DOCSLIB.ORG

Supplementary Table S3. Mutations Found Only in Block Q Tumor Focus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table S3. Mutations Found Only in Block Q Tumor Focus Supplementary Table S3. Mutations found only in block Q tumor focus. Gene Symbol Genbank ID Chromosome Position Change Classification Type Reference Variant Q Reference Q Variant dbSNP COSMIC ABCB1 NM_000927 chr7 87144722 T1036I MISSENSE SNV G A 56 9 COSM1195596 ABCD3 NM_002858 chr1 94964360 R496C MISSENSE SNV C T 6 3 COSM913502 ABHD12 NM_015600 chr20 25284257 H320Y MISSENSE SNV G A 145 41 ACE NM_000789 chr17 61560826 K498M MISSENSE SNV A T 28 6 ACOT11 NM_015547 chr1 55013998 G6R MISSENSE SNV G A 62 17 ADAMTS12 NM_030955 chr5 33576716 P1139S MISSENSE SNV G A 19 15 COSM482731 ADD3 NM_016824 chr10 111878395 L206F MISSENSE SNV G T 18 6 AIFM1 NM_004208 chrX 129281788 G138V MISSENSE SNV C A 25 14 COSM1555996 AKAP10 NM_007202 chr17 19839697 V457I MISSENSE SNV C T 41 8 AKAP9 NM_005751 chr7 91631983 D918Y MISSENSE SNV G T 26 9 ALDH3A1 NM_000691 chr17 19643657 R314H MISSENSE SNV C T 23 10 COSM1381458 ALDOC NM_005165 chr17 26901130 A252T MISSENSE SNV C T 142 40 ALPK2 NM_052947 chr18 56246277 Q577H MISSENSE SNV C A 35 15 ANK3 NM_020987 chr10 61831926 R2905C MISSENSE SNV G A 13 5 COSM673798 ANO10 NM_018075 chr3 43596868 L524I MISSENSE SNV A T 46 10 ANO10 NM_018075 chr3 43596867 L524X NONSENSE SNV A T 40 10 ARAP2 NM_015230 chr4 36075330 L1575S MISSENSE SNV A G 19 6 ARFGEF2 NM_006420 chr20 47558459 P71S MISSENSE SNV C T 28 7 ARFGEF2 NM_006420 chr20 47632850 A1405T MISSENSE SNV G A 5 3 COSM1245314 ARHGAP15 NM_018460 chr2 144525593 T427M MISSENSE SNV C T 79 12 COSM1494595 ARHGAP33 NM_052948 chr19 36279057 S1036L MISSENSE SNV C T 37 9 ARHGEF6 NM_004840 chrX 135757198 T668S MISSENSE SNV G C 12 8 ATP10D NM_020453 chr4 47517614 D138N MISSENSE SNV G A 36 9 COSM1618868 ATP6V0A2 NM_012463 chr12 124212338 S177F MISSENSE SNV C T 8 4 COSM1322672 ATP6V1C2 NM_001039362 chr2 10863001 A9V MISSENSE SNV C T 29 6 COSM224645 ATP7B NM_000053 chr13 52520548 V978M MISSENSE SNV C T 34 8 B4GALT4 NM_003778 chr3 118945838 Q102X NONSENSE SNV G A 39 13 BAHD1 NM_014952 chr15 40751321 E220K MISSENSE SNV G A 50 11 BARX2 NM_003658 chr11 129306690 R78C MISSENSE SNV C T 64 12 COSM301747 BICD1 NM_001714 chr12 32481442 R685W MISSENSE SNV C T 46 9 BMPR2 NM_001204 chr2 203397422 E415Q MISSENSE SNV G C 35 10 COSM1306312 BOD1L1 NM_148894 chr4 13602442 E2028K MISSENSE SNV C T 37 6 COSM384444 C10orf91 NM_173541 chr10 134261486 G120E MISSENSE SNV G A 70 14 C1orf109 NM_017850 chr1 38149006 Q187X NONSENSE SNV G A 39 19 C2orf49 NM_024093 chr2 105959534 H166D MISSENSE SNV C G 31 8 CAPN7 NM_014296 chr3 15288887 E709D MISSENSE SNV G T 28 6 CARD10 NM_014550 chr22 37888746 P847H MISSENSE SNV G T 152 69 CCDC14 NM_022757 chr3 123665920 R318X NONSENSE SNV G A 8 4 CCDC141 NM_173648 chr2 179718210 E1068K MISSENSE SNV C T 26 8 CCDC166 NM_001162914 chr8 144790063 N73H MISSENSE SNV T G 28 13 CD46 NM_172359 chr1 207934695 P193S MISSENSE SNV C T 7 6 CHD9 NM_025134 chr16 53326835 R1794H MISSENSE SNV G A 19 7 COSM1201019 CHST4 NM_001166395 chr16 71570653 H25N MISSENSE SNV C A 38 11 CILP NM_003613 chr15 65491173 R484Q MISSENSE SNV C T 65 14 COSM1201212 CLC NM_001828 chr19 40225125 P34L MISSENSE SNV G A 17 13 COSM1494273 CLEC7A NM_197947 chr12 10280396 G51E MISSENSE SNV C T 14 4 COSM122193 CNGA3 NM_001298 chr2 99013218 V529M MISSENSE SNV G A 134 39 rs104893619 COSM77490 COL6A1 NM_001848 chr21 47422272 R736K MISSENSE SNV G A 24 12 CRLS1 NM_019095 chr20 5990515 N134S MISSENSE SNV A G 5 2 COSM1190209 CRYZ NM_001130042 chr1 75184968 P118L MISSENSE SNV G A 28 7 CTNNA1 NM_001903 chr5 138253514 W491X NONSENSE SNV G A 5 4 CYFIP1 NM_014608 chr15 22935935 N291Y MISSENSE SNV A T 16 6 DCAF7 NM_005828 chr17 61657272 V166M MISSENSE SNV G A 155 61 DCC NM_005215 chr18 50278721 R130Q MISSENSE SNV G A 52 12 COSM271921 DCHS2 NM_017639 chr4 155180777 D1782N MISSENSE SNV C T 2 2 COSM1695109 DENND2C NM_001256404 chr1 115142958 R658X NONSENSE SNV G A 66 16 COSM1203338 DMRT1 NM_021951 chr9 916902 A321E MISSENSE SNV C A 38 7 COSM1331451 DSP NM_004415 chr6 7575559 S823L MISSENSE SNV C T 22 5 rs141834182 COSM1487922 DYNC1H1 NM_001376 chr14 102446846 G307V MISSENSE SNV G T 8 4 EID1 NM_014335 chr15 49170926 D185N MISSENSE SNV G A 34 17 EIF2D NM_006893 chr1 206769077 S500F MISSENSE SNV G A 22 7 ERGIC2 NM_016570 chr12 29494115 P370S MISSENSE SNV G A 25 6 FAM184A NM_024581 chr6 119399345 M40I MISSENSE SNV C A 26 8 FAM3D NM_138805 chr3 58631311 A63V MISSENSE SNV G A 80 20 FAM49A NM_030797 chr2 16769321 E23K MISSENSE SNV C T 37 10 COSM1690222 FAM98A NM_015475 chr2 33820655 A35S MISSENSE SNV C A 48 9 FANCA NM_000135 chr16 89842155 P632L MISSENSE SNV G A 107 32 FBXL19 NM_001099784 chr16 30941800 G419E MISSENSE SNV G A 55 24 FBXO47 NM_001008777 chr17 37093483 A435V MISSENSE SNV G A 25 8 FLG2 NM_001014342 chr1 152327060 E1068K MISSENSE SNV C T 21 5 COSM1293190 FMN2 NM_020066 chr1 240494024 P1520L MISSENSE SNV C T 26 4 COSM1473674 FMN2 NM_020066 chr1 240494024 P1520L MISSENSE SNV C T 26 4 COSM1473674 FNBP4 NM_015308 chr11 47767904 E317K MISSENSE SNV C T 77 12 FPGT NM_003838 chr1 74670968 V413L MISSENSE SNV G T 10 5 COSM682189 GABRQ NM_018558 chrX 151820033 R316W MISSENSE SNV C T 29 6 COSM1582818 GALNT3 NM_004482 chr2 166613573 A459E MISSENSE SNV G T 6 5 GALR1 NM_001480 chr18 74963012 V170M MISSENSE SNV G A 45 19 GPR113 NM_001145168 chr2 26533073 M1023I MISSENSE SNV C T 126 29 GPR32 NM_001506 chr19 51274417 G187D MISSENSE SNV G A 32 15 GPR98 NM_032119 chr5 90106906 R5277C MISSENSE SNV C T 31 6 COSM1158970 GPSM2 NM_013296 chr1 109440206 C124Y MISSENSE SNV G A 75 16 GREB1L NM_001142966 chr18 19085502 T1401I MISSENSE SNV C T 28 18 GZMB NM_004131 chr14 25101144 E174K MISSENSE SNV C T 34 7 COSM1369431 HEATR1 NM_018072 chr1 236748396 P724S MISSENSE SNV G A 5 3 COSM1690000 HIST1H2BH NM_003524 chr6 26251954 D26N MISSENSE SNV G A 29 10 COSM1076752 HMCN1 NM_031935 chr1 186024704 L2348I MISSENSE SNV C A 57 13 HMGCLL1 NM_019036 chr6 55360350 I251N MISSENSE SNV A T 8 4 HS3ST5 NM_153612 chr6 114379025 S146F MISSENSE SNV G A 17 6 COSM232507 IFIT1B NM_001010987 chr10 91143394 M108I MISSENSE SNV G A 76 15 IGDCC4 NM_020962 chr15 65677303 D1111N MISSENSE SNV C T 56 17 IGSF9 NM_001135050 chr1 159904002 G361E MISSENSE SNV C T 59 10 ISLR2 NM_001130138 chr15 74426437 Q448X NONSENSE SNV C T 58 22 ITGA4 NM_000885 chr2 182360586 E488K MISSENSE SNV G A 7 4 ITGA6 NM_001079818 chr2 173349861 D575N MISSENSE SNV G A 19 4 COSM441507 ITIH1 NM_002215 chr3 52813491 V152I MISSENSE SNV G A 48 9 rs147534607 COSM236766 JHDM1D NM_030647 chr7 139824444 G343V MISSENSE SNV C A 21 6 KBTBD7 NM_032138 chr13 41766650 R582X NONSENSE SNV G A 21 4 COSM1255212 KDM5A NM_001042603 chr12 432830 R696W MISSENSE SNV G A 76 13 COSM939275 KIAA0895 NM_001100425 chr7 36396605 D258A MISSENSE SNV T G 9 11 KIF15 NM_020242 chr3 44879775 M1060I MISSENSE SNV G T 52 8 COSM371412 KIT NM_000222 chr4 55597547 V732A MISSENSE SNV T C 24 4 COSM1430172 KLHL20 NM_014458 chr1 173721027 Y241F MISSENSE SNV A T 8 4 KRT1 NM_006121 chr12 53072390 D248N MISSENSE SNV C T 16 4 COSM75184 KRTAP5-5 NM_001001480 chr11 1651615 Y182C MISSENSE SNV A G 8 8 rs74396270 COSM1321770 L3MBTL2 NM_031488 chr22 41605733 E20K MISSENSE SNV G A 83 18 LANCL2 NM_018697 chr7 55467697 P193L MISSENSE SNV C T 22 7 LCE1C NM_178351 chr1 152777810 G49R MISSENSE SNV C T 26 8 COSM1319951 LDB1 NM_001113407 chr10 103870647 E111X NONSENSE SNV C A 40 16 LHFPL1 NM_178175 chrX 111903900 E146K MISSENSE SNV C T 16 6 LMOD1 NM_012134 chr1 201868559 G528W MISSENSE SNV C A 251 77 LOXL1 NM_005576 chr15 74219254 Q44X NONSENSE SNV C T 18 11 LPHN3 NM_015236 chr4 62598825 H250Y MISSENSE SNV C T 43 12 LRP2 NM_004525 chr2 170066149 R2095X NONSENSE SNV G A 29 5 COSM1213761 LRRC47 NM_020710 chr1 3701701 A382P MISSENSE SNV C G 124 31 MAN1A1 NM_005907 chr6 119669720 L171M MISSENSE SNV G T 32 8 MAP3K4 NM_005922 chr6 161470575 W424X NONSENSE SNV G A 84 17 MCM6 NM_005915 chr2 136624217 V233M MISSENSE SNV C T 43 16 MCM7 NM_005916 chr7 99698914 A2S MISSENSE SNV C A 21 9 MERTK NM_006343 chr2 112786035 R865Q MISSENSE SNV G A 49 10 COSM271387 METRN NM_024042 chr16 765976 G166V MISSENSE SNV G T 24 11 METTL3 NM_019852 chr14 21969168 A335T MISSENSE SNV C T 41 8 MFSD6 NM_017694 chr2 191301002 G83S MISSENSE SNV G A 19 10 MLLT4 NM_001207008 chr6 168325721 V994M MISSENSE SNV G A 17 10 MORN1 NM_024848 chr1 2288966 G314E MISSENSE SNV C T 53 13 COSM905201 MRPL37 NM_016491 chr1 54678309 A323V MISSENSE SNV C T 29 6 COSM1687717 MTG1 NM_138384 chr10 135212728 E140K MISSENSE SNV G A 43 15 MTTP NM_000253 chr4 100532397 R623C MISSENSE SNV C T 8 7 MUS81 NM_025128 chr11 65628512 H68Q MISSENSE SNV C G 54 11 MUSK NM_005592 chr9 113459626 L170F MISSENSE SNV C T 66 14 MYO9A NM_006901 chr15 72190522 R1441I MISSENSE SNV C A 3 2 COSM964548 NAIP NM_004536 chr5 70308532 E71K MISSENSE SNV C T 32 8 NAV3 NM_014903 chr12 78513083 R1036I MISSENSE SNV G T 59 8 COSM943624 NEB NM_001271208 chr2 152408319 K6626I MISSENSE SNV T A 34 7 NEB NM_001271208 chr2 152552115 V551I MISSENSE SNV C T 47 7 COSM387101 NGF NM_002506 chr1 115828746 R224Q MISSENSE SNV C T 64 10 COSM1294771 NLN NM_020726 chr5 65073345 P181L MISSENSE SNV C T 23 18 NLRX1 NM_024618 chr11 119045219 V303M MISSENSE SNV G A 34 6 rs147720831 COSM686914 NOC4L NM_024078 chr12 132633393 A285G MISSENSE SNV C G 49 12 NR2F6 NM_005234 chr19 17351500 R118Q MISSENSE SNV C T 80 16 NR3C2 NM_000901 chr4 149356799 A405D MISSENSE SNV G T 4 7 NUP155 NM_153485 chr5 37348685 G306V MISSENSE SNV C A 29 6 OR10A3 NM_001003745 chr11 7960899 V57I MISSENSE SNV C T 75 14 COSM271435 OR2AK2 NM_001004491 chr1 248129556 R308K MISSENSE SNV G A 57 11 OR2L2 NM_001004686 chr1 248202305 V246I MISSENSE SNV G A 35 13 OR4K2 NM_001005501 chr14 20344535 A37T MISSENSE SNV G A 13 6 OR52B6 NM_001005162
Load more

Recommended publications
  • OR52B6 (NM 001005162) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG224573 OR52B6 (NM_001005162) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR52B6 (NM_001005162) Human Tagged ORF Clone Tag: TurboGFP Symbol: OR52B6 Synonyms: OR11-47 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG224573 representing NM_001005162 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCACAGGTGAGGGCGCTGCATAAAATCATGGCCCTTTTTTCTGCTAACAGCATAGGTGCTATGAACA ACTCTGACACTCGCATAGCAGGCTGCTTCCTCACTGGCATCCCTGGGCTGGAGCAACTACATATCTGGCT GTCCATCCCCTTCTGCATCATGTACATCGCTGCCCTGGAAGGCAATGGCATCCTAATTTGTGTCATCCTC TCCCAGGCAATCCTGCATGAGCCCATGTACATATTCTTATCTATGCTGGCCAGTGCTGATGTCTTGCTCT CTACCACCACCATGCCTAAGGCCCTGGCCAATTTGTGGCTAGGTTATAGCCACATTTCCTTTGATGGCTG CCTCACTCAGATGTTCTTCATTCACTTCCTCTTCATTCACTCTGCTGTCCTGCTGGCCATGGCCTTTGAC CGCTATGTGGCCATCTGCTCCCCCCTGCGATATGTCACAATCCTCACAAGCAAGGTCATTGGGAAGATCG TCACTGCCACCCTGAGCCGCAGCTTCATCATTATGTTTCCATCCATCTTTCTCCTTGAGCACCTGCACTA TTGCCAGATCAACATCATTGCACACACATTTTGTGAGCACATGGGCATTGCCCATCTGTCCTGTTCTGAT ATCTCCATCAATGTCTGGTATGGGTTGGCAGCTGCTCTTCTCTCCACAGGCCTGGACATCATGCTTATTA CTGTTTCCTACATCCACATCCTCCAAGCAGTCTTCCGCCTCCTTTCTCAAGATGCCCGCTCCAAGGCCCT GAGTACCTGTGGATCCCATATCTGTGTCATCCTACTCTTCTATGTCCCTGCCCTTTTTTCTGTCTTTGCC TACAGGTTTGGTGGGAGAAGCATCCCATGCTATGTCCATATTCTCCTGGCCAGCCTCTACGTTGTCATTC
    [Show full text]
  • Genetic Characterization of Greek Population Isolates Reveals Strong Genetic Drift at Missense and Trait-Associated Variants
    ARTICLE Received 22 Apr 2014 | Accepted 22 Sep 2014 | Published 6 Nov 2014 DOI: 10.1038/ncomms6345 OPEN Genetic characterization of Greek population isolates reveals strong genetic drift at missense and trait-associated variants Kalliope Panoutsopoulou1,*, Konstantinos Hatzikotoulas1,*, Dionysia Kiara Xifara2,3, Vincenza Colonna4, Aliki-Eleni Farmaki5, Graham R.S. Ritchie1,6, Lorraine Southam1,2, Arthur Gilly1, Ioanna Tachmazidou1, Segun Fatumo1,7,8, Angela Matchan1, Nigel W. Rayner1,2,9, Ioanna Ntalla5,10, Massimo Mezzavilla1,11, Yuan Chen1, Chrysoula Kiagiadaki12, Eleni Zengini13,14, Vasiliki Mamakou13,15, Antonis Athanasiadis16, Margarita Giannakopoulou17, Vassiliki-Eirini Kariakli5, Rebecca N. Nsubuga18, Alex Karabarinde18, Manjinder Sandhu1,8, Gil McVean2, Chris Tyler-Smith1, Emmanouil Tsafantakis12, Maria Karaleftheri16, Yali Xue1, George Dedoussis5 & Eleftheria Zeggini1 Isolated populations are emerging as a powerful study design in the search for low-frequency and rare variant associations with complex phenotypes. Here we genotype 2,296 samples from two isolated Greek populations, the Pomak villages (HELIC-Pomak) in the North of Greece and the Mylopotamos villages (HELIC-MANOLIS) in Crete. We compare their genomic characteristics to the general Greek population and establish them as genetic isolates. In the MANOLIS cohort, we observe an enrichment of missense variants among the variants that have drifted up in frequency by more than fivefold. In the Pomak cohort, we find novel associations at variants on chr11p15.4 showing large allele frequency increases (from 0.2% in the general Greek population to 4.6% in the isolate) with haematological traits, for example, with mean corpuscular volume (rs7116019, P ¼ 2.3 Â 10 À 26). We replicate this association in a second set of Pomak samples (combined P ¼ 2.0 Â 10 À 36).
    [Show full text]
  • Supplemental Files 1-5.Pdf
    Supplemental file 1: The whole list of tumor aberrations by time tumor biopsy ctDNA 2002 (T1) 2012 (M1) 2015 (M2) 08/2015 09/2015 11/2015 02/2016 05/2016 07/2016 11/2016 02/2017 05/2017 07/2017 11/2017 PIK3CA Q546R PIK3CA Q546R PIK3CA Q546R PIK3CA Q546R 0.30% PIK3CA Q546R 1.30% PIK3CA Q546R 5.40% PIK3CA Q546R 12.50% PIK3CA Q546R 9.50% PIK3CA Q546R 32.58% PIK3CA Q546R 44.30% PIK3CA Q546R 15.40% PIK3CA Q546R 41.00% TP53 E180K TP53 E180K TP53 E180K TP53 E180K 0.30% TP53 E180K 1.00% TP53 E180K 4.80% PIK3CA M1043I 0.20% PIK3CA M1043I 0.70% PIK3CA E453K 0.69% PIK3CA E453K 3.20% PIK3CA E453K 0.55% PIK3CA M1043I 0.20% PIK3R2 S688* PIK3R2 S688* ATR E2579K VHL E173Q 0.40% PTEN Q245* 0.20% PTEN Q245* 0.30% PIK3CA E726K 1.50% PIK3CA E245Q 0.10% PIK3CA M1043I 0.36% PIK3CA M1043I 1.20% TP53 E180K 11.80% PIK3CA E453K 0.25% PLCG2 P737T PLCG2 P737T PIK3CA E726K VHL E173Q 1.10% RB1 R556* 3.10% TP53 E180K 11.00% PIK3CA E726K 0.20% PIK3CA E726K 0.23% PIK3CA E726K 0.44% TP53 I195F 1.20% PIK3CA E39Q 0.53% CDKN1B Q163* PIK3CA M1004I MET S1061F MET L229F 0.30% CCND1 E9K 0.10% PTEN Q245* 0.80% TP53 E180K 7.30% TP53 E180K 24.28% TP53 E180K 35.40% TP53 L137Q 1.30% TP53 E180K 38.40% ERBB2 R487W PTEN S229* TBX3 S435* MET W112C 1.20% NF1 D1556N 1.30% TP53 I195F 0.20% TP53 R175G 0.20% TP53 I195F 1.70% ESR1 E380Q 7.10% TP53 I195F 0.56% ALK E1407K RB1 Q217* SPEN Q743* NF1 R1176T 1.00% NF1 E76K 0.30% ESR1 E380Q 0.90% TP53 I195F 1.37% TP53 L137Q 2.10% ESR1 L391V 0.41% TP53 I254M 0.25% APC E2637K PIK3CA D1017N PTEN I253M VHL E173Q 1.20% RB1 R556* 7.20% NF1 R1176T 0.50% TP53
    [Show full text]
  • The Potential Genetic Network of Human Brain SARS-Cov-2 Infection
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.06.027318; this version posted April 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. The potential genetic network of human brain SARS-CoV-2 infection. Colline Lapina 1,2,3, Mathieu Rodic 1, Denis Peschanski 4,5, and Salma Mesmoudi 1, 3, 4, 5 1 Prematuration Program: linkAllBrains. CNRS. Paris. France 2 Graduate School in Cognitive Engineering (ENSC). Talence. France 3 Complex Systems Institute Paris île-de-France. Paris. France 4 CNRS, Paris-1-Panthéon-Sorbonne University. CESSP-UMR8209. Paris. France 5 MATRICE Equipex. Paris. France Abstract The literature reports several symptoms of SARS-CoV-2 in humans such as fever, cough, fatigue, pneumonia, and headache. Furthermore, patients infected with similar strains (SARS-CoV and MERS-CoV) suffered testis, liver, or thyroid damage. Angiotensin-converting enzyme 2 (ACE2) serves as an entry point into cells for some strains of coronavirus (SARS-CoV, MERS-CoV, SARS-CoV-2). Our hypothesis was that as ACE2 is essential to the SARS-CoV-2 virus invasion, then brain regions where ACE2 is the most expressed are more likely to be disturbed by the infection. Thus, the expression of other genes which are also over-expressed in those damaged areas could be affected. We used mRNA expression levels data of genes provided by the Allen Human Brain Atlas (ABA), and computed spatial correlations with the LinkRbrain platform.
    [Show full text]
  • Clinical, Molecular, and Immune Analysis of Dabrafenib-Trametinib
    Supplementary Online Content Chen G, McQuade JL, Panka DJ, et al. Clinical, molecular and immune analysis of dabrafenib-trametinib combination treatment for metastatic melanoma that progressed during BRAF inhibitor monotherapy: a phase 2 clinical trial. JAMA Oncology. Published online April 28, 2016. doi:10.1001/jamaoncol.2016.0509. eMethods. eReferences. eTable 1. Clinical efficacy eTable 2. Adverse events eTable 3. Correlation of baseline patient characteristics with treatment outcomes eTable 4. Patient responses and baseline IHC results eFigure 1. Kaplan-Meier analysis of overall survival eFigure 2. Correlation between IHC and RNAseq results eFigure 3. pPRAS40 expression and PFS eFigure 4. Baseline and treatment-induced changes in immune infiltrates eFigure 5. PD-L1 expression eTable 5. Nonsynonymous mutations detected by WES in baseline tumors This supplementary material has been provided by the authors to give readers additional information about their work. © 2016 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/30/2021 eMethods Whole exome sequencing Whole exome capture libraries for both tumor and normal samples were constructed using 100ng genomic DNA input and following the protocol as described by Fisher et al.,3 with the following adapter modification: Illumina paired end adapters were replaced with palindromic forked adapters with unique 8 base index sequences embedded within the adapter. In-solution hybrid selection was performed using the Illumina Rapid Capture Exome enrichment kit with 38Mb target territory (29Mb baited). The targeted region includes 98.3% of the intervals in the Refseq exome database. Dual-indexed libraries were pooled into groups of up to 96 samples prior to hybridization.
    [Show full text]
  • The Hypothalamus As a Hub for SARS-Cov-2 Brain Infection and Pathogenesis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.08.139329; this version posted June 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The hypothalamus as a hub for SARS-CoV-2 brain infection and pathogenesis Sreekala Nampoothiri1,2#, Florent Sauve1,2#, Gaëtan Ternier1,2ƒ, Daniela Fernandois1,2 ƒ, Caio Coelho1,2, Monica ImBernon1,2, Eleonora Deligia1,2, Romain PerBet1, Vincent Florent1,2,3, Marc Baroncini1,2, Florence Pasquier1,4, François Trottein5, Claude-Alain Maurage1,2, Virginie Mattot1,2‡, Paolo GiacoBini1,2‡, S. Rasika1,2‡*, Vincent Prevot1,2‡* 1 Univ. Lille, Inserm, CHU Lille, Lille Neuroscience & Cognition, DistAlz, UMR-S 1172, Lille, France 2 LaBoratorY of Development and PlasticitY of the Neuroendocrine Brain, FHU 1000 daYs for health, EGID, School of Medicine, Lille, France 3 Nutrition, Arras General Hospital, Arras, France 4 Centre mémoire ressources et recherche, CHU Lille, LiCEND, Lille, France 5 Univ. Lille, CNRS, INSERM, CHU Lille, Institut Pasteur de Lille, U1019 - UMR 8204 - CIIL - Center for Infection and ImmunitY of Lille (CIIL), Lille, France. # and ƒ These authors contriButed equallY to this work. ‡ These authors directed this work *Correspondence to: [email protected] and [email protected] Short title: Covid-19: the hypothalamic hypothesis 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.08.139329; this version posted June 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Explorations in Olfactory Receptor Structure and Function by Jianghai
    Explorations in Olfactory Receptor Structure and Function by Jianghai Ho Department of Neurobiology Duke University Date:_______________________ Approved: ___________________________ Hiroaki Matsunami, Supervisor ___________________________ Jorg Grandl, Chair ___________________________ Marc Caron ___________________________ Sid Simon ___________________________ [Committee Member Name] Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University 2014 ABSTRACT Explorations in Olfactory Receptor Structure and Function by Jianghai Ho Department of Neurobiology Duke University Date:_______________________ Approved: ___________________________ Hiroaki Matsunami, Supervisor ___________________________ Jorg Grandl, Chair ___________________________ Marc Caron ___________________________ Sid Simon ___________________________ [Committee Member Name] An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University 2014 Copyright by Jianghai Ho 2014 Abstract Olfaction is one of the most primitive of our senses, and the olfactory receptors that mediate this very important chemical sense comprise the largest family of genes in the mammalian genome. It is therefore surprising that we understand so little of how olfactory receptors work. In particular we have a poor idea of what chemicals are detected by most of the olfactory receptors in the genome, and for those receptors which we have paired with ligands, we know relatively little about how the structure of these ligands can either activate or inhibit the activation of these receptors. Furthermore the large repertoire of olfactory receptors, which belong to the G protein coupled receptor (GPCR) superfamily, can serve as a model to contribute to our broader understanding of GPCR-ligand binding, especially since GPCRs are important pharmaceutical targets.
    [Show full text]
  • Supplementary Tables
    Supplementary Tables Supplementary Table 1. Differentially methylated genes in correlation with their expression pattern in the A4 progression model A. Hypomethylated–upregulated Genes (n= 76) ALOX5 RRAD RTN4R DSCR6 FGFR3 HTR7 WNT3A POGK PLCD3 ALPPL2 RTEL1 SEMA3B DUSP5 FOSB ITGB4 MEST PPL PSMB8 ARHGEF4 BST2 SEMA7A SLC12A7 FOXQ1 KCTD12 LETM2 PRPH PXMP2 ARNTL2 CDH3 SHC2 SLC20A2 HSPA2 KIAA0182 LIMK2 NAB1 RASIP1 ASRGL1 CLDN3 DCBLD1 SNX10 SSH1 KREMEN2 LIPE NDRG2 ATF3 CLU DCHS1 SOD3 ST3GAL4 MAL LRRC1 NR3C2 ATP8B3 CYC1 DGCR8 EBAG9 SYNGR1 TYMS MCM2 NRG2 RHOF DAGLA DISP2 FAM19A5 TNNI3 UNC5B MYB PAK6 RIPK4 DAZAP1 DOCK3 FBXO6 HSPA4L WHSC1 PNMT PCDH1 B. Hypermethylated-downregulated Genes (n= 31) ARHGAP22 TNFSF9 KLF6 LRP8 NRP1 PAPSS2 SLC43A2 TBC1D16 ASB2 DZIP1 TPM1 MDGA1 NRP2 PIK3CD SMARCA2 TLL2 C18orf1 FBN1 LHFPL2 TRIO NTNG2 PTGIS SOCS2 TNFAIP8 DIXDC1 KIFC3 LMO1 NR3C1 ODZ3 PTPRM SYNPO Supplementary Table 2. Genes enriched for different histone methylation marks in A4 progression model identified through ChIP-on-chip a. H3K4me3 (n= 978) AATF C20orf149 CUL3 FOXP1 KATNA1 NEGR1 RAN SPIN2B ABCA7 C20orf52 CWF19L1 FRK KBTBD10 NEIL1 RANBP2 SPPL2A ABCC9 C21orf13-SH3BGR CXCL3 FSIP1 KBTBD6 NELF RAPGEF3 SPRY4 ABCG2 C21orf45 CYC1 FUK KCMF1 NFKB2 RARB SPRYD3 ABHD7 C22orf32 CYorf15A FXR2 KCNH7 NGDN RASAL2 SPTLC2 ACA15 C2orf18 DAXX FZD9 KCNMB4 NKAP RASD1 SRFBP1 ACA26 C2orf29 DAZ3 G6PD KCTD18 NKTR RASEF SRI ACA3 C2orf32 DBF4 GABPB2 KDELR2 NNT RASGRF1 SRM ACA48 C2orf55 DBF4B GABRA5 KIAA0100 NOL5A RASSF1 SSH2 ACAT1 C3orf44 DBI GADD45B KIAA0226 NOLC1 RASSF3 SSH3 ACSL5
    [Show full text]
  • Supplementary Materialsupplementary Material
    DOI:10.1071/AN20275_AC CSIRO 2021 Animal Production Science 2021, 61, 731–744 Genome-wide association study between copy number variation regions and carcass and meat quality traits in Nellore cattle Mariana Piatto Berton1,5, Marcos Vinícius de Antunes Lemos1, Tatiane Cristina Seleguim Chud2, Nedenia Bonvino Stafuzza1, Sabrina Kluska1, Sabrina Thaise Amorim1, Lucas Silva Ferlin Lopes1, Angélica Simone Cravo Pereira3, Derek Bickhart4, George Liu4, Lúcia Galvão de Albuquerque1 and Fernando Baldi1 1Departamento de Zootecnia, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista, Via de acesso Prof. Paulo Donato Castellane, s/no, CEP 14884-900 Jaboticabal, SP, Brazil 2Centre for Genetic Improvement of Livestock, University of Guelph, Guelph, ON, Canada N1G 2W1 3 Faculdade de Zootecnia e Engenharia de Alimentos, Universidade de São Paulo, Rua Duque de Caxias Norte, 225, CEP 13635-900 Pirassununga, SP, Brazil 4 USDA-ARS, ANRI, Bovine Functional Genomics Laboratory, Beltsville, Maryland 20705, USA; 2Department of Animal and Avian Sciences, University of Maryland, College Park, Maryland 20742, USA 5Corresponding author. E-mail: [email protected] Table S1. Description of significant (P value<0.05) CNVRs associated with beef tenderness (BT) and candidate genes within the CNVRs. CNVR ID BTA Type* Start (bp) End (bp) Size (bp) Low** High** P value FDR CNVR_gain_3 1 Gain 1374155 3404571 2030417 27 45 0.026 0.36 CNVR_gain_644 2 Gain 81291862 83154452 1862591 32 15 0.015 0.40 CNVR_loss_936 5 Loss 22514133 22563988 49856 233
    [Show full text]
  • Online Supporting Information S2: Proteins in Each Negative Pathway
    Online Supporting Information S2: Proteins in each negative pathway Index Proteins ADO,ACTA1,DEGS2,EPHA3,EPHB4,EPHX2,EPOR,EREG,FTH1,GAD1,HTR6, IGF1R,KIR2DL4,NCR3,NME7,NOTCH1,OR10S1,OR2T33,OR56B4,OR7A10, Negative_1 OR8G1,PDGFC,PLCZ1,PROC,PRPS2,PTAFR,SGPP2,STMN1,VDAC3,ATP6V0 A1,MAPKAPK2 DCC,IDS,VTN,ACTN2,AKR1B10,CACNA1A,CHIA,DAAM2,FUT5,GCLM,GNAZ Negative_2 ,ITPA,NEU4,NTF3,OR10A3,PAPSS1,PARD3,PLOD1,RGS3,SCLY,SHC1,TN FRSF4,TP53 Negative_3 DAO,CACNA1D,HMGCS2,LAMB4,OR56A3,PRKCQ,SLC25A5 IL5,LHB,PGD,ADCY3,ALDH1A3,ATP13A2,BUB3,CD244,CYFIP2,EPHX2,F CER1G,FGD1,FGF4,FZD9,HSD17B7,IL6R,ITGAV,LEFTY1,LIPG,MAN1C1, Negative_4 MPDZ,PGM1,PGM3,PIGM,PLD1,PPP3CC,TBXAS1,TKTL2,TPH2,YWHAQ,PPP 1R12A HK2,MOS,TKT,TNN,B3GALT4,B3GAT3,CASP7,CDH1,CYFIP1,EFNA5,EXTL 1,FCGR3B,FGF20,GSTA5,GUK1,HSD3B7,ITGB4,MCM6,MYH3,NOD1,OR10H Negative_5 1,OR1C1,OR1E1,OR4C11,OR56A3,PPA1,PRKAA1,PRKAB2,RDH5,SLC27A1 ,SLC2A4,SMPD2,STK36,THBS1,SERPINC1 TNR,ATP5A1,CNGB1,CX3CL1,DEGS1,DNMT3B,EFNB2,FMO2,GUCY1B3,JAG Negative_6 2,LARS2,NUMB,PCCB,PGAM1,PLA2G1B,PLOD2,PRDX6,PRPS1,RFXANK FER,MVD,PAH,ACTC1,ADCY4,ADCY8,CBR3,CLDN16,CPT1A,DDOST,DDX56 ,DKK1,EFNB1,EPHA8,FCGR3A,GLS2,GSTM1,GZMB,HADHA,IL13RA2,KIR2 Negative_7 DS4,KLRK1,LAMB4,LGMN,MAGI1,NUDT2,OR13A1,OR1I1,OR4D11,OR4X2, OR6K2,OR8B4,OXCT1,PIK3R4,PPM1A,PRKAG3,SELP,SPHK2,SUCLG1,TAS 1R2,TAS1R3,THY1,TUBA1C,ZIC2,AASDHPPT,SERPIND1 MTR,ACAT2,ADCY2,ATP5D,BMPR1A,CACNA1E,CD38,CYP2A7,DDIT4,EXTL Negative_8 1,FCER1G,FGD3,FZD5,ITGAM,MAPK8,NR4A1,OR10V1,OR4F17,OR52D1,O R8J3,PLD1,PPA1,PSEN2,SKP1,TACR3,VNN1,CTNNBIP1 APAF1,APOA1,CARD11,CCDC6,CSF3R,CYP4F2,DAPK1,FLOT1,GSTM1,IL2
    [Show full text]
  • OR52B6 (NM 001005162) Human Tagged ORF Clone Lentiviral Particle Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC224573L4V OR52B6 (NM_001005162) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: OR52B6 (NM_001005162) Human Tagged ORF Clone Lentiviral Particle Symbol: OR52B6 Synonyms: OR11-47 Vector: pLenti-C-mGFP-P2A-Puro (PS100093) ACCN: NM_001005162 ORF Size: 1005 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC224573). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_001005162.1, NP_001005162.1 RefSeq Size: 1008 bp RefSeq ORF: 1008 bp Locus ID: 340980 UniProt ID: Q8NGF0 Protein Families: Transmembrane Protein Pathways: Olfactory transduction MW: 36.8 kDa This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 OR52B6 (NM_001005162) Human Tagged ORF Clone Lentiviral Particle – RC224573L4V Gene Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell.
    [Show full text]
  • Supplementary Methods
    doi: 10.1038/nature06162 SUPPLEMENTARY INFORMATION Supplementary Methods Cloning of human odorant receptors 423 human odorant receptors were cloned with sequence information from The Olfactory Receptor Database (http://senselab.med.yale.edu/senselab/ORDB/default.asp). Of these, 335 were predicted to encode functional receptors, 45 were predicted to encode pseudogenes, 29 were putative variant pairs of the same genes, and 14 were duplicates. We adopted the nomenclature proposed by Doron Lancet 1. OR7D4 and the six intact odorant receptor genes in the OR7D4 gene cluster (OR1M1, OR7G2, OR7G1, OR7G3, OR7D2, and OR7E24) were used for functional analyses. SNPs in these odorant receptors were identified from the NCBI dbSNP database (http://www.ncbi.nlm.nih.gov/projects/SNP) or through genotyping. OR7D4 single nucleotide variants were generated by cloning the reference sequence from a subject or by inducing polymorphic SNPs by site-directed mutagenesis using overlap extension PCR. Single nucleotide and frameshift variants for the six intact odorant receptors in the same gene cluster as OR7D4 were generated by cloning the respective genes from the genomic DNA of each subject. The chimpanzee OR7D4 orthologue was amplified from chimpanzee genomic DNA (Coriell Cell Repositories). Odorant receptors that contain the first 20 amino acids of human rhodopsin tag 2 in pCI (Promega) were expressed in the Hana3A cell line along with a short form of mRTP1 called RTP1S, (M37 to the C-terminal end), which enhances functional expression of the odorant receptors 3. For experiments with untagged odorant receptors, OR7D4 RT and S84N variants without the Rho tag were cloned into pCI.
    [Show full text]