTED: Bos taurus hexokinase 2 (HK2), mRNA. XM_002691189 HK2 PREDICTED: Bos taurus hexokinase 2 (HK2), mRNA. XM_005193867 LOC101904937 PREDICTED: Bos taurus methylcytosine dioxygenase TET3-like (LOC101904937), mRNA. XM_005193867 LOC101904937 PREDICTED: Bos taurus methylcytosine dioxygenase TET3-like (LOC101904937), mRNA. XM_005212646 STRN PREDICTED: Bos taurus striatin, calmodulin binding protein (STRN), XM_005212646 STRN PREDICTED: Bos taurus striatin, calmodulin binding protein (STRN), PREDICTED: Bos taurus HEAT repeat-containing protein 5B-like (LOC540503), transcript XM_002691283 LOC540503 variant X1, mRNA. NM_001206209 CCDC88A Bos taurus coiled-coil domain containing 88A (CCDC88A), mRNA. NM_001035433 RPIA Bos taurus ribose 5-phosphate isomerase A (RPIA), mRNA. NM_001035433 RPIA Bos taurus ribose 5-phosphate isomerase A (RPIA), mRNA. NM_001101288 RAB10 Bos taurus RAB10, member RAS oncogene family (RAB10), mRNA. NM_001101288 RAB10 Bos taurus RAB10, member RAS oncogene family (RAB10), mRNA. NM_001101288 RAB10 Bos taurus RAB10, member RAS oncogene family (RAB10), mRNA. XR_138971 LOC100847863 PREDICTED: Bos taurus uncharacterized LOC100847863 (LOC100847863), NM_001081603 MAPKAP1 Bos taurus mitogen-activated protein kinase associated protein 1 (MAPKAP1), mRNA. PREDICTED: Bos taurus mitogen-activated protein kinase associated protein 1 (MAPKAP1), XM_005213141 MAPKAP1 transcript variant X2, mRNA. PREDICTED: Bos taurus mitogen-activated protein kinase associated protein 1 (MAPKAP1), XM_005213140 MAPKAP1 transcript variant X1, mRNA. NM_001080365 ARRDC1 Bos taurus arrestin domain containing 1 (ARRDC1), mRNA. XM_865470 LOC614107 PREDICTED: Bos taurus hexokinase 2-like (LOC614107), mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_001250798 LOC617406 (LOC617406), transcript variant 2, mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript

201

XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XM_866575 NEK11 PREDICTED: Bos taurus NIMA-related kinase 11 (NEK11), transcript NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. NM_001080332 DNAJC15 Bos taurus DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), NM_001080332 DNAJC15 Bos taurus DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), NM_001080332 DNAJC15 Bos taurus DnaJ (Hsp40) homolog, subfamily C, member 15 (DNAJC15), NM_001206537 COG3 Bos taurus component of oligomeric golgi complex 3 (COG3), mRNA. NM_001037817 IPO5 Bos taurus importin 5 (IPO5), mRNA. NM_001037817 IPO5 Bos taurus importin 5 (IPO5), mRNA. XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), NM_001038190 ARGLU1 Bos taurus arginine and glutamate rich 1 (ARGLU1), mRNA. PREDICTED: Bos taurus cytidine and dCMP deaminase domain containing 1 (CDADC1), XM_005213610 CDADC1 transcript variant X1, mRNA. Bos taurus solute carrier family 25 (mitochondrial carrier; ornithine transporter) member NM_001046326 SLC25A15 15 (SLC25A15), mRNA. Bos taurus solute carrier family 25 (mitochondrial carrier; ornithine transporter) member NM_001046326 SLC25A15 15 (SLC25A15), mRNA. XM_005194130 NBEA PREDICTED: Bos taurus neurobeachin (NBEA), transcript variant X2, PREDICTED: Bos taurus PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) XM_005213752 PAN3 (PAN3), transcript variant X2, mRNA. PREDICTED: Bos taurus PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) XM_005213754 PAN3 (PAN3), transcript variant X4, mRNA. PREDICTED: Bos taurus PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) XM_005213754 PAN3 (PAN3), transcript variant X4, mRNA. PREDICTED: Bos taurus PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) XM_003586703 PAN3 (PAN3), transcript variant X1, mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 12 (KCTD12), XM_005194182 KCTD12 mRNA. XR_227385 LOC100140518 PREDICTED: Bos taurus serine/threonine kinase 24-like (LOC100140518), misc_RNA. XM_005194228 ATP11A PREDICTED: Bos taurus ATPase, class VI, type 11A (ATP11A), PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XR_139187 LOC100337007 PREDICTED: Bos taurus zinc finger protein 347-like (LOC100337007), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), NM_001103275 ACOT11 Bos taurus acyl-CoA thioesterase 11 (ACOT11), mRNA.

202

XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. PREDICTED: Bos taurus integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen XM_005214148 ITGB1 CD29 includes MDF2, MSK12) (ITGB1), transcript Bos taurus integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes NM_174368 ITGB1 MDF2, MSK12) (ITGB1), mRNA. Bos taurus integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes NM_174368 ITGB1 MDF2, MSK12) (ITGB1), mRNA. XM_001789214 BEND7 PREDICTED: Bos taurus BEN domain containing 7 (BEND7), transcript NM_001076878 zinc transporter Bos taurus solute carrier family 39 (zinc transporter), member 12 NM_001015586 DSTN Bos taurus destrin (actin depolymerizing factor) (DSTN), mRNA. PREDICTED: Bos taurus core-binding factor, runt domain, alpha subunit 2; translocated to, XM_606138 CBFA2T2 2 (CBFA2T2), transcript variant X2, XM_005215047 NCOA3 PREDICTED: Bos taurus nuclear receptor coactivator 3 (NCOA3), XR_237142 LOC100847759 PREDICTED: Bos taurus uncharacterized LOC100847759 (LOC100847759), XR_226062 LOC100847759 PREDICTED: Bos taurus uncharacterized LOC100847759 (LOC100847759), PREDICTED: Bos taurus glycerophosphocholine phosphodiesterase GDE1 homolog (S. XM_002692364 GPCPD1 cerevisiae) (GPCPD1), transcript variant X1, mRNA. NM_001037587 GID8 Bos taurus GID complex subunit 8 homolog (S. cerevisiae) (GID8), XM_002692257 LOC529294 PREDICTED: Bos taurus protein LSM14 homolog B-like (LOC529294), XM_002692257 LOC529294 PREDICTED: Bos taurus protein LSM14 homolog B-like (LOC529294), PREDICTED: Bos taurus core-binding factor, runt domain, alpha subunit 2; translocated to, XM_606138 CBFA2T2 2 (CBFA2T2), transcript variant X2, XM_005214854 CPNE1 PREDICTED: Bos taurus copine I (CPNE1), transcript variant X2, NM_001099001 NFS1 Bos taurus NFS1 nitrogen fixation 1 homolog (S. cerevisiae) (NFS1), NM_001099001 NFS1 Bos taurus NFS1 nitrogen fixation 1 homolog (S. cerevisiae) (NFS1), PREDICTED: Bos taurus solute carrier family 12 (potassium/chloride transporter), member XM_005214640 SLC12A5 5 (SLC12A5), transcript variant X1, mRNA. PREDICTED: Bos taurus UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 XM_002692354 B4GALT5 (B4GALT5), mRNA. PREDICTED: Bos taurus UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 XM_002692354 B4GALT5 (B4GALT5), mRNA. PREDICTED: Bos taurus UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 XM_002692354 B4GALT5 (B4GALT5), mRNA. PREDICTED: Bos taurus UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 XM_002692354 B4GALT5 (B4GALT5), mRNA. PREDICTED: Bos taurus UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 XM_586129 B4GALT5 (B4GALT5), mRNA. XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. XM_005200861 GYG2 PREDICTED: Bos taurus glycogenin 2 (GYG2), transcript variant X1,

203

PREDICTED: Bos taurus cGG triplet repeat binding protein 1-like (LOC539802), transcript XM_611424 LOC539802 variant 1, mRNA. PREDICTED: Bos taurus centrosome and spindle pole associated protein 1 (CSPP1), XM_005215480 CSPP1 transcript variant X3, mRNA. NM_001038090 CYC1 Bos taurus cytochrome c-1 (CYC1), mRNA. XM_005215449 ASPH PREDICTED: Bos taurus aspartate beta-hydroxylase (ASPH), transcript XM_003583039 PDE7A PREDICTED: Bos taurus phosphodiesterase 7A (PDE7A), transcript NM_001099122 UBE2W Bos taurus ubiquitin-conjugating enzyme E2W (putative) (UBE2W), NM_001099122 UBE2W Bos taurus ubiquitin-conjugating enzyme E2W (putative) (UBE2W), Bos taurus smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG5), NM_001083679 SMG5 mRNA. Bos taurus smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG5), NM_001083679 SMG5 mRNA. NM_001206791 LRRCC1 Bos taurus leucine rich repeat and coiled-coil domain containing 1 (LRRCC1), mRNA. NM_001206791 LRRCC1 Bos taurus leucine rich repeat and coiled-coil domain containing 1 (LRRCC1), mRNA. NM_001206791 LRRCC1 Bos taurus leucine rich repeat and coiled-coil domain containing 1 (LRRCC1), mRNA. NM_001206791 LRRCC1 Bos taurus leucine rich repeat and coiled-coil domain containing 1 (LRRCC1), mRNA. PREDICTED: Bos taurus olfactory receptor, family 5, subfamily D, member 13-like XM_002707870 LOC100297422 (LOC100297422), mRNA. NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), Bos taurus DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) NM_001046012 DCUN1D5 (DCUN1D5), mRNA. NM_001098999 UBE4A Bos taurus ubiquitination factor E4A (UBE4A), mRNA. XM_005215840 UBE4A PREDICTED: Bos taurus ubiquitination factor E4A (UBE4A), transcript XM_005215917 BTBD10 PREDICTED: Bos taurus BTB (POZ) domain containing 10 (BTBD10), XM_005215931 SBF2 PREDICTED: Bos taurus SET binding factor 2 (SBF2), transcript NM_001103237 SBF2 Bos taurus SET binding factor 2 (SBF2), mRNA. PREDICTED: Bos taurus UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 XM_005194671 B3GNT6 (core 3 synthase) (B3GNT6), transcript variant X2, mRNA. XM_005216273 TCP11L1 PREDICTED: Bos taurus t-complex 11 (mouse)-like 1 (TCP11L1), PREDICTED: Bos taurus homeodomain interacting protein kinase 3 (HIPK3), transcript XM_005216297 HIPK3 variant X4, mRNA. PREDICTED: Bos taurus homeodomain interacting protein kinase 3 (HIPK3), transcript XM_005216295 HIPK3 variant X2, mRNA. NM_001144083 API5 Bos taurus apoptosis inhibitor 5 (API5), mRNA. NM_001144083 API5 Bos taurus apoptosis inhibitor 5 (API5), mRNA. XR_227422 LOC101908301 PREDICTED: Bos taurus uncharacterized LOC101908301 (LOC101908301),

204

XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XM_005216118 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XM_005216408 MTCH2 PREDICTED: Bos taurus mitochondrial carrier 2 (MTCH2), transcript XM_005216408 MTCH2 PREDICTED: Bos taurus mitochondrial carrier 2 (MTCH2), transcript XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XM_005198775 LOC100295951 PREDICTED: Bos taurus uncharacterized LOC100295951 (LOC100295951), XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XR_231044 LOC100848024 PREDICTED: Bos taurus uncharacterized LOC100848024 (LOC100848024), XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. NM_001035377 CEP170 Bos taurus centrosomal protein 170kDa (CEP170), mRNA. XM_005217032 SOAT1 PREDICTED: Bos taurus sterol O-acyltransferase 1 (SOAT1), NM_001034206 SOAT1 Bos taurus sterol O-acyltransferase 1 (SOAT1), mRNA. XM_005217031 SOAT1 PREDICTED: Bos taurus sterol O-acyltransferase 1 (SOAT1), NM_001192537 HMCN1 Bos taurus hemicentin 1 (HMCN1), mRNA. NM_001192537 HMCN1 Bos taurus hemicentin 1 (HMCN1), mRNA. NM_001192537 HMCN1 Bos taurus hemicentin 1 (HMCN1), mRNA. NM_001081612 ELK4 Bos taurus ELK4, ETS-domain protein (SRF accessory protein 1) (ELK4), mRNA. NM_001081612 ELK4 Bos taurus ELK4, ETS-domain protein (SRF accessory protein 1) (ELK4), mRNA. XM_002693867 anion exchanger PREDICTED: Bos taurus solute carrier family 26 (anion exchanger), XM_005216787 GPATCH2 PREDICTED: Bos taurus G patch domain containing 2 (GPATCH2), NM_001192199 RAB3GAP2 Bos taurus RAB3 GTPase activating protein subunit 2 (non-catalytic) (RAB3GAP2), mRNA. XM_005216862 ENAH PREDICTED: Bos taurus enabled homolog (Drosophila) (ENAH), XM_005216863 ENAH PREDICTED: Bos taurus enabled homolog (Drosophila) (ENAH), NM_001206010 thiamine transporter Bos taurus solute carrier family 19 (thiamine transporter), member NM_001206010 thiamine transporter Bos taurus solute carrier family 19 (thiamine transporter), member

205

NM_001206010 thiamine transporter Bos taurus solute carrier family 19 (thiamine transporter), member NM_001206010 thiamine transporter Bos taurus solute carrier family 19 (thiamine transporter), member NM_001206010 thiamine transporter Bos taurus solute carrier family 19 (thiamine transporter), member NM_001206010 thiamine transporter Bos taurus solute carrier family 19 (thiamine transporter), member NM_001040490 TNFRSF1B Bos taurus tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), mRNA. NM_001040490 TNFRSF1B Bos taurus tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), mRNA. NM_001206041 PHF13 Bos taurus PHD finger protein 13 (PHF13), mRNA. PREDICTED: Bos taurus spen homolog, transcriptional regulator (Drosophila) (SPEN), XM_002694139 SPEN mRNA. PREDICTED: Bos taurus spen homolog, transcriptional regulator (Drosophila) (SPEN), XM_591419 SPEN mRNA. PREDICTED: Bos taurus denticleless E3 ubiquitin protein ligase homolog (Drosophila) (DTL), XM_003583269 DTL mRNA. PREDICTED: Bos taurus CD46 molecule, complement regulatory protein (CD46), transcript XM_005217309 CD46 variant X1, mRNA. PREDICTED: Bos taurus CD46 molecule, complement regulatory protein (CD46), transcript XM_005217324 CD46 variant X16, mRNA. NM_001242564 CD46 Bos taurus CD46 molecule, complement regulatory protein (CD46), PREDICTED: Bos taurus CD46 molecule, complement regulatory protein (CD46), transcript XM_005217309 CD46 variant X1, mRNA. XM_003583275 ZBTB41 PREDICTED: Bos taurus zinc finger and BTB domain containing 41 (ZBTB41), mRNA. XR_227775 LOC101909063 PREDICTED: Bos taurus uncharacterized LOC101909063 (LOC101909063), XM_002697375 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. XR_083420 LOC510382 PREDICTED: Bos taurus guanylate-binding protein 6-like (LOC510382), XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. NM_001046362 PLRG1 Bos taurus pleiotropic regulator 1 (PLRG1), mRNA. NM_001046362 PLRG1 Bos taurus pleiotropic regulator 1 (PLRG1), mRNA. XM_005217603 ANKRD50 PREDICTED: Bos taurus ankyrin repeat domain 50 (ANKRD50), XM_005217603 ANKRD50 PREDICTED: Bos taurus ankyrin repeat domain 50 (ANKRD50), PREDICTED: Bos taurus calcium/calmodulin-dependent protein kinase kinase 2, beta XM_005217776 CAMKK2 (CAMKK2), transcript variant X1, mRNA. PREDICTED: Bos taurus calcium/calmodulin-dependent protein kinase kinase 2, beta XM_005217776 CAMKK2 (CAMKK2), transcript variant X1, mRNA. PREDICTED: Bos taurus ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (ATP2A2), XM_005217906 ATP2A2 transcript variant X1, mRNA. NM_001191430 ATP2A2 Bos taurus ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (ATP2A2), mRNA. XM_005218146 LIMK2 PREDICTED: Bos taurus LIM domain kinase 2 (LIMK2), transcript NM_001075959 SNAP29 Bos taurus synaptosomal-associated protein, 29kDa (SNAP29), mRNA. XM_005217449 RPS3A PREDICTED: Bos taurus ribosomal protein S3A (RPS3A), transcript XM_005217448 RPS3A PREDICTED: Bos taurus ribosomal protein S3A (RPS3A), transcript

206

NM_001034038 RPS3A Bos taurus ribosomal protein S3A (RPS3A), mRNA. XM_005217499 OABP PREDICTED: Bos taurus ATP-binding cassette, sub-family E (OABP), NM_001083685 OABP Bos taurus ATP-binding cassette, sub-family E (OABP), member 1 NM_001082454 CCRN4L Bos taurus CCR4 carbon catabolite repression 4-like (S. cerevisiae) (CCRN4L), mRNA. NM_001205855 INTU Bos taurus inturned planar cell polarity effector homolog (Drosophila) (INTU), mRNA. NM_001192191 PGAM5 Bos taurus phosphoglycerate mutase family member 5 (PGAM5), mRNA. XM_868214 BCL7A PREDICTED: Bos taurus B-cell CLL/lymphoma 7A (BCL7A), partial mRNA. XM_002694523 PXN PREDICTED: Bos taurus paxillin (PXN), transcript variant X1, mRNA. XM_002694523 PXN PREDICTED: Bos taurus paxillin (PXN), transcript variant X1, mRNA. XM_002694620 TTC28 PREDICTED: Bos taurus tetratricopeptide repeat domain 28 (TTC28), NM_001038210 ZMAT5 Bos taurus zinc finger, matrin-type 5 (ZMAT5), mRNA. XM_005218139 MORC2 PREDICTED: Bos taurus MORC family CW-type zinc finger 2 (MORC2), XM_005218139 MORC2 PREDICTED: Bos taurus MORC family CW-type zinc finger 2 (MORC2), XM_005218137 MORC2 PREDICTED: Bos taurus MORC family CW-type zinc finger 2 (MORC2), XM_005218137 MORC2 PREDICTED: Bos taurus MORC family CW-type zinc finger 2 (MORC2), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus potassium voltage-gated channel, Isk-related family, member 3 XM_005194661 KCNE3 (KCNE3), transcript variant X1, mRNA. XM_005195205 PAPD5 PREDICTED: Bos taurus PAP associated domain containing 5 (PAPD5), XM_005218718 CBFB PREDICTED: Bos taurus core-binding factor, beta subunit (CBFB), XM_005218718 CBFB PREDICTED: Bos taurus core-binding factor, beta subunit (CBFB), XM_005218718 CBFB PREDICTED: Bos taurus core-binding factor, beta subunit (CBFB), XM_005218718 CBFB PREDICTED: Bos taurus core-binding factor, beta subunit (CBFB), PREDICTED: Bos taurus solute carrier family 7 (amino acid transporter light chain, y+L XM_005218634 SLC7A6 system), member 6 (SLC7A6), transcript NM_001002763 CDH1 Bos taurus cadherin 1, type 1, E-cadherin (epithelial) (CDH1), NM_001002763 CDH1 Bos taurus cadherin 1, type 1, E-cadherin (epithelial) (CDH1), PREDICTED: Bos taurus PH domain and leucine rich repeat protein phosphatase 2 (PHLPP2), XM_005218644 PHLPP2 transcript variant X1, mRNA. PREDICTED: Bos taurus PH domain and leucine rich repeat protein phosphatase 2 (PHLPP2), XM_005218644 PHLPP2 transcript variant X1, mRNA. PREDICTED: Bos taurus PH domain and leucine rich repeat protein phosphatase 2 (PHLPP2), XM_005218644 PHLPP2 transcript variant X1, mRNA. XM_005219027 KIAA0355 PREDICTED: Bos taurus KIAA0355 ortholog (KIAA0355), transcript XM_005219027 KIAA0355 PREDICTED: Bos taurus KIAA0355 ortholog (KIAA0355), transcript XM_005219027 KIAA0355 PREDICTED: Bos taurus KIAA0355 ortholog (KIAA0355), transcript XM_003583454 ADM5 PREDICTED: Bos taurus adrenomedullin 5 (putative) (ADM5), mRNA. XM_003583454 ADM5 PREDICTED: Bos taurus adrenomedullin 5 (putative) (ADM5), mRNA. XM_005219283 PRMT1 PREDICTED: Bos taurus protein arginine methyltransferase 1 (PRMT1), NM_001015624 PRMT1 Bos taurus protein arginine methyltransferase 1 (PRMT1), mRNA.

207

XM_005219788 ZNF304 PREDICTED: Bos taurus zinc finger protein 304 (ZNF304), transcript XM_005219788 ZNF304 PREDICTED: Bos taurus zinc finger protein 304 (ZNF304), transcript XM_005195519 ZNF154 PREDICTED: Bos taurus zinc finger protein 154 (ZNF154), transcript NM_174800 CFDP2 Bos taurus craniofacial development protein 2 (CFDP2), mRNA. XM_005218347 BCNT2 PREDICTED: Bos taurus bucentaur-2 (BCNT2), transcript variant X3, XM_005218378 TMEM170A PREDICTED: Bos taurus transmembrane protein 170A (TMEM170A), PREDICTED: Bos taurus membrane-bound transcription factor peptidase, site 1 (MBTPS1), XM_005218389 MBTPS1 transcript variant X1, mRNA. PREDICTED: Bos taurus membrane-bound transcription factor peptidase, site 1 (MBTPS1), XM_005218389 MBTPS1 transcript variant X1, mRNA. PREDICTED: Bos taurus membrane-bound transcription factor peptidase, site 1 (MBTPS1), XM_005218389 MBTPS1 transcript variant X1, mRNA. PREDICTED: Bos taurus zinc finger, CCHC domain containing 14 (ZCCHC14), transcript XM_005218624 ZCCHC14 variant X1, mRNA. NM_001191433 N4BP1 Bos taurus NEDD4 binding protein 1 (N4BP1), mRNA. NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. PREDICTED: Bos taurus PH domain and leucine rich repeat protein phosphatase 2 (PHLPP2), XM_005218644 PHLPP2 transcript variant X1, mRNA. PREDICTED: Bos taurus zinc finger protein 112 homolog (mouse) (ZFP112), transcript XM_002695086 ZFP112 variant X1, mRNA. XM_001789308 ZFP112 PREDICTED: Bos taurus zinc finger protein 112 homolog (mouse) (ZFP112), mRNA. PREDICTED: Bos taurus dystrophia myotonica, WD repeat containing (DMWD), transcript XM_002695097 DMWD variant X1, mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XM_003583488 ZNF836 PREDICTED: Bos taurus zinc finger protein 836 (ZNF836), mRNA. XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XM_005198775 LOC100295951 PREDICTED: Bos taurus uncharacterized LOC100295951 (LOC100295951), PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_228009 LOC101909540 PREDICTED: Bos taurus uncharacterized LOC101909540 (LOC101909540), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), PREDICTED: Bos taurus negative regulator of ubiquitin-like proteins 1 (NUB1), transcript XM_005205827 NUB1 variant X1, mRNA. PREDICTED: Bos taurus PTPRF interacting protein, binding protein 2 (liprin beta 2) XM_003586954 PPFIBP2 (PPFIBP2), mRNA. XR_229156 LOC101907943 PREDICTED: Bos taurus uncharacterized LOC101907943 (LOC101907943), PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. NM_001192437 HLF Bos taurus hepatic leukemia factor (HLF), mRNA. NM_001192437 HLF Bos taurus hepatic leukemia factor (HLF), mRNA. NM_001193168 VPS53 Bos taurus vacuolar protein sorting 53 homolog (S. cerevisiae) (VPS53), mRNA. XM_005220608 SOCS7 PREDICTED: Bos taurus suppressor of cytokine signaling 7 (SOCS7), XM_005220607 SOCS7 PREDICTED: Bos taurus suppressor of cytokine signaling 7 (SOCS7), XM_005220607 SOCS7 PREDICTED: Bos taurus suppressor of cytokine signaling 7 (SOCS7),

208

PREDICTED: Bos taurus male-specific lethal 1 homolog (Drosophila) (MSL1), transcript XM_001254563 MSL1 variant X1, mRNA. PREDICTED: Bos taurus male-specific lethal 1 homolog (Drosophila) (MSL1), transcript XM_001254563 MSL1 variant X1, mRNA. PREDICTED: Bos taurus proteasome (prosome, macropain) activator subunit 3 (PA28 XM_002696000 PSME3 gamma; Ki) (PSME3), transcript variant X1, mRNA. XM_005220724 NBR1 PREDICTED: Bos taurus neighbor of BRCA1 gene 1 (NBR1), transcript NM_001100367 NBR1 Bos taurus neighbor of BRCA1 gene 1 (NBR1), mRNA. XM_005220815 ARF4 PREDICTED: Bos taurus ADP-ribosylation factor 4 (ARF4), transcript NM_001038125 DCAF7 Bos taurus DDB1 and CUL4 associated factor 7 (DCAF7), mRNA. PREDICTED: Bos taurus 2-oxoglutarate and iron-dependent oxygenase domain containing 3 XM_582598 OGFOD3 (OGFOD3), mRNA. NM_001035289 ACOX1 Bos taurus acyl-CoA oxidase 1, palmitoyl (ACOX1), mRNA. NM_001035289 ACOX1 Bos taurus acyl-CoA oxidase 1, palmitoyl (ACOX1), mRNA. NM_001242571 H3F3B Bos taurus H3 histone, family 3B (H3F3B), mRNA. NM_001242571 H3F3B Bos taurus H3 histone, family 3B (H3F3B), mRNA. NM_001034630 GRB2 Bos taurus growth factor receptor-bound protein 2 (GRB2), mRNA. NM_001034630 GRB2 Bos taurus growth factor receptor-bound protein 2 (GRB2), mRNA. XM_002695677 SSH2 PREDICTED: Bos taurus slingshot protein phosphatase 2 (SSH2), NM_001046026 CTDNEP1 Bos taurus CTD nuclear envelope phosphatase 1 (CTDNEP1), mRNA. NM_001046026 CTDNEP1 Bos taurus CTD nuclear envelope phosphatase 1 (CTDNEP1), mRNA. NM_001046026 CTDNEP1 Bos taurus CTD nuclear envelope phosphatase 1 (CTDNEP1), mRNA. XM_005220300 MYH10 PREDICTED: Bos taurus myosin, heavy chain 10, non-muscle (MYH10), XM_005220300 MYH10 PREDICTED: Bos taurus myosin, heavy chain 10, non-muscle (MYH10), NM_174834 MYH10 Bos taurus myosin, heavy chain 10, non-muscle (MYH10), mRNA. XR_238694 LOC101902723 PREDICTED: Bos taurus uncharacterized LOC101902723 (LOC101902723), NM_001102515 NFE2L1 Bos taurus nuclear factor (erythroid-derived 2)-like 1 (NFE2L1), NM_001102515 NFE2L1 Bos taurus nuclear factor (erythroid-derived 2)-like 1 (NFE2L1), PREDICTED: Bos taurus nuclear factor (erythroid-derived 2)-like 1 (NFE2L1), transcript XM_005220593 NFE2L1 variant X4, mRNA. XM_005220607 SOCS7 PREDICTED: Bos taurus suppressor of cytokine signaling 7 (SOCS7), XM_005220607 SOCS7 PREDICTED: Bos taurus suppressor of cytokine signaling 7 (SOCS7), XM_005195726 TOP2A PREDICTED: Bos taurus topoisomerase (DNA) II alpha 170kDa (TOP2A), XR_228755 LOC101905542 PREDICTED: Bos taurus uncharacterized LOC101905542 (LOC101905542), NM_001001855 BIRC5 Bos taurus baculoviral IAP repeat containing 5 (BIRC5), mRNA. PREDICTED: Bos taurus G protein-coupled receptor, family C, group 5, member C (GPRC5C), XM_005221250 GPRC5C transcript variant X2, mRNA. XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), NM_001076097 SULT1C4 Bos taurus sulfotransferase family, cytosolic, 1C, member 4 (SULT1C4), mRNA. NM_001205735 AMMECR1L Bos taurus AMME chromosomal region gene 1-like (AMMECR1L), mRNA. XM_002685232 MAP3K2 PREDICTED: Bos taurus mitogen-activated protein kinase kinase kinase 2 (MAP3K2), mRNA. XM_002685232 MAP3K2 PREDICTED: Bos taurus mitogen-activated protein kinase kinase kinase 2 (MAP3K2), mRNA.

XM_005202459 BAZ2B PREDICTED: Bos taurus bromodomain adjacent to zinc finger domain, 2B (BAZ2B),

209

transcript variant X4, mRNA.

PREDICTED: Bos taurus bromodomain adjacent to zinc finger domain, 2B (BAZ2B), XM_005202461 BAZ2B transcript variant X6, mRNA. XM_005202431 ARL5A PREDICTED: Bos taurus ADP-ribosylation factor-like 5A (ARL5A), XM_005202431 ARL5A PREDICTED: Bos taurus ADP-ribosylation factor-like 5A (ARL5A), NM_001046245 ARL5A Bos taurus ADP-ribosylation factor-like 5A (ARL5A), mRNA. XM_005202431 ARL5A PREDICTED: Bos taurus ADP-ribosylation factor-like 5A (ARL5A), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), PREDICTED: Bos taurus tubulin tyrosine ligase-like family, member 4 (TTLL4), transcript XM_005202837 TTLL4 variant X1, mRNA. PREDICTED: Bos taurus tubulin tyrosine ligase-like family, member 4 (TTLL4), transcript XM_005202837 TTLL4 variant X1, mRNA. PREDICTED: Bos taurus tubulin tyrosine ligase-like family, member 4 (TTLL4), transcript XM_005202837 TTLL4 variant X1, mRNA. XM_005203131 EYA3 PREDICTED: Bos taurus eyes absent homolog 3 (Drosophila) (EYA3), NM_001081511 WASF2 Bos taurus WAS protein family, member 2 (WASF2), mRNA. XM_005203087 WASF2 PREDICTED: Bos taurus WAS protein family, member 2 (WASF2), NM_001046035 FUCA1 Bos taurus fucosidase, alpha-L- 1, tissue (FUCA1), mRNA. XM_001789087 ZNF436 PREDICTED: Bos taurus zinc finger protein 436 (ZNF436), transcript XM_003585792 USP48 PREDICTED: Bos taurus ubiquitin specific peptidase 48 (USP48), NM_001101911 RCC2 Bos taurus regulator of chromosome condensation 2 (RCC2), mRNA. NM_001101911 RCC2 Bos taurus regulator of chromosome condensation 2 (RCC2), mRNA. XM_003585804 FBXO42 PREDICTED: Bos taurus F-box protein 42 (FBXO42), transcript variant PREDICTED: Bos taurus integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen XM_005202253 ITGAV CD51) (ITGAV), transcript variant X2, PREDICTED: Bos taurus integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen XM_005202252 ITGAV CD51) (ITGAV), transcript variant X1, PREDICTED: Bos taurus integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen XM_005202252 ITGAV CD51) (ITGAV), transcript variant X1, PREDICTED: Bos taurus integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen XM_005202252 ITGAV CD51) (ITGAV), transcript variant X1, NM_001075883 DYNC1I2 Bos taurus dynein, cytoplasmic 1, intermediate chain 2 (DYNC1I2), NM_001034281 ARL6IP6 Bos taurus ADP-ribosylation-like factor 6 interacting protein 6 (ARL6IP6), mRNA. NM_001098468 CCDC93 Bos taurus coiled-coil domain containing 93 (CCDC93), mRNA. PREDICTED: Bos taurus zona pellucida sperm-binding protein 3 receptor-like (LOC506707), XM_583188 LOC506707 mRNA. XM_005202676 ANKRD44 PREDICTED: Bos taurus ankyrin repeat domain 44 (ANKRD44), XM_005202666 CLK1 PREDICTED: Bos taurus CDC-like kinase 1 (CLK1), transcript variant NM_001102271 CLK1 Bos taurus CDC-like kinase 1 (CLK1), mRNA. XM_005202667 CLK1 PREDICTED: Bos taurus CDC-like kinase 1 (CLK1), transcript variant PREDICTED: Bos taurus thyroid hormone receptor interactor 12 (TRIP12), transcript variant XM_005202925 TRIP12 X1, mRNA. PREDICTED: Bos taurus thyroid hormone receptor interactor 12 (TRIP12), transcript variant XM_005202927 TRIP12 X3, mRNA. PREDICTED: Bos taurus thyroid hormone receptor interactor 12 (TRIP12), transcript variant XM_005202926 TRIP12 X2, mRNA.

210

PREDICTED: Bos taurus thyroid hormone receptor interactor 12 (TRIP12), transcript variant XM_005202926 TRIP12 X2, mRNA. PREDICTED: Bos taurus thyroid hormone receptor interactor 12 (TRIP12), transcript variant XM_005202932 TRIP12 X8, mRNA. XM_005202995 S100PBP PREDICTED: Bos taurus S100P binding protein (S100PBP), transcript Bos taurus KH domain containing, RNA binding, signal transduction associated 1 NM_001046442 KHDRBS1 (KHDRBS1), mRNA. Bos taurus KH domain containing, RNA binding, signal transduction associated 1 NM_001046442 KHDRBS1 (KHDRBS1), mRNA. NM_001076253 YTHDF2 Bos taurus YTH domain family, member 2 (YTHDF2), mRNA. NM_001076253 YTHDF2 Bos taurus YTH domain family, member 2 (YTHDF2), mRNA. NM_001080218 CLIC4 Bos taurus chloride intracellular channel 4 (CLIC4), mRNA. NM_001080218 CLIC4 Bos taurus chloride intracellular channel 4 (CLIC4), mRNA. NM_001080218 CLIC4 Bos taurus chloride intracellular channel 4 (CLIC4), mRNA. NM_001080218 CLIC4 Bos taurus chloride intracellular channel 4 (CLIC4), mRNA. XM_001789087 ZNF436 PREDICTED: Bos taurus zinc finger protein 436 (ZNF436), transcript NM_001099701 PINK1 Bos taurus PTEN induced putative kinase 1 (PINK1), mRNA. XM_002685794 IFFO2 PREDICTED: Bos taurus intermediate filament family orphan 2 (IFFO2), mRNA. NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_002697375 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), XM_005208073 ART3 PREDICTED: Bos taurus ADP-ribosyltransferase 3 (ART3), transcript XR_231044 LOC100848024 PREDICTED: Bos taurus uncharacterized LOC100848024 (LOC100848024), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. NM_001046036 DIMT1 Bos taurus DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae) (DIMT1), mRNA. NM_001083426 C20H5orf34 Bos taurus chromosome 20 open reading frame, human C5orf34 (C20H5orf34), mRNA. XM_002696402 MTMR12 PREDICTED: Bos taurus myotubularin related protein 12 (MTMR12), XM_002696402 MTMR12 PREDICTED: Bos taurus myotubularin related protein 12 (MTMR12), NM_001166499 ITGA2 Bos taurus integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA. NM_001166499 ITGA2 Bos taurus integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA. PREDICTED: Bos taurus nicotinamide nucleotide transhydrogenase (NNT), transcript variant XM_005221528 NNT X1, mRNA. XM_005221621 RAI14 PREDICTED: Bos taurus retinoic acid induced 14 (RAI14), transcript NM_001102212 TRIO Bos taurus triple functional domain (PTPRF interacting) (TRIO), NM_001102212 TRIO Bos taurus triple functional domain (PTPRF interacting) (TRIO), NM_001102212 TRIO Bos taurus triple functional domain (PTPRF interacting) (TRIO),

211

PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XR_139187 LOC100337007 PREDICTED: Bos taurus zinc finger protein 347-like (LOC100337007), NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XM_005221818 ABHD2 PREDICTED: Bos taurus abhydrolase domain containing 2 (ABHD2), NM_001015549 ABHD2 Bos taurus abhydrolase domain containing 2 (ABHD2), mRNA. NM_174644 IDH3A Bos taurus isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A), mRNA. NM_174644 IDH3A Bos taurus isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A), mRNA. NM_174644 IDH3A Bos taurus isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A), mRNA. NM_174644 IDH3A Bos taurus isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A), mRNA. NM_001192690 TECPR2 Bos taurus tectonin beta-propeller repeat containing 2 (TECPR2), XM_005221700 UBE3A PREDICTED: Bos taurus ubiquitin protein ligase E3A (UBE3A), XM_005221700 UBE3A PREDICTED: Bos taurus ubiquitin protein ligase E3A (UBE3A), NM_001192940 BAZ1A Bos taurus bromodomain adjacent to zinc finger domain, 1A (BAZ1A), NM_001192940 BAZ1A Bos taurus bromodomain adjacent to zinc finger domain, 1A (BAZ1A), NM_001244171 MIS18BP1 Bos taurus MIS18 binding protein 1 (MIS18BP1), mRNA. NM_001244171 MIS18BP1 Bos taurus MIS18 binding protein 1 (MIS18BP1), mRNA. XM_005222222 TC2N PREDICTED: Bos taurus tandem C2 domains, nuclear (TC2N), transcript XM_005222198 ITPK1 PREDICTED: Bos taurus inositol-tetrakisphosphate 1-kinase (ITPK1), XM_005222198 ITPK1 PREDICTED: Bos taurus inositol-tetrakisphosphate 1-kinase (ITPK1), XM_005222198 ITPK1 PREDICTED: Bos taurus inositol-tetrakisphosphate 1-kinase (ITPK1), XR_228393 LOC101902851 PREDICTED: Bos taurus uncharacterized LOC101902851 (LOC101902851), XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XR_231044 LOC100848024 PREDICTED: Bos taurus uncharacterized LOC100848024 (LOC100848024), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2), XM_005222418 LRRFIP2 transcript variant X8, mRNA. NM_001038070 LRRFIP2 Bos taurus leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2), mRNA.

XM_005222418 LRRFIP2 PREDICTED: Bos taurus leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2),

212

transcript variant X8, mRNA.

PREDICTED: Bos taurus leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2), XM_005222420 LRRFIP2 transcript variant X10, mRNA. PREDICTED: Bos taurus leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2), XM_005222418 LRRFIP2 transcript variant X8, mRNA. PREDICTED: Bos taurus leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2), XM_005222420 LRRFIP2 transcript variant X10, mRNA. NM_001075892 OXSR1 Bos taurus oxidative-stress responsive 1 (OXSR1), mRNA. XM_005222471 OXSR1 PREDICTED: Bos taurus oxidative-stress responsive 1 (OXSR1), XM_005222471 OXSR1 PREDICTED: Bos taurus oxidative-stress responsive 1 (OXSR1), NM_001034530 ARF4 Bos taurus ADP-ribosylation factor 4 (ARF4), mRNA. NM_001034530 ARF4 Bos taurus ADP-ribosylation factor 4 (ARF4), mRNA. XM_005196457 LOC100847355 PREDICTED: Bos taurus dynein heavy chain 12, axonemal-like (LOC100847355), mRNA. NM_001101294 DUSP7 Bos taurus dual specificity phosphatase 7 (DUSP7), mRNA. XM_005196471 VPRBP PREDICTED: Bos taurus Vpr (HIV-1) binding protein (VPRBP), XM_003583810 VPRBP PREDICTED: Bos taurus Vpr (HIV-1) binding protein (VPRBP), XM_002696890 EGFR PREDICTED: Bos taurus epidermal growth factor receptor (EGFR), XM_592211 EGFR PREDICTED: Bos taurus epidermal growth factor receptor (EGFR), XM_005222534 ZNF445 PREDICTED: Bos taurus zinc finger protein 445 (ZNF445), transcript NM_001205819 ZNF445 Bos taurus zinc finger protein 445 (ZNF445), mRNA. PREDICTED: Bos taurus protein phosphatase 4, regulatory subunit 2 (PPP4R2), transcript XM_581095 PPP4R2 variant X2, mRNA. PREDICTED: Bos taurus protein phosphatase 4, regulatory subunit 2 (PPP4R2), transcript XM_581095 PPP4R2 variant X2, mRNA. NM_001076228 PTPRG Bos taurus protein tyrosine phosphatase, receptor type, G (PTPRG), NM_001076228 PTPRG Bos taurus protein tyrosine phosphatase, receptor type, G (PTPRG), PREDICTED: Bos taurus dystroglycan 1 (dystrophin-associated glycoprotein 1) (DAG1), XM_005222703 DAG1 transcript variant X1, mRNA. XR_232840 LOC100847139 PREDICTED: Bos taurus kelch-like protein 18-like (LOC100847139), XM_005223081 VGLL4 PREDICTED: Bos taurus vestigial like 4 (Drosophila) (VGLL4), NM_001099128 VGLL4 Bos taurus vestigial like 4 (Drosophila) (VGLL4), mRNA. PREDICTED: Bos taurus Sec61 alpha 1 subunit (S. cerevisiae) (SEC61A1), transcript variant XM_005223160 SEC61A1 X1, mRNA. NM_001040504 SEC61A1 Bos taurus Sec61 alpha 1 subunit (S. cerevisiae) (SEC61A1), mRNA. NM_001040504 SEC61A1 Bos taurus Sec61 alpha 1 subunit (S. cerevisiae) (SEC61A1), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), PREDICTED: Bos taurus glutamate-cysteine ligase, catalytic subunit (GCLC), transcript XM_005223237 GCLC variant X2, mRNA. PREDICTED: Bos taurus glutamate-cysteine ligase, catalytic subunit (GCLC), transcript XM_005223238 GCLC variant X3, mRNA. PREDICTED: Bos taurus glutamate-cysteine ligase, catalytic subunit (GCLC), transcript XM_005223236 GCLC variant X1, mRNA. NM_001083674 GCLC Bos taurus glutamate-cysteine ligase, catalytic subunit (GCLC),

213

PREDICTED: Bos taurus glutamate-cysteine ligase, catalytic subunit (GCLC), transcript XM_005223237 GCLC variant X2, mRNA. PREDICTED: Bos taurus glutamate-cysteine ligase, catalytic subunit (GCLC), transcript XM_005223237 GCLC variant X2, mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), XM_003585402 DNAH8 PREDICTED: Bos taurus dynein, axonemal, heavy chain 8 (DNAH8), NM_001025347 LOC574091 Bos taurus nucleoside-diphosphate kinase NBR-A (LOC574091), mRNA. PREDICTED: Bos taurus transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)-like XM_005223265 LOC618733 (LOC618733), transcript variant X1, XM_005192931 USP49 PREDICTED: Bos taurus ubiquitin specific peptidase 49 (USP49), XM_005223490 CCND3 PREDICTED: Bos taurus cyclin D3 (CCND3), transcript variant X2, XM_005223435 MRPS10 PREDICTED: Bos taurus mitochondrial ribosomal protein S10 (MRPS10), NM_001035314 MRPS10 Bos taurus mitochondrial ribosomal protein S10 (MRPS10), mRNA. PREDICTED: Bos taurus valyl-tRNA synthetase 2, mitochondrial (putative) (VARS2), XM_005223583 VARS2 transcript variant X3, mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. NM_001078128 SOX4 Bos taurus SRY (sex determining region Y)-box 4 (SOX4), mRNA. NM_001078128 SOX4 Bos taurus SRY (sex determining region Y)-box 4 (SOX4), mRNA. XM_003583942 RREB1 PREDICTED: Bos taurus ras responsive element binding protein 1 (RREB1), mRNA. XM_003583942 RREB1 PREDICTED: Bos taurus ras responsive element binding protein 1 (RREB1), mRNA. XM_003583942 RREB1 PREDICTED: Bos taurus ras responsive element binding protein 1 (RREB1), mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), NM_001281902 LOC100848171 Bos taurus envelope glycoprotein gp70-like (LOC100848171), mRNA. NM_001205479 ZNF24 Bos taurus zinc finger protein 24 (ZNF24), mRNA. NM_001205479 ZNF24 Bos taurus zinc finger protein 24 (ZNF24), mRNA. NM_001205479 ZNF24 Bos taurus zinc finger protein 24 (ZNF24), mRNA. XR_232310 LOC101910077 PREDICTED: Bos taurus uncharacterized LOC101910077 (LOC101910077), XM_005196765 SPIRE1 PREDICTED: Bos taurus spire homolog 1 (Drosophila) (SPIRE1), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), XR_082750 LOC618220 PREDICTED: Bos taurus ribosomal protein L6 pseudogene (LOC618220), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001103275 ACOT11 Bos taurus acyl-CoA thioesterase 11 (ACOT11), mRNA. PREDICTED: Bos taurus intraflagellar transport 140 homolog (Chlamydomonas) (IFT140), XM_002697913 IFT140 transcript variant X1, mRNA.

214

NM_001109965 ZNF75A Bos taurus zinc finger protein 75a (ZNF75A), mRNA. XM_005224483 UBN1 PREDICTED: Bos taurus ubinuclein 1 (UBN1), transcript variant X1, XM_005224483 UBN1 PREDICTED: Bos taurus ubinuclein 1 (UBN1), transcript variant X1, PREDICTED: Bos taurus centriolar coiled coil protein 110kDa (CCP110), transcript variant XM_005196931 CCP110 X2, mRNA. XM_003584029 RBBP6 PREDICTED: Bos taurus retinoblastoma-binding protein 6 (RBBP6), XM_003584029 RBBP6 PREDICTED: Bos taurus retinoblastoma-binding protein 6 (RBBP6), XM_005224881 TMEM248 PREDICTED: Bos taurus transmembrane protein 248 (TMEM248), NM_001046081 TMEM248 Bos taurus transmembrane protein 248 (TMEM248), mRNA. XM_005224880 TMEM248 PREDICTED: Bos taurus transmembrane protein 248 (TMEM248), XM_005225082 TBL2 PREDICTED: Bos taurus transducin (beta)-like 2 (TBL2), transcript XM_005225005 ACTB PREDICTED: Bos taurus actin, beta (ACTB), transcript variant X1, NM_173979 ACTB Bos taurus actin, beta (ACTB), mRNA. NM_173979 ACTB Bos taurus actin, beta (ACTB), mRNA. XM_003584064 LOC100300830 PREDICTED: Bos taurus SUN domain-containing protein 1-like (LOC100300830), mRNA. XM_005224590 CCDC78 PREDICTED: Bos taurus coiled-coil domain containing 78 (CCDC78), XM_002697888 PPL PREDICTED: Bos taurus periplakin (PPL), transcript variant X1, NM_001101919 ATP1B4 Bos taurus ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), mRNA. PREDICTED: Bos taurus lipopolysaccharide-induced TNF factor (LITAF), transcript variant X2, XM_005224464 LITAF mRNA. PREDICTED: Bos taurus lipopolysaccharide-induced TNF factor (LITAF), transcript variant X2, XM_005224464 LITAF mRNA. NM_001046252 LITAF Bos taurus lipopolysaccharide-induced TNF factor (LITAF), mRNA. PREDICTED: Bos taurus DCN1, defective in cullin neddylation 1, domain containing 3 (S. XM_005224701 DCUN1D3 cerevisiae) (DCUN1D3), transcript variant NM_001083746 ZNF689 Bos taurus zinc finger protein 689 (ZNF689), mRNA. PREDICTED: Bos taurus zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript XM_005225002 ZKSCAN1 variant X1, mRNA. PREDICTED: Bos taurus zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript XM_005225002 ZKSCAN1 variant X1, mRNA. PREDICTED: Bos taurus zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript XM_005225002 ZKSCAN1 variant X1, mRNA. PREDICTED: Bos taurus zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript XM_005225002 ZKSCAN1 variant X1, mRNA. PREDICTED: Bos taurus cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), XM_005225004 CPSF4 transcript variant X2, mRNA. NM_173942 CPSF4 Bos taurus cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA.

215

NM_001034715 MARCH5 Bos taurus membrane-associated ring finger (C3HC4) 5 (MARCH5), XM_005225549 CCNJ PREDICTED: Bos taurus cyclin J (CCNJ), transcript variant X3, mRNA. XM_005225548 CCNJ PREDICTED: Bos taurus cyclin J (CCNJ), transcript variant X2, mRNA. XM_005225547 CCNJ PREDICTED: Bos taurus cyclin J (CCNJ), transcript variant X1, mRNA. PREDICTED: Bos taurus family with sequence similarity 178, member A (FAM178A), XM_005225611 FAM178A transcript variant X5, mRNA. PREDICTED: Bos taurus chromosome 26 open reading frame, human C10orf26 XM_002698456 C26H10orf26 (C26H10orf26), transcript variant X1, mRNA. XM_005225724 ADD3 PREDICTED: Bos taurus adducin 3 (gamma) (ADD3), transcript variant XM_001787922 NANOS1 PREDICTED: Bos taurus nanos homolog 1 (Drosophila) (NANOS1), Bos taurus pleckstrin homology domain containing, family A (phosphoinositide binding NM_001075593 PLEKHA1 specific) member 1 (PLEKHA1), mRNA. PREDICTED: Bos taurus pleckstrin homology domain containing, family A (phosphoinositide XM_005225798 PLEKHA1 binding specific) member 1 (PLEKHA1), NM_001017933 ACADSB Bos taurus acyl-CoA dehydrogenase, short/branched chain (ACADSB), XM_003587864 LOC100848463 PREDICTED: Bos taurus uncharacterized LOC100848463 (LOC100848463), XM_003587864 LOC100848463 PREDICTED: Bos taurus uncharacterized LOC100848463 (LOC100848463), NM_174436 PRKG1 Bos taurus protein kinase, cGMP-dependent, type I (PRKG1), mRNA. Bos taurus ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) (ACTR1A), NM_001193248 ACTR1A mRNA. XM_003587875 SH3PXD2A PREDICTED: Bos taurus SH3 and PX domains 2A (SH3PXD2A), mRNA. PREDICTED: Bos taurus minichromosome maintenance complex binding protein (MCMBP), XM_005225779 MCMBP transcript variant X1, mRNA. NM_001098974 MCMBP Bos taurus minichromosome maintenance complex binding protein (MCMBP), mRNA. PREDICTED: Bos taurus inositol polyphosphate-5-phosphatase, 40kDa (INPP5A), partial XM_866984 INPP5A mRNA. XR_139187 LOC100337007 PREDICTED: Bos taurus zinc finger protein 347-like (LOC100337007), XR_139187 LOC100337007 PREDICTED: Bos taurus zinc finger protein 347-like (LOC100337007), NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. XM_005226117 HOOK3 PREDICTED: Bos taurus hook homolog 3 (Drosophila) (HOOK3), NM_001192600 HOOK3 Bos taurus hook homolog 3 (Drosophila) (HOOK3), mRNA. XM_616436 ZDHHC2 PREDICTED: Bos taurus zinc finger, DHHC-type containing 2 (ZDHHC2), XM_616436 ZDHHC2 PREDICTED: Bos taurus zinc finger, DHHC-type containing 2 (ZDHHC2), NM_001034648 THAP1 Bos taurus THAP domain containing, apoptosis associated protein 1 (THAP1), mRNA. NM_001034648 THAP1 Bos taurus THAP domain containing, apoptosis associated protein 1 (THAP1), mRNA. PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), NM_001083527 DDX21 Bos taurus DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 (DDX21), mRNA. NM_001083527 DDX21 Bos taurus DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 (DDX21), mRNA. NM_001083527 DDX21 Bos taurus DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 (DDX21), mRNA.

216

NM_001206102 MCU Bos taurus mitochondrial calcium uniporter (MCU), mRNA. PREDICTED: Bos taurus family with sequence similarity 190, member B (FAM190B), XM_005197254 FAM190B transcript variant X3, mRNA. PREDICTED: Bos taurus family with sequence similarity 190, member B (FAM190B), XM_005197254 FAM190B transcript variant X3, mRNA. PREDICTED: Bos taurus centriole, cilia and spindle-associated protein (CCSAP), transcript XM_002698761 CCSAP variant X1, mRNA. XM_005226385 SAR1A PREDICTED: Bos taurus SAR1 homolog A (S. cerevisiae) (SAR1A), XM_005226384 SAR1A PREDICTED: Bos taurus SAR1 homolog A (S. cerevisiae) (SAR1A), XM_005226384 SAR1A PREDICTED: Bos taurus SAR1 homolog A (S. cerevisiae) (SAR1A), NM_001034521 SAR1A Bos taurus SAR1 homolog A (S. cerevisiae) (SAR1A), mRNA. NM_174161 PSAP Bos taurus prosaposin (PSAP), mRNA. NM_174161 PSAP Bos taurus prosaposin (PSAP), mRNA. NM_174161 PSAP Bos taurus prosaposin (PSAP), mRNA. XM_005226356 MICU1 PREDICTED: Bos taurus mitochondrial calcium uptake 1 (MICU1), NM_001205686 DNAJC9 Bos taurus DnaJ (Hsp40) homolog, subfamily C, member 9 (DNAJC9), NM_001075474 MRPS16 Bos taurus mitochondrial ribosomal protein S16 (MRPS16), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_227617 LOC101908176 PREDICTED: Bos taurus uncharacterized LOC101908176 (LOC101908176), XM_002698950 FRMPD2 PREDICTED: Bos taurus FERM and PDZ domain containing 2 (FRMPD2), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XR_234264 LOC100848362 PREDICTED: Bos taurus uncharacterized LOC100848362 (LOC100848362), NM_001206269 FZD4 Bos taurus frizzled family receptor 4 (FZD4), mRNA. XM_002699070 GAB2 PREDICTED: Bos taurus GRB2-associated binding protein 2 (GAB2), NM_001077035 ASRGL1 Bos taurus asparaginase like 1 (ASRGL1), mRNA. XM_607792 GAB2 PREDICTED: Bos taurus GRB2-associated binding protein 2 (GAB2), NM_001099159 TMEM218 Bos taurus transmembrane protein 218 (TMEM218), mRNA. XM_005227211 RTN3 PREDICTED: Bos taurus reticulon 3 (RTN3), mRNA. NM_001192217 RIN1 Bos taurus Ras and Rab interactor 1 (RIN1), mRNA. XM_002684569 ORAOV1 PREDICTED: Bos taurus oral cancer overexpressed 1 (ORAOV1), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XM_005198775 LOC100295951 PREDICTED: Bos taurus uncharacterized LOC100295951 (LOC100295951), NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), NM_001077066 GPR161 Bos taurus G protein-coupled receptor 161 (GPR161), mRNA. XM_005203534 DEDD PREDICTED: Bos taurus death effector domain containing (DEDD), NM_001034643 DEDD Bos taurus death effector domain containing (DEDD), mRNA. XM_005203534 DEDD PREDICTED: Bos taurus death effector domain containing (DEDD), NM_001206320 UBE2Q1 Bos taurus ubiquitin-conjugating enzyme E2Q family member 1 (UBE2Q1), mRNA.

217

NM_001206320 UBE2Q1 Bos taurus ubiquitin-conjugating enzyme E2Q family member 1 (UBE2Q1), mRNA. NM_001206320 UBE2Q1 Bos taurus ubiquitin-conjugating enzyme E2Q family member 1 (UBE2Q1), mRNA. PREDICTED: Bos taurus solute carrier family 16, member 1 (monocarboxylic acid XM_005204092 SLC16A1 transporter 1) (SLC16A1), transcript variant XR_240300 LOC101902865 PREDICTED: Bos taurus uncharacterized LOC101902865 (LOC101902865), NM_001076821 DPH5 Bos taurus DPH5 homolog (S. cerevisiae) (DPH5), mRNA. PREDICTED: Bos taurus family with sequence similarity 184, member B (FAM184B), XM_003582318 FAM184B transcript variant X1, mRNA. NM_001077827 JUN Bos taurus jun proto-oncogene (JUN), mRNA. XM_003585901 NDC1 PREDICTED: Bos taurus NDC1 transmembrane nucleoporin (NDC1), XM_003582008 NDC1 PREDICTED: Bos taurus NDC1 transmembrane nucleoporin (NDC1), NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. XM_589637 EFCAB14 PREDICTED: Bos taurus EF-hand calcium binding domain 14 (EFCAB14), XM_589637 EFCAB14 PREDICTED: Bos taurus EF-hand calcium binding domain 14 (EFCAB14), XM_001256090 RBM44 PREDICTED: Bos taurus RNA binding motif protein 44 (RBM44), NM_001192122 SFT2D2 Bos taurus SFT2 domain containing 2 (SFT2D2), mRNA. PREDICTED: Bos taurus TIP41, TOR signaling pathway regulator-like (S. cerevisiae) (TIPRL), XM_005203402 TIPRL transcript variant X1, mRNA. NM_001205585 UHMK1 Bos taurus U2AF homology motif (UHM) kinase 1 (UHMK1), mRNA. NM_001113311 CKS1B Bos taurus CDC28 protein kinase regulatory subunit 1B (CKS1B), NM_001113311 CKS1B Bos taurus CDC28 protein kinase regulatory subunit 1B (CKS1B), XR_233876 SNX27 PREDICTED: Bos taurus sorting nexin family member 27 (SNX27), NM_001076242 GABPB2 Bos taurus GA binding protein transcription factor, beta subunit 2 (GABPB2), mRNA. NM_001206187 RPRD2 Bos taurus regulation of nuclear pre-mRNA domain containing 2 (RPRD2), mRNA. XM_005204040 TRIM33 PREDICTED: Bos taurus tripartite motif containing 33 (TRIM33), XM_005204156 CTTNBP2NL PREDICTED: Bos taurus CTTNBP2 N-terminal like (CTTNBP2NL), XM_005204154 CTTNBP2NL PREDICTED: Bos taurus CTTNBP2 N-terminal like (CTTNBP2NL), PREDICTED: Bos taurus leucine rich repeat containing 8 family, member B (LRRC8B), XM_005197834 LRRC8B transcript variant X1, mRNA. PREDICTED: Bos taurus leucine rich repeat containing 8 family, member B (LRRC8B), XM_005197834 LRRC8B transcript variant X1, mRNA. PREDICTED: Bos taurus leucine rich repeat containing 8 family, member B (LRRC8B), XM_005197834 LRRC8B transcript variant X1, mRNA. PREDICTED: Bos taurus protein kinase, cAMP-dependent, catalytic, beta (PRKACB), XM_005204378 PRKACB transcript variant X6, mRNA. XM_005204457 AK4 PREDICTED: Bos taurus adenylate kinase 4 (AK4), transcript variant XM_005204457 AK4 PREDICTED: Bos taurus adenylate kinase 4 (AK4), transcript variant NM_001206870 LOC785042 Bos taurus protein Hook homolog 1-like (LOC785042), mRNA. NM_001205605 PRKAA2 Bos taurus protein kinase, AMP-activated, alpha 2 catalytic subunit (PRKAA2), mRNA. NM_001205605 PRKAA2 Bos taurus protein kinase, AMP-activated, alpha 2 catalytic subunit (PRKAA2), mRNA. PREDICTED: Bos taurus solute carrier family 5 (sodium/glucose cotransporter), member 9 XM_005204758 SLC5A9 (SLC5A9), transcript variant X3, mRNA. XM_005204748 ZFP69 PREDICTED: Bos taurus zinc finger protein 642 (ZFP69), transcript XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript

XM_005223911 LOC617406 PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like

218

(LOC617406), transcript variant X2,

XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. NM_001172519 PEG10 Bos taurus paternally expressed 10 (PEG10), transcript variant 1, XM_005205213 ARL4A PREDICTED: Bos taurus ADP-ribosylation factor-like 4A (ARL4A), XM_005205215 ARL4A PREDICTED: Bos taurus ADP-ribosylation factor-like 4A (ARL4A), XM_005205213 ARL4A PREDICTED: Bos taurus ADP-ribosylation factor-like 4A (ARL4A), XM_005205701 FLNC PREDICTED: Bos taurus filamin C, gamma (FLNC), transcript variant XM_598279 WEE2 PREDICTED: Bos taurus WEE1 homolog 2 (S. pombe) (WEE2), mRNA. XM_598279 WEE2 PREDICTED: Bos taurus WEE1 homolog 2 (S. pombe) (WEE2), mRNA. XM_598279 WEE2 PREDICTED: Bos taurus WEE1 homolog 2 (S. pombe) (WEE2), mRNA. XM_598279 WEE2 PREDICTED: Bos taurus WEE1 homolog 2 (S. pombe) (WEE2), mRNA. NM_001144104 CASP2 Bos taurus caspase 2, apoptosis-related cysteine peptidase (CASP2), PREDICTED: Bos taurus caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript XM_005205863 CASP2 variant X1, mRNA. PREDICTED: Bos taurus Rho guanine nucleotide exchange factor (GEF) 5 (ARHGEF5), XM_005205839 ARHGEF5 transcript variant X1, mRNA. NM_001205918 ZNF398 Bos taurus zinc finger protein 398 (ZNF398), mRNA. XM_005205857 ZNF398 PREDICTED: Bos taurus zinc finger protein 398 (ZNF398), transcript PREDICTED: Bos taurus negative regulator of ubiquitin-like proteins 1 (NUB1), transcript XM_005205827 NUB1 variant X1, mRNA. PREDICTED: Bos taurus negative regulator of ubiquitin-like proteins 1 (NUB1), transcript XM_005205827 NUB1 variant X1, mRNA. XM_005205199 DGKB PREDICTED: Bos taurus diacylglycerol kinase, beta 90kDa (DGKB), PREDICTED: Bos taurus leukocyte receptor cluster (LRC) member 8 (LENG8), transcript XM_005219700 LENG8 variant X1, mRNA. NM_001034644 RALA Bos taurus v-ral simian leukemia viral oncogene homolog A (ras related) (RALA), mRNA. NM_001034644 RALA Bos taurus v-ral simian leukemia viral oncogene homolog A (ras related) (RALA), mRNA. NM_001199002 YAE1D1 Bos taurus Yae1 domain containing 1 (YAE1D1), mRNA. NM_001191390 RBM28 Bos taurus RNA binding motif protein 28 (RBM28), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA),

219

PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. PREDICTED: Bos taurus PTPRF interacting protein, binding protein 2 (liprin beta 2) XM_003586954 PPFIBP2 (PPFIBP2), mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. PREDICTED: Bos taurus family with sequence similarity 114, member A1 (FAM114A1), XM_588946 FAM114A1 transcript variant X3, mRNA. PREDICTED: Bos taurus pleckstrin homology domain containing, family G (with RhoGef XM_005198216 PLEKHG7 domain) member 7 (PLEKHG7), transcript variant X1, NM_001040493 METAP2 Bos taurus methionyl aminopeptidase 2 (METAP2), mRNA. XM_005206103 GTSF1 PREDICTED: Bos taurus gametocyte specific factor 1 (GTSF1), XM_005206297 LETMD1 PREDICTED: Bos taurus LETM1 domain containing 1 (LETMD1), XM_003585161 NDFIP1 PREDICTED: Bos taurus Nedd4 family interacting protein 1 (NDFIP1), NM_001001147 CCNT1 Bos taurus cyclin T1 (CCNT1), mRNA. NM_001001147 CCNT1 Bos taurus cyclin T1 (CCNT1), mRNA. NM_001206876 SENP1 Bos taurus SUMO1/sentrin specific peptidase 1 (SENP1), mRNA. NM_001025320 TWF1 Bos taurus twinfilin, actin-binding protein, homolog 1 (Drosophila) (TWF1), mRNA. NM_001192284 CYP27B1 Bos taurus cytochrome P450, family 27, subfamily B, polypeptide 1 (CYP27B1), mRNA. XM_005206506 TAC3 PREDICTED: Bos taurus tachykinin 3 (TAC3), transcript variant X1, NM_001145865 PRIM1 Bos taurus primase, DNA, polypeptide 1 (49kDa) (PRIM1), mRNA. NM_001046525 RNF41 Bos taurus ring finger protein 41 (RNF41), mRNA. NM_001046525 RNF41 Bos taurus ring finger protein 41 (RNF41), mRNA. NM_001046525 RNF41 Bos taurus ring finger protein 41 (RNF41), mRNA. XM_005198332 LOC787705 PREDICTED: Bos taurus uncharacterized LOC787705 (LOC787705), mRNA. PREDICTED: Bos taurus apoptotic peptidase activating factor 1 (APAF1), transcript variant XM_005206645 APAF1 X1, mRNA. PREDICTED: Bos taurus apoptotic peptidase activating factor 1 (APAF1), transcript variant XM_005206646 APAF1 X2, mRNA. PREDICTED: Bos taurus RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), XM_005206785 RBFOX2 transcript variant X1, mRNA. NM_001075858 AMN1 Bos taurus antagonist of mitotic exit network 1 homolog (S. cerevisiae) (AMN1), mRNA. NM_001206695 B4GALNT3 Bos taurus beta-1,4-N-acetyl-galactosaminyl transferase 3 (B4GALNT3), mRNA. XM_582882 WNK1 PREDICTED: Bos taurus WNK lysine deficient protein kinase 1 (WNK1), XM_002687906 WNK1 PREDICTED: Bos taurus WNK lysine deficient protein kinase 1 (WNK1), XM_003586147 WNK1 PREDICTED: Bos taurus WNK lysine deficient protein kinase 1 (WNK1), XM_005207290 WNK1 PREDICTED: Bos taurus WNK lysine deficient protein kinase 1 (WNK1), XM_002687906 WNK1 PREDICTED: Bos taurus WNK lysine deficient protein kinase 1 (WNK1),

220

XM_002687906 WNK1 PREDICTED: Bos taurus WNK lysine deficient protein kinase 1 (WNK1), XM_002687214 EEA1 PREDICTED: Bos taurus early endosome antigen 1 (EEA1), transcript XM_005206111 USP44 PREDICTED: Bos taurus ubiquitin specific peptidase 44 (USP44), XM_005206111 USP44 PREDICTED: Bos taurus ubiquitin specific peptidase 44 (USP44), PREDICTED: Bos taurus amiloride-sensitive cation channel 2, neuronal (ACCN2), transcript XM_005206312 ACCN2 variant X2, mRNA. XM_003582222 MARCH9 PREDICTED: Bos taurus membrane-associated ring finger (C3HC4) 9 (MARCH9), mRNA. XM_588580 CDK17 PREDICTED: Bos taurus cyclin-dependent kinase 17 (CDK17), XM_588580 CDK17 PREDICTED: Bos taurus cyclin-dependent kinase 17 (CDK17), XM_005206584 ARL1 PREDICTED: Bos taurus ADP-ribosylation factor-like 1 (ARL1), XM_005206583 ARL1 PREDICTED: Bos taurus ADP-ribosylation factor-like 1 (ARL1), NM_001046229 ARL1 Bos taurus ADP-ribosylation factor-like 1 (ARL1), mRNA. XM_005206915 MRPS35 PREDICTED: Bos taurus mitochondrial ribosomal protein S35 (MRPS35), NM_001075619 MRPS35 Bos taurus mitochondrial ribosomal protein S35 (MRPS35), mRNA. PREDICTED: Bos taurus ribosomal modification protein rimK-like family member B XM_005207066 RIMKLB (RIMKLB), transcript variant X2, mRNA. PREDICTED: Bos taurus ribosomal modification protein rimK-like family member B XM_005207067 RIMKLB (RIMKLB), transcript variant X3, mRNA. PREDICTED: Bos taurus CD300 molecule-like family member g (CD300LG), transcript variant XM_005195759 CD300LG X3, mRNA. NM_001102080 CSNK1D Bos taurus casein kinase 1, delta (CSNK1D), mRNA. XM_002687933 CSNK1D PREDICTED: Bos taurus casein kinase 1, delta (CSNK1D), mRNA. NM_001078109 CSNK1E Bos taurus casein kinase 1, epsilon (CSNK1E), mRNA. Bos taurus solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, NM_001045948 SLC25A17 34kDa), member 17 (SLC25A17), mRNA. XM_005207406 NAGA PREDICTED: Bos taurus N-acetylgalactosaminidase, alpha- (NAGA), XM_005207453 A4GALT PREDICTED: Bos taurus alpha 1,4-galactosyltransferase (A4GALT), XR_229156 LOC101907943 PREDICTED: Bos taurus uncharacterized LOC101907943 (LOC101907943), NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. PREDICTED: Bos taurus multidrug resistance-associated protein 4-like (LOC101905101), XM_005213910 LOC101905101 mRNA. PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), NM_001143743 BOLA Bos taurus MHC class I antigen (BOLA), mRNA. XM_866575 NEK11 PREDICTED: Bos taurus NIMA-related kinase 11 (NEK11), transcript XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. Bos taurus hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 NM_001103282 HERC1 (CHC1)-like domain (RLD) 1 (HERC1), mRNA. XM_002702853 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA.

221

XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. PREDICTED: Bos taurus olfactory receptor, family 5, subfamily D, member 13-like XM_002707870 LOC100297422 (LOC100297422), mRNA. XR_227775 LOC101909063 PREDICTED: Bos taurus uncharacterized LOC101909063 (LOC101909063), XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_866575 NEK11 PREDICTED: Bos taurus NIMA-related kinase 11 (NEK11), transcript XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. NM_174417 PDE5A Bos taurus phosphodiesterase 5A, cGMP-specific (PDE5A), mRNA. NM_174417 PDE5A Bos taurus phosphodiesterase 5A, cGMP-specific (PDE5A), mRNA. NM_174417 PDE5A Bos taurus phosphodiesterase 5A, cGMP-specific (PDE5A), mRNA. XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), NM_001191521 LIMCH1 Bos taurus LIM and calponin homology domains 1 (LIMCH1), mRNA. XM_005207880 LIMCH1 PREDICTED: Bos taurus LIM and calponin homology domains 1 (LIMCH1), XM_005207880 LIMCH1 PREDICTED: Bos taurus LIM and calponin homology domains 1 (LIMCH1), NM_001282452 TMEM33 Bos taurus transmembrane protein 33 (TMEM33), transcript variant 1, PREDICTED: Bos taurus CD300 molecule-like family member g (CD300LG), transcript variant XM_005195759 CD300LG X3, mRNA. XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), XM_002688475 KIAA0232 PREDICTED: Bos taurus KIAA0232 ortholog (KIAA0232), transcript XM_005207620 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207620 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207617 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207612 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207618 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207618 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207615 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207619 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207612 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005207617 SGMS2 PREDICTED: Bos taurus sphingomyelin synthase 2 (SGMS2), transcript XM_005203639 TPM3 PREDICTED: Bos taurus tropomyosin 3 (TPM3), transcript variant X14, NM_001075135 UBE2D3 Bos taurus ubiquitin-conjugating enzyme E2D 3 (UBE2D3), mRNA. NM_001075135 UBE2D3 Bos taurus ubiquitin-conjugating enzyme E2D 3 (UBE2D3), mRNA. NM_001075135 UBE2D3 Bos taurus ubiquitin-conjugating enzyme E2D 3 (UBE2D3), mRNA. PREDICTED: Bos taurus bone morphogenetic protein receptor, type IB (BMPR1B), transcript XM_005207718 BMPR1B variant X1, mRNA. XM_005207728 PDLIM5 PREDICTED: Bos taurus PDZ and LIM domain 5 (PDLIM5), transcript XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XM_005208155 LIN54 PREDICTED: Bos taurus lin-54 homolog (C. elegans) (LIN54), XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009), XM_003582999 LOC100852009 PREDICTED: Bos taurus uncharacterized LOC100852009 (LOC100852009),

222

PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_234852 LOC101905378 PREDICTED: Bos taurus uncharacterized LOC101905378 (LOC101905378), XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_231044 LOC100848024 PREDICTED: Bos taurus uncharacterized LOC100848024 (LOC100848024), XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_232310 LOC101910077 PREDICTED: Bos taurus uncharacterized LOC101910077 (LOC101910077), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript NM_001101107 FARSA Bos taurus phenylalanyl-tRNA synthetase, alpha subunit (FARSA), NM_001099699 C7H19orf52 Bos taurus chromosome 7 open reading frame, human C19orf52 (C7H19orf52), mRNA. NM_001205622 LRRC8E Bos taurus leucine rich repeat containing 8 family, member E (LRRC8E), mRNA. XM_001254723 MAP2K7 PREDICTED: Bos taurus mitogen-activated protein kinase kinase 7 (MAP2K7), mRNA. PREDICTED: Bos taurus eukaryotic translation initiation factor 4E family member 1B XM_866118 EIF4E1B (EIF4E1B), mRNA. NM_001281909 SLBP2 Bos taurus oocyte-specific histone RNA stem-loop-binding protein 2-like (SLBP2), mRNA. XM_003582422 KDM3B PREDICTED: Bos taurus lysine (K)-specific demethylase 3B (KDM3B), XM_005199056 KDM3B PREDICTED: Bos taurus lysine (K)-specific demethylase 3B (KDM3B), NM_001014873 WDR55 Bos taurus WD repeat domain 55 (WDR55), mRNA. XM_002689268 NDFIP1 PREDICTED: Bos taurus Nedd4 family interacting protein 1 (NDFIP1), XM_003585161 NDFIP1 PREDICTED: Bos taurus Nedd4 family interacting protein 1 (NDFIP1), XM_002689268 NDFIP1 PREDICTED: Bos taurus Nedd4 family interacting protein 1 (NDFIP1), XM_002689268 NDFIP1 PREDICTED: Bos taurus Nedd4 family interacting protein 1 (NDFIP1), XM_003585161 NDFIP1 PREDICTED: Bos taurus Nedd4 family interacting protein 1 (NDFIP1), XM_005209576 RBM27 PREDICTED: Bos taurus RNA binding motif protein 27 (RBM27), NM_001193172 RBM27 Bos taurus RNA binding motif protein 27 (RBM27), mRNA. PREDICTED: Bos taurus peroxisome proliferator-activated receptor gamma, coactivator 1 XM_003586329 PPARGC1B beta (PPARGC1B), transcript variant X2, mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XM_001790223 RUFY1 PREDICTED: Bos taurus RUN and FYVE domain containing 1 (RUFY1), NM_001035338 CDC37 Bos taurus cell division cycle 37 homolog (S. cerevisiae) (CDC37), NM_174322 G protein Bos taurus guanine nucleotide binding protein (G protein), alpha 11 NM_174322 G protein Bos taurus guanine nucleotide binding protein (G protein), alpha 11 NM_174322 G protein Bos taurus guanine nucleotide binding protein (G protein), alpha 11 XM_005199002 LINGO3 PREDICTED: Bos taurus leucine rich repeat and Ig domain containing 3 (LINGO3), mRNA. XM_002684208 CCNI2 PREDICTED: Bos taurus cyclin I family, member 2 (CCNI2), mRNA. XM_005209089 GRAMD3 PREDICTED: Bos taurus GRAM domain containing 3 (GRAMD3), transcript

223

NM_001045917 DBN1 Bos taurus drebrin 1 (DBN1), mRNA. NM_001144090 HBEGF Bos taurus heparin-binding EGF-like growth factor (HBEGF), mRNA. XM_005209551 CSNK1A1 PREDICTED: Bos taurus casein kinase 1, alpha 1 (CSNK1A1), XM_005209556 CSNK1A1 PREDICTED: Bos taurus casein kinase 1, alpha 1 (CSNK1A1), XM_005209556 CSNK1A1 PREDICTED: Bos taurus casein kinase 1, alpha 1 (CSNK1A1), XM_005209556 CSNK1A1 PREDICTED: Bos taurus casein kinase 1, alpha 1 (CSNK1A1), NM_174711 CSNK1A1 Bos taurus casein kinase 1, alpha 1 (CSNK1A1), mRNA. XM_005209550 CSNK1A1 PREDICTED: Bos taurus casein kinase 1, alpha 1 (CSNK1A1), PREDICTED: Bos taurus peroxisome proliferator-activated receptor gamma, coactivator 1 XM_005209630 PPARGC1B beta (PPARGC1B), transcript variant X3, mRNA. XM_002689348 PWWP2A PREDICTED: Bos taurus PWWP domain containing 2A (PWWP2A), mRNA. NM_001040553 NUDCD2 Bos taurus NudC domain containing 2 (NUDCD2), mRNA. NM_001104987 MCTP1 Bos taurus multiple C2 domains, transmembrane 1 (MCTP1), mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), NM_001143743 BOLA Bos taurus MHC class I antigen (BOLA), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus family with sequence similarity 114, member A1 (FAM114A1), XM_588946 FAM114A1 transcript variant X3, mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_001250798 LOC617406 (LOC617406), transcript variant 2, mRNA. PREDICTED: Bos taurus rho GTPase activating protein 20-like (LOC100337360), partial XM_002688053 LOC100337360 mRNA. PREDICTED: Bos taurus olfactory receptor, family 5, subfamily D, member 13-like XM_002707870 LOC100297422 (LOC100297422), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA.

224

XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. XR_139187 LOC100337007 PREDICTED: Bos taurus zinc finger protein 347-like (LOC100337007), PREDICTED: Bos taurus palladin, cytoskeletal associated protein (PALLD), transcript variant XM_003582498 PALLD X1, mRNA. NM_001103275 ACOT11 Bos taurus acyl-CoA thioesterase 11 (ACOT11), mRNA. XM_005209848 ZNF395 PREDICTED: Bos taurus zinc finger protein 395 (ZNF395), transcript XM_002689609 ERMP1 PREDICTED: Bos taurus endoplasmic reticulum metallopeptidase 1 (ERMP1), mRNA. NM_001102335 PGM5 Bos taurus phosphoglucomutase 5 (PGM5), mRNA. PREDICTED: Bos taurus glucosaminyl (N-acetyl) transferase 1, core 2 (GCNT1), transcript XM_005210035 GCNT1 variant X1, mRNA. NM_001100309 TDRD7 Bos taurus tudor domain containing 7 (TDRD7), mRNA. XM_005210164 TDRD7 PREDICTED: Bos taurus tudor domain containing 7 (TDRD7), transcript PREDICTED: Bos taurus excision repair cross-complementing rodent repair deficiency, XM_005210398 ERCC6L2 complementation group 6-like 2 (ERCC6L2), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), NM_001046310 RAD23B Bos taurus RAD23 homolog B (S. cerevisiae) (RAD23B), mRNA. NM_001046310 RAD23B Bos taurus RAD23 homolog B (S. cerevisiae) (RAD23B), mRNA. NM_001046310 RAD23B Bos taurus RAD23 homolog B (S. cerevisiae) (RAD23B), mRNA. XM_005210503 AKAP2 PREDICTED: Bos taurus A kinase (PRKA) anchor protein 2 (AKAP2), NM_001193034 AKAP2 Bos taurus A kinase (PRKA) anchor protein 2 (AKAP2), mRNA. NM_001193034 AKAP2 Bos taurus A kinase (PRKA) anchor protein 2 (AKAP2), mRNA. XM_005210503 AKAP2 PREDICTED: Bos taurus A kinase (PRKA) anchor protein 2 (AKAP2), NM_001193034 AKAP2 Bos taurus A kinase (PRKA) anchor protein 2 (AKAP2), mRNA. XM_005210046 PRUNE2 PREDICTED: Bos taurus prune homolog 2 (Drosophila) (PRUNE2), XM_005210094 RNF38 PREDICTED: Bos taurus ring finger protein 38 (RNF38), transcript NM_001077937 ZBTB5 Bos taurus zinc finger and BTB domain containing 5 (ZBTB5), mRNA. XM_005210348 BAG1 PREDICTED: Bos taurus BCL2-associated athanogene (BAG1), transcript XM_005210348 BAG1 PREDICTED: Bos taurus BCL2-associated athanogene (BAG1), transcript XM_005210304 UBQLN1 PREDICTED: Bos taurus ubiquilin 1 (UBQLN1), transcript variant X1, XM_005210304 UBQLN1 PREDICTED: Bos taurus ubiquilin 1 (UBQLN1), transcript variant X1, NM_001078064 INIP Bos taurus chromosome 8 open reading frame, human C9orf80 (INIP), NM_001078064 INIP Bos taurus chromosome 8 open reading frame, human C9orf80 (INIP), NM_001076974 FBXW2 Bos taurus F-box and WD repeat domain containing 2 (FBXW2), mRNA. NM_001076974 FBXW2 Bos taurus F-box and WD repeat domain containing 2 (FBXW2), mRNA. NM_001076974 FBXW2 Bos taurus F-box and WD repeat domain containing 2 (FBXW2), mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_001250798 LOC617406 (LOC617406), transcript variant 2, mRNA. XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), XR_229178 LOC100848861 PREDICTED: Bos taurus uncharacterized LOC100848861 (LOC100848861), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710),

225

XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), XM_866575 NEK11 PREDICTED: Bos taurus NIMA-related kinase 11 (NEK11), transcript XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript XM_002697329 BOLA PREDICTED: Bos taurus non-classical MHC class I antigen (BOLA), NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. XM_003586456 LOC100847721 PREDICTED: Bos taurus dual specificity protein kinase TTK-like (LOC100847721), mRNA. NM_001192828 RRAGD Bos taurus Ras-related GTP binding D (RRAGD), mRNA. PREDICTED: Bos taurus synaptotagmin binding, cytoplasmic RNA interacting protein XM_003582613 SYNCRIP (SYNCRIP), transcript variant X3, mRNA. PREDICTED: Bos taurus synaptotagmin binding, cytoplasmic RNA interacting protein XM_003582613 SYNCRIP (SYNCRIP), transcript variant X3, mRNA. PREDICTED: Bos taurus synaptotagmin binding, cytoplasmic RNA interacting protein XM_002705186 SYNCRIP (SYNCRIP), transcript variant X1, mRNA. PREDICTED: Bos taurus synaptotagmin binding, cytoplasmic RNA interacting protein XM_002705186 SYNCRIP (SYNCRIP), transcript variant X1, mRNA. PREDICTED: Bos taurus synaptotagmin binding, cytoplasmic RNA interacting protein XM_589161 SYNCRIP (SYNCRIP), transcript variant X2, mRNA. NM_001079617 PCMT1 Bos taurus protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), mRNA. PREDICTED: Bos taurus myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, XM_002690394 MLLT4 Drosophila); translocated to, 4 (MLLT4), PREDICTED: Bos taurus myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, XM_002690394 MLLT4 Drosophila); translocated to, 4 (MLLT4), PREDICTED: Bos taurus myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, XM_002690394 MLLT4 Drosophila); translocated to, 4 (MLLT4), NM_001046083 RPF2 Bos taurus ribosome production factor 2 homolog (S. cerevisiae) (RPF2), mRNA. NM_001046083 RPF2 Bos taurus ribosome production factor 2 homolog (S. cerevisiae) (RPF2), mRNA. NM_001046083 RPF2 Bos taurus ribosome production factor 2 homolog (S. cerevisiae) (RPF2), mRNA. XM_005210804 FOXO3 PREDICTED: Bos taurus forkhead box O3 (FOXO3), transcript variant XM_005210804 FOXO3 PREDICTED: Bos taurus forkhead box O3 (FOXO3), transcript variant XM_005210804 FOXO3 PREDICTED: Bos taurus forkhead box O3 (FOXO3), transcript variant XM_005210863 MANEA PREDICTED: Bos taurus mannosidase, endo-alpha (MANEA), transcript NM_001191538 NHSL1 Bos taurus NHS-like 1 (NHSL1), mRNA. NM_001191538 NHSL1 Bos taurus NHS-like 1 (NHSL1), mRNA. NM_001205667 FBXO30 Bos taurus F-box protein 30 (FBXO30), mRNA. XR_232281 LOC101909710 PREDICTED: Bos taurus uncharacterized LOC101909710 (LOC101909710), PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. PREDICTED: Bos taurus chromosome 3 open reading frame, human C1orf168 (C3H1orf168), XM_002703974 C3H1orf168 mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2,

226

XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. NM_001080352 ACN9 Bos taurus ACN9 homolog (S. cerevisiae) (ACN9), mRNA. NM_001207060 ANKRD34B Bos taurus ankyrin repeat domain 34B (ANKRD34B), mRNA. PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, XR_139747 LOC100847211 PREDICTED: Bos taurus uncharacterized LOC100847211 (LOC100847211), NM_001205592 XIAP Bos taurus X-linked inhibitor of apoptosis (XIAP), mRNA. XM_005227600 MTMR1 PREDICTED: Bos taurus myotubularin related protein 1 (MTMR1), PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. PREDICTED: Bos taurus eukaryotic translation initiation factor 5B-like (LOC614207), XR_083545 LOC614207 misc_RNA. NM_001031752 BMP15 Bos taurus bone morphogenetic protein 15 (BMP15), mRNA. NM_001031752 BMP15 Bos taurus bone morphogenetic protein 15 (BMP15), mRNA. NM_001031752 BMP15 Bos taurus bone morphogenetic protein 15 (BMP15), mRNA. NM_001031752 BMP15 Bos taurus bone morphogenetic protein 15 (BMP15), mRNA. PREDICTED: Bos taurus family with sequence similarity 123B (FAM123B), transcript variant XM_584347 FAM123B X3, mRNA. NM_001098937 RPS6KA3 Bos taurus ribosomal protein S6 kinase, 90kDa, polypeptide 3 (RPS6KA3), mRNA. PREDICTED: Bos taurus ribosomal protein S6 kinase, 90kDa, polypeptide 3 (RPS6KA3), XM_005228373 RPS6KA3 transcript variant X2, mRNA. PREDICTED: Bos taurus ribosomal protein S6 kinase, 90kDa, polypeptide 3 (RPS6KA3), XM_005228375 RPS6KA3 transcript variant X4, mRNA. XM_005228441 GPM6B PREDICTED: Bos taurus glycoprotein M6B (GPM6B), transcript variant NM_001103275 ACOT11 Bos taurus acyl-CoA thioesterase 11 (ACOT11), mRNA. NM_001205784 GPC4 Bos taurus glypican 4 (GPC4), mRNA. XM_005200593 LOC508073 PREDICTED: Bos taurus melanoma-associated antigen 10-like (LOC508073), mRNA. NM_001192736 GLA Bos taurus galactosidase, alpha (GLA), mRNA. NM_001192736 GLA Bos taurus galactosidase, alpha (GLA), mRNA. NM_001192736 GLA Bos taurus galactosidase, alpha (GLA), mRNA. NM_001206461 DSEL Bos taurus dermatan sulfate epimerase-like (DSEL), mRNA. NM_001191236 ELK1 Bos taurus ELK1, member of ETS oncogene family (ELK1), mRNA. NM_001191236 ELK1 Bos taurus ELK1, member of ETS oncogene family (ELK1), mRNA. NM_001191236 ELK1 Bos taurus ELK1, member of ETS oncogene family (ELK1), mRNA. NM_001191236 ELK1 Bos taurus ELK1, member of ETS oncogene family (ELK1), mRNA. NM_174614 SMC1A Bos taurus structural maintenance of chromosomes 1A (SMC1A), mRNA. NM_174614 SMC1A Bos taurus structural maintenance of chromosomes 1A (SMC1A), mRNA. Bos taurus eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa (EIF2S3), NM_001046117 EIF2S3 mRNA. Bos taurus eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa (EIF2S3), NM_001046117 EIF2S3 mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442),

227

XR_239597 LOC101903263 PREDICTED: Bos taurus uncharacterized LOC101903263 (LOC101903263), PREDICTED: Bos taurus potassium channel tetramerization domain containing 3 (KCTD3), XM_005216780 KCTD3 transcript variant X1, mRNA. XR_226062 LOC100847759 PREDICTED: Bos taurus uncharacterized LOC100847759 (LOC100847759), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. XM_867016 LOC615257 PREDICTED: Bos taurus butyrophilin, subfamily 1, member A1-like (LOC615257), mRNA. XM_005216121 ZNF215 PREDICTED: Bos taurus zinc finger protein 215 (ZNF215), transcript NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. XR_229334 LOC101906442 PREDICTED: Bos taurus uncharacterized LOC101906442 (LOC101906442), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_206843 ASIP Bos taurus agouti signaling protein (ASIP), mRNA. XM_005198775 LOC100295951 PREDICTED: Bos taurus uncharacterized LOC100295951 (LOC100295951), NM_001040518 TM2D3 Bos taurus TM2 domain containing 3 (TM2D3), mRNA. XR_232310 LOC101910077 PREDICTED: Bos taurus uncharacterized LOC101910077 (LOC101910077), PREDICTED: Bos taurus serpin peptidase inhibitor, clade B (ovalbumin), member 6-like XM_005223911 LOC617406 (LOC617406), transcript variant X2, NM_001206364 SLAMF6 Bos taurus SLAM family member 6 (SLAMF6), mRNA. MainRNA_Refseq MainRNA_Symbol MainRNA_Desc

228

References Abd El Naby WS, Hagos TH, Hossain MM, Salilew-Wondim D, Gad AY, Rings F, Cinar MU, Tholen E, Looft C, Schellander K, et al. 2011. Expression analysis of regulatory microRNAs in bovine cumulus oocyte complex and preimplantation embryos. Zygote 21:31–51. Abounit S, Zurzolo C. 2012. Wiring through tunneling nanotubes - from electrical signals to organelle transfer. Journal of Cell Science 125:1089–1098. Adams GP, Evans AC, Rawlings NC. 1994. Follicular waves and circulating gonadotrophins in 8-month-old prepubertal heifers. Journal of Reproduction and Fertility 100:27–33. Adams GP, Jaiswal R, Singh J, Malhi P. 2008. Progress in understanding ovarian follicular dynamics in cattle. Theriogenology 69:72–80. Albuz FK, Sasseville M, Lane M, Armstrong DT, Thompson JG, Gilchrist RB. 2010. Simulated physiological oocyte maturation (SPOM): a novel in vitro maturation system that substantially improves embryo yield and pregnancy outcomes. Human Reproduction 25:2999–3011. Andaloussi SE, Mäger I, Breakefield XO, Wood MJA. 2013. Extracellular vesicles: biology and emerging therapeutic opportunities. Nature Publishing Group 12:347–357. Antar LN, Dictenberg JB, Plociniak M, Afroz R, Bassell GJ. 2005. Localization of FMRP- associated mRNA granules and requirement of microtubules for activity-dependent trafficking in hippocampal neurons. Genes Brain and Behavior 4:350–359. Aoki R, Kitaguchi T, Oya M, Yanagihara Y, Sato M, Miyawaki A, Tsuboi T. 2010. Duration of fusion pore opening and the amount of hormone released are regulated by myosin II during kiss-and-run exocytosis. Biochemical Journal 429:497–504. Ascano M, Mukherjee N, Bandaru P, Miller JB, Nusbaum JD, Corcoran DL, Langlois C, Munschauer M, Dewell S, Hafner M, et al. 2012. FMRP targets distinct mRNA sequence elements to regulate protein expression. Nature 492:382–386. Ashkar FA, Semple E, Schmidt CH, St John E, Bartlewski PM, King WA. 2010. Thyroid hormone supplementation improves bovine embryo development in vitro. Human Reproduction 25:334–344. Atay S, Gercel-Taylor C, Kesimer M, Taylor DD. 2011. Morphologic and proteomic

229

characterization of exosomes released by cultured extravillous trophoblast cells. Experimental Cell Research 317:1192–1202. Avery B, Greve T. 2000. Effects of ethanol and dimethylsulphoxide on nuclear and cytoplasmic maturation of bovine cumulus-oocyte complexes. Molecular Reproduction and Devevelopment. 55:438–445. Baker J, Hardy MP, Zhou J, Bondy C. 1996. Effects of an Igf1 gene null mutation on mouse reproduction. Molecular Endocrinology 10:903–918. Baker TG. 1963. A Quantitative and Cytological Study of Germ Cells in Human Ovaries. Proceedings of the Royal Society of London. 158: 417–433. Barckmann B, Simonelig M. 2013. Control of maternal mRNA stability in germ cells and early embryos. Biochimica and Biophsica Acta: Gene Regulatory Mechanisms 1829:714–724. Bardoni B, Davidovic L, Bensaid M, Khandjian EW. 2006. The fragile X syndrome: exploring its molecular basis and seeking a treatment. Expert Review of Molecular Medicine 8:1–16. Bardoni B, Sittler A, Shen Y, Mandel JL. 1997. Analysis of domains affecting intracellular localization of the FMRP protein. Neurobiology of Disease 4:329–336. Barlowe C, Orci L, Yeung T, Hosobuchi M, Hamamoto S, Salama N, Rexach MF, Ravazzola M, Amherdt M, Schekman R. 1994. COPII: A membrane coat formed by Sec proteins that drive vesicle budding from the endoplasmic reticulum. Cell 77:895– 907. Barnetova I, Morovic M, Strejcek F, Østrup O, Hyttel P, Niemann H, Laurincik J, Fulka J Jr., Fulka H. 2012. RNA polymerase II transcriptional silencing in growing and fully grown germinal vesicle oocytes isolated from gonadotropin-stimulated and non- stimulated gilts. Moleular Reproduction and Devevelopment 79:697–708. Barraud-Lange V, Chalas Boissonnas C, Serres C, Auer J, Schmitt A, Lefevre B, Wolf JP, Ziyyat A. 2012. Membrane transfer from oocyte to sperm occurs in two CD9- independent ways that do not supply the fertilising ability of Cd9-deleted oocytes. Reproduction 144:53–66. Bartheld Von CS, Altick AL. 2011. Multivesicular bodies in neurons: Distribution, protein content, and trafficking functions. Progress in Neurobiology 93:313–340.

230

Bashirullah A, Cooperstock RL, Lipshitz HD. 1998. RNA localization in development. Annual Reviews in Biochemistry 67:335–394. Baumann CG, Morris DG, Sreenan JM, Leese HJ. 2007. The quiet embryo hypothesis: Molecular characteristics favoring viability. Molecular Reproducction and Devevelpoment. 74:1345–1353. Belleannee C, Calvo E, Caballero J, Sullivan R. 2013. Epididymosomes Convey Different Repertoires of MicroRNAs Throughout the Bovine Epididymis. Biology of Reproduction 89:30–30. Belting M, Wittrup A. 2008. Nanotubes, exosomes, and nucleic acid-binding peptides provide novel mechanisms of intercellular communication in eukaryotic cells: implications in health and disease. The Journal of Cell Biology 183:1187–1191. Betteridge KJ. 2003. A history of farm animal embryo transfer and some associated techniques. Animal Reproduction Science 79:203–244. Bezares-Calderón LA, Becerra A, Salinas LS, Maldonado E, Navarro RE. 2010. Bioinformatic analysis of P granule-related proteins: insights into germ granule evolution in nematodes. Developmental Genes and Evolultion 220:41–52. Bhojwani S, Alm H, Torner H, Kanitz W, Poehland R. 2007. Selection of developmentally competent oocytes through brilliant cresyl blue stain enhances blastocyst development rate after bovine nuclear transfer. Theriogenology 67:341–345. Biggers JD, Whittingham DG, Donahue RP. 1967. The pattern of energy metabolism in the mouse oöcyte and zygote. Proceedings of the National Academy of Science 58: 560– 567. Blackmore DG. 2004. Biosynthesis of the Canine Zona Pellucida Requires the Integrated Participation of Both Oocytes and Granulosa Cells. Biology of Reproduction 71:661– 668. Block J, Wrenzycki C, Niemann H, Herrmann D, Hansen PJ. 2008. Effects of insulin-like growth factor-1 on cellular and molecular characteristics of bovine blastocysts produced in vitro. Molecular Reproduction and Development 75:895–903. Blondin P, Coenen K, Sirard MA. 1997. The impact of reactive oxygen species on bovine sperm fertilizing ability and oocyte maturation. Journal of Andrology 18:454–460. Blondin P, Guilbault LA, Sirard MA. 1995. In vitro production of bovine embryos:

231

Developmental competence is acquired before maturation. Theriogenology 43:168. Blondin P, Sirard MA. 1995. Oocyte and follicular morphology as determining characteristics for developmental competence in bovine oocytes. Molecular Reproduction and Development 41:54–62. Bobrie A, Colombo M, Krumeich S, Raposo G, Théry C. 2012. Diverse subpopulations of vesicles secreted by different intracellular mechanisms are present in exosome preparations obtained by differential ultracentrifugation. Journal of Extracellular Vesicles 1:834–11. Bonifacino JS, Glick BS. 2004. The mechanisms of vesicle budding and fusion. Cell 116:153–166. Bontekoe CJM, McIlwain KL, Nieuwenhuizen IM, Yuva-Paylor LA, Nellis A, Willemsen R, Fang Z, Kirkpatrick L, Bakker CE, McAninch R, et al. 2002. Knockout mouse model for Fxr2: a model for mental retardation. Human Molecular Genetics 11:487– 498. Bouniol-Baly C, Hamraoui L, Guibert J, Beaujean N, Szöllösi MS, Debey P. 1999. Differential transcriptional activity associated with chromatin configuration in fully grown mouse germinal vesicle oocytes. Biology of Reproduction 60:580–587. Bousquet D, Burnside EB, Van Doormaal BJ. 2003. Biotechnologies of reproduction applied to dairy cattle production: Embryo transfer and IVF. Canadian Journal of Animal Science 83:403–407. Bouvet P, Wolffe AP. 1994. A role for transcription and FRGY2 in masking maternal mRNA within Xenopus oocytes. Cell 77:931–941. Brengues M. 2005. Movement of Eukaryotic mRNAs Between Polysomes and Cytoplasmic Processing Bodies. Science 310:486–489. Brison DR, Houghton FD, Falconer D, Roberts SA, Hawkhead J, Humpherson PG, Lieberman BA, Leese HJ. 2004. Identification of viable embryos in IVF by non- invasive measurement of amino acid turnover. Human Reproduction. 19:2319–2324. Bu S, Xie H, Tao Y, Wang J, Xia G. 2004. Nitric oxide influences the maturation of cumulus cell-enclosed mouse oocytes cultured in spontaneous maturation medium and hypoxanthine-supplemented medium through different signaling pathways. Molecular and Cellular Endocrinology 223:85–93.

232

Buijsen RAM, Sellier C, Severijnen L-AWFM, Oulad-Abdelghani M, Verhagen RFM, Berman RF, Charlet-Berguerand N, Willemsen R, Hukema RK. 2014. FMRpolyG- positive inclusions in CNS and non-CNS organs of a fragile X premutation carrier with fragile X-associated tremor/ataxia syndrome. Acta Neuropathologica Communications 2:162. Bunel A, Nivet AL, Blondin P, Vigneault C, Richard FJ, Sirard MA. 2014. Cumulus cell gene expression associated with pre-ovulatory acquisition of developmental competence in bovine oocytes. Reproduction Fertility and Development 26:855–11. Caballero J, Gilbert I, Fournier E, Gagné D, Scantland S, Macaulay A, Robert C. 2014. Exploring the function of long non-coding RNA in the development of bovine early embryos. Reproduction Fertility and Development 27:40–52. Caballero JN, Frenette G, Belleannée C, Sullivan R. 2013. CD9-Positive Microvesicles Mediate the Transfer of Molecules to Bovine Spermatozoa during Epididymal Maturation. PLoS ONE 8:e65364–12. Caballero JN, Gervasi MG, Veiga MF, Dalvit GC, Perez-Martínez S, Cetica PD, Vazquez- Levin MH. 2014. Epithelial cadherin is present in bovine oviduct epithelial cells and gametes, and is involved in fertilization-related events. Theriogenology 81:1189–1206. Cai C, Tamai K, Molyneaux K. 2010. KHDC1B is a novel CPEB binding partner specifically expressed in mouse oocytes and early embryos. Moleculr Biology of the Cell 21:3137–3148. Calder MD, Caveney AN, Smith LC, Watson AJ. 2003. Responsiveness of bovine cumulus-oocyte-complexes (COC) to porcine and recombinant human FSH, and the effect of COC quality on gonadotropin receptor and Cx43 marker gene mRNAs during maturation in vitro. Reproductive Biology and Endocrinology 1:14. Calder MD, Madan P, Watson AJ. 2008. Bovine oocytes and early embryos express Staufen and ELAVL RNA-binding proteins. Zygote 16:1–8. Cao Q, Richter JD. 2002. Dissolution of the maskin–eIF4E complex by cytoplasmic

polyadenylation and poly (A)‐binding protein controls cyclin B1 mRNA translation and oocyte maturation. The EMBO Journal 21:3852–3862. Castrillon DH. 2003. Suppression of Ovarian Follicle Activation in Mice by the Transcription Factor Foxo3a. Science 301:215–218.

233

Chang HC. 2005. Developmental incompetency of denuded mouse oocytes undergoing maturation in vitro is ooplasmic in nature and is associated with aberrant Oct-4 expression. Human Reproduction 20:1958–1968. Charlesworth A, Cox LL, MacNicol AM. 2004. Cytoplasmic Polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent Mechanisms Regulate Early Class Maternal mRNA Translational Activation in Xenopus Oocytes. Journal of Biological Chemistry 279:17650–17659. Chesnel F, Eppig JJ. 1995. Synthesis and accumulation of p34cdc2 and cyclin B in mouse oocytes during acquisition of competence to resume meiosis. Molecular Reproduction and Development 40:503–508. Chuan S, Homer M, Pandian R, Conway D, Garzo G, Yeo L, Su HI. 2014. Hyperglycosylated human chorionic gonadotropin as an early predictor of pregnancy outcomes after in vitro fertilization. Fertility and Sterility 101:392–398. Clark MB, Mattick JS. 2011. Long noncoding RNAs in cell biology. Seminars in Cell and Developmental Biology 22:366–376. Cleary JD, Ranum LPW. 2013. Repeat-associated non-ATG (RAN) translation in neurological disease. Human Molecular Genetics 22:R45–51. Collier B, Gorgoni B, Loveridge C, Cooke HJ, Gray NK. 2005. The DAZL family proteins are PABP-binding proteins that regulate translation in germ cells. The EMBO Journal 24:2656–2666. Combelles CMH, Cekleniak NA, Racowsky C, Albertini DF. 2002. Assessment of nuclear and cytoplasmic maturation in in-vitro matured human oocytes. Human Reproduction 17:1006–1016. Conti M, Andersen CB, Richard F, Mehats C, Chun SY, Horner K, Jin C, Tsafriri A. 2002. Role of cyclic nucleotide signaling in oocyte maturation. Molecular and Cellular Endocrinology 187:153–159. Cordin O, Banroques J, Tanner NK, Linder P. 2006. The DEAD-box protein family of RNA helicases. Gene 367:17–37. Cosson B, Gautier-Courteille C, Maniey D, Aït-Ahmed O, Lesimple M, Osborne HB, Paillard L. 2012. Oligomerization of EDEN-BP is required for specific mRNA deadenylation and binding. Biology of the Cell 98:653–665.

234

Coticchio G, Guglielmo MC, Albertini DF, Dal Canto M, Mignini Renzini M, De Ponti E, Fadini R. 2014. Contributions of the actin cytoskeleton to the emergence of polarity during maturation in human oocytes. Molecular Human Reproduction 20:200–207. Coticchio G, Guglielmo MC, Dal Canto M, Fadini R, Mignini Renzini M, De Ponti E, Brambillasca F, Albertini DF. 2013. Mechanistic foundations of the metaphase II spindle of human oocytes matured in vivo and in vitro. Human Reproduction 28:3271– 3282. Coticchio Giovani, Albertini DF, De Santis L. 2013 Apr 9. Oogenesis. :1–361. Coticchio Giovanni, Dal-Canto M, Guglielmo M-C, Mignini-Renzini M, Fadini R. 2012. Human oocyte maturation in vitro. Internation Journal of Developmental Biology. 56:909–918. Cougot N. 2004. Cytoplasmic foci are sites of mRNA decay in human cells. The Journal of Cell Biology 165:31–40. Craig A, Haghighat A, Annie TK, Sonenberg N. 1998. Interaction of polyadenylate-binding protein with the eIF4G homologue PAIP enhances translation. Nature 392:520–523. Craig ZR, Wang W, Flaws JA. 2011. Endocrine-disrupting chemicals in ovarian function: effects on steroidogenesis, metabolism and nuclear receptor signaling. Reproduction 142:633–646. da Silveira JC, Veeramachaneni DNR, Winger QA, Carnevale EM, Bouma GJ. 2012. Cell- secreted vesicles in equine ovarian follicular fluid contain miRNAs and proteins: a possible new form of cell communication within the ovarian follicle. Biology of Reproduction 86:71. Darnell JC, Van Driesche SJ, Zhang C, Hung KYS, Mele A, Fraser CE, Stone EF, Chen C, Fak JJ, Chi SW, et al. 2011. FMRP Stalls Ribosomal Translocation on mRNAs Linked to Synaptic Function and Autism. Cell 146:247–261. Davidovic L, Jaglin XH, Lepagnol-Bestel A-M, Tremblay S, Simonneau M, Bardoni B, Khandjian EW. 2007. The fragile X mental retardation protein is a molecular adaptor between the neurospecific KIF3C kinesin and dendritic RNA granules. Human Molecular Genetics 16:3047–3058. Davies PJ, Davies DR, Levitzki A, Maxfield FR, Milhaud P, Willingham MC, Pastan IH. 1980. Transglutaminase is essential in receptor-mediated endocytosis of alpha 2-

235

macroglobulin and polypeptide hormones. Nature 283:162–167. Davis-Dusenbery BN, Hata A. 2014. Smad-mediated miRNA processing. RNA Biology 8:71–76. De Bem T, Adona PR, Bressan FF, Mesquita LG, Chiaratti MR, Meirelles FV, Leal C. 2014. The Influence of Morphology, Follicle Size and Bcl-2 and Bax Transcripts on the Developmental Competence of Bovine Oocytes. Reprod Dom Anim 49:576–583. de Bruin JP. 2004. Age-Related Changes in the Ultrastructure of the Resting Follicle Pool in Human Ovaries. Biology of Reproduction 70:419–424. de Heredia ML, Jansen R-P. 2004. mRNA localization and the cytoskeleton. Current Opinion in Cell Biology 16:80–85. De Smedt V, Szöllösi D. 1991. Cytochalasin D treatment induces meiotic resumption in follicular sheep oocytes. Molecular Reproduction and Development 29:163–171. Dekel N. 2005. Cellular, biochemical and molecular mechanisms regulating oocyte maturation. Molecular and Cellular Endocrinology 234:19–25. Dekel N, Hechor E, Ben-yehosua-josefserg L, Galiani D, Girsh E, Garnot I, kaufman O, kovo-hasharoni M, Lasar S, Shimoni I. 2000 Jan 18. Mechanisms involved in control of cell cycle: meiosis in oocytes and mitosis in early embryos. :1–2. Dekel N, Sherizly I. 1985. Epidermal growth factor induces maturation of rat follicle- enclosed oocytes. Endocrinology 116:406–409. Deng W, Lin H. 1997. Spectrosomes and Fusomes Anchor Mitotic Spindles during Asymmetric Germ Cell Divisions and Facilitate the Formation of a Polarized Microtubule Array for Oocyte Specification in Drosophila. Developmental Biology 189:79–94. Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, Guernec G, Martin D, Merkel A, Knowles DG, et al. 2012. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Research 22:1775–1789. Dey SR, Deb GK, Ha AN, Lee JI, Bang JI, Lee KL, Kong IK. 2012. Coculturing denuded oocytes during the in vitro maturation of bovine cumulus oocyte complexes exerts a synergistic effect on embryo development. Theriogenology 77:1064–1077. Didiot MC, Subramanian M, Flatter E, Mandel J-L, Moine H. 2009. Cells lacking the

236

fragile X mental retardation protein (FMRP) have normal RISC activity but exhibit altered stress granule assembly. Molecular Biology of the Cell 20:428–437. Dimond A, Fraser P. 2013. Long Noncoding RNAs Xist in Three Dimensions. Science 341:720–721. Dinger ME, Mercer TR, Mattick JS. 2008. RNAs as extracellular signaling molecules. Journal of Molecular Endocrinology 40:151–159. Dolzhanskaya N, Merz G, Denman RB. 2006. Oxidative stress reveals heterogeneity of FMRP granules in PC12 cell neurites. Brain Research 1112:56–64. Driancourt MA. 2001. Regulation of ovarian follicular dynamics in farm animals. Implications for manipulation of reproduction. Theriogenology 55:1211–1239. Driancourt MA, Reynaud K, Cortvrindt R, Smitz J. 2000. Roles of KIT and KIT LIGAND in ovarian function. Reviews in Reproduction 5:143–152. Duszewska AM, Reklewski Z, Pieńkowski M, Karasiewicz J, Modliński JA. 2000. Development of bovine embryos on Vero/BRL cell monolayers (mixed co-culture). Theriogenology 54:1239–1247. Edwards RG. 1965. Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and human ovarian oocytes. Nature 208:349–351. Elis S, Batellier F, Couty I, Balzergue S, Martin-Magniette M-L, Monget P, Blesbois E, Govoroun MS. 2008. Search for the genes involved in oocyte maturation and early embryo development in the hen. BMC Genomics 9:110–20. Eppig JJ. 1991. Intercommunication between mammalian oocytes and companion somatic cells. Bioessays 13:569–574. Erickson BH. 1966a. Development and radio-response of the prenatal bovine ovary. Reproduction 11:97–105. Erickson BH. 1966b. Development and senescence of the postnatal bovine ovary. Journal of Animal Science 25:800–805. Erickson G. 2008. Follicle Growth and Development. Global Librrary of Womens Medicine Available Online: http://www.glowm.com/section_view/heading/Follicle %20Growth%20and%20 Development/item/288 [accessed 2015 Nov 9] Eulalio A, Behm-Ansmant I, Schweizer D, Izaurralde E. 2007. P-Body Formation Is a Consequence, Not the Cause, of RNA-Mediated Gene Silencing. Molecular and

237

Cellular Biology 27:3970–3981. Faerge I, Grondahl C, Ottesen JL, Hyttel P. 2001. Autoradiographic localization of specific binding of meiosis-activating sterol to cumulus-oocyte complexes from marmoset, cow, and mouse. Biology of Reproduction 64:527–536. Faini M, Beck R, Wieland FT, Briggs JAG. 2013 Mar 14. Vesicle coats: structure, function, and general principles of assembly. Trends in Cell Biology:1–10. Faini M, Prinz S, Beck R, Schorb M, Riches JD, Bacia K, Brugger B, Wieland FT, Briggs JAG. 2012. The Structures of COPI-Coated Vesicles Reveal Alternate Coatomer Conformations and Interactions. Science 336:1451–1454. Fair T. 2003. Follicular oocyte growth and acquisition of developmental competence. Animal Reproduction Science 78:203–216. Fair T, Hulshof S, Hyttel P, Greve T. 1997. Nucleus ultrastructure and transcriptional activity of bovine oocytes in preantral and early antral follicles. Molecular Reproduction and Development 46:208–215. Fair T, Hulshof SC, Hyttel P, Greve T, Boland M. 1997. Oocyte ultrastructure in bovine primordial to early tertiary follicles. Anatomy and Embryology 195:327–336. Fair T, Hyttel P, Greve T. 1995. Bovine oocyte diameter in relation to maturational competence and transcriptional activity. Molecular Reproduction and Development 42:437–442. Fang Y, Wu N, Gan X, Yan W, Morrell JC, Gould SJ. 2007. Higher-Order Oligomerization Targets Plasma Membrane Proteins and HIV Gag to Exosomes. Plos Biology 5:e158– 17. Feng G, Shi D, Yang S, Wang X. 2012. Co-culture embedded in cumulus clumps promotes maturation of denuded oocytes and reconstructs gap junctions between oocytes and cumulus cells. Zygote 21:231–237. Ferrandon D, Elphick L, Nüsslein-Volhard C, Johnston DS. 1994. Staufen protein associates with the 3′UTR of bicoid mRNA to form particles that move in a microtubule-dependent manner. Cell 79:1221–1232. Flemr M, Ma J, Schultz RM, Svoboda P. 2010. P-Body Loss Is Concomitant with Formation of a Messenger RNA Storage Domain in Mouse Oocytes. Biology of Reproduction 82:1008–1017.

238

Fortune JE. 1994. Ovarian follicular growth and development in mammals. Biology of Reproduction 50:225–232. Franciosi F, Coticchio G, Lodde V, Tessaro I, Modina SC, Fadini R, Dal Canto M, Renzini MM, Albertini DF, Luciano AM. 2014. Natriuretic Peptide Precursor C Delays Meiotic Resumption and Sustains Gap Junction-Mediated Communication in Bovine Cumulus- Enclosed Oocytes. Biology of Reproduction 91:61–61. Gandolfi TA, Gandolfi F. 2001. The maternal legacy to the embryo: cytoplasmic components and their effects on early development. Theriogenology 55:1255–1276. Gerdes H-H, Carvalho RN. 2008. Intercellular transfer mediated by tunneling nanotubes. Current Opinion in Cell Biology 20:470–475. Ghaffari Novin M, Heidari M, Akhondi MA, Jeddi Tehrani M. 2007. In vitro application of Matrigel enhances human blastocyst formation and hatching. Iranian Journal of Reproductive Medicine 5. Giacobini P, Parkash J, Campagne C, Messina A, Casoni F, Vanacker C, Langlet F, Hobo B, Cagnoni G, Gallet S, et al. 2014. Brain Endothelial Cells Control Fertility through Ovarian-Steroid–Dependent Release of Semaphorin 3A. Harris WA, editor. PLoS Biology 12:e1001808–18. Gibbings DJ, Ciaudo C, Erhardt M, Voinnet O. 2009. Multivesicular bodies associate with components of miRNA effector complexes and modulate miRNA activity. Nature: Cell Biology 11:1143–1149. Gilbert I, Scantland S, Sylvestre E-L, Gravel C, Laflamme I, Sirard M-A, Robert C. 2009. The dynamics of gene products fluctuation during bovine pre-hatching development. Molecular Reproduction and Development 76:762–772. Gilchrist RB. 2011. Recent insights into oocyte - follicle cell interactions provide opportunities for the development of new approaches to in vitro maturation. Reproduction Fertility and Development 23:23–9. Ginther OJ, Wiltbank MC, Fricke PM, Gibbons JR, Kot K. 1996. Selection of the dominant follicle in cattle. Biology of Reproduction 55:1187–1194. Girard A, Dufort I, Douville G, Sirard M-A. 2015. Global gene expression in granulosa cells of growing, plateau and atretic dominant follicles in cattle. Reproductive Biology and Endocrinology 13:17.

239

Gleicher N, Barad DH. 2010. The FMR1 gene as regulator of ovarian recruitment and ovarian reserve. Obstetrical & Gynecological Survey 65:523–530. Gohin M, Fournier E, Dufort I, Sirard M-A. 2014. Discovery, identification and sequence analysis of RNAs selected for very short or long poly A tail in immature bovine oocytes. Molecular Human Reproduction 20:127–138. Granot I, Dekel N. 2002. The ovarian gap junction protein connexin43: regulation by gonadotropins. Trends Endocrinology and Metabolism. 13:310–313. Grant B, Hirsh D. 1999. Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Molecular Biology of the Cell 10:4311–4326. Grieshaber NA, Ko C, Grieshaber SS, Ji I, Ji TH. 2003. Follicle-Stimulating Hormone- Responsive Cytoskeletal Genes in Rat Granulosa Cells: Class I β-Tubulin, Tropomyosin-4, and Kinesin Heavy Chain. Endocrinology 144:29–39. Griffin J, Emery BR, Huang I, Peterson CM, Carrell DT. 2006. Comparative analysis of follicle morphology and oocyte diameter in four mammalian species (mouse, hamster, pig, and human). Journal of Experimental and Clinical Reproduction 3:2–9. Groisman I, Huang YS, Mendez R, Cao Q, Richter JD. 2001. Translational control of embryonic cell division by CPEB and maskin. Cold Spring Harbor Symposia on Quantitative Biology 66:345–351. Gu W, Tekur S, Reinbold R, Eppig JJ, Choi YC, Zheng JZ, Murray MT, Hecht NB. 1998. Mammalian male and female germ cells express a germ cell-specific Y-Box protein, MSY2. Biology of Reproduction 59:1266–1274. Gutiérrez-Vázquez C, Villarroya-Beltri C, Mittelbrunn M, Sánchez-Madrid F. 2013. Transfer of extracellular vesicles during immune cell-cell interactions. Immunological Reviews 251:125–142. Guzman LM, Ortega-Hrepich C, Albuz F, Verheyen G, Devroey P, Smitz J, De Vos M. 2012. Developmental capacity of in vitro–matured human oocytes retrieved from polycystic ovary syndrome ovaries containing no follicles larger than 6 mm. Fertility and Sterility 98:503–507.e2. Hemmerich P, Mikecz von A, Neumann F, Sözeri O, Wolff-Vorbeck G, Zoebelein R, Krawinkel U. 1993. Structural and functional properties of ribosomal protein L7 from humans and rodents. Nucleic Acids Research 21:223–231.

240

Hickey TE. 2005. Androgens Augment the Mitogenic Effects of Oocyte-Secreted Factors and Growth Differentiation Factor 9 on Porcine Granulosa Cells. Biology of Reproduction 73:825–832. Hogström L, Mark J. 2007. Fragile X syndrome: relation to premature ovarian failure and infertility treatment. Acta Obstetrics and Gynecological Scandinavia 86:244–246. Hsu C, Morohashi Y, Yoshimura SI, Manrique-Hoyos N, Jung S, Lauterbach MA, Bakhti M, Gronborg M, Mobius W, Rhee J, et al. 2010. Regulation of exosome secretion by Rab35 and its GTPase-activating proteins TBC1D10A-C. The Journal of Cell Biology 189:223–232. Hurst S, Talbot NJ, Stebbings H. 1999. A staufen-like RNA-binding protein in translocation channels linking nurse cells to oocytes in Notonecta shows nucleotide- dependent attachment to microtubules. Journal of Cell Science 112:2947–2955. Hurtig J, Chiu DT, Önfelt B. 2010. Intercellular nanotubes: insights from imaging studies and beyond. WIREs Nanomed Nanobiotechnol 2:260–276. Hussein TS, Thompson JG, Gilchrist RB. 2006. Oocyte-secreted factors enhance oocyte developmental competence. Developmental Biology 296:514–521. Hyttel P. 1987. Bovine cumulus-oocyte disconnection in vitro. Anatomy and Embryology 176:41–44. Hyttel P. 2012. Electron Microscopy of Mammalian Oocyte Development, Maturation and Fertilization. Bentham Science Publishers. Pp. 1-37 Hyttel P, Fair T, Callesen H, Greve T. 1997. Oocyte growth, capacitation and final maturation in cattle. Theriogenology 47:23–32. Hyttel P, Xu KP, Smith S, Greve T. 1986. Ultrastructure of in-vitro oocyte maturation in cattle. Journal of Reproduction and Fertility 78:615–625. Irion U, Adams J, Chang C-W, St Johnston D. 2006. Miranda couples oskar mRNA/Staufen complexes to the bicoid mRNA localization pathway. Developmental Biology 297:522–533. Irving-Rodgers HF, van Wezel IL, Mussard ML, Kinder JE, Rodgers RJ. 2001. Atresia revisited: two basic patterns of atresia of bovine antral follicles. Reproduction 122:761–775. Ivanov AI. 2008. Pharmacological inhibition of endocytic pathways: is it specific enough to

241

be useful? Methods in Molecular Biology. 440:15–33.

Jaffe LA, Norris RP. 2010. Initiation of the Meiotic Prophase‐to‐Metaphase Transition in Mammalian Oocytes. Oogenesis: The Universal Process. Chichester, UK: John Wiley & Sons, Ltd. Pp 179-197. Jansen RP. 2001. mRNA localization: message on the move. Nature Reviews: Molecular and Cellular Biology 2:247–256. Johnson ML, Redmer DA, Reynolds LP, Grazul-Bilska AT. 1999. Expression of gap junctional proteins connexin 43, 32, and 26 throughout follicular development and atresia in cows. Endocrine 10:43–51. Kahvejian A, Roy G, Sonenberg N. 2001. The mRNA Closed-loop Model: The Function of PABP and PABP-interacting Proteins in mRNA Translation. Cold Spring Harbor Symposia on Quantitative Biology 66:293–300. Kaji K, Oda S, Shikano T, Ohnuki T, Uematsu Y, Sakagami J, Tada N, Miyazaki S, Kudo A. 2000. The gamete fusion process is defective in eggs of Cd9-deficient mice. Nature Genetics 24:279–282. Kane DA, Kimmel CB. 1993. The zebrafish midblastula transition. Development 119:447– 456. Katakowski M, Buller B, Wang X, Rogers T, Chopp M. 2010. Functional MicroRNA Is Transferred between Glioma Cells. Cancer Research 70:8259–8263. Kearse MG, Todd PK. 2014. Repeat-Associated Non-AUG Translation and Its Impact in Neurodegenerative Disease. Neurotherapeutics 11:721–731. Kedersha N, Stoecklin G, Ayodele M, Yacono P, Lykke-Andersen J, Fritzler MJ, Scheuner D, Kaufman RJ, Golan DE, Anderson P. 2005 Jun 20. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. The Journal of Cell Biology:871–884. Kenigsberg S, Bentov Y, Chalifa-Caspi V, Potashnik G, Ofir R, Birk OS. 2008. Gene expression microarray profiles of cumulus cells in lean and overweight-obese polycystic ovary syndrome patients. Molecular Human Reproduction 15:89–103. Keskintepe L, Brackett BG. 1996. In vitro developmental competence of in vitro-matured bovine oocytes fertilized and cultured in completely defined media. Biology of Reproduction 55:333–339.

242

Khandjian EW, Corbin F, Woerly S, Rousseau F. 1996. The fragile X mental retardation protein is associated with ribosomes. Nat Genet 12:91–93. Kidder GM, Mhawi AA. 2002. Gap junctions and ovarian folliculogenesis. Reproduction 123:613–620. Kim JH, Richter JD. 2006. Opposing Polymerase-Deadenylase Activities Regulate Cytoplasmic Polyadenylation. Molecular Cell 24:173–183. Kim JY. 2012. Control of ovarian primordial follicle activation. Clinical and Experimental Reproductive Medicine 39:10–5. Kirchhausen ECFASBT, Aguet F, Boulant S, Kirchhausen T. 2012. The First Five Seconds in the Life of a Clathrin-Coated Pit. Cell 150:495–507. Kishimoto T. 2003. Cell-cycle control during meiotic maturation. Current Opinion in Cell Biology 15:654–663. Knight PG, Glister C. 2001. Potential local regulatory functions of inhibins, activins and follistatin in the ovary. Reproduction 121:503–512. Knight PG, Glister C. 2006. TGF- superfamily members and ovarian follicle development. Reproduction 132:191–206. Kotani T, Yasuda K, Ota R, Yamashita M. 2013. Cyclin B1 mRNA translation is temporally controlled through formation and disassembly of RNA granules. The Journal of Cell Biology 202:1041–1055. Kouranti I, Sachse M, Arouche N, Goud B, Echard A. 2006. Rab35 Regulates an Endocytic Recycling Pathway Essential for the Terminal Steps of Cytokinesis. Current Biology 16:1719–1725.

Kubisch HM, Larson MA, Kiesling DO. 2001. Control of interferon‐τ secretion by in vitro‐ derived bovine blastocysts during extended culture and outgrowth formation. Molecular Reproduction and Development 58:390–397. La Fuente De R. 2006. Chromatin modifications in the germinal vesicle (GV) of mammalian oocytes. Developmental Biology 292:1–12. La Fuente De R, Eppig JJ. 2001. Transcriptional Activity of the Mouse Oocyte Genome: Companion Granulosa Cells Modulate Transcription and Chromatin Remodeling. Developmental Biology 229:224–236. La Fuente De R, O'Brien MJ, Eppig JJ. 1999. Epidermal growth factor enhances

243

preimplantation developmental competence of maturing mouse oocytes. Human Reproduction. 14:3060–3068. Labrecque R, Vigneault C, Blondin P, Sirard M-A. 2014. Gene expression analysis of bovine oocytes at optimal coasting time combined with GnRH antagonist during the no-FSH period. Theriogenology 81:1092–1100. Lalancette C, Miller D, Li Y, Krawetz SA. 2008. Paternal contributions: New functional insights for spermatozoal RNA. Journal of Cellular Biochemistry 104:1570–1579. Lazzaroni L, Fusi FM, Doldi N, Ferrari A. 1999. The use of Matrigel at low concentration enhances in vitro blastocyst formation and hatching in a mouse embryo model. Fertility and Sterility 71:1133–1137. Le Hir H, Gatfield D, Izaurralde E, Moore MJ. 2001. The exon–exon junction complex

provides a binding platform for factors involved in mRNA export and nonsense‐ mediated mRNA decay. The EMBO Journal 20:4987–4997. Lee YL, Xu JS, Chan ST, Ho PC, Yeung WS. 2001. Vero cells, but not oviductal cells, increase the hatching frequency and total cell count of mouse blastocysts partly by changing energy substrate concentrations in culture medium. Journal of Assisted Reproductive Genetics 18:566–574. Leese HJ, Sturmey RG, Baumann CG, McEvoy TG. 2007. Embryo viability and metabolism: obeying the quiet rules. Human Reproduction 22:3047–3050. Li C. 2009. Fragile X Mental Retardation Protein is involved in protein synthesis- dependent collapse of growth cones induced by Semaphorin-3A. Front. Neural Circuits 3:1–10. Lin M-D, Jiao X, Grima D, Newbury SF, Kiledjian M, Chou T-B. 2008. Drosophila processing bodies in oogenesis. Developmental Biology 322:276–288. Linder P. 2006. Dead-box proteins: a family affair--active and passive players in RNP- remodeling. Nucleic Acids Research 34:4168–4180. Liu YX, Hsueh AJ. 1986. Synergism between granulosa and theca-interstitial cells in estrogen biosynthesis by gonadotropin-treated rat ovaries: studies on the two-cell, two- gonadotropin hypothesis using steroid antisera. Biology of Reproduction 35:27–36. Lodde V, Modina S, Maddox-Hyttel P, Franciosi F, Lauria A, Luciano AM. 2008. Oocyte morphology and transcriptional silencing in relation to chromatin remodeling during

244

the final phases of bovine oocyte growth. Molecular Reproduction and Developmetn 75:915–924. Lodish H, Blerk A, Kaiser CA, Krieger M, Bretscher A, Ploegh H, Amon A, Scott MP. 2012. Molecular Cell Biology. W.H. Freeman. Lowther KM, Nikolaev VO, Mehlmann LM. 2011. Endocytosis in the mouse oocyte and its contribution to cAMP signaling during meiotic arrest. Reproduction 141:737–747. Lu CL, Yan J, Zhi X, Xia X, Wang TR, Yan LY, Yu Y, Ding T, Gao JM, Li R, et al. 2015. Basic fibroblast growth factor promotes macaque follicle development in vitro. Reproduction 149:425–433. Luciano AM, Franciosi F, Modina SC, Lodde V. 2011. Gap Junction-Mediated Communications Regulate Chromatin Remodeling During Bovine Oocyte Growth and Differentiation Through cAMP-Dependent Mechanism(s). Biology of Reproduction 85:1252–1259. Luciano AM, Lodde V, Beretta MS, Colleoni S, Lauria A, Modina S. 2005. Developmental capability of denuded bovine oocyte in a Co-culture system with intact cumulus-oocyte complexes: Role of cumulus cells, cyclic adenosine 3',5'-monophosphate, and glutathione. Molecular Reproduction and Development 71:389–397. Lund SA, Murdoch J, Van Kirk EA, Murdoch WJ. 1999. Mitogenic and antioxidant mechanisms of estradiol action in preovulatory ovine follicles: relevance to luteal function. Biology of Reproduction 61:388–392. Lunov O, Zablotskii V, Syrovets T, Röcker C, Tron K, Nienhaus GU, Simmet T. 2011. Modeling receptor-mediated endocytosis of polymer-functionalized iron oxide nanoparticles by human macrophages. Biomaterials 32:547–555. Ma J, Flemr M, Stein P, Berninger P, Malik R, Zavolan M, Svoboda P, Schultz RM. 2010. MicroRNA Activity Is Suppressed in Mouse Oocytes. Current Biology 20:265–270. Macaulay AD, Hamilton CK, King WA, Bartlewski PM. 2013. Influence of physiological concentrations of androgens on the developmental competence and sex ratio of in vitro produced bovine embryos. Reproductive Biology 13:41–50. Magoffin DA. 2005. Ovarian theca cell. The International Journal of Biochemistry & Cell Biology 37:1344–1349. Mamo S, Carter F, Lonergan P, Leal CL, Naib Al A, McGettigan P, Mehta JP, Evans AC,

245

Fair T. 2011. Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation. BMC Genomics 12:151. Marson A, Levine SS, Cole MF, Frampton GM, Brambrink T, Johnstone S, Guenther MG, Johnston WK, Wernig M, Newman J, et al. 2008. Connecting microRNA Genes to the Core Transcriptional Regulatory Circuitry of Embryonic Stem Cells. Cell 134:521– 533. Martineau Y, Derry MC, Wang X, Yanagiya A, Berlanga JJ, Shyu AB, Imataka H, Gehring K, Sonenberg N. 2008. Poly(A)-Binding Protein-Interacting Protein 1 Binds to Eukaryotic Translation Initiation Factor 3 To Stimulate Translation. Molecular and Cellular Biology 28:6658–6667. Marzo L, Gousset K, Zurzolo C. 2012. Multifaceted Roles of Tunneling Nanotubes in Intercellular Communication. Frontiers in Physiology 3: 1-14 Mastromonaco GF, Semple E, Robert C, Rho GJ, Betts DH, King WA. 2004. Different culture media requirements of IVF and nuclear transfer bovine embryos. Reproduction in Domestic Animals 39:462–467. Masui Y. 2001. From oocyte maturation to the in vitro cell cycle: the history of discoveries of Maturation-Promoting Factor (MPF) and Cytostatic Factor (CSF). Differentiation 69:1–17. Matwee C, Betts DH, King WA. 2000. Apoptosis in the early bovine embryo. Zygote 8:57– 68. Mayor S, Pagano RE. 2007. Pathways of clathrin-independent endocytosis. Nature Reviews: Molecular and Cellular Biology 8:603–612. McCleland ML, Shermoen AW, O'Farrell PH. 2009. DNA replication times the cell cycle and contributes to the mid-blastula transition in Drosophila embryos. The Journal of Cell Biology 187:7–14. McLaughlin EA, McIver SC. 2008. Awakening the oocyte: controlling primordial follicle development. Reproduction 137:1–11. Melko M, Bardoni B. 2010. The role of G-quadruplex in RNA metabolism: Involvement of FMRP and FMR2P. Biochimie 92:919–926. Meng W, Takeichi M. 2009. Adherens Junction: Molecular Architecture and Regulation.

246

Cold Spring Harbor Perspectives in Biology 1:a002899–a002899. Mermillod P, Marchal R. 1999. La maturation de l'ovocyte de mammifères. médecine/sciences 15:148. Mientjes EJ. 2004. Fxr1 knockout mice show a striated muscle phenotype: implications for Fxr1p function in vivo. Human Molecular Genetics 13:1291–1302. Miyado K. 2000. Requirement of CD9 on the Egg Plasma Membrane for Fertilization. Science 287:321–324. Miyara FA, Migne C, Dumont-Hassan M, Meur AL, Cohen-Bacrie P, Aubriot FO-X, Glissant AL, Nathan C, Douard SP, Stanovici A, et al. 2003. Chromatin configuration and transcriptional control in human and mouse oocytes. Molecular Reproduction and Development 64:458–470. Miyoshi T, Otsuka F, Nakamura E, Inagaki K, Ogura-Ochi K, Tsukamoto N, Takeda M, Makino H. 2012. Regulatory role of kit ligand-c-kit interaction and oocyte factors in steroidogenesis by rat granulosa cells. Molecular and Cellular Endocrinology 358:18– 26. Mondou E, Dufort I, Gohin M, Fournier E, Sirard MA. 2012. Analysis of microRNAs and their precursors in bovine early embryonic development. Molecular Human Reproduction 18:425–434. Monget P, Fabre S, Mulsant P, Lecerf F, Elsen JM, Mazerbourg S, Pisselet C, Monniaux D. 2002. Regulation of ovarian folliculogenesis by IGF and BMP system in domestic animals. Domestic Anmial Endocrinology 23:139–154. Montpetit B, Thomsen ND, Helmke KJ, Seeliger MA, Berger JM, Weis K. 2011. A conserved mechanism of DEAD-box ATPase activation by nucleoporins and InsP6 in mRNA export. Nature 472:238–242. Moor RM, Osborn JC, Cran DG, Walters DE. 1981. Selective effect of gonadotrophins on cell coupling, nuclear maturation and protein synthesis in mammalian oocytes. Journal of Embryology and Experimetal Morphology 61:347–365. Moore GPM, Lintern-Moore S. 1978. Transcription of the Mouse Oocyte Genome. Biology of Reproduction 18:865–870. Murdoch WJ. 1998. Inhibition by oestradiol of oxidative stress-induced apoptosis in pig ovarian tissues. Reproduction 114:127–130.

247

Naarmann IS, Harnisch C, Muller-Newen G, Urlaub H, Ostareck-Lederer A, Ostareck DH. 2010. DDX6 recruits translational silenced human reticulocyte 15-lipoxygenase mRNA to RNP granules. RNA 16:2189–2204. Nakamura M, Minegishi T, Hasegawa Y, Nakamura K, Igarashi S, Ito I, Shinozaki H, Miyamoto K, Eto Y, Ibuki Y. 1993. Effect of an activin A on follicle-stimulating hormone (FSH) receptor messenger ribonucleic acid levels and FSH receptor expressions in cultured rat granulosa cells. Endocrinology 133:538–544. Newport J, Kirschner M. 1982. A major developmental transition in early Xenopus embryos: II. Control of the onset of transcription. Cell 30:687–696. Nguyen-Chi M, Morello D. 2011. RNA-binding proteins, RNA granules, and gametes: is unity strength? Reproduction 142:803–817. Nickel W, Brügger B, Wieland FT. 2002. Vesicular transport: the core machinery of COPI recruitment and budding. Journal of Cell Science 115:3235–3240. Nivet A-L, Bunel A, Labrecque R, Belanger J, Vigneault C, Blondin P, Sirard M-A. 2012. FSH withdrawal improves developmental competence of oocytes in the bovine model. Reproduction 143:165–171. Nivet A-L, Vigneault C, Blondin P, Sirard M-A. 2013. Changes in granulosa cells' gene expression associated with increased oocyte competence in bovine. Reproduction 145:555–565. Nolze A, Schneider J, Keil R, Lederer M, Huttelmaier S, Kessels MM, Qualmann B, Hatzfeld M. 2013. FMRP regulates actin filament organization via the armadillo protein p0071. RNA 19:1483–1496. Norris RP, Freudzon M, Mehlmann LM, Cowan AE, Simon AM, Paul DL, Lampe PD, Jaffe LA. 2008. Luteinizing hormone causes MAP kinase-dependent phosphorylation and closure of connexin 43 gap junctions in mouse ovarian follicles: one of two paths to meiotic resumption. Development 135:3229–3238. Norris RP, Freudzon M, Nikolaev VO, Jaffe LA. 2010. Epidermal growth factor receptor kinase activity is required for gap junction closure and for part of the decrease in ovarian follicle cGMP in response to LH. Reproduction 140:655–662. Norris RP, Ratzan WJ, Freudzon M, Mehlmann LM, Krall J, Movsesian MA, Wang H, Ke H, Nikolaev VO, Jaffe LA. 2009. Cyclic GMP from the surrounding somatic cells

248

regulates cyclic AMP and meiosis in the mouse oocyte. Development 136:1869–1878. Oda K, Matsuoka Y, Funahashi A, Kitano H. 2005. A comprehensive pathway map of epidermal growth factor receptor signaling. Molecular Systems Biology 1:E1–E17. Oh SY, He F, Krans A, Frazer M, Taylor JP, Paulson HL, Todd PK. 2015. RAN translation at CGG repeats induces ubiquitin proteasome system impairment in models of fragile X-associated tremor ataxia syndrome. Human Molecular Genetics 24:4317–4326. Ohshima K, Inoue K, Fujiwara A, Hatakeyama K, Kanto K, Watanabe Y, Muramatsu K, Fukuda Y, Ogura S-I, Yamaguchi K, et al. 2010. Let-7 MicroRNA Family Is Selectively Secreted into the Extracellular Environment via Exosomes in a Metastatic Gastric Cancer Cell Line. Wölfl S, editor. PLoS ONE 5:e13247–10. Okray Z, de Esch CE, Van Esch H, Devriendt K, Claeys A, Yan J, Verbeeck J, Froyen G, Willemsen R, de Vrij FM, et al. 2015. A novel fragile X syndrome mutation reveals a conserved role for the carboxy-terminus in FMRP localization and function. EMBO Molecular Medicine 7:423–437. Orozco-Lucero E, Dufort I, Robert C, Sirard M-A. 2014. Rapidly cleaving bovine two-cell embryos have better developmental potential and a distinctive mRNA pattern. Molecular Reproduction and Development 81:31–41. Ostrowski M, Carmo NB, Krumeich S, Fanget I, Raposo G, Savina A, Moita CF, Schauer K, Hume AN, Freitas RP, et al. 2009. Rab27a and Rab27b control different steps of the exosome secretion pathway. Nature Cell Biology 12:19–30. Palfrey HC, Artalejo CR. 2003. Secretion: Kiss and Run Caught on Film. Current Biology 13:R397–R399. Park JY. 2004. EGF-Like Growth Factors As Mediators of LH Action in the Ovulatory Follicle. Science 303:682–684. Paulini F, Silva RC, Rôlo JLJ de P, Lucci CM. 2014. Ultrastructural changes in oocytes during folliculogenesis in domestic mammals. Journal of Ovarian Research 7:102. Paynton BV, Bachvarova R. 1994. Polyadenylation and deadenylation of maternal mRNAs during oocyte growth and maturation in the mouse. Molecular Reproduction and Development 37:172–180. Pedersen T, Peters H. 1968. Proposal for a Classification of Oocytes and follicles in the mouse ovary. Reproduction 17:555–557.

249

Pegtel DM, Cosmopoulos K, Thorley-Lawson DA, van Eijndhoven MAJ, Hopmans ES, Lindenberg JL, de Gruijl TD, Wurdinger T, Middeldorp JM. 2010. Functional delivery of viral miRNAs via exosomes. Proceedings of the National Academy of Sciences 107:6328–6333. Penny GD, Kay GF, Sheardown SA, Rastan S, Brockdorff N. 1996. Requirement for Xist in X chromosome inactivation. Nature 379:131–137. Pepling ME, Wilhelm JE, O'Hara AL, Gephardt GW, Spradling AC. 2007. Mouse oocytes within germ cell cysts and primordial follicles contain a Balbiani body. Proceedings of the National Academy of Sciences 104:187–192. Persani L, Rossetti R, Cacciatore C, Bonomi M. 2009. Primary ovarian insufficiency: X chromosome defects and autoimmunity. Journal of Autoimmunity 33:35–41. Pierson RA, Ginther OJ. 1984. Ultrasonography of the bovine ovary. Theriogenology 21:495–504. Pincus G, Enzmann EV. 1935. The comparative behavior of mammalian eggs in vivo and in vitro I. The activation of ovarian eggs. Journal of Experimental Medicine 62:665– 675. Pinto D, Pagnamenta AT, Klei L, Anney R, Merico D, Regan R, Conroy J, Magalhaes TR, Correia C, Abrahams BS, et al. 2010. Functional impact of global rare copy number variation in autism spectrum disorders. Nature 466:368–372. Piqué M, López JM, Foissac S, Guigó R, Méndez R. 2008. A Combinatorial Code for CPE- Mediated Translational Control. Cell 132:434–448. Plourde D, Vigneault C, Lemay A, Breton L, Gagné D, Laflamme I, Blondin P, Robert C. 2012. Contribution of oocyte source and culture conditions to phenotypic and transcriptomic variation in commercially produced bovine blastocysts. Theriogenology 78:116–131.e3. Polanski Z, Ledan E, Brunet S, Louvet S, Verlhac MH, Kubiak JZ, Maro B. 1998. Cyclin synthesis controls the progression of meiotic maturation in mouse oocytes. Development 125:4989–4997. Prasad S, Singh K. 2014. Testosterone down regulates the expression of Fmr-1 gene in the cerebral cortex of gonadectomized old male mice. Biogerontology 15:503–515. Pretto DI, Mendoza-Morales G, Lo J, Cao R, Hadd A, Latham GJ, Durbin-Johnson B,

250

Hagerman R, Tassone F. 2014. CGG allele size somatic mosaicism and methylation in FMR1 premutation alleles. Journal of Medical Genetics 51:309–318. Quirk SM, Cowan RG, Harman RM, Hu C-L, Porter DA. 2004. Ovarian follicular growth and atresia: the relationship between cell proliferation and survival. Journal of Animal Science 82:E40–52. Radford HE, Meijer HA, de Moor CH. 2008. Translational control by cytoplasmic polyadenylation in Xenopus oocytes. Biochimica et Biophysica Acta: Gene Regulatory Mechanisms 1779:217–229. Reddy K, Pearson CE. 2013. RAN Translation: Fragile X in the Running. Neuron 78:405– 408. Redzic JS, Balaj L, van der Vos KE, Breakefield XO. 2014 May 15. Extracellular RNA mediates and marks cancer progression. Seminars in Cancer Biology:1–10. Reese WO. 2004. Duke's Physiology of Domestic Animals. 12 ed. Reese WO, editor. Cornell University Press. Richani D, Ritter LJ, Thompson JG, Gilchrist RB. 2013. Mode of oocyte maturation affects EGF-like peptide function and oocyte competence. Molecular Human Reproduction 19:500–509. Richard FJ, Sirard M. 1996a. Effects of follicular cells on oocyte maturation. I: Effects of follicular hemisections on bovine oocyte maturation in vitro. Biology of Reproduction 54:16–21. Richard FJ, Sirard MA. 1996b. Effects of follicular cells on oocyte maturation. II: Theca cell inhibition of bovine oocyte maturation in vitro. Biology of Reproduction 54:22–28. Richard FJ, Sirard MA. 1998. Theca cell monolayers that inhibit maturation of bovine oocytes show differences in their protein secretion pattern. Molecular Rerpoduction and Development 50:200–206. Richards JS. 2001. Perspective: the ovarian follicle--a perspective in 2001. Endocrinology 142:2184–2193. Rizos D. 2002. Bovine Embryo Culture in the Presence or Absence of Serum: Implications for Blastocyst Development, Cryotolerance, and Messenger RNA Expression. Biology of Reproduction 68:236–243. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. 2002. Consequences of bovine oocyte

251

maturation, fertilization or early embryo development in vitro versus in vivo: Implications for blastocyst yield and blastocyst quality. Mol. Reprod. Dev. 61:234– 248. Rizzoli SO, Jahn R. 2007. Kiss-and-run, Collapse and “Readily Retrievable” Vesicles. Traffic 8:1137–1144. Robinson MS. 1997. Coats and vesicle budding. Trends in Cell Biology 7:99–102. Rodgers RJ, Irving-Rodgers HF. 2010. Formation of the Ovarian Follicular Antrum and Follicular Fluid. Biology of Reproduction 82:1021–1029. Rodman JS, Wandinger-Ness A. 2000. Rab GTPases coordinate endocytosis. Journal of Cell Science 113:183–192. Rodman TC, Bachvarova R. 1976. RNA synthesis in preovulatory mouse oocytes. The Journal of Cell Biology 70:251–257. Russell DL, Robker RL. 2007. Molecular mechanisms of ovulation: co-ordination through the cumulus complex. Human Reproduction Update 13:289–312. Sagirkaya H, Misirlioglu M, Kaya A, First NL, Parrish JJ, Memili E. 2007. Developmental potential of bovine oocytes cultured in different maturation and culture conditions. Animal Reproduction Science 101:225–240. Santiquet N, Papillon-Dion E, Djender N, Guillemette C, Richard FJ. 2014. New Elements in the C-Type Natriuretic Peptide Signaling Pathway Inhibiting Swine In Vitro Oocyte Meiotic Resumption. Biology of Reproduction 91:16–16. Santiquet N, Robert C, Richard FJ. 2013. The Dynamics of Connexin Expression, Degradation and Localisation Are Regulated by Gonadotropins during the Early Stages of In Vitro Maturation of Swine Oocytes. PLoS ONE 8:e68456–11. Sato Y, Cheng Y, Kawamura K, Takae S, Hsueh AJW. 2012. C-Type Natriuretic Peptide Stimulates Ovarian Follicle Development. Molecular Endocrinology 26:1158–1166. Scantland S, Tessaro I, Macabelli CH, Macaulay AD, Cagnone G, Fournier E, Luciano AM, Robert C. 2014. The adenosine salvage pathway as an alternative to mitochondrial production of ATP in maturing mammalian oocytes. Biology of Reproduction 91:75– 75. Schnorrer F, Bohmann K, Nüsslein-Volhard C. 2000. The molecular motor dynein is involved in targeting swallow and bicoid RNA to the anterior pole of Drosophila

252

oocytes. Nature Cell Biology 2:185–190. Schuettler J, Peng Z, Zimmer J, Sinn P, Hagens von C, Strowitzki T, Vogt PH. 2011. Variable expression of the Fragile X Mental Retardation 1 (FMR1) gene in patients with premature ovarian failure syndrome is not dependent on number of (CGG)n triplets in exon 1. Human Reproduction 26:1241–1251. Schultz RM. 1993. Regulation of zygotic gene activation in the mouse. Bioessays 15:531– 538. Schultz RM, Montgomery RR, Belanoff JR. 1983. Regulation of mouse oocyte meiotic maturation: implication of a decrease in oocyte cAMP and protein dephosphorylation in commitment to resume meiosis. Developmental Biology 97:264–273. Sela-Abramovich S, Edry I, Galiani D, Nevo N, Dekel N. 2006. Disruption of Gap Junctional Communication within the Ovarian Follicle Induces Oocyte Maturation. Endocrinology 147:2280–2286. Shahbabian K, Chartrand P. 2011. Control of cytoplasmic mRNA localization. Cellular and Molecualr Life Sciences 69:535–552. Shkolnik K, Tadmor A, Ben-Dor S, Nevo N, Galiani D, Dekel N. 2011. Reactive oxygen species are indispensable in ovulation. Proc. Natl. Acad. Sci. U.S.A. 108:1462–1467. Silva CC, Knight PG. 2000. Effects of androgens, progesterone and their antagonists on the developmental competence of in vitro matured bovine oocytes. Journal of Reproduction and Fertility 119:261–269. Silverman E, Edwalds-Gilbert G, Lin R-J. 2003. DExD/H-box proteins and their partners: helping RNA helicases unwind. Gene 312:1–16. Simon AM, Goodenough DA, Li E, Paul DL. 1997. Female infertility in mice lacking connexin 37. Nature 385:525–529. Simons M, Raposo G. 2009. Exosomes – vesicular carriers for intercellular communication. Current Opinion in Cell Biology 21:575–581. Simpson I, Rose B, Loewenstein WR. 1977. Size limit of molecules permeating the junctional membrane channels. Science 195:294–296. Singh K, Prasad S. 2008. Age- and sex-related analysis of methylation of 5′-upstream sequences of Fmr-1 gene in mouse brain and modulation by sex steroid hormones. Biogerontology 9:455–465.

253

Sirard MA. 1988. The culture of bovine oocytes to obtain developmentally competent embryos. Biology of Reproduction 39:546–552. Sirard MA, Blondin P. 1996. Oocyte maturation and IVF in cattle. Animal Reproduction Science 42:417–426. Sirard MA, Florman HM, Leibfried-Rutledge ML, Barnes FL, Sims ML, First NL. 1989. Timing of nuclear progression and protein synthesis necessary for meiotic maturation of bovine oocytes. Biology of Reproduction 40:1257–1263. Sirois J, Fortune JE. 1988. Ovarian follicular dynamics during the estrous cycle in heifers monitored by real-time ultrasonography. Biology of Reproduction 39:308–317. Skinner MK. 2005. Regulation of primordial follicle assembly and development. Human Reproduction Update 11:461–471. Soede NM, Langendijk P, Kemp B. 2011. Reproductive cycles in pigs. Animal Reproduction Science 124:251–258. Sossin WS, Lacaille J-C. 2010. Mechanisms of translational regulation in synaptic plasticity. Current Opinion in Neurobiology 20:450–456. Spencer CM. 2006. Exaggerated behavioral phenotypes in Fmr1/Fxr2 double knockout mice reveal a functional genetic interaction between Fragile X-related proteins. Human Molecular Genetics 15:1984–1994. Srivastava L, Lapik YR, Wang M, Pestov DG. 2010. Mammalian DEAD Box Protein Ddx51 Acts in 3' End Maturation of 28S rRNA by Promoting the Release of U8 snoRNA. Molecular and Cellular Biology 30:2947–2956. Stebbins-Boaz B, Cao Q, de Moor CH, Méndez R, Richter JD. 1999. Maskin Is a CPEB- Associated Factor that Transiently Interacts with eIF-4E. Molecular Cell 4:1017–1027. Stein M, Pilli M, Bernauer S, Habermann BH, Zerial M, Wade RC. 2012. The Interaction Properties of the Human Rab GTPase Family – A Comparative Analysis Reveals Determinants of Molecular Binding Selectivity. Promponas VJ, editor. PLoS ONE 7:e34870–13. Stoop H. 2005. Differentiation and development of human female germ cells during prenatal gonadogenesis: an immunohistochemical study. Human Reproduction 20:1466–1476. Sullivan AK. 2004. Association of FMR1 repeat size with ovarian dysfunction. Human

254

Reproduction 20:402–412. Sun X-S, Liu Y, Yue K-Z, Ma S-F, Tan J-H. 2004. Changes in germinal vesicle (GV) chromatin configurations during growth and maturation of porcine oocytes. Molecular Reproduction and Development 69:228–234. Suntres ZE, Smith MG, Momen-Heravi F, Hu J, Zhang X, Wu Y, Zhu H, Wang J, Zhou J, Patrick W. 2013. Therapeutic uses of exosomes. Exosomes and Microvesicles:1. Sutovský P, Fléchon JE, Fléchon B, Motlik J, Peynot N, Chesné P, Heyman Y. 1993. Dynamic changes of gap junctions and cytoskeleton during in vitro culture of cattle oocyte cumulus complexes. Biology of Reproduction 49:1277–1287. Sutton-McDowall ML, Gilchrist RB, Thompson JG. 2010. The pivotal role of glucose metabolism in determining oocyte developmental competence. Reproduction 139:685– 695. Swetloff A, Conne B, Huarte J, Pitetti J-L, Nef S, Vassalli J-D. 2009. Dcp1-bodies in mouse oocytes. Mol. Biol. Cell 20:4951–4961. Takahashi K, Yan IK, Kogure T, Haga H, Patel T. 2014. Extracellular vesicle-mediated transfer of long non-coding RNA ROR modulates chemosensitivity in human hepatocellular cancer. Open Biology 4:458–467. Takai Y, Matikainen T, Jurisicova A, Kim MR, Trbovich AM, Fujita E, Nakagawa T, Lemmers B, Flavell RA, Hakem R, et al. 2007. Caspase-12 compensates for lack of caspase-2 and caspase-3 in female germ cells. Apoptosis 12:791–800. Tan JH, Wang HL, Sun XS, Liu Y, Sui HS, Zhang J. 2009. Chromatin configurations in the germinal vesicle of mammalian oocytes. Molecular Human Reproduction 15:1–9. Tanaka Y, Nakada K, Moriyoshi M, Sawamukai Y. 2001. Appearance and number of follicles and change in the concentration of serum FSH in female bovine fetuses. Reproduction 121:777–782. Tang MKS, Wong AST. 2015. Exosomes: Emerging biomarkers and targets for ovarian cancer. Cancer Letters 367:26–33. Tessaro I, Luciano AM, Franciosi F, Lodde V, Corbani D, Modina SC. 2011. The endothelial nitric oxide synthase/nitric oxide system is involved in the defective quality of bovine oocytes from low mid-antral follicle count ovaries. Journal of Animal Science 89:2389–2396.

255

Tetta C, Ghigo E, Silengo L, Deregibus MC, Camussi G. 2012. Extracellular vesicles as an emerging mechanism of cell-to-cell communication. Endocrine 44:11–19. Théry C, Ostrowski M, Segura E. 2009. Membrane vesicles as conveyors of immune responses. Nature Reviews Immunology 9:581–593. Tillo M, Ruhrberg C, Mackenzie F. 2014. Emerging roles for semaphorins and VEGFs in synaptogenesis and synaptic plasticity. Cell Adhesion and Migration 6:541–546. Tilly JL. 1996. Apoptosis and ovarian function. Rev. Reprod. 1:162–172. Todd AG, Lin H, Ebert AD, Liu Y, Androphy EJ. 2013. COPI transport complexes bind to specific RNAs in neuronal cells. Human Molecular Genetics 22:729–736. Tokumoto T, Yamashita M, Tokumoto M, Katsu Y, Horiguchi R, Kajiura H, Nagahama Y. 1997. Initiation of cyclin B degradation by the 26S proteasome upon egg activation. The Journal of Cell Biology 138:1313–1322. Tomek W, Torner H, Kanitz W. 2002. Comparative analysis of protein synthesis, transcription and cytoplasmic polyadenylation of mRNA during maturation of bovine oocytes in vitro. Reproduction in Domestic Animals 37:86–91. Trapphoff T, Hajj El N, Zechner U, Haaf T, Eichenlaub-Ritter U. 2010. DNA integrity, growth pattern, spindle formation, chromosomal constitution and imprinting patterns of mouse oocytes from vitrified pre-antral follicles. Human Reproduction 25:3025–3042. Tremblay K. 2004. Expression of Cyclin B1 Messenger RNA Isoforms and Initiation of Cytoplasmic Polyadenylation in the Bovine Oocyte. Biology of Reproduction 72:1037– 1044. Tsafrir A, Altarescu G, Margalioth E, Brooks B, Renbaum P, Levy-Lahad E, Rabinowitz R, Varshaver I, Eldar-Geva T. 2010. PGD for fragile X syndrome: ovarian function is the main determinant of success. Human Reproduction 25:2629–2636. Tsafriri A, Linder HR, Zor U, Lamprecht SA. 1972. In vitro induction of meiotic division in follicle enclosed rat oocytes by LH, cyclic AMP, and prostaglandin E2. Reproduction 31:39–50. Turchinovich A, Weiz L, Burwinkel B. 2012. Extracellular miRNAs: the mystery of their origin and function. Trends in Biochemical Sciences 37:460–465. Turnbull KE, Braden AW, Mattner PE. 1977. The pattern of follicular growth and atresia in the ovine ovary. Australian Journal of Biological Sciences 30:229–241.

256

Turzillo AM, Fortune JE. 1990. Suppression of the secondary FSH surge with bovine follicular fluid is associated with delayed ovarian follicular development in heifers. Journal of Reproduction and Fertility 89:643–653. Updike D, Strome S. 2010. P Granule Assembly and Function in Caenorhabditis elegans Germ Cells. Journal of Andrology 31:53–60. Valadi H, Ekström K, Bossios A, Sjöstrand M, Lee JJ, Lötvall JO. 2007. Exosome- mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nature Cell Biology 9:654–659. Valiunas V, Polosina YY, Miller H, Potapova IA, Valiuniene L, Doronin S, Mathias RT, Robinson RB, Rosen MR, Cohen IS, et al. 2005. Connexin-specific cell-to-cell transfer of short interfering RNA by gap junctions. The Journal of Physiology 568:459–468. Van Blerkom J, Antczak M, Schrader R. 1997. The developmental potential of the human oocyte is related to the dissolved oxygen content of follicular fluid: association with vascular endothelial growth factor levels and perifollicular blood flow characteristics. Human Reproduction 12:1047–1055. Vardy L, Orr-Weaver TL. 2007. Regulating translation of maternal messages: multiple repression mechanisms. Trends in Cell Biology 17:547–554. Villarroya-Beltri C, Vazquez CG, Nanchez-Cabo FA, Handez DP, Vazquez JU, Martin- Cofreces N, Martinez-Herrera DJ, Pascual-Montano A, Mittelbrunn MIA, Sanchez- Madrid F. 2013. Sumoylated hnRNPA2B1 controls the sorting of miRNAs into exosomes through binding to specific motifs. Nature Communications 4:1–10. Wang HF, Isobe N, Kumamoto K, Yamashiro H, Yamashita Y, Terada T. 2006. Studies of the role of steroid hormone in the regulation of oocyte maturation in cattle. Reproductive Biology and Endocrinology 4:4. Wang HX, Tekpetey FR, Kidder GM. 2009. Identification of WNT/ -CATENIN signaling pathway components in human cumulus cells. Molecular Human Reproduction 15:11– 17. Wang JT, Seydoux G. 2014. Marine mammals trace anthropogenic structures at sea. Current Biology 24:R637–R638. Wang Y, Kong N, Li N, Hao X, Wei K, Xiang X, Xia G, Zhang M. 2013. Epidermal Growth Factor Receptor Signaling-Dependent Calcium Elevation in Cumulus Cells Is

257

Required for NPR2 Inhibition and Meiotic Resumption in Mouse Oocytes. Endocrinology 154:3401–3409. Wetzels AM, Bastiaans BA, Hendriks JC, Goverde HJ, Punt-van der Zalm AP, Verbeet JG, Braat DD. 1998. The effects of co-culture with human fibroblasts on human embryo development in vitro and implantation. Hum. Reprod. 13:1325–1330. Whyte JRC, Munro S. 2002. Vesicle tethering complexes in membrane traffic. Journal of Cell Science 115:2627–2637. Wigglesworth K, Lee KB, Emori C, Sugiura K, Eppig JJ. 2015. Transcriptomic Diversification of Developing Cumulus and Mural Granulosa Cells in Mouse Ovarian Follicles. Biology of Reproduction 92:23–23. Williams AE. 2007. Functional aspects of animal microRNAs. Cellular and Molecular Life Sciences. 65:545–562. Wolke U, Jezuit EA, Priess JR. 2007. Actin-dependent cytoplasmic streaming in C. elegans oogenesis. Development 134:2227–2236. Xiang W, MacLaren LA. 2002. Expression of fertilin and CD9 in bovine trophoblast and endometrium during implantation. Biology of Reproduction 66:1790–1796. Yamamizu K, Furuta S, Katayama S, Narita M. 2011. The κ opioid system regulates endothelial cell differentiation and pathfinding in vascular development. Blood 118:775–785. Yeh Yeo RW, Chai R, Hian K, Kiang S. 2013. Exosome: A Novel and Safer Therapeutic Refinement of Mesenchymal Stem Cell. Exosomes and Microvesicles 1: 1-12. Yu J, Hecht NB, Schultz RM. 2001. Expression of MSY2 in mouse oocytes and preimplantation embryos. Biology of Reproduction 65:1260–1270. Yu J, Russell JE. 2001. Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human -Globin mRNA. Molecular and Cellular Biology 21:5879–5888. Zhang Y, Liu D, Chen X, Li J, Li L, Bian Z, Sun F, Lu J, Yin Y, Cai X, et al. 2010. Secreted Monocytic miR-150 Enhances Targeted Endothelial Cell Migration. Molecular Cell 39:133–144. Zheng D, Ezzeddine N, Chen CYA, Zhu W, He X, Shyu AB. 2008. Deadenylation is prerequisite for P-body formation and mRNA decay in mammalian cells. The Journal

258

of Cell Biology 182:89–101. Zomer A, Vendrig T, Hopmans ES, van Eijndhoven M, Middeldorp JM, Pegtel DM. 2014. Exosomes. Communicative & Integrative Biology 3:447–450.

259