DOCSLIB.ORG

MCM2 Mouse Monoclonal Antibody [Clone ID: OTI1G4] Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MCM2 Mouse Monoclonal Antibody [Clone ID: OTI1G4] Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA805472 MCM2 Mouse Monoclonal Antibody [Clone ID: OTI1G4] Product data: Product Type: Primary Antibodies Clone Name: OTI1G4 Applications: IHC, WB Recommended Dilution: WB 1:2000, IHC 1:150 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG2b Clonality: Monoclonal Immunogen: Full length human recombinant protein of human MCM2 (NP_004517) produced in HEK293T cell. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 101.7 kDa Gene Name: minichromosome maintenance complex component 2 Database Link: NP_004517 Entrez Gene 17216 MouseEntrez Gene 312538 RatEntrez Gene 4171 Human P49736 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 MCM2 Mouse Monoclonal Antibody [Clone ID: OTI1G4] – TA805472 Background: The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012] Synonyms: BM28; CCNL1; cdc19; CDCL1; D3S3194; MITOTIN Protein Families: Druggable Genome, Stem cell - Pluripotency, Transcription Factors Protein Pathways: Cell cycle, DNA replication Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY MCM2 ([RC202506], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-MCM2. Positive lysates [LY401445] (100ug) and [LC401445] (20ug) can be purchased separately from OriGene. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 4 MCM2 Mouse Monoclonal Antibody [Clone ID: OTI1G4] – TA805472 Immunohistochemical staining of paraffin- embedded Human colon tissue within the normal limits using anti-MCM2 mouse monoclonal antibody. (Heat-induced epitope retrieval by 1 mM EDTA in 10mM Tris, pH8.5, 120°C for 3min, TA805472) Immunohistochemical staining of paraffin- embedded Adenocarcinoma of Human colon tissue using anti-MCM2 mouse monoclonal antibody. (Heat-induced epitope retrieval by 1 mM EDTA in 10mM Tris, pH8.5, 120°C for 3min, TA805472) Immunohistochemical staining of paraffin- embedded Carcinoma of Human lung tissue using anti-MCM2 mouse monoclonal antibody. (Heat-induced epitope retrieval by 1 mM EDTA in 10mM Tris, pH8.5, 120°C for 3min, TA805472) This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 3 / 4 MCM2 Mouse Monoclonal Antibody [Clone ID: OTI1G4] – TA805472 Immunohistochemical staining of paraffin- embedded Human tonsil within the normal limits using anti-MCM2 mouse monoclonal antibody. (Heat-induced epitope retrieval by 1 mM EDTA in 10mM Tris, pH8.5, 120°C for 3min, TA805472) This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 4 / 4.
Load more

Recommended publications
  • CCNL1 (NM 020307) Human Untagged Clone – SC113160 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC113160 CCNL1 (NM_020307) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCNL1 (NM_020307) Human Untagged Clone Tag: Tag Free Symbol: CCNL1 Synonyms: ania-6a; ANIA6A; BM-001; PRO1073 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_020307, the custom clone sequence may differ by one or more nucleotides ATGGCGTCCGGGCCTCATTCGACAGCTACTGCTGCCGCAGCCGCCTCATCGGCCGCCCCAAGCGCGGGCG GCTCCAGCTCCGGGACGACGACCACGACGACGACCACGACGGGAGGGATCCTGATCGGCGATCGCCTGTA CTCGGAAGTTTCACTTACCATCGACCACTCTCTGATTCCGGAGGAGAGGCTCTCGCCCACCCCATCCATG CAGGATGGGCTCGACCTGCCCAGTGAGACGGACTTACGCATCCTGGGCTGCGAGCTCATCCAGGCCGCCG GCATTCTCCTCCGGCTGCCGCAGGTGGCGATGGCAACGGGGCAGGTGTTGTTTCATCGTTTTTTCTACTC CAAATCTTTCGTCAAACACAGTTTCGAGATTGTTGCTATGGCTTGTATTAATCTTGCATCAAAAATCGAA GAAGCACCTAGAAGAATAAGAGATGTGATTAATGTATTCCACCACCTCCGCCAGTTAAGAGGAAAAAGGA CTCCAAGCCCCCTGATCCTTGATCAGAACTACATTAACACCAAAAATCAAGTTATCAAAGCAGAGAGGAG GGTGCTAAAGGAGTTGGGATTTTGTGTTCATGTCAAGCATCCTCATAAGATCATTGTTATGTATTTACAA GTCTTAGAATGTGAACGTAATCAAACCCTGGTTCAAACTGCCTGGAATTACATGAATGACAGTCTTCGAA CCAATGTGTTTGTTCGATTTCAACCAGAGACTATAGCATGTGCTTGCATCTACCTTGCAGCTAGAGCACT TCAGATTCCGTTGCCAACTCGTCCCCATTGGTTTCTTCTTTTTGGTACTACAGAAGAGGAAATCCAGGAA ATCTGCATAGAAACACTTAGGCTTTATACCAGAAAAAAGCCAAACTATGAATTACTGGAAAAAGAAGTAG AAAAAAGAAAAGTAGCCTTACAAGAAGCCAAATTAAAAGCAAAGGGATTGAATCCGGATGGAACTCCAGC
    [Show full text]
  • Epigenome-Wide Study Identified Methylation Sites Associated With
    nutrients Article Epigenome-Wide Study Identified Methylation Sites Associated with the Risk of Obesity Majid Nikpay 1,*, Sepehr Ravati 2, Robert Dent 3 and Ruth McPherson 1,4,* 1 Ruddy Canadian Cardiovascular Genetics Centre, University of Ottawa Heart Institute, 40 Ruskin St–H4208, Ottawa, ON K1Y 4W7, Canada 2 Plastenor Technologies Company, Montreal, QC H2P 2G4, Canada; [email protected] 3 Department of Medicine, Division of Endocrinology, University of Ottawa, the Ottawa Hospital, Ottawa, ON K1Y 4E9, Canada; [email protected] 4 Atherogenomics Laboratory, University of Ottawa Heart Institute, Ottawa, ON K1Y 4W7, Canada * Correspondence: [email protected] (M.N.); [email protected] (R.M.) Abstract: Here, we performed a genome-wide search for methylation sites that contribute to the risk of obesity. We integrated methylation quantitative trait locus (mQTL) data with BMI GWAS information through a SNP-based multiomics approach to identify genomic regions where mQTLs for a methylation site co-localize with obesity risk SNPs. We then tested whether the identified site contributed to BMI through Mendelian randomization. We identified multiple methylation sites causally contributing to the risk of obesity. We validated these findings through a replication stage. By integrating expression quantitative trait locus (eQTL) data, we noted that lower methylation at cg21178254 site upstream of CCNL1 contributes to obesity by increasing the expression of this gene. Higher methylation at cg02814054 increases the risk of obesity by lowering the expression of MAST3, whereas lower methylation at cg06028605 contributes to obesity by decreasing the expression of SLC5A11. Finally, we noted that rare variants within 2p23.3 impact obesity by making the cg01884057 Citation: Nikpay, M.; Ravati, S.; Dent, R.; McPherson, R.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • High-Throughput Bioinformatics Approaches to Understand Gene Expression Regulation in Head and Neck Tumors
    High-throughput bioinformatics approaches to understand gene expression regulation in head and neck tumors by Yanxiao Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2016 Doctoral Committee: Associate Professor Maureen A. Sartor, Chair Professor Thomas E. Carey Assistant Professor Hui Jiang Professor Ronald J. Koenig Associate Professor Laura M. Rozek Professor Kerby A. Shedden c Yanxiao Zhang 2016 All Rights Reserved I dedicate this thesis to my family. For their unfailing love, understanding and support. ii ACKNOWLEDGEMENTS I would like to express my gratitude to Dr. Maureen Sartor for her guidance in my research and career development. She is a great mentor. She patiently taught me when I started new in this field, granted me freedom to explore and helped me out when I got lost. Her dedication to work, enthusiasm in teaching, mentoring and communicating science have inspired me to feel the excite- ment of research beyond novel scientific discoveries. I’m also grateful to have an interdisciplinary committee. Their feedback on my research progress and presentation skills is very valuable. In particular, I would like to thank Dr. Thomas Carey and Dr. Laura Rozek for insightful discussions on the biology of head and neck cancers and human papillomavirus, Dr. Ronald Koenig for expert knowledge on thyroid cancers, Dr. Hui Jiang and Dr. Kerby Shedden for feedback on the statistics part of my thesis. I would like to thank all the past and current members of Sartor lab for making the lab such a lovely place to stay and work in.
    [Show full text]
  • Combinatorial Strategies Using CRISPR/Cas9 for Gene Mutagenesis in Adult Mice
    Combinatorial strategies using CRISPR/Cas9 for gene mutagenesis in adult mice Avery C. Hunker A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2019 Reading Committee: Larry S. Zweifel, Chair Sheri J. Mizumori G. Stanley McKnight Program Authorized to Offer Degree: Pharmacology 2 © Copyright 2019 Avery C. Hunker 3 University of Washington ABSTRACT Combinatorial strategies using CRISPR/Cas9 for gene mutagenesis in adult mice Avery C. Hunker Chair of the Supervisory Committee: Larry Zweifel Department of Pharmacology A major challenge to understanding how genes modulate complex behaviors is the inability to restrict genetic manipulations to defined cell populations or circuits. To circumvent this, we created a simple strategy for limiting gene knockout to specific cell populations using a viral-mediated, conditional CRISPR/SaCas9 system in combination with intersectional genetic strategies. A small single guide RNA (sgRNA) directs Staphylococcus aureus CRISPR-associated protein (SaCas9) to unique sites on DNA in a Cre-dependent manner resulting in double strand breaks and gene mutagenesis in vivo. To validate this technique we targeted nine different genes of diverse function in distinct cell types in mice and performed an array of analyses to confirm gene mutagenesis and subsequent protein loss, including IHC, cell-type specific DNA sequencing, electrophysiology, Western blots, and behavior. We show that these vectors are as efficient as conventional conditional gene knockout and provide a viable alternative to complex genetic crosses. This strategy provides additional benefits of 4 targeting gene mutagenesis to cell types previously difficult to isolate, and the ability to target genes in specific neural projections for gene inactivation.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Candidate Gene and Genome-Wide Association Studies for Circulating
    nutrients Article Candidate Gene and Genome-Wide Association Studies for Circulating Leptin Levels Reveal Population and Sex-Specific Associations in High Cardiovascular Risk Mediterranean Subjects 1,2, 2,3, 1,2 1,2 Carolina Ortega-Azorín y , Oscar Coltell y , Eva M. Asensio , Jose V. Sorlí , José I. González 1,2, Olga Portolés 1,2, Carmen Saiz 1,2, Ramon Estruch 2,4 , Judith B Ramírez-Sabio 5, Alejandro Pérez-Fidalgo 1,6, Jose M Ordovas 7,8,9 and Dolores Corella 1,2,* 1 Department of Preventive Medicine and Public Health, School of Medicine, University of Valencia, 46010 Valencia, Spain; [email protected] (C.O.-A.); [email protected] (E.M.A.); [email protected] (J.V.S.); [email protected] (J.I.G.); [email protected] (O.P.); [email protected] (C.S.); [email protected] (A.P.-F.) 2 CIBER Fisiopatología de la Obesidad y Nutrición, Instituto de Salud Carlos III, 28029 Madrid, Spain; [email protected] (O.C.); [email protected] (R.E.) 3 Department of Computer Languages and Systems, Universitat Jaume I, 12071 Castellón, Spain 4 Department of Internal Medicine, Hospital Clinic, Institut d’Investigació Biomèdica August Pi i Sunyer (IDIBAPS), University of Barcelona, Villarroel, 170, 08036 Barcelona, Spain 5 Oncology Department, Sagunto Hospital, 46250 Sagunto, Spain; [email protected] 6 CIBER Cáncer, Instituto de Salud Carlos III, 28029 Madrid, Spain 7 Nutrition and Genomics Laboratory, JM-USDA Human Nutrition Research Center on Aging at Tufts University, Boston, MA 02111, USA; [email protected] 8 Department of Cardiovascular Epidemiology and Population Genetics, Centro Nacional de Investigaciones Cardiovasculares (CNIC), 28029 Madrid, Spain 9 IMDEA Alimentación, 28049 Madrid, Spain * Correspondence: [email protected]; Tel.: +34-96-386-4800 Both authors contributed equally to this work.
    [Show full text]
  • Discovery of Synthetic Lethal and Tumor Suppressive Paralog Pairs in the Human Genome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423710; this version posted December 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Discovery of synthetic lethal and tumor suppressive paralog pairs in the human genome Phoebe C. R. Parrish1,2,3*, James D. Thomas2,4*, Shriya Kamlapurkar1,2, Austin Gabel2,3,4, Robert K. Bradley2,3,4, Alice H. Berger1,2,3 1 Human Biology Division, Fred Hutchinson Cancer Research Center, Seattle, WA, USA 2 Computational Biology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, WA, USA 3 Department of Genome Sciences, University of Washington, Seattle, WA, USA 4 Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, WA, USA Corresponding author: Alice Berger ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423710; this version posted December 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Highlights ● Comprehensive genetic interaction mapping of 1,030 human duplicated paralogs using a dual targeting CRISPR/Cas9 approach ● Duplicated paralogs are highly enriched for genetic interactions ● Synthetic lethal paralogs include CCNL1/CCNL2, CDK4/CDK6, and GSK3A/GSK3B ● Tumor suppressor paralog pairs include CDKN2A/CDKN2B and FBXO25/FBXO32 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423710; this version posted December 21, 2020.
    [Show full text]
  • SUPPLEMENTARY MATERIALS and METHODS PBMC Transcriptomics
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut SUPPLEMENTARY MATERIALS AND METHODS PBMC transcriptomics identifies immune-metabolism disorder during the development of HBV-ACLF Contents l Supplementary methods l Supplementary Figure 1 l Supplementary Figure 2 l Supplementary Figure 3 l Supplementary Figure 4 l Supplementary Figure 5 l Supplementary Table 1 l Supplementary Table 2 l Supplementary Table 3 l Supplementary Table 4 l Supplementary Tables 5-14 l Supplementary Table 15 l Supplementary Table 16 l Supplementary Table 17 Li J, et al. Gut 2021;0:1–13. doi: 10.1136/gutjnl-2020-323395 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut SUPPLEMENTARY METHODS Test for HBV DNA The levels of HBV DNA were detected using real-time PCR with a COBAS® AmpliPrep/COBAS® TaqMan 48 System (Roche, Basel, Switzerland) and HBV Test v2.0. Criteria for diagnosing cirrhosis Pathology The gold standard for the diagnosis of cirrhosis is a liver biopsy obtained through a percutaneous or transjugular approach.1 Ultrasonography was performed 2-4 hours before biopsy. Liver biopsy specimens were obtained by experienced physicians. Percutaneous transthoracic puncture of the liver was performed according to the standard criteria. After biopsy, patients were monitored in the hospital with periodic analyses of haematocrit and other vital signs for 24 hours. Cirrhosis was diagnosed according to the globally agreed upon criteria.2 Cirrhosis is defined based on its pathological features under a microscope: (a) the presence of parenchymal nodules, (b) differences in liver cell size and appearance, (c) fragmentation of the biopsy specimen, (d) fibrous septa, and (d) an altered architecture and vascular relationships.
    [Show full text]
  • T-, B-And NK-Lymphoid, but Not Myeloid Cells Arise from Human
    Leukemia (2007) 21, 311–319 & 2007 Nature Publishing Group All rights reserved 0887-6924/07 $30.00 www.nature.com/leu ORIGINAL ARTICLE T-, B- and NK-lymphoid, but not myeloid cells arise from human CD34 þ CD38ÀCD7 þ common lymphoid progenitors expressing lymphoid-specific genes I Hoebeke1,3, M De Smedt1, F Stolz1,4, K Pike-Overzet2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium and 2Department of Immunology, Erasmus University Medical Center, Rotterdam, The Netherlands Hematopoietic stem cells in the bone marrow (BM) give rise to share a direct common progenitor either, as CLPs were not all blood cells. According to the classic model of hematopoi- found in the fetal liver.5 Instead, fetal B and T cells would esis, the differentiation paths leading to the myeloid and develop through B/myeloid and T/myeloid intermediates. lymphoid lineages segregate early. A candidate ‘common 6 lymphoid progenitor’ (CLP) has been isolated from The first report of a human CLP came from Galy et al. who À þ CD34 þ CD38À human cord blood cells based on CD7 expres- showed that a subpopulation of adult and fetal BM Lin CD34 sion. Here, we confirm the B- and NK-differentiation potential of cells expressing the early B- and T-cell marker CD10 is not þ À þ CD34 CD38 CD7 cells and show in addition that this capable of generating monocytic, granulocytic, erythroid or population has strong capacity to differentiate into T cells. As megakaryocytic cells, but can differentiate into dendritic cells, CD34 þ CD38ÀCD7 þ cells are virtually devoid of myeloid B, T and NK cells.
    [Show full text]
  • Molecular Characterization of Astrocytoma Progression Towards Secondary Glioblastomas Utilizing Patient-Matched Tumor Pairs
    cancers Article Molecular Characterization of Astrocytoma Progression Towards Secondary Glioblastomas Utilizing Patient-Matched Tumor Pairs Michael Seifert 1,2,* , Gabriele Schackert 2,3,4, Achim Temme 2,3,4, Evelin Schröck 2,4,5,6,7, Andreas Deutsch 8 and Barbara Klink 2,4,5,9 1 Institute for Medical Informatics and Biometry (IMB), Carl Gustav Carus Faculty of Medicine, Technische Universität Dresden, D-01307 Dresden, Germany 2 National Center for Tumor Diseases (NCT), Partner Site Dresden, D-01307 Dresden, Germany; [email protected] (G.S.); [email protected] (A.T.); [email protected] (E.S.); [email protected] (B.K.) 3 Department of Neurosurgery, Section Experimental Neurosurgery/Tumor Immunology, University Hospital Carl Gustav Carus, Technische Universität Dresden, D-01307 Dresden, Germany 4 German Cancer Consortium (DKTK), Dresden, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany 5 Institute for Clinical Genetics, Carl Gustav Carus Faculty of Medicine, Technische Universität Dresden, D-01307 Dresden, Germany 6 ERN-GENTURIS, Hereditary Cancer Syndrome Center Dresden, D-01307 Dresden, Germany 7 Max Planck Institute of Molecular Cell Biology and Genetics (MPI-CBG), D-01307 Dresden, Germany 8 Center for Information Services and High Performance Computing (ZIH), Technische Universität Dresden, D-01062 Dresden, Germany; [email protected] 9 National Center of Genetics (NCG), Laboratoire national de santé (LNS), L-3555 Dudelange, Luxembourg * Correspondence: [email protected] Received: 19 May 2020; Accepted: 21 June 2020; Published: 26 June 2020 Abstract: Astrocytomas are primary human brain tumors including diffuse or anaplastic astrocytomas that develop towards secondary glioblastomas over time.
    [Show full text]
  • Consensus Transcriptional Regulatory Networks of Coronavirus-Infected
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.24.059527; this version posted July 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Consensus transcriptional regulatory networks of coronavirus- 2 infected human cells 1 2 1 3 Scott A Ochsner , Rudolf T Pillich and Neil J McKenna 1 4 The Signaling Pathways Project and Department of Molecular and 2 5 Cellular Biology, Baylor College of Medicine, Houston, TX 77030; 6 Department of Medicine, University of California San Diego, La Jolla, CA 7 92093. 8 Address Correspondence To: 9 Neil J. McKenna 10 Department of Molecular and Cellular Biology 11 Baylor College of Medicine 12 Houston, TX 77030 13 USA 14 e: [email protected] 15 t: 713-798-8568 16 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.24.059527; this version posted July 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 17 Abstract 18 Establishing consensus around the transcriptional interface between coronavirus (CoV) 19 infection and human cellular signaling pathways can catalyze the development of novel 20 anti-CoV therapeutics. Here, we used publicly archived transcriptomic datasets to 21 compute consensus regulatory signatures, or consensomes, that rank human genes 22 based on their rates of differential expression in MERS-CoV (MERS), SARS-CoV-1 23 (SARS1) and SARS-CoV-2 (SARS2)-infected cells.
    [Show full text]