Supplemental Files 1-5.Pdf
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Deep Sequencing of the Human Retinae Reveals the Expression of Odorant Receptors
fncel-11-00003 January 20, 2017 Time: 14:24 # 1 CORE Metadata, citation and similar papers at core.ac.uk Provided by Frontiers - Publisher Connector ORIGINAL RESEARCH published: 24 January 2017 doi: 10.3389/fncel.2017.00003 Deep Sequencing of the Human Retinae Reveals the Expression of Odorant Receptors Nikolina Jovancevic1*, Kirsten A. Wunderlich2, Claudia Haering1, Caroline Flegel1, Désirée Maßberg1, Markus Weinrich1, Lea Weber1, Lars Tebbe2, Anselm Kampik3, Günter Gisselmann1, Uwe Wolfrum2, Hanns Hatt1† and Lian Gelis1† 1 Department of Cell Physiology, Ruhr-University Bochum, Bochum, Germany, 2 Department of Cell and Matrix Biology, Johannes Gutenberg University of Mainz, Mainz, Germany, 3 Department of Ophthalmology, Ludwig Maximilian University of Munich, Munich, Germany Several studies have demonstrated that the expression of odorant receptors (ORs) occurs in various tissues. These findings have served as a basis for functional studies that demonstrate the potential of ORs as drug targets for a clinical application. To the best of our knowledge, this report describes the first evaluation of the mRNA expression of ORs and the localization of OR proteins in the human retina that set a Edited by: stage for subsequent functional analyses. RNA-Sequencing datasets of three individual Hansen Wang, University of Toronto, Canada neural retinae were generated using Next-generation sequencing and were compared Reviewed by: to previously published but reanalyzed datasets of the peripheral and the macular Ewald Grosse-Wilde, human retina and to reference tissues. The protein localization of several ORs was Max Planck Institute for Chemical Ecology (MPG), Germany investigated by immunohistochemistry. The transcriptome analyses detected an average Takaaki Sato, of 14 OR transcripts in the neural retina, of which OR6B3 is one of the most highly National Institute of Advanced expressed ORs. -
A Framework to Identify Contributing Genes In
A framework to identify contributing genes in patients with Phelan-McDermid syndrome Anne-Claude Tabet, Thomas Rolland, Marie Ducloy, Jonathan Levy, Julien Buratti, Alexandre Mathieu, Damien Haye, Laurence Perrin, Céline Dupont, Sandrine Passemard, et al. To cite this version: Anne-Claude Tabet, Thomas Rolland, Marie Ducloy, Jonathan Levy, Julien Buratti, et al.. A frame- work to identify contributing genes in patients with Phelan-McDermid syndrome. npj Genomic Medicine, Springer Nature, 2019, 4 (1), pp.16. 10.1038/s41525-019-0090-y. hal-02347889 HAL Id: hal-02347889 https://hal.archives-ouvertes.fr/hal-02347889 Submitted on 16 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. bioRxiv preprint doi: https://doi.org/10.1101/117978; this version posted March 18, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A framework to identify modifier genes in patients -
OR52B6 (NM 001005162) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG224573 OR52B6 (NM_001005162) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR52B6 (NM_001005162) Human Tagged ORF Clone Tag: TurboGFP Symbol: OR52B6 Synonyms: OR11-47 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG224573 representing NM_001005162 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCACAGGTGAGGGCGCTGCATAAAATCATGGCCCTTTTTTCTGCTAACAGCATAGGTGCTATGAACA ACTCTGACACTCGCATAGCAGGCTGCTTCCTCACTGGCATCCCTGGGCTGGAGCAACTACATATCTGGCT GTCCATCCCCTTCTGCATCATGTACATCGCTGCCCTGGAAGGCAATGGCATCCTAATTTGTGTCATCCTC TCCCAGGCAATCCTGCATGAGCCCATGTACATATTCTTATCTATGCTGGCCAGTGCTGATGTCTTGCTCT CTACCACCACCATGCCTAAGGCCCTGGCCAATTTGTGGCTAGGTTATAGCCACATTTCCTTTGATGGCTG CCTCACTCAGATGTTCTTCATTCACTTCCTCTTCATTCACTCTGCTGTCCTGCTGGCCATGGCCTTTGAC CGCTATGTGGCCATCTGCTCCCCCCTGCGATATGTCACAATCCTCACAAGCAAGGTCATTGGGAAGATCG TCACTGCCACCCTGAGCCGCAGCTTCATCATTATGTTTCCATCCATCTTTCTCCTTGAGCACCTGCACTA TTGCCAGATCAACATCATTGCACACACATTTTGTGAGCACATGGGCATTGCCCATCTGTCCTGTTCTGAT ATCTCCATCAATGTCTGGTATGGGTTGGCAGCTGCTCTTCTCTCCACAGGCCTGGACATCATGCTTATTA CTGTTTCCTACATCCACATCCTCCAAGCAGTCTTCCGCCTCCTTTCTCAAGATGCCCGCTCCAAGGCCCT GAGTACCTGTGGATCCCATATCTGTGTCATCCTACTCTTCTATGTCCCTGCCCTTTTTTCTGTCTTTGCC TACAGGTTTGGTGGGAGAAGCATCCCATGCTATGTCCATATTCTCCTGGCCAGCCTCTACGTTGTCATTC -
Apoptotic Cells Inflammasome Activity During the Uptake of Macrophage
Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 is online at: average * The Journal of Immunology , 26 of which you can access for free at: 2012; 188:5682-5693; Prepublished online 20 from submission to initial decision 4 weeks from acceptance to publication April 2012; doi: 10.4049/jimmunol.1103760 http://www.jimmunol.org/content/188/11/5682 Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser and Andrea J. Tenner J Immunol cites 56 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/04/20/jimmunol.110376 0.DC1 This article http://www.jimmunol.org/content/188/11/5682.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 29, 2021. The Journal of Immunology Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. -
Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v -
Single Cell Derived Clonal Analysis of Human Glioblastoma Links
SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig. -
WO 2019/068007 Al Figure 2
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/068007 Al 04 April 2019 (04.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and C12N 15/10 (2006.01) C07K 16/28 (2006.01) (71) Applicants: GROSS, Gideon [EVIL]; IE-1-5 Address C12N 5/10 (2006.0 1) C12Q 1/6809 (20 18.0 1) M.P. Korazim, 1292200 Moshav Almagor (IL). GIBSON, C07K 14/705 (2006.01) A61P 35/00 (2006.01) Will [US/US]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., C07K 14/725 (2006.01) P.O. Box 4044, 7403635 Ness Ziona (TL). DAHARY, Dvir [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (21) International Application Number: Box 4044, 7403635 Ness Ziona (IL). BEIMAN, Merav PCT/US2018/053583 [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (22) International Filing Date: Box 4044, 7403635 Ness Ziona (E.). 28 September 2018 (28.09.2018) (74) Agent: MACDOUGALL, Christina, A. et al; Morgan, (25) Filing Language: English Lewis & Bockius LLP, One Market, Spear Tower, SanFran- cisco, CA 94105 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/564,454 28 September 2017 (28.09.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/649,429 28 March 2018 (28.03.2018) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicant: IMMP ACT-BIO LTD. -
Predicting Human Olfactory Perception from Activities of Odorant Receptors
iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski, Anandasankar Ray [email protected] odor perception HIGHLIGHTS Machine learning predicted activity of 34 human ORs for ~0.5 million chemicals chemical structure Activities of human ORs predicts OR activity could predict odor character using machine learning Few OR activities were needed to optimize r predictions of each odor e t c percept a AI r a odorant activates mul- h Behavior predictions in c Drosophila also need few r tiple ORs o olfactory receptor d o activities ts ic ed pr ity tiv ac OR Kowalewski & Ray, iScience 23, 101361 August 21, 2020 ª 2020 The Author(s). https://doi.org/10.1016/ j.isci.2020.101361 iScience ll OPEN ACCESS Article Predicting Human Olfactory Perception from Activities of Odorant Receptors Joel Kowalewski1 and Anandasankar Ray1,2,3,* SUMMARY Odor perception in humans is initiated by activation of odorant receptors (ORs) in the nose. However, the ORs linked to specific olfactory percepts are unknown, unlike in vision or taste where receptors are linked to perception of different colors and tastes. The large family of ORs (~400) and multiple receptors activated by an odorant present serious challenges. Here, we first use machine learning to screen ~0.5 million compounds for new ligands and identify enriched structural motifs for ligands of 34 human ORs. We next demonstrate that the activity of ORs successfully predicts many of the 146 different perceptual qualities of chem- icals. Although chemical features have been used to model odor percepts, we show that biologically relevant OR activity is often superior. -
Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/). -
Genetic Characterization of Greek Population Isolates Reveals Strong Genetic Drift at Missense and Trait-Associated Variants
ARTICLE Received 22 Apr 2014 | Accepted 22 Sep 2014 | Published 6 Nov 2014 DOI: 10.1038/ncomms6345 OPEN Genetic characterization of Greek population isolates reveals strong genetic drift at missense and trait-associated variants Kalliope Panoutsopoulou1,*, Konstantinos Hatzikotoulas1,*, Dionysia Kiara Xifara2,3, Vincenza Colonna4, Aliki-Eleni Farmaki5, Graham R.S. Ritchie1,6, Lorraine Southam1,2, Arthur Gilly1, Ioanna Tachmazidou1, Segun Fatumo1,7,8, Angela Matchan1, Nigel W. Rayner1,2,9, Ioanna Ntalla5,10, Massimo Mezzavilla1,11, Yuan Chen1, Chrysoula Kiagiadaki12, Eleni Zengini13,14, Vasiliki Mamakou13,15, Antonis Athanasiadis16, Margarita Giannakopoulou17, Vassiliki-Eirini Kariakli5, Rebecca N. Nsubuga18, Alex Karabarinde18, Manjinder Sandhu1,8, Gil McVean2, Chris Tyler-Smith1, Emmanouil Tsafantakis12, Maria Karaleftheri16, Yali Xue1, George Dedoussis5 & Eleftheria Zeggini1 Isolated populations are emerging as a powerful study design in the search for low-frequency and rare variant associations with complex phenotypes. Here we genotype 2,296 samples from two isolated Greek populations, the Pomak villages (HELIC-Pomak) in the North of Greece and the Mylopotamos villages (HELIC-MANOLIS) in Crete. We compare their genomic characteristics to the general Greek population and establish them as genetic isolates. In the MANOLIS cohort, we observe an enrichment of missense variants among the variants that have drifted up in frequency by more than fivefold. In the Pomak cohort, we find novel associations at variants on chr11p15.4 showing large allele frequency increases (from 0.2% in the general Greek population to 4.6% in the isolate) with haematological traits, for example, with mean corpuscular volume (rs7116019, P ¼ 2.3 Â 10 À 26). We replicate this association in a second set of Pomak samples (combined P ¼ 2.0 Â 10 À 36).