DOCSLIB.ORG

Supplemental Files 1-5.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Files 1-5.Pdf Supplemental file 1: The whole list of tumor aberrations by time tumor biopsy ctDNA 2002 (T1) 2012 (M1) 2015 (M2) 08/2015 09/2015 11/2015 02/2016 05/2016 07/2016 11/2016 02/2017 05/2017 07/2017 11/2017 PIK3CA Q546R PIK3CA Q546R PIK3CA Q546R PIK3CA Q546R 0.30% PIK3CA Q546R 1.30% PIK3CA Q546R 5.40% PIK3CA Q546R 12.50% PIK3CA Q546R 9.50% PIK3CA Q546R 32.58% PIK3CA Q546R 44.30% PIK3CA Q546R 15.40% PIK3CA Q546R 41.00% TP53 E180K TP53 E180K TP53 E180K TP53 E180K 0.30% TP53 E180K 1.00% TP53 E180K 4.80% PIK3CA M1043I 0.20% PIK3CA M1043I 0.70% PIK3CA E453K 0.69% PIK3CA E453K 3.20% PIK3CA E453K 0.55% PIK3CA M1043I 0.20% PIK3R2 S688* PIK3R2 S688* ATR E2579K VHL E173Q 0.40% PTEN Q245* 0.20% PTEN Q245* 0.30% PIK3CA E726K 1.50% PIK3CA E245Q 0.10% PIK3CA M1043I 0.36% PIK3CA M1043I 1.20% TP53 E180K 11.80% PIK3CA E453K 0.25% PLCG2 P737T PLCG2 P737T PIK3CA E726K VHL E173Q 1.10% RB1 R556* 3.10% TP53 E180K 11.00% PIK3CA E726K 0.20% PIK3CA E726K 0.23% PIK3CA E726K 0.44% TP53 I195F 1.20% PIK3CA E39Q 0.53% CDKN1B Q163* PIK3CA M1004I MET S1061F MET L229F 0.30% CCND1 E9K 0.10% PTEN Q245* 0.80% TP53 E180K 7.30% TP53 E180K 24.28% TP53 E180K 35.40% TP53 L137Q 1.30% TP53 E180K 38.40% ERBB2 R487W PTEN S229* TBX3 S435* MET W112C 1.20% NF1 D1556N 1.30% TP53 I195F 0.20% TP53 R175G 0.20% TP53 I195F 1.70% ESR1 E380Q 7.10% TP53 I195F 0.56% ALK E1407K RB1 Q217* SPEN Q743* NF1 R1176T 1.00% NF1 E76K 0.30% ESR1 E380Q 0.90% TP53 I195F 1.37% TP53 L137Q 2.10% ESR1 L391V 0.41% TP53 I254M 0.25% APC E2637K PIK3CA D1017N PTEN I253M VHL E173Q 1.20% RB1 R556* 7.20% NF1 R1176T 0.50% TP53 I254S 0.12% ESR1 E380Q 7.70% TP53 R175G 0.12% TP53 L137Q 0.89% ARID1B G2144E NF1 E924K APC F2762L 0.20% MET W112C 0.10% NF1 D1556N 0.30% TP53 L137Q 1.43% ESR1 L391V 0.51% PTEN D252N 0.37% ESR1 E380Q 28.30% PTCH1 D599H SRC I429M AR R832P 0.20% AR R832P 0.50% APC E633K 0.20% ESR1 E380Q 2.44% ESR1 M357I 0.20% PTEN K66N 1.30% ESR1 L391V 0.27% ERBB4 D335N EGFR M952I 1.30% EGFR M952I 2.40% AR R832P 0.60% NF1 Q2531* 8.16% PTEN D252N 1.01% NF1 R1176T 0.59% PTEN D252N 0.36% BARD1 R664K MET L229F 3.90% APC E633K 0.40% PTEN Q245* 0.30% NF1 R1176T 7.00% PTEN K128N 0.18% NF1 Q2531* 1.20% PTEN K66N 1.50% Promoter PIK3CG G725S KIT S464L 1.10% APC F2762L 0.30% TERT –122C>T 0.40% PTEN K66N 2.14% PTEN K66N 7.40% FGFR1 K656E 1.40% NF1 Q2531* 0.88% LRP1B E1467Q NOTCH1 S2341F 1.00% PTPN11 Q57E 2.10% EGFR M952I 1.10% EGFR M952I 9.16% PTEN L25F 0.36% EGFR M952I 1.34% NF1 S1150* 0.26% RB1 R556* MYC G175S 0.50% VHL E173Q 3.30% FGFR3 S249C 0.10% MET W112C 7.50% PTEN Q171H 0.30% MET W112C 0.61% NF1 R1176T 0.89% MLL K2855N NF1 E2558K 1.50% MET W112C 0.40% PTPN11 Q57E 0.38% NF1 Q2531* 1.80% FOXL2 E118Q 0.20% NF1 L552V 0.19% PIK3C2B D791H APC M526I 0.30% PTPN11 Q57E 0.30% MTOR K1465N 13.05% NF1 D1556N 0.32% BRCA2 E2846K 0.28% FGFR1 K656E 1.80% FAT1 D2913N PTEN P190L 0.20% RB1 R556* 3.40% MTOR R2505Q 0.57% NF1 R1176T 1.70% ERBB2 E1021K 0.26% EGFR M952I 1.19% MET L229F KIT S464L 2.00% VHL E173Q 0.70% NPM1 D172N 4.57% NF1 E924K 0.27% CDKN2A F5L 0.55% ERBB2 E405K 0.27% Promoter RAF1 L613V NOTCH1 S2341F 2.40% CDKN2A F5L 0.10% MET L229F 22.52% TERT –122C>T 0.45% MET L229F 6.30% MET W112C 0.70% HSP90AA1 L342V NOTCH1 L2067M 1.00% KIT S464L 1.10% ESR1 G442R 0.41% CCND1 S111C 0.25% NF1 E2558K 0.73% GNA11 E191K 0.18% NSD1 K717N BRCA1 S616F 0.40% MET L229F 5.70% NF1 E2558K 6.77% MET W112C 2.16% FOXL2 H293Y 0.29% BRCA2 E2846K 0.22% TET2 E330Q NTRK1 V341M 0.40% MYC G175S 0.70% FOXL2 H293Y 0.43% BRCA2 E2846K 0.57% NPM1 D172N 0.48% MET L229F 7.40% CSF1R V406I CDKN2A F5L 0.20% NF1 E2558K 1.10% EGFR M952I 3.01% MTOR K1465N 4.17% NF1 E2558K 0.89% PIK3C2B E807Q ARID1A L1029F 0.20% NOTCH1 S2341F 1.10% FGFR1 K656E 0.55% EGFR M636L 0.15% RAD50 Q966E MET L229F 9.40% NOTCH1 L2067M 0.50% ERBB2 E1021K 0.71% MTOR K1465N 4.47% MCL1 R80W NTRK1 V341M 0.30% FOXL2 E118Q 0.26% NPM1 D172N 0.38% RANBP2 K997N MTOR K1465N 3.40% PTPN11 Q57E 0.34% CDK6 L33F 0.91% FAT1 V912I MTOR K1465N 19.14% CDKN2A F5L 2.76% NOTCH2 L2048H CDK4 I51M 0.21% BRCA1 E1527Q 0.13% PRKDC S503C CDK6 L33F 0.19% VEGFA G39A 0.44% MTOR K1465N CDKN2A F5L 0.80% KIT D439H 0.36% FGFR2 I217M 0.20% MDM2 E273Q 0.16% FOXL2 H293Y 1.54% GNAQ T175M 0.46% MET L229F 28.40% ESR1 L469V 0.15% NF1 E2558K 2.04% NPM1 D172N 1.08% PDGFRB A789T 0.21% PTEN P190L 0.53% SMO R726* 0.33% Supplemental file 1: The whole list of tumor aberrations. Driver and predicted drivers by Cancer Genome Interpreter (CGI) are shaded in green. Sample T1 and M1 are sequenced and analyzed in Avera with results filtered by driver status. Sample M2 is tested with FoundationOne with a 315 gene panel. Liquid biopsies from 2015 to 2016 are sequenced with Guardent360 with a 70 gene panel. liquid biopsies from 2017 are sequenced with FoudationAct with a 67 gene panel. Supplemental File 2: Detailed information of driver and predicted driver mutations Genomic coordinates Gene (GRCh37) HGVS cDNA HGVS protein Variant type dbSNP/COSMIC GenotypeID NM_004304: ALK chr2:29416734 c.4219G>A p.E1407K missense COSM7126334 heterozygous NM_000038: APC chr5:112179254 c.7909G>A p.E2637K missense . heterozygous NM_000038: APC chr5:112179575 c.8286C>A p.F2762L missense . heterozygous NM_000038: APC chr5:112170801 c.1897G>A p.E633K missense . heterozygous NM_000044: AR chrX:66942714 c.2495G>C p.R832P missense . heterozygous NM_017519: ARID1B chr6:157528745 c.6431G>A p.G2144E missense . heterozygous NM_001184: ATR chr3:142171996 c.7735G>A p.E2579K missense . heterozygous NM_000465: BARD1 chr2:215595145 c.1991G>A p.R664K missense rs1574706698 heterozygous NM_000059: BRCA2 chr13:32945141 c.8536G>A p.E2846K missense . heterozygous NM_053056: CCND1 chr11:69456106 c.25G>A p.E9K missense COSM6975262 heterozygous NM_053056： CCND1 chr11:69457932 c.332C>G p.S111C missense . heterozygous NM_004064: CDKN1B chr12:12871770 c.487C>T p.Q163* nonsense . heterozygous NM_005228: EGFR chr7:55268016 c.2856G>A p.M952I missense . heterozygous NM_004448: ERBB2 chr17:37872138 c.1459C>T p.R487W missense rs375382055 heterozygous NM_004448: ERBB2 chr17:37883158 c.3061G>A p.E1021K missense . heterozygous NM_004448: ERBB2 chr17:37871603 c.1213G>A p.E405K missense . heterozygous NM_005235: ERBB4 chr2:212576896 c.1003G>A p.D335N missense . heterozygous NM_000125: ESR1 chr6:152332832 c.1138G>C p.E380Q missense COSM3829320 heterozygous NM_000125: ESR1 chr6:152332865 c.1171C>G p.L391V missense . heterozygous NM_000125: ESR1 chr6:152265618 c.1071G>C p.M357I missense . heterozygous NM_005245: FAT1 chr4:187539003 c.8737G>A p.D2913N missense rs752221845 heterozygous NM_023110: FGFR1 chr8:38272308 c.1966A>G p.K656E missense rs869320694 heterozygous NM_000142: FGFR3 chr4:1803568 c.746C>G p.S249C missense rs121913483 heterozygous NM_023067: FOXL2 chr3:138665213 c.352G>C p.E118Q missense . heterozygous NM_002067: GNA11 chr19:3115036 c.571G>A p.E191K missense rs1317391449 heterozygous NM_018557: LRP1B chr2:141625339 c.4399G>C p.E1467Q missense . heterozygous NM_000245: MET chr7:116415034 c.3128C>T p.S1061F missense . heterozygous NM_000245: MET chr7:116339474 c.336G>C p.W112C missense . heterozygous NM_005933: MLL chr11:118375181c,8565G>C p.K2855N missense . heterozygous NM_001042492: NF1 chr17:29556403 c.2770G>A p.E924K missense . heterozygous NM_001042492: NF1 chr17:29559852 c.3449C>G p.S1150* nonsense rs1555614972 heterozygous NM_001042492: NF1 chr17:29679408 c.7591C>T p.Q2531* nonsense rs1555536372 heterozygous NM_001042492: NF1 chr17:29560050 c.3527G>C p.R1176T missense . heterozygous NM_001042492: NF1 chr17:29588817 c.4666G>A p.D1556N missense . heterozygous NM_001042492: NF1 chr17:29486049 c.226G>A p.E76K missense . heterozygous NM_001042492: NF1 chr17:29548880 c.1654C>G p.L552V missense . heterozygous NM_002646： PIK3C2B chr1:204416682 c.2371G>C p.D791H missense . heterozygous NM_006218: PIK3CA chr3:178928079 c.1357G>A p.E453K missense rs1057519925 heterozygous NM_006218: PIK3CA chr3:178936095 c.1637A>G p.Q546R missense rs397517201 heterozygous NM_006218: PIK3CA chr3:178938934 c.2176G>A p.E726K missense rs867262025 heterozygous NM_006218: PIK3CA chr3:178952074 c.3129G>A p.M1043I missense rs121913283 heterozygous NM_006218: PIK3CA chr3:178951957 c.3012G>A p.M1004I missense COSM1420933 heterozygous NM_006218: PIK3CA chr3:178951994 c.3049G>A p.D1017N missense . heterozygous NM_006218: PIK3CA chr3:178919248 c.733G>C p.E245Q missense . heterozygous NM_006218: PIK3CA chr3:178916728 c.115G>C p.E39Q missense . heterozygous NM_002649: PIK3CG chr7:106513269 c.2173G>A p.G725S missense COSM5609846 heterozygous NM_005027: PIK3R2 chr19:18279980 c.2063C>A p.S688* nonsense . heterozygous NM_002661: PLCG2 chr16:81953243 c.2209C>A p.P737T missense . heterozygous NM_001083603: PTCH1 chr9:98232147 c.1795G>C p.D599H missense . heterozygous NM_000314: PTEN chr10:89717661 c.686C>A p.S229* nonsense COSM6955728 heterozygous NM_000314: PTEN chr10:89717734 c.759C>G p.I253M missense .
Load more

Recommended publications
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Deep Sequencing of the Human Retinae Reveals the Expression of Odorant Receptors
    fncel-11-00003 January 20, 2017 Time: 14:24 # 1 CORE Metadata, citation and similar papers at core.ac.uk Provided by Frontiers - Publisher Connector ORIGINAL RESEARCH published: 24 January 2017 doi: 10.3389/fncel.2017.00003 Deep Sequencing of the Human Retinae Reveals the Expression of Odorant Receptors Nikolina Jovancevic1*, Kirsten A. Wunderlich2, Claudia Haering1, Caroline Flegel1, Désirée Maßberg1, Markus Weinrich1, Lea Weber1, Lars Tebbe2, Anselm Kampik3, Günter Gisselmann1, Uwe Wolfrum2, Hanns Hatt1† and Lian Gelis1† 1 Department of Cell Physiology, Ruhr-University Bochum, Bochum, Germany, 2 Department of Cell and Matrix Biology, Johannes Gutenberg University of Mainz, Mainz, Germany, 3 Department of Ophthalmology, Ludwig Maximilian University of Munich, Munich, Germany Several studies have demonstrated that the expression of odorant receptors (ORs) occurs in various tissues. These findings have served as a basis for functional studies that demonstrate the potential of ORs as drug targets for a clinical application. To the best of our knowledge, this report describes the first evaluation of the mRNA expression of ORs and the localization of OR proteins in the human retina that set a Edited by: stage for subsequent functional analyses. RNA-Sequencing datasets of three individual Hansen Wang, University of Toronto, Canada neural retinae were generated using Next-generation sequencing and were compared Reviewed by: to previously published but reanalyzed datasets of the peripheral and the macular Ewald Grosse-Wilde, human retina and to reference tissues. The protein localization of several ORs was Max Planck Institute for Chemical Ecology (MPG), Germany investigated by immunohistochemistry. The transcriptome analyses detected an average Takaaki Sato, of 14 OR transcripts in the neural retina, of which OR6B3 is one of the most highly National Institute of Advanced expressed ORs.
    [Show full text]
  • A Framework to Identify Contributing Genes In
    A framework to identify contributing genes in patients with Phelan-McDermid syndrome Anne-Claude Tabet, Thomas Rolland, Marie Ducloy, Jonathan Levy, Julien Buratti, Alexandre Mathieu, Damien Haye, Laurence Perrin, Céline Dupont, Sandrine Passemard, et al. To cite this version: Anne-Claude Tabet, Thomas Rolland, Marie Ducloy, Jonathan Levy, Julien Buratti, et al.. A frame- work to identify contributing genes in patients with Phelan-McDermid syndrome. npj Genomic Medicine, Springer Nature, 2019, 4 (1), pp.16. 10.1038/s41525-019-0090-y. hal-02347889 HAL Id: hal-02347889 https://hal.archives-ouvertes.fr/hal-02347889 Submitted on 16 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. bioRxiv preprint doi: https://doi.org/10.1101/117978; this version posted March 18, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A framework to identify modifier genes in patients
    [Show full text]
  • OR52B6 (NM 001005162) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG224573 OR52B6 (NM_001005162) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR52B6 (NM_001005162) Human Tagged ORF Clone Tag: TurboGFP Symbol: OR52B6 Synonyms: OR11-47 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG224573 representing NM_001005162 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCACAGGTGAGGGCGCTGCATAAAATCATGGCCCTTTTTTCTGCTAACAGCATAGGTGCTATGAACA ACTCTGACACTCGCATAGCAGGCTGCTTCCTCACTGGCATCCCTGGGCTGGAGCAACTACATATCTGGCT GTCCATCCCCTTCTGCATCATGTACATCGCTGCCCTGGAAGGCAATGGCATCCTAATTTGTGTCATCCTC TCCCAGGCAATCCTGCATGAGCCCATGTACATATTCTTATCTATGCTGGCCAGTGCTGATGTCTTGCTCT CTACCACCACCATGCCTAAGGCCCTGGCCAATTTGTGGCTAGGTTATAGCCACATTTCCTTTGATGGCTG CCTCACTCAGATGTTCTTCATTCACTTCCTCTTCATTCACTCTGCTGTCCTGCTGGCCATGGCCTTTGAC CGCTATGTGGCCATCTGCTCCCCCCTGCGATATGTCACAATCCTCACAAGCAAGGTCATTGGGAAGATCG TCACTGCCACCCTGAGCCGCAGCTTCATCATTATGTTTCCATCCATCTTTCTCCTTGAGCACCTGCACTA TTGCCAGATCAACATCATTGCACACACATTTTGTGAGCACATGGGCATTGCCCATCTGTCCTGTTCTGAT ATCTCCATCAATGTCTGGTATGGGTTGGCAGCTGCTCTTCTCTCCACAGGCCTGGACATCATGCTTATTA CTGTTTCCTACATCCACATCCTCCAAGCAGTCTTCCGCCTCCTTTCTCAAGATGCCCGCTCCAAGGCCCT GAGTACCTGTGGATCCCATATCTGTGTCATCCTACTCTTCTATGTCCCTGCCCTTTTTTCTGTCTTTGCC TACAGGTTTGGTGGGAGAAGCATCCCATGCTATGTCCATATTCTCCTGGCCAGCCTCTACGTTGTCATTC
    [Show full text]
  • Apoptotic Cells Inflammasome Activity During the Uptake of Macrophage
    Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 is online at: average * The Journal of Immunology , 26 of which you can access for free at: 2012; 188:5682-5693; Prepublished online 20 from submission to initial decision 4 weeks from acceptance to publication April 2012; doi: 10.4049/jimmunol.1103760 http://www.jimmunol.org/content/188/11/5682 Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser and Andrea J. Tenner J Immunol cites 56 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/04/20/jimmunol.110376 0.DC1 This article http://www.jimmunol.org/content/188/11/5682.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 29, 2021. The Journal of Immunology Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E.
    [Show full text]
  • Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
    Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v
    [Show full text]
  • Single Cell Derived Clonal Analysis of Human Glioblastoma Links
    SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig.
    [Show full text]
  • WO 2019/068007 Al Figure 2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/068007 Al 04 April 2019 (04.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and C12N 15/10 (2006.01) C07K 16/28 (2006.01) (71) Applicants: GROSS, Gideon [EVIL]; IE-1-5 Address C12N 5/10 (2006.0 1) C12Q 1/6809 (20 18.0 1) M.P. Korazim, 1292200 Moshav Almagor (IL). GIBSON, C07K 14/705 (2006.01) A61P 35/00 (2006.01) Will [US/US]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., C07K 14/725 (2006.01) P.O. Box 4044, 7403635 Ness Ziona (TL). DAHARY, Dvir [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (21) International Application Number: Box 4044, 7403635 Ness Ziona (IL). BEIMAN, Merav PCT/US2018/053583 [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (22) International Filing Date: Box 4044, 7403635 Ness Ziona (E.). 28 September 2018 (28.09.2018) (74) Agent: MACDOUGALL, Christina, A. et al; Morgan, (25) Filing Language: English Lewis & Bockius LLP, One Market, Spear Tower, SanFran- cisco, CA 94105 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/564,454 28 September 2017 (28.09.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/649,429 28 March 2018 (28.03.2018) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicant: IMMP ACT-BIO LTD.
    [Show full text]
  • Predicting Human Olfactory Perception from Activities of Odorant Receptors
    iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski, Anandasankar Ray [email protected] odor perception HIGHLIGHTS Machine learning predicted activity of 34 human ORs for ~0.5 million chemicals chemical structure Activities of human ORs predicts OR activity could predict odor character using machine learning Few OR activities were needed to optimize r predictions of each odor e t c percept a AI r a odorant activates mul- h Behavior predictions in c Drosophila also need few r tiple ORs o olfactory receptor d o activities ts ic ed pr ity tiv ac OR Kowalewski & Ray, iScience 23, 101361 August 21, 2020 ª 2020 The Author(s). https://doi.org/10.1016/ j.isci.2020.101361 iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski1 and Anandasankar Ray1,2,3,* SUMMARY Odor perception in humans is initiated by activation of odorant receptors (ORs) in the nose. However, the ORs linked to specific olfactory percepts are unknown, unlike in vision or taste where receptors are linked to perception of different colors and tastes. The large family of ORs (~400) and multiple receptors activated by an odorant present serious challenges. Here, we first use machine learning to screen ~0.5 million compounds for new ligands and identify enriched structural motifs for ligands of 34 human ORs. We next demonstrate that the activity of ORs successfully predicts many of the 146 different perceptual qualities of chem- icals. Although chemical features have been used to model odor percepts, we show that biologically relevant OR activity is often superior.
    [Show full text]
  • Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
    Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/).
    [Show full text]
  • Genetic Characterization of Greek Population Isolates Reveals Strong Genetic Drift at Missense and Trait-Associated Variants
    ARTICLE Received 22 Apr 2014 | Accepted 22 Sep 2014 | Published 6 Nov 2014 DOI: 10.1038/ncomms6345 OPEN Genetic characterization of Greek population isolates reveals strong genetic drift at missense and trait-associated variants Kalliope Panoutsopoulou1,*, Konstantinos Hatzikotoulas1,*, Dionysia Kiara Xifara2,3, Vincenza Colonna4, Aliki-Eleni Farmaki5, Graham R.S. Ritchie1,6, Lorraine Southam1,2, Arthur Gilly1, Ioanna Tachmazidou1, Segun Fatumo1,7,8, Angela Matchan1, Nigel W. Rayner1,2,9, Ioanna Ntalla5,10, Massimo Mezzavilla1,11, Yuan Chen1, Chrysoula Kiagiadaki12, Eleni Zengini13,14, Vasiliki Mamakou13,15, Antonis Athanasiadis16, Margarita Giannakopoulou17, Vassiliki-Eirini Kariakli5, Rebecca N. Nsubuga18, Alex Karabarinde18, Manjinder Sandhu1,8, Gil McVean2, Chris Tyler-Smith1, Emmanouil Tsafantakis12, Maria Karaleftheri16, Yali Xue1, George Dedoussis5 & Eleftheria Zeggini1 Isolated populations are emerging as a powerful study design in the search for low-frequency and rare variant associations with complex phenotypes. Here we genotype 2,296 samples from two isolated Greek populations, the Pomak villages (HELIC-Pomak) in the North of Greece and the Mylopotamos villages (HELIC-MANOLIS) in Crete. We compare their genomic characteristics to the general Greek population and establish them as genetic isolates. In the MANOLIS cohort, we observe an enrichment of missense variants among the variants that have drifted up in frequency by more than fivefold. In the Pomak cohort, we find novel associations at variants on chr11p15.4 showing large allele frequency increases (from 0.2% in the general Greek population to 4.6% in the isolate) with haematological traits, for example, with mean corpuscular volume (rs7116019, P ¼ 2.3 Â 10 À 26). We replicate this association in a second set of Pomak samples (combined P ¼ 2.0 Â 10 À 36).
    [Show full text]