Functional and Structural Characterization of Olfactory Receptors in Human Heart and Eye

DISSERTATION

to obtain the degree Doctor Rerum Naturalium (Dr.rer.nat.) at the Faculty of Biology and Biotechnology International Graduate School Biosciences Ruhr-University Bochum

Functional and structural characterization of olfactory receptors in human heart and eye

Department of Cellphysiology

submitted by Nikolina Jovancevic

from Zadar, Croatia

Bochum February 2016

First Referee: Prof. Dr. Dr. Dr. Hanns Hatt Second Referee: Prof. Dr. Stefan Wiese

DISSERTATION

zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie an der Internationalen Graduiertenschule Biowissenschaften der Ruhr-Universität Bochum

Funktionale und strukturelle Charakterisierung olfaktorischer Rezeptoren im humanen Herzen und Auge

Lehrstuhl für Zellphysiologie

vorgelegt von Nikolina Jovancevic

aus Zadar, Kroatien

Bochum Februar 2016

Referent: Prof. Dr. Dr. Dr. Hanns Hatt Korreferent: Prof. Dr. Stefan Wiese

To my family

TABLE OF CONTENTS

TABEL OF CONTENT

1 INTRODUCTION 1

1.1 G protein-coupled receptors 1 1.1.1 General 1 1.1.2 Structure and classification 2 1.1.3 Olfactory Receptors 4

1.2 Function of olfactory receptors 9 1.2.1 The olfactory system 9 1.2.2 Ectopic expression of olfactory receptors 11

1.3 Excursus: Anatomy and physiology of the heart 13 1.3.1 Anatomy of the heart and blood circuit 14 1.3.2 The cardiac conduction system 15 1.3.3 Excitation-contraction coupling 16 1.3.4 Cardiac GPCRs: Modulation of cardiac contraction 17

1.4 Excursus: Anatomy and physiology of the eye 18 1.4.1 Anatomy of the retina 19 1.4.2 Physiology of the retina: visual processing 20 1.4.3 The retinal pigment epithelium: Structure and function 21

1.5 Objectives 23

2 MATERIAL 38

2.1 Laboratory apparatus 38

2.2 Consumables 39

2.3 Chemicals 39

2.4 Solution and media 41

2.5 Odorants 43

2.6 Inhibitors 44

2.7 Transfection reagent 44

2.8 Kits and PCR mixes 44

2.9 Enzyme 45

2.10 Antibodies and blocking peptide 45 2.10.1 Primary antibodies and blocking peptide 45 2.10.2 Secondary antibodies 45 1

TABLE OF CONTENTS

2.11 DNA and protein standards 46

2.12 Primer sequences 46

2.13 siRNA 48

2.14 Plasmids 48

2.15 Cell culture 48 2.15.1 Cell culture supplies 48 2.15.2 Media and solution 49 2.15.3 Stem cell-derived cardiomyocytes 49 2.15.4 RPE cells 50 2.15.5 Hana3A cells 50

2.16 Human tissues 50 2.16.1 Heart tissue 50 2.16.2 Retina tissue 50

2.17 Competent bacterial strain 51

2.18 Databases 51

2.19 Software 51

3 METHODS 52

3.1 Cell culture 52 3.1.1 Culture and differentiation of human embryonic (hESC) and induced pluripotent stem cells (hiPSC) towards cardiomyocytes 52 3.1.2 Culture of RPE cells and Hana3A cells 53

3.2 Cell-based assays 53 3.2.1 Luciferase reporter assay 53 3.2.2 Cell proliferation assay 54 3.2.3 Cell migration assay: Scratch wound-healing assay 54 3.2.4 Matrigel inversion assay 54

3.3 Molecular biology 55 3.3.1 RNA isolation 55 3.3.2 Synthesis of complementary DNA 55 3.3.3 Reverse transcription polymerase chain reaction (RT-PCR) 55 3.3.4 Agarose gel electrophoresis 56 3.3.5 Purification of DNA fragments 56 3.3.6 DNA sequencing 56 3.3.7 Cloning of OR51E2-mutants 57 3.3.8 mRNA-Sequencing (RNAseq) 59 2

TABLE OF CONTENTS

3.4 siRNA transfection 61

3.5 Protein biochemistry 61 3.5.1 Protein isolation from cultured cells and human tissues 61 3.5.2 Sodium dodecylsulfate polyacrylamide gel electrophoresis 62 3.5.3 Western Blot 62 3.5.4 Detecting of protein phosphorylation 63

3.6 Immunofluorescence stainings 64 3.6.1 Immunohistochemistry of human retina 64 3.6.2 Immunohistochemistry of human heart tissue 64 3.6.3 Immunocytochemistry 65

3.7 Ca2+ imaging 65

3.8 Contractile force measurements of slice preparations of adult human ventricle 66

3.9 Determination of the fatty acid pattern in human serum epicardial adipose biopsies 67

4 RESULTS 68

4.1 Identification and functional characterization of olfactory receptors in the human heart 68 4.1.1 Olfactory receptor OR51E1 is expressed in the human heart and in stem cell-derived cardiomyocytes 68 4.1.2 Ligand screening on OR51E1 70 4.1.3 OR51E1-activation induces a negative chronotropic effect in human stem cell-derived cardiomyocytes 72

4.1.4 OR51E1 signaling involves Gβγ 76 4.1.5 OR51E1 agonists reduce contraction force of explanted heart preparations 78 4.1.6 OR51E1-agonists are present in human blood at receptor activating concentrations 80

4.2 Identification and functional characterization of olfactory receptors in the human eye 81 4.2.1 Identification of olfactory receptors in the neural retina 81 4.2.2 Identification and functional characterization olfactory receptors in the human retinal pigment epithelial cells 91

4.3 Structural characterization of OR51E2 100

5 DISCUSSION 105

5.1 Identification and functional characterization of olfactory receptors in the human heart 105 5.1.1 Expression of OR51E1 in the human heart 105 5.1.2 Activation of OR51E1 in cardiomyocytes 106 5.1.3 Possible role of OR51E1 in the heart 107

5.2 Identification and functional characterization of olfactory receptors in the human eye 110

TABLE OF CONTENTS

5.2.1 Detection of olfactory receptors in the neural retina 110 5.2.2 Identification and functional characterization of olfactory receptors in human retinal pigment epithelial cells 114

5.3 Structural characterization of OR51E2 119

6 SUMMARY 124

7 ZUSAMMENFASSUNG 127

8 REFERENCES 130

9 APPENDIX 157

9.1 List of abbreviations 157

9.2 List of figures 159

9.3 List of tables 160

9.4 Curriculum vitae 161

9.5 Publication list 162

9.6 Danksagung 163

9.7 Erklärung 165

INTRODUCTION

1 INTRODUCTION

For humans is communication essential, it appears in various ways and is necessary for an intact society. Communication not only occurs between individuals but also within our bodies and is crucial for our survival. Cells are able to communicate via molecular antennas, so called receptors, on their cell surface. These receptors pick up signals from the extracellular environment, transfer them into the cells, and trigger signal-specific cellular responses. The superfamily of G protein-coupled receptors (GPCRs) represents with approximately 800 genes the largest and most diverse group of human membrane receptors (Pierce et al., 2002). Therefore, the following chapter focuses on this receptor family.

1.1 G protein-coupled receptors

1.1.1 General

The superfamily of G protein-coupled receptors (GPCRs) is involved in the regulation of various physiological processes, such as the neuronal transduction, cellular metabolism, differentiation, proliferation, secretion and immunological reactions (Wu et al., 2012). They are activated by a broad spectrum of extracellular signals including neurotransmitters, hormones, cytokines, light energy, odorants, taste ligands and extracellular Ca2+ ions (Pierce et al., 2002). At the cellular level, these external signals are transmitted across the plasma membrane by GPCRs, which convert these extracellular cues into one or more intracellular responses. As their name implies, GPCRs interact intercellularly with heterotrimeric G proteins. Ligand- binding to a GPCR causes a conformational change, which in turn triggers the activation of the coupled G protein. The activated heterotrimeric G protein dissociates into the α-subunit and the -complex. The α-subunit inhibits or stimulates specific effector proteins, such as adenylyl cyclase, phosphodiesterase, phospholipase, phosphoinositol-3-kinase or ion channels (Strader et al., 1995). This results in a change of the concentration of second messengers within the cell, which regulate the activity of various proteins, thereby affecting e.g. the gene expression or secretion. Due to the participation of GPCRs in a variety of physiological

INTRODUCTION

processes, it is not surprising that a dysfunction can lead to diseases such as retinitis pigmentosa, hypo- and hyperthyroidism, nephrogenic diabetes insipidus and even cancer (Schöneberg et al., 2004). Moreover, their key role in cellular communication makes them a favorable target for pharmacological research. Currently, more than 60% of the commercially available drugs achieve their effect through agonistic or antagonistic interaction with GPCRs, which include various psychotropic drugs, beta-blockers or antihistamines (Hopkins & Groom, 2002).

1.1.2 Structure and classification

In the 1980s, a structure consisting of seven α-helical transmembrane (TM) domains was postulated for the β2 adrenoreceptor analogous to that of rhodopsin (Dixon et al., 1986). The hypothesis of the existence of a large receptor gene family developed and was rapidly confirmed by cloning other receptors (Dohlman et al., 1991). At the beginning, the crystal structure of bacteriorhodopsin served as a model for predicting the three-dimensional structure of the receptor family (Henderson & Unwin, 1975). However, in the year 2000 the first detailed structural analysis of GPCRs was performed with the determination of the X-ray structure of bovine rhodopsin (Palczewski et al., 2000). The results confirmed a heptahelical structure of the membrane protein with an extracellular amino-terminus (N-terminus) and an intracellular carboxyl terminus (C-terminus). The seven transmembrane domains are linked by alternating extra- and intracellular loops. To date, the structures of 24 GPCRs were determined by X-ray crystal structure analyses (Cherezov et al., 2007; Rasmussen et al., 2007; Jaakola et al., 2008; Warne et al., 2008; Chien et al., 2010; Wu et al., 2010; Shimamura et al., 2011; Granier et al., 2012; Haga et al., 2012; Hanson et al., 2012; Kruse et al., 2012; Liu et al., 2012; Manglik et al., 2012; Thompson et al., 2012; White et al., 2012; Wu et al., 2012a; Zhang et al., 2012a; Hollenstein et al., 2013; Siu et al., 2013; Tan et al., 2013, Wacker et al., 2013a; Wang et al., 2013a; Wang et al., 2013b; Wu et al., 2014; Zhang et al., 2014). GPCRs are classified according to sequence homology, specific structural characteristics and functional features. Based on their sequence homology, GPCRs are classified in the classes A-F: rhodopsin-like receptors (class A); secretin receptors (class B); metabotropic glutamate/pheromone receptors (class C); fungal mating pheromone receptors (class D); cyclic AMP receptors (class E) and frizzled/smoothened receptors (class F). More recently, an alternative classification system, the GRAFS classification of Fredriksson et al., was 2

INTRODUCTION

developed from the data of the Human Genome Project (Fredriksson et al., 2003). By this system, GPCRs can be phylogenetically grouped into five major families (Glutamate, Rhodopsin, Adhesion, Frizzled/Taste2, Secretin). The rhodopsin-like family, which comprises 90% of all receptors, is subdivided into the classes α-δ and has a number of common characteristics. The highly conserved motifs include the motif NSxxNPxxY within TM VII and the E/DRY motif that is located between TM III and the intracellular loop 2 (Rovati et al., 2007; Oldham & Hamm, 2008). Some receptors do not have these conserved motifs, but could be allocated to the rhodopsin-like family due to other conserved regions. The structure of rhodopsin-like receptors also differs from the adhesion-, frizzled/taste2-, secretin-receptors and the most members of the glutamate family by a shorter N-terminus. In contrast to the other families, in which the N-terminus plays a key role in the interaction with ligands, it is postulated for the rhodopsin-like family that the ligand binding occurs within a cavity between the TM regions (Kristiansen, 2004).

Figure 1. Phylogenetic tree of the human GPCR superfamily. The pylogenetic tree was generated using sequence similarity within the seven-TM region. Highlighted in red are the family members with determined structures: ADORA2A, adenosine A2A receptor (Protein Data Bank (PDB) code: 3EML); ADRB1, β1-adrenergic receptor (PDB code: 2VT4); ADRB2, β2-adrenergic receptor (PDB code: 2RH1); CHRM2, muscarinic acetylcholine receptor M2 (PDB code: 3UON); CHRM3, muscarinic acetylcholine receptor M3 (PDB code: 4DAJ); CXCR4, CXC chemokine receptor 4 (PDB code: 3ODU); DRD3, dopamine D3 receptor (3PBL); EDG1, sphingosine-1-phosphate receptor 1 (PDB code: 3V2Y); HRH1, histamine H1 receptor (PDB code: 3RZE); NTSR1, neurotensin receptor 1 (PDB code: 4GRV); OPRD1, δ-type opioid receptor (PDB code: 4EJ4); OPRK1, κ-type opioid receptor (PDB code: 4DJH); OPRL1, opiate receptor-like 1 (nociceptin/orphanin FQ peptide

INTRODUCTION

opioid receptor) (PDB code: 4EA3); OPRM1, μ-type opioid receptor (PDB code: 4DKL); RHO, rhodopsin (PDB code: 1F88); F2R, proteinase-activated receptor 1 (PDB code: 3VW7); CCR5, chemokine receptor (4MBS); HTR1B, serotonine receptor 1B(PDB code: 4IAR); HTR2B, serotonine receptor 2B (PDB code: 4IB4); P2Y12, purine receptor (PDB code: 2PXZ);. GCGR, Glucagon receptor (PDB code: 4L6R); SMOH, smoothened receptor (PDB code: 4JKV); CRHR1, corticotropin-releasing hormone receptor 1 (PDB code: 4K5Y); GRM1, metabotropic glutamate receptor 1 (PDB code: 4OR2). Figure modified from Ref (Stevens et al., 2013).

1.1.3 Olfactory Receptors

Olfactory receptors (ORs) constitute with approximately 400 members the largest group among the GPCRs in human (Mombaerts, 2001; Fredriksson et al., 2003) By sequence similarity and the presence of conserved motifs they are assigned in class A, rhodopsin-like receptors (Fredriksson et al., 2003). However, recent phylogenetic analyses suggest a separate evolution of ORs and rhodopsin (Wolf & Grünewald, 2015). However, a final statement cannot be made without X-ray crystal structure analysis of ORs. ORs genes have been firstly identified in the rat (Buck & Axel, 1991). With more than 1000 potentially functional genes ORs are also the largest gene family in vertebrates (Firestein, 2001; Mombaerts, 2001). The OR repertoire in the mammalian genome comprises ~800-1500 genes that are organized in clusters within ~100 various regions and are distributed over all chromosomes (except chromosome 20 and Y) (Gaillard et al., 2004). In contrast, only 40-140 functional OR genes are found in fish (Alioto & Ngai, 2005; Niimura & Nei, 2005). The OR gene expansion is likely occurred during the transition from aquatic to terrestrial habitats. In addition, the number of OR genes varies widely within the mammals: platypus (~700), human (~960), mouse, rat and opossum (~1500) and dog (~1100) (Keller & Vosshall, 2008). This variability increases when considering the ratio of functional genes and pseudogenes. Due to deletions/insertions, frame shifts or point mutations, OR genes can loose their protein coding ability. Aquatic mammals show with 70-80% the highest pseudogenization of OR genes, in which the auditory system is more dominant compared to the olfactory system (Kishida et al., 2007). This finding may reflect the relative paucity of odorants encountered in such environments. With 50-60%, humans have the most pronounced number of OR pseudogenes among land mammals (~350 potential functional genes) (Keller & Vosshall, 2008). In comparison, OR pseudogene sequences account for up to 41% of the chimpanzee, 30% of the old world monkeys, 15-20% of the new world monkeys and 20% of the cattle, dogs, rats and mice genomes (Kishida et al., 2007; Rouquier & Giorgi, 2007). The increased pseudogenization from rodents over primates up to human points out that olfactory perception

INTRODUCTION

lost its importance in the course of primate evolution with the acquisition of full trichromatic vision (Gilad et al., 2004). For a long period, pseudogenes were assumed as non-functional junk DNA. However, more recent studies demonstrated their high expression and cross- species conservation (Balakirev & Ayala, 2003; Karreth et al., 2015). Moreover, it could be observed that some ORs are adapting to the requirements of human-specific odor perception (Gilad et al., 2005; Go & Niimura, 2008). This can be assumed from a positive selection of human-specific subfamilies, whose ligands were unknown but of special interest for the study species-specific features (Keller & Vosshall, 2008). Comparative studies have also shown that in humans and other primates the detection thresholds of particular odorants are comparable to that of rodents (Laska et al., 2000). In addition, a study in 2014 demonstrated that humans are able to distinguish more than one trillion different odorants by a complex, combinatorial activation of different ORs (Bushdid et al., 2014). However, a recent study suggests a lower number of olfactory stimuli that humans can discriminate (Gerkin & Castro, 2015). Unlike most mammals, humans do not depend on olfactory cues for survival and are therefore considered as microsmatic organisms (Menashe & Lancet, 2006). Indeed, it has been assumed for decades that humans are highly variable in their olfactory sensitivities. This is evident in significant threshold deficiencies towards particular odorants, termed specific anosmia or ‘smell blindness’ (Amoore, 1967; Amoore et al., 1968; Gross-Isseroff et al., 1992). These inter-individual differences are caused, inter alia, by genetic variability such as copy number variation and single-nucleotide polymorphism in OR genes (Menashe & Lancet, 2006; Young et al., 2008; Jaeger et al., 2013). OR genes are characterized by a coding region of ~1 kb and usually an intron-less open reading frame, which is preceded by a variable number of upstream exons and terminated by a polyadenylation site 0.15–1.5 kb downstream from the stop codon (Buck & Axel, 1991; Nef et al., 1992; Asai et al., 1996; Glusman et al., 1996). OR genes can be divided into two phylogenetic classes by their amino acid identity of >40%: while the genomes of fishes contain only the more ancient class I (fish-like) OR genes (Mombaerts, 2004), mammals contain both class I and class II (also known as mammalian-like) OR genes. It was previously suggested that class I ORs are activated by water-soluble compounds, whereas class II ORs are activated by volatile odorants (Gaillard et al., 2004). Hence, class I ORs in terrestrial vertebrates were first considered as non-functional evolutionary relics. However, volatile ligands for ORs class I could be identified for both mice and human (Malnic et al., 1999; Neuhaus et al., 2009; Saito et al., 2009).

INTRODUCTION

OR proteins are composed of 300-350 amino acids and are characterized by structural features common to all GPCRs such as seven hydrophobic membrane-spanning helices (19–26 amino acids each), a potential disulfide bond between the highly conserved cysteines in extracellular loops 1 and 2, a conserved NXS/T consensus for glycosylation in the N-terminal region, several potential phosphorylation sites in intracellular regions and numerous conserved short sequences. The DRY motif, a hallmark of GPCRs at the end of the transmembrane domain III, is supposed to be involved in G protein activation (Gaillard et al., 2004). Nevertheless, there are certain OR-specific characteristics such as the possession of two conserved cysteines in the second extracellular loop, another short conserved amino acid sequences in the first and second intracellular loop and in the transmembrane domains III, V, VI and VII. In addition, the extended intracellular loop 2 is a characteristic feature of ORs. The proteins also contain 17 hypervariable regions, which are primarily located in the transmembrane domains III-V that is likely contributed to selective binding of different odorants (Pilpel & Lancet, 1999; Gaillard et al., 2004; Man et al., 2004; Gelis et al., 2012). These variable regions of ORs lead to selective detection of different odorants, but a particular odorant can be detected by different ORs (Malnic et al., 1999; Anselmi et al., 2011; Gelis et al., 2012). The resulting OR activation pattern encodes for the discrimination of different odorant classes. The functional group and the molecular length of the carboxylic acid chain play a crucial role for odor detection. In addition, the ligand affinity of ORs can be strongly dependent on the ligand concentration (Krautwurst et al., 1998; Malnic et al., 1999; Wetzel et al., 1999; Araneda et al., 2000). So far, there are only a few studies that proof an interaction between specific odorants with human ORs, because the identification of the receptor ligands (a process often referred to “de-orphanization”) is surprisingly difficult. A major impediment has been the difficulty in obtaining cell surface expression of cloned receptors in heterologous expression systems (Touhara, 2007). In 1999, the ligand spectrum of a human OR (OR17-40) was characterized for the first time by heterologous expression studies (Hatt et al., 1999; Wetzel et al., 1999). To date, the ligands of further human ORs were identified OR17-4 (Spehr et al., 2003), OR1A1 and OR1A2 (Schmiedeberg et al., 2007), OR51E1 (Fujita et al., 2007; Saito et al., 2009), OR51E2 (Neuhaus et al., 2009); OR2AG1 (Gelis et al., 2012) as well as OR2AT4 (Busse et al., 2014). In the last years, the number of de-orphaned ORs has been expanded due to more effective and generally applicable solutions for de-orphaning as described by Saito and colleagues (2009) (Saito et al., 2009). Thereby, a study conducted by Mainland et al. (2014) achieved to double the total number of de-orphaned human ORs, in total of approximately 40 at this point in time (Mainland et al., 2014a). The classical approach to 6

INTRODUCTION

enhance cell surface expression of ORs utilizes receptor chimeras, in which a N-terminal peptide from rhodopsin is fused to the OR N-terminus (Krautwurst et al., 1998). Besides, Matsunami and colleagues identified olfactory-specific chaperones to facilitate functional OR expression. In addition, they have established a new technology to monitor OR activation, based on the detection of cAMP responsive element (CRE) luciferase system (Saito et al., 2009; Li & Matsunami, 2011; Adipietro et al., 2012; Mainland et al., 2014a).

A B

Figure 2. Structure of ORs. (A) The ‚snake‘ plot illustrates the amino acid sequence of a particular mice odorant receptor (Olfr151). Sequence comparison across OR family disclosed highly conserved residues (shades of blue) and variable regions (shades of red). The TMs (boxed) are linked by intracellular and extracellular loops. (B) Schematic view of the predicted three-dimensional OR structure based on a rhodopsin template. The ligand binding site may be partially formed by the highly variable regions. Figure modified from Ref. (Firestein, 2001).

1.1.3.1 Modeling of olfactory receptors

Interaction between an odorant and an OR is the initial step in olfactory perception. Knowledge on the three-dimensional structure of ORs is crucial for the understanding of odorant binding and receptor activation mechanisms. It also enables the computational prediction of agonists and antagonists. Due to difficulties in the production of large quantities of recombinant functional OR proteins that are necessary for crystallization and the formation of the well-ordered crystals required for a high-resolution structure, an X-Ray structural

INTRODUCTION

model of an OR does not yet exist. In order to get an idea of the OR structure and the activation mechanisms, the establishment of computational modeling approaches is necessary. However, this approach for predicting the OR protein structure remains especially difficult due to limited availability of related GPCR X-Ray structures. Homology modeling predicts the three-dimensional structure of proteins from the amino acid sequences based on sequence comparisons with experimentally determined template structures, 24 of which currently exist in the GPCR family. The predicted structure is required for investigation of the ligand binding pocket and for the discrimination of activating and non-activating ligands by ligand docking to the model. The first created computational model of an OR, rat OR5, was based on a bacteriorhodopsin template and demonstrated the specific ligand-binding residues located at helices III through VII (Singer & Shepherd, 1994). Due to the increasing resolution of rhodopsin X-ray structural models that became available as templates over time, the accuracy of homology modeling of ORs could be improved. Electron density microscopic structure of rhodopsin with a resolution of 7.5 Ǻ was used for the prediction of ligand binding residues in the rat OR-I7 (octanal) and in six mouse ORs, which enabled the identification of novel ligands (Singer, 2000; Floriano et al., 2004). The predicted structure of OR-I7 was confirmed based on the inactive bovine rhodopsin X-ray structural model with a 2.8 Ǻ resolution (Hall et al., 2004). The higher resolution rhodopsin structures served as template for modeling of several ORs including human candidates. The resolution of further GPCRs structures in their active and inactive forms such as β-adrenergic receptors or the dopamine receptor offered alternative templates for OR homology modeling. Models of OR1G1 were obtained with all in 2012 available structure templates and MOR136-1 with six templates (Launay et al., 2012b; Ho et al., 2015). After 2005, the results of OR modeling and ligand docking in in silico simulations were systematically validated by the combination of site-directed mutagenesis and functional analysis of receptor mutants with Ca2+ imaging or in vitro reporter gene assays (Katada et al., 2005; Schmiedeberg et al., 2007; Gelis et al., 2012; Launay et al., 2012a). This allows not only the validation of the predicted ligand binding residues but also the analysis of the molecular interaction between ligand and the corresponding amino acid residue. Beside the static structural homology modeling and ligand docking approach, Gelis et al. (2012) established the molecular dynamics (MD) simulation technique in order to evaluate the dynamics of OR/odorant interactions (Gelis et al., 2012). The importance to consider the OR/odorant dynamics is supported by the fact that most odorants are highly flexible compounds. Therefore, the analysis of the dynamic of an odorant/receptor interaction pattern over time may provide additional insights into the molecular mechanisms of ligand binding 8

INTRODUCTION

and receptor activation as compared to a static ligand docking approach. However, most published human OR models were obtained by static modeling. The model of OR1G1 led to the assumption that antagonists and agonists dock to different parts of the binding pocket (Launay et al., 2012b). The modeling of OR1A1 and OR1A2 revealed the orientation of odorants within a homology modeling-derived binding pocket and potential amino acid residues that are necessary for the odor recognition (Schmiedeberg et al., 2007). Up to date, homology models of human ORs were still created for OR1D2 and OR17-210, a pseudogene with a disputable untypical hexahelical structure (Doszczak et al., 2007; Lai et al., 2008). The MD simulation technique allowed for studying the role of specific residues in the binding pocket of OR2AG1 in interaction with the ligand and enabled the prediction of novel ligands beside the known activator amylbutyrate. Moreover, the results on OR2AG1 could be used to predict ligands for the paralogues receptor OR2AG2 and the orthologous mouse receptor mOR283-2 (Gelis et al., 2012). Dynamic homology modeling thus offers the possibility to de- orphanize ORs in silico and constitutes an innovative approach for OR-based ligand design.

1.2 Function of olfactory receptors

1.2.1 The olfactory system

In mammals, the olfactory system is responsible for the perception and discrimination of odorants from the environment. Odorants are generally volatile, highly flexible, often hydrophobic and organic molecules with a low molecular weight (<400 Da). As already described, humans are considered as microsmatic organisms. Compared to the other senses such as sight, the sense of smell seems to play a minor role in humans. In comparison to other mammalian the survival of the human being does not necessarily depend on the sense of olfaction. Nevertheless, the human olfactory sense is important for finding and controlling food, the identification of dangers or participation in the social communication (Menashe & Lancet, 2006). In mammalian, the odor perception takes place in the nose. Odorants usually reach in a flow of inhaled air the olfactory mucosa [olfactory epithelium (OE)] in the nose, which is located on the upper part of the nasal cavity. The OE consists of three different cell types: the olfactory sensory neurons (OSNs), the basal cells and the supporting cells. OSNs are primary

INTRODUCTION

bipolar neurons and project a single apical dendrite containing fine cilia into the mucosal layer of the nasal cavity. Odorants have to firstly diffuse through this protein rich hydrous mucus to reach the ORs, which can be found in the plasma membrane of the cilia. The olfactory perception begins when odorous ligands activate ORs. The OR activation causes a conformational change of the receptor, which in turn leads to the activation of the intracellular bound olfactory G protein (Golf) (Jones & Reed, 1989). The heterotrimeric Golf protein belongs to the family of stimulative G proteins (Gs). The activation of the Golf protein causes an exchange of the bound guanosine diphosphate (GDP) to guanosine triphosphate (GTP). As a result, the G protein subunits dissociate into two parts: the GTP-bound α-subunit and a βγ- complex (Stryer & Bourne, 1986).

In the next step of the signaling cascade, Gαolf mediated activation of adenylyl cyclase III (AC-III), which catalyzes the conversion of adenosine triphosphate (ATP) to cyclic adenosine monophosphate (cAMP) (Pfeuffer et al., 1989). cAMP acts as a second messenger by binding to a cyclic nucleotide-gated cation channel (CNG channel), whereby incoming Na+ and Ca2+ ions trigger the depolarization of the OSN membrane (Nakamura & Gold, 1987). The increased intracellular Ca2+ concentration activates chloride channels (TMEM16B) and causes the efflux of negatively charged Cl- ions, which further enhance the cell depolarization (Kleene & Gesteland, 1991; Stephan et al., 2009; Rasche et al., 2010). A competing model that proposes an additional phosphatidylinositol-3-phosphate pathway in the mammalian OR signal transduction is controversial. Knockouts of members of the cAMP-mediated pathway such as murine Gαolf or AC-III lead to anosmic phenotypes and underline the fundamental role of the cAMP-mediated pathway (Brunet et al., 1996; Wong et al., 2000). Therefore, it is currently assumed that odorant signals are primarily mediated through the cAMP pathway, but the IP3 pathway may have a modulatory effect on the cAMP signaling pathway or both pathways can affect mutually (Vogl et al., 2000; Spehr et al., 2002; Klasen et al., 2010). Nevertheless, if the cell depolarization exceeds the threshold potential, action potentials are generated, which are transmitted along the axon of OSN to the olfactory nerve (1st cranial nerve). These converge into glomerular structures in the olfactory bulb, named the glomeruli. Then, the signal travels via mitral cells to higher brain regions where the smell sensation is perceived (Firestein, 2001; Munger et al., 2009).

INTRODUCTION

Figure 3. The human olfactory system. Odorants reach the olfactory epithelium in the nose via air flow. Binding of odorants to a receptor triggers the olfactory signal pathway that converts a chemical signal to an electrical one in the olfactory sensory neurons (OSNs). Axons of OSNs project to the olfactory bulb. They terminate in glomeruli and are connected with mitral cells through synapses, which send their axons to higher brain areas. Figure modified from Ref. (Mainland et al., 2014b).

1.2.2 Ectopic expression of olfactory receptors

Contrary to the original assumption that ORs are exclusive present in the olfactory epithelium (Buck & Axel, 1991), recent studies demonstrate the expression of ORs in a broad spectrum of non-olfactory tissues (Feldmesser et al., 2006; Zhang et al., 2007; Flegel et al., 2013). In 1992, Parmentier et al. were able to identify for the first time that ORs are expressed beyond the nose in germ cells of dogs and humans (Parmentier et al., 1992). One this basis, further ORs were identified in human testis and spermatozoa and functionally characterized. Activation of these ORs affects the cellular Ca2+ homeostasis and leads to chemotaxis, chemokinesis, acrosom reaction and thus may potentially play a key role in reproduction (Spehr et al., 2003; Veitinger et al., 2011; Flegel et al., 2015b). Moreover, OR-mediated sperm activation was also observed in insects and may represent an example of convergent evolution. Further studies describe the presence of ORs in other human tissues such as the tongue, the prostate, erythrocytes, the heart and the lung (Feingold et al., 1999; Xu et al., 11

INTRODUCTION

2000; Gaudin et al., 2001; Weng et al., 2006; Giandomenico et al., 2013). The improvements in transcriptome analysis, microarray and next generation sequencing techniques enabled researchers to detect the presence of OR transcripts in nearly all human tissues (Zhang et al., 2007; La Cruz et al., 2009; Flegel et al., 2013). The subcategory of ectopically expressed ORs is considerably higher conserved between primate species than those receptors that are exclusively expressed in the olfactory epithelium. This phenomenon points towards a positive selection pressure and crucial functions in human non-olfactory tissues (La Cruz et al., 2009). Nevertheless, potential functions of such ectopically expressed ORs are controversially discussed. However, ectopic expressed ORs gained attention in the recent years as the physiological functions could be characterized for few receptors. Beside their physiological role in spermatozoa, ORs are described as chemosensors in enterochromaffin cells of the human gut and their activation leads to secretion of serotonin (Braun et al., 2007). An involvement of ORs was shown in mediating various secretion processes such as glucagon, neuropeptide calcitonin gene-related peptide and renin secretion (Pluznick et al., 2013; Gu et al., 2014; Kang et al., 2015). In addition, Pluznick et al (2013) demonstrated that the OR induced renin secretion from kidney (renal juxtaglomerular apparatus) affects the blood pressure in mice (Pluznick et al., 2013). A further key function of ectopically expressed ORs appears to be the regulation of proliferation and migration. Activation of OR2AT4 in human keratinocytes by sandalwood derivatives promotes cellular proliferation and migration and thereby induces wound-healing (Busse et al., 2014). Activation of the same receptor in circulating leukocytes inhibits proliferation and initiates apoptosis (Manteniotis et al., 2016). Moreover, the activation of OR10J5 by lyral leads to an increased migration of human umbilical vein endothelial cells and enhanced angiogenesis in mice (Kim et al., 2015). Lyral seems also to affect migrative properties of murine myocytes during muscle regeneration through MOR23 (Griffin et al., 2009). Activation of OR1A2 by (-)-citronellal results in a reduced cell proliferation of a hepatocellular carcinoma cell line, indicating an effect on hepatocellular carcinoma progression (Maßberg et al., 2015). In prostate cancer cells, the activation of OR51E2 (also called PSGR, prostate specific G-protein coupled receptor) leads to an inhibition of proliferation in vitro, whereas recent in vivo studies suggest a role of OR51E2 in the promotion of invasiveness and tumor development (Neuhaus et al., 2009; Rodriguez et al., 2014; Sanz et al., 2014; Wiese et al., 2015). Furthermore, OR51E2 has been described as a potential biomarker for the identification of prostate cancer due to its significant upregulation in prostate carcinoma cells in comparison to healthy prostate epithelial cells (Xu et al., 2000; Xia et al., 2001; Wang et al., 2006a; Xu et al., 2006). The 12

INTRODUCTION

activation of the same receptor reduces the proliferation and induces the pigmentation of human melanocytes (Dissertation Lian Gelis, Department of Cellphysiology, RUB). The OR51E2 paralogous receptor OR51E1 (also called PSGR2, prostate specific G-protein coupled receptor 2) has also been described as being upregulated in prostate cancer cells (Weigle et al., 2004; Fuessel et al., 2006; Wang et al., 2006a). Moreover, an overexpression of OR51E1 was detected in intestine neuroendocrine carcinomas and somatostatin receptor- negative lung carcinoids (Cui et al., 2013; Giandomenico et al., 2013). Due to the presence of ORs in non-olfactory tissues and the overexpression in some tumor entities, their role in the development and progression of cancer is subject of current research. These studies focus on the discovery of olfactory receptor function in cancerous cells in order to characterize the potential of ORs as novel targets for therapeutic application or as diagnostic biomarkers. Several studies show the association between a regulated OR expression and the manifestation of different diseases. Accordingly, the downregulation of ORs in mononuclear cells of peripheral blood is related to the incidence of traumatic brain injury (Zhao et al., 2013). The dysregulation of ORs expressed in the brain is linked with the development and progression of neurodegenerative diseases such as Alzheimer’s disease, Creutzfeldt-Jakob, Progressive Supranuclear Palsy and Parkinson’s disease (Ansoleaga et al., 2013; Garcia- Esparcia et al., 2013). Moreover, Ma et al. (2015) identified a mutation in the OR2W3 gene associated with autosomal dominant retinitis pigmentosa (Ma et al., 2015). Despite the obvious potential of ectopically expressed ORs, their physiological function and pharmacological applicability is poorly understood. Therefore, the characterization of ectopic ORs offers a wide range of promising research areas.

1.3 Excursus: Anatomy and physiology of the heart

The heart is a hollow muscular organ, which pumps blood through the blood vessels through the whole body. Circulation of blood supplies the body with oxygen and nutrients, and also supports the removal of metabolic wastes. Key functions also include the maintenance of homeostasis, the humoral and cellular defense as well as the communication via hormones (Schmidt & Lang, 2007). As the cardiovascular system takes over a vital function for the human organism, it is not surprising that disorders of the circulatory system (ischaemic heart disease, stroke, etc.) are the leading cause of premature death (Go et al., 2014). Nevertheless, the majority of cardiovascular drugs exert their function by targeting the adrenergic and 13

INTRODUCTION

angiotensin GPCR signaling pathways (Foster et al., 2015). It is likely, however, that currently uncharacterized cardiac GPCRs offer opportunities for the development of novel therapies to treat cardiovascular diseases. The present work deals with the investigation of up to date sparsely characterized ORs in the human heart. Therefore, essential anatomical and physiological aspects of the human heart are briefly described in the following chapters.

1.3.1 Anatomy of the heart and blood circuit

The heart is located in the middle compartment of the mediastinum in the chest. A membrane namely pericardium surrounds and protects the heart. The wall of the heart consists of three layers: the epicardium, myocardium and endocardium. The outer protective layer, the epicardium, consists of mesothelium and connective tissues. The heart wall consists of approximately 95% myocardium and is composed of cardiac muscle fibers that generate the pumping force. The innermost endocardium is a thin layer of endothelium and connective tissue. It provides smooth endothelial lining for the chambers and valves of the heart. The smooth structure minimizes surface friction when blood passes through the heart. The heart has four chambers. Two upper receiving chambers are the left and right atria and two lower pumping chambers are the left and right ventricles, which are divided by valves, the so called atrioventricular valves. The right atrium receives blood from the whole body. The blood is released into the right ventricle, which ejects the blood into the pulmonary truck. The oxygenated blood enters the left atrium and flows into the left ventricle. The left ventricle pumps the oxygenated blood through the aorta into the body except the air sacs of the lungs. The ventricles and arteries are divided by semilunar valves. The coronary circulation provides blood flow to the myocardium. As already mentioned, the myocardium is the thickest of all layers, but the thickness varies according to the chamber’s function. Due to the highest workload, the left ventricle has the thickest wall (Tortora & Derrickson, 2011).

INTRODUCTION

Figure 4. Anatomy of the human heart. The heart is divided in four chambers (2 atria and 2 ventricles), which consists of different cell types. A particularly interesting cell type is the pacemaker cells. The sinoatrial node (SAN) consists of a group of pacemaker cells, which are located in the right atrium. The pacemaker cells generate electrical impulses to initiate heart contraction. The electrical impulses are conducted from the atria to the ventricles via the atrioventricular node (AVN). The subsequent excitation of the His bundle, the bundle branch and Purkinje fibers leads to a coordinated contraction of the ventricles. Figure modified from Ref. (Xin et al., 2013).

1.3.2 The cardiac conduction system

The most unique feature of the heart is the inherent ability to create lifelong rhythmic cardiac contractions without external stimulation. The source of this rhythmic contraction is a network of self-excitable cardiac muscle fibers called autorhythmic fibers. Different components inter alia sodium channels, cardiac ryanodine receptor, cardiac calsequestrin and hyperpolarization-activated cyclic nucleotide-gated (HCN) channels are responsible for the autorhythmic activity (Park & Fishman, 2011). HCN channels play the key role for the overall pacemaker frequency (Park & Fishman, 2011; Scicchitano et al., 2012; Benarroch, 2013). At the end of an action potential they are activated by hyperpolarization. HCN channel opening (funny current) leads to a slow increase of the membrane potential up to the threshold for the opening of voltage-sensitive Ca2+ channels. Beside this pathway, which is referred as “membrane clock”, a second mechanism, known as “Ca2+ clock”, was discussed in the last years. Here, the cause of the depolarization is the intracellular Ca2+ oscillating induced by spontaneous and rhythmic Ca2+ release from the sarcoplasmic reticulum (Lakatta et al., 2010). Nevertheless, the resulting Ca2+ influx provokes action potentials (Accili et al., 2002; Benarroch, 2013). These fibers repeatedly generate action potentials that trigger heart contraction. About 1% of cardiac muscle fibers are autorhythmic fibers with two different

INTRODUCTION

functions: acting as pacemaker and forming the cardiac conduction system. Pacemaker cells in the sinoatrial (SA) node spontaneously depolarize. When the depolarization reaches the threshold, it triggers action potentials. Each action potential originates from the SA node, propagates in both atria via gap junctions and induces contraction at the same time. Afterwards, the electrical excitation spreads to the atrioventricular (AV) node in the septum with a time delay. This results in a slowdown of the action potential frequency and provides the atria to fully eject all blood into the ventricle. The subsequent excitation of the His bundle, the bundle branch and Purkinje fibers leads to a coordinated contraction of the ventricles, whereby the whole blood is pumped out of the ventricles into the arteries (His, 1893; Tawara, 1906; Schmidt & Lang, 2007). The cardiac cycle, when the heart refills with blood, is called diastole (relaxation) followed by the contraction called systole (Anderson et al., 2009; Tortora & Derrickson, 2011).

1.3.3 Excitation-contraction coupling

The electrical excitation is transformed into a mechanical contraction in cardiomyocytes by a process called electro-mechanical coupling. During the action potential, Ca2+ ions enter the cell through the L-type Ca2+ channels. The Ca2+ influx in turn triggers a release of Ca2+ through ryanodine receptors (RYR) from the sarcoplasmic reticulum (SR). Ca2+ released by the SR increases the intracellular Ca2+ concentration from about 10-7 to 10-5 M. This free Ca2+ binds to troponin C and thereby induces the rearrangement of tropomyosin. Subsequently, the Ca2+ ions trigger the interaction of actin and myosin, which finally leads to the muscle contraction of the heart. For the relaxation of the cell, it is crucial that the intracellular Ca2+ concentration decreases and that the Ca2+ ions dissociate from troponin C. The decrease of the cytosolic Ca2+ concentration is achieved by RYR inactivation and sequestration of Ca2+ in the SR is mediated through sarco-endoplasmic reticulum calcium- ATPase (SERCA) and mitochondrial Ca2+ uniporters. Further, the cytosolic Ca2+ concentration decreases via the Na+/Ca2+ exchanger (NCX) and the Ca2+-ATPase, which are located in the plasma membrane (Bers, 2002).

INTRODUCTION

1.3.4 Cardiac GPCRs: Modulation of cardiac contraction

Stimuli from the autonomic nervous system and blood-borne hormones can regulate timing and strength of the heart’s contraction via GPCRs. Modulation of cardiac contraction force is called inotropy, while changes of the contraction frequency are referred to chronotropy. The term lusitropy describes the modulation of cardiac relaxation and dromotropy refers to the conduction speed in the AV node (Tortora & Derrickson, 2011). One of the most important group of cardiac GPCRs is the adrenergic receptors (ARs), which translate chemical messages via catecholamines from the sympathetic nervous system into cardiovascular responses (Bylund et al., 1994). There are two main groups of ARs, α and β, with nine subtypes. The α1ARs, which are expressed in the heart and vasculature, act vasoconstrictive via Gαq mediated signaling pathways, whereas the α2ARs reduce myocardial contractility and slow heart rate via coupling to Gαi (Rockman et al., 2002).

The β1AR is the predominant βAR subtype in the heart and positively regulates the inotropic and chronotropic responses via the Gαs-cAMP-PKA pathway. Alterations in βAR signaling are of crucial importance for the pathogenesis of human heart failure, because chronic rise of catecholamines results in the dysregulation of βAR signaling by receptor desensitization or downregulation (Bristow et al., 1982; Bristow et al., 1986). Accordingly, βARs are in the focus of pharmacological treatments of heart failures. The discovery of βARs antagonists, β- blockers such as propranolol, metoprolol or bisoprolol, revolutionized the medical management of heart failures. The counterpart of the βAR is the muscarinic acetylcholine receptor M2 (mAChR2). Activation of this receptor by the parasympathetic nervous system leads to a negative dromotropy, a negative chronotropy and also indirectly to a negative inotropy. These effects occur via the inhibition of the adenylyl cyclase by Gαi, which in turn exerts an inhibitory influence on the HCN channel. Moreover, the Gβγ subunits inhibit the G protein-coupled inwardly-rectifying potassium channels (GIRK) in the SA node, which leads to a hyperpolarization and delayed depolarization of the cell by of HCN (Rockman et al., 2002a; Wang et al., 2013c). The mAChR2 antagonists, such as atropine, are used in the treatment of bradycardia (Trappe, 2010). Beyond the ARs and mAChR, numerous other GPCRs can modulate cardiac contraction or metabolism. Opioid receptors mediate paracrine effects on vascular tone, cardiac excitation-contraction coupling, heart rate and myocardial inotropy, while endothelin receptors act as vasoconstrictor, which also have chronotropic, inotropic, direct arrhythmic and hypertrophic effects on the cardiovascular system (Yamazaki et al., 1996; Burrell et al., 2000; Asano et al., 2002; van den Brink et al., 2003; Headrick et

INTRODUCTION

al., 2012; Kaoukis et al., 2013). Furthermore, the endothelin-1 receptor promotes cardiac remodeling and hypertrophy similar to angiotensin II type 1 receptor, whose antagonists are drugs applied for hypertension and cardiovascular disease (Foster et al., 2015). A recent large scale NGS analysis revealed mRNA expression of a subset of ‘non-classical’ GPCRs, e.g. chemosensory receptors such as taste receptors and ORs, in the human heart (Flegel et al., 2013). To date, the physiological function of these receptors has been rarely studied.

1.4 Excursus: Anatomy and physiology of the eye

Recent studies demonstrate the expression of ORs in a broad spectrum of non-olfactory tissues (Feldmesser et al., 2006; Zhang et al., 2007; Flegel et al., 2013). However, the expression profile and function of ORs in the human eye has not been characterized until now. First interesting approaches were provided by Pronin et al. (2014) and Ma et al. (2015). Pronin and coworkers analyzed the mouse corneal transcriptome and describe the expression of ORs and related genes (Pronin et al., 2014). Ma et al. (2015) identified a mutation in OR2W3 gene associated with autosomal dominant retinitis pigmentosa (Ma et al., 2015). This result indicates an important functional role of ORs in the human retina and provides interesting indications for novel therapeutic strategies. These studies suggested an expression of OR transcripts also in the human eye a finding which is further investigated in present thesis. Because the second project of the present work deals with the role of ORs in neuronal retina and RPE, the subsequent sections briefly touch on the anatomy and physiology of the human eye. The eye mediates the visual perception and thus the most important sensory organ in human. It consists of three coats: the outer (fibrous) layer, the middle (vascular) layer and the inner layer. The outer layer is composed of sclera and cornea, which acts as the eye's outermost lens and has protective function. The sclera provides the structure as well as protection and attachment for the extraocular muscles. The middle layer is built up of the choroid, the ciliary body and the iris. The choroid supplies the adjacent layers with nutrients and oxygen, while the functions of the ciliary body are accommodation, aqueous humor production and resorption. The iris regulates the amount of light reaching the retina and the pigmentation of the iris defines the eye color. The inner layer consists of the retina, which is build up of different layers and one of them is the retinal pigment epithelium (RPE) (Tortora &

INTRODUCTION

Derrickson, 2012). The retina is responsible for the detection of light and converts this external signal into electro-chemical impulses.

1.4.1 Anatomy of the retina

The retina is a complex network of neurons which are composed of five major classes of neurons. These include the photoreceptors, bipolar cells, horizontal cells, amacrin cells and ganglion cells, which are arranged in multiple distinct layers. The RPE forms the outermost layer. The adjacent photoreceptor layer consist of cones and rods and is separated in the inner/outer segment (IS/OS). The rods (approximately 110-125 millions in number) are responsible for vision at low light levels (scotopic vision) and are concentrated at the outer edges of the retina. In contrast, the cones (about 6.4 millions) mediate color vision (photopic vision) and are densely packed in the fovea centralis that represent the area of maximum visual acuity. The cones can be distinguished in three types with different photopsins: blue- sensitive cones or S-type (absorption maximum at 420 nm), green-sensitive cones or M-type (absorption maximum at 534 nm) and red-sensitive cones or L-type (absorption maximum at 564 nm). The cell bodies of the photoreceptors are divided from IS through the external limiting membrane and form the outer nuclear layer (ONL). The synaptic wiring of photoreceptors, bipolar cells and horizontal cells occurs in the outer plexiform layer (OPL), whereas the nuclei and surrounding cell bodies of bipolar cells, horizontal cells and amacrine cells are represented in the adjacent inner nuclear layer (INL). The INL is followed by the inner plexiform layer (IPL) that comprises the synapses between the bipolar cell axons and the dendrites of the ganglion and amacrine cells. The cell bodies of ganglion cells and some displaced amacrine cells are located in the ganglion cell layer (GCL). The axons of ganglion cells form the optic nerve fibers within the nerve fiber layer (NFL). The optic nerve projects to the lateral geniculate nucleus of the thalamus and the superior colliculus as well as to the pretectum and other targets. The final layer is the inner limiting membrane (ILM) (Schmidt et al., 2006; Ulfig, 2011).

INTRODUCTION

Figure 5. The human eye and the retinal cell types. (A) The human eye is surrounded by three layers: the outermost (fibrous) layer, the middle (vascularized) layer and the innermost layer (retina). The outermost region of the retina comprises the supportive retinal pigment epithelium (RPE). The RPE forms a barrier between retina and choroid. The neural layers of the retina, next to the RPE, are directed towards the interior of the eye, consists of light-sensing rod and cone photoreceptors, a middle layer of connecting neurons (bipolar, horizontal and amacrin cells) and the innermost layer of ganglions. The signals, which originate from the photoreceptors are transmitted via ganglions through the optical nerve into the brain. (B) Toluidine blue-stained histological sections of the mouse eye. S, sclera; Ch, choroids; RPE, retinal pigmented epithelium; OS, photoreceptor outer segments; IS, photoreceptor inner segments; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer. Figure modified from Ref. (Hennig et al., 2004; Kimbrel & Lanza, 2015).

1.4.2 Physiology of the retina: visual processing

Visual perception begins when light enters the cornea and spreads through thelayers of other retinal neurons before reaching photoreceptors, where the light is converted into an electrical signal. The OS, which is specialized for phototransduction, contains the visual pigment rhodopsin within the membranous discs. Rhodopsin is a GPCR consisting of a protein moiety, which binds covalently a cofactor called retinal. Absorption of light causes a configuration change from the 11-cis to the all-trans-retinal that leads to an activation of rhodopsin. Activated rhodopsin undergoes a conformational change to meta-rhodopsin II and stimulates transducin (Gt protein), which in turn activates a phosphodiesterase that catalyzes the hydrolysis of cGMP. The reduction of cGMP leads to closure of the cGMP-gated channels and thus decreases the inward current of Na+ and Ca2+ ions and leads to cell hyperpolarization. In darkness, cells release glutamate, which inhibits on-center bipolar cells and excites off- center cells. Due to the hyperpolarization of the photoreceptors by light exposure, the glutamate release decreases, which leads to a depolarization of on-center bipolar and hyperpolarzation of off-center cells. Bipolar cell as well as horizontal and amacrine cells are interneurons that do not simply transmit signals from the photoreceptors to the ganglion cells.

INTRODUCTION

They combine signals from several photoreceptors in such a way that they evoke electrical responses in ganglion cells, which crucially depend on the exact spatial and temporal patterns of the light stimulation (Kandel, 2013).

1.4.3 The retinal pigment epithelium: Structure and function

The RPE, a monolayer of pigmented cells, builds a part of the blood-retina barrier. The RPE is located between photoreceptor outer segment and Bruch’s membrane, which separates the RPE from choroid. As long apical microvilli of RPE surround the light-sensitive OS, a complex of close structural interaction is constructed. The RPE has several functions. One of them is the increase of optical quality by absorption of scattered light, which is possible due to the pigmentation. The pigmentation also contributes to protection against oxidative stress. A reduction of protective mechanism or accumulation of photo-oxidative reaction species results in an increase of oxidative stress, which represent an important factor in the pathogenesis of age related macular degeneration. A further function is the trans-epithelial transport of nutrients and ions between photoreceptors and choroid. The RPE transports water that in large amount is produced in the retina, also ions (predominantly Cl-) and metabolic end products such as lactic acid from the sub-retinal space to the blood and thus regulates the pH. In this way, it supports the photoreceptor function, whereas the neuronal retina coordinates this trans-epithelial transport. Moreover, the RPE in cooperation with the Müller glia cells is responsible for the spatial buffering of ions in the sub-retinal space to maintain excitability of photoreceptors. In the other direction, from blood to the photoreceptors, the RPE transports glucose, vitamin A (all-trans-retinol) to ensure the supply for the visual cycle and docosahexaenoic acid, which is an essential component of the membranes of neurons and photoreceptors. Alteration of trans-epithelial transport caused by acquired and inherited disorders can lead to vision loss. A further important task of RPE is the participation in the visual cycle. Light transduction by rhodopsin underlies the stereochemical change of 11-cis-retinal into all-trans-retinal. All- trans-retinal is metabolized into all-trans-retinol and transported to the RPE. All-trans-retinal is metabolized into all-trans-retinol and transported to the RPE because photoreceptors are unable to regenerate all-trans-retinal into 11-cis-retinal due to a lack of cis-trans isomerase. In the RPE retinol re-isomerized to 11-cis-retinal and redelivered to the photoreceptors. The common pathway involves the interstitial retinal binding protein (IRBP), cellular retinol 21

INTRODUCTION

binding protein (CRBP), cellular retinaldehyde binding protein (CRALBP), all-trans-retinol dehydrogenase (atRDH), 11-cis-retinol dehydrogenase (11cRDH), lecithin retinol acyltransferase (LRAT), and RPE specific protein with a molecular mass of 65 kDa (RPE65). Gene defects leading to a reduced function of proteins participating in the visual cycle causes inherited retinal degenerations such as retinitis pigmentosa. In addition, the RPE acts in the photoreceptor renewal. The OS undergo a constant renewal process as they are exposed to oxidative stress that leads to accumulation of photo-damaged proteins and lipids. In this renewal process OS are newly built up from the base and the apex of the OS that contain the highest concentration of radicals, photo-damaged proteins and lipids are shed from the photoreceptors and phagocytozed by the RPE. In the RPE, shed OS are digested and important molecules, such as retinal or docosahexaenoic acid, are recycled. The process of OS shedding and phagocytosis follows a circadian rhythm. Defects in RPE OS phagocytosis have been identified in Usher type 1B and retinitis pigmentosa patients. In conclusion, it remains to be mentioned that the RPE has an immunosuppressive function and secretes a variety of growth factors and factors that are essential for maintenance of the structural integrity of retina and choroid. This includes e.g. tissue inhibitor of matrix metalloproteinase, fibroblast growth factors, transforming growth factor, vascular endothelial growth factor and pigment epithelium-derived factor (Strauss, 2005).

Figure 6. Histology and functions of the retinal pigment epithelium (RPE). (A) The RPE is the outermost layer of the retina and is in direct contact with the photoreceptors. The RPE and the choroidal blood vessels (choriocapillaeris) are separated by the Bruch’s membrane. RPE cells are polarized with distinct apical (blue) and basolateral (purple) membrane parts. The RPE forms the outer blood-retinal barrier. Further functions of the RPE cells include light absorption, epithelial transport (inclusive: maintains the ionic, pH and fluid balance), secretion, visual cycle and phagocytosis. (B) Toluidine blue-stained histological sections of mouse eye. Light microscopic image shows the outer segment (OS), RPE and choroid (Ch). Figure modified from Ref. (Ding et al., 2011; Toops et al., 2014).

INTRODUCTION

1.5 Objectives

GPCRs play an important role in sensing extracellular signals, which cover a broad spectrum from physical stimuli for vision, including transmitters and peptide molecules e.g. hormones or chemical ligands for taste and smell. The significance of these receptors appears by the fact that more than 60 % of all commercially available drugs target GPCRs (more than half is orphan), including pharmaceuticals for the treatment of cardiovascular diseases such as hypertension, arrhythmias and heart failure. It is likely, however, that still uncharacterized GPCRs bear diagnostic and therapeutic potential. A recently performed large scale next- generation sequencing analysis revealed broad mRNA expression of a subset of ‘non- classical’ GPCRs, e.g. chemosensory receptors like odorant receptors (ORs), in various normal and diseased human tissues. In order to support the hypothesis that ORs carry out physiological functions in non-olfactory cells, the aim of this thesis was to functionally investigate not yet characterized ORs in particular human tissues. The first part of this thesis focused on the expression and physiological role of ORs in the human heart. Initial analysis of the cardiac mRNA expression profile of ORs as delivered by Next Generation Sequencing (NGS) technology intended to evaluate the highest expressed OR for detailed analysis of the molecular receptive field in a heterologous expression system. The results from ligand screening were supposed to provide tool compounds for the functional characterization of this receptor in a representative ex vivo heart model system consisting of stem cell-derived cardiomyocytes. Physiological investigation was sought to be accomplished by Ca2+ imaging experiments. The second project addressed the function of ORs in the human retina. The analysis of data obtained by NGS provided an initial overview on OR expression in primary retinal pigment epithelial cells (RPE cells) and the neural layer of the retina. The localization of interesting receptors in the neural network of the retina was sought to be clarified by immunofluorescence staining. Ca2+ imaging experiments and physiological in vitro-assays of migration and proliferation were supposed to provide insights on the functional relevance of a particular OR in primary human RPE cells. Accumulating evidence proving an involvement of ORs in different physiological and pathophysiological processes indicates a high potential of this receptor family as targets for drug discovery. As a prerequisite for in silico docking analysis to identify novel high-affinity compounds for a potential clinical application, information on the molecular structure needs to be obtained for the OR of interest. Therefore, the third project of my thesis aimed to enable 23

INTRODUCTION

detailed insights into the molecular basis of ligand binding to OR51E2, the best characterized ectopically expressed OR so far, by results from in vitro activation analyses of point-mutated receptors. The results of the present work can significantly contribute to the understanding of the occurrence and the physiological function of ORs in human heart and eye and provide a basis for targeting ORs in human disease.

MATERIAL

2 MATERIAL

2.1 Laboratory apparatus

Devices Manufacturer Analytical balance A210P Sartorius Analytical balance MC1 Sartorius Agarose gel electrophoresis chamber RUB CCD Camera Till Photonics Centrifuge 5415R Eppendorf Centrifuge MiniSpin plus Eppendorf Centrifuge sorvall RC 6+ Thermo Scientific Confocal microscope LSM 510 Meta Zeiss Counting chamber Neubauer Improved Brand Electrophoresis chtamber Mini Gel Bio-Rad Fluorescence microscope Laxieret 100 Zeiss Fluorescence microscope Axioplan 2 Zeiss Fluorescence microscope Axioskop 2 Zeiss Gel documentation Fusion-SL Vilber Lourmat Gel documentation Multiimage Light Biozym Horizontal Shakers Polymax 1040 Heidolph Incubator shaker Certomat R Braun Biotec Incubator HERACell 240 Heraeus Inverted microscope Axiovert 35 Zeiss Inverted microscope Axiovert 200 Zeiss Laminar flow bankTC72 Gelaire Mastercycler ep gradient S Eppendorf Mastercycler ep realplex Eppendorf Microplate reader Fusion α Packard Monochromator Polychrome V T.I.L.L. Phototonics pH meter1120 Mettler Toledo Powersupply Consort EV231 Biostep Real time PCR machine Mastercycler ep realplex Eppendorf Rotor F10S-6x50y Sorvall Rotor F21S8X5 Sorvall Spectrophotometer NanoDrop ND-1000 Thermo Scientific Spectrophotometer Helios γ Thermo Scientific Tank-blot-sytsem Criterion Blotter Bio-Rad Thermomixer 5436 Eppendorf Tissue homogenizer Precellys 24 Bertin Technologies 38

MATERIAL

Ultrasonic cell disruptor/homogenizers Sonifier B12 Branson Vacuum pump 2522C-02 Welch Vortex Genie 2 Scientific Industries Waterbath type 1004 GFL

2.2 Consumables

Name Manufacturer 24-well plate Orange Scientific 96-well plate, clear Greiner bio-one 96-well plate, white Falcon 96-well plate, white/clear bottom, Poly-L-Lysine coated BD Bioscience Cell culture dishes (ø 35 mm) Sarstedt Cell scraper Sarstedt Coverslips (ø 8 mm) Waldeck Cryotubes Nalgene Disposable syringes (5 ml, 10 ml, 50 ml) Henke Sass Wolff Microscope slides Thermo Scientific Millicell® hanging cell culture inserts with 8-μm-pore polyethylene Merck Millipore terephthalate membrane filter Nitrocellulose membrane Optitran BA-S 85 Whatman Plastic tubes (15 ml, 50 ml) Falcon Precellys Ceramic Kit 1.4/1.8 Peglab Reaction tubes (0.5 ml, 1.5 ml, 2 ml) Sarstedt Sterile filter (0.20 μm, 0.45 μm) Sarstedt T-25 tissue culture flask Nunc T-75- tissue culture flask Nunc Whatman 3MM paper Whatman

2.3 Chemicals

Name Manufacturer 4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid (HEPES) AppliChem 3-Isobutyl-1-methylxanthine (IBMX) Sigma-Aldrich 3K Proteinshake (Western Blot blocking) Layenberger 4-(3-butoxy-4-methoxybenzyl) imidazolidone Sigma-Aldrich 4',6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich 39

MATERIAL

Acrylamide Sigma-Aldrich Agar Life technologies Agarose SeaKem LE Cambrex BioSc. Ammonium persulfate (APS) J.T. Baker Ampicillin Sigma-Aldrich Adenosine triphosphate (ATP) Fermentas Bovine serum albumin (BSA) Sigma-Aldrich Bromophenol blue Sigma-Aldrich

Boric acid (H3BO3) Sigma-Aldrich Calcium chloride (CaCl2) J.T. Baker Carbachol Sigma-Aldrich Complete® Mini Protease Inhibitor Cocktail Tablets Roche Dimethyl sulfoxide (DMSO) J.T. Baker

Dinatriumhydrogenphosphat (Na2HPO4) Merck Millipore Dithiothreitol (DTT) BioRad Ethanol J.T. Baker Ethidium bromide AppliChem Ethylenediaminetetraacetic acid (EDTA) Serva Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid Sigma-Aldrich (EGTA) Ficoll 400 GE Healthcare Forskolin Sigma-Aldrich Fura-2/AM Life technologies Gelatin from cold water fish Sigma-Aldrich Geltrex® Matrigel Life technologies Glucose VWR Glycine Carl Roth Glycerine Sigma-Aldrich Isopropanol J.T. Baker

Magnesium chloride (MgCl2) J.T. Baker Magnesium sulfate (MgSO4) Sigma-Aldrich Methanol J.T. Baker N,N,N´,N´-tetramethylethylenediamine (TEMED) Sigma-Aldrich Nonidet P-40 Sigma-Aldrich Paraformaldehyde (PFA) J.T. Baker PhosSTOP Phosphatase Inhibitor Cocktail Tablets Roche Ponceau S Sigma-Aldrich Potassium chloride (KCl) J.T. Baker

Potassium hydrogen phosphate (KH2PO4) Riedel-deHaën ProLong® Gold Antifade Reagent Life technologies Propidium iodide Sigma-Aldrich Serum goat Enzo Sodium chloride (NaCl) J.T. Baker Sodium deoxycholate J.T. Baker 40

MATERIAL

Sodium dihydrogen phosphate (NaH2PO4) J.T. Baker Sodium dodecyl sulfate (SDS) AppliChem

Sodium hydrogen carbonate (NaHCO3) VWR Sodium pyrovate VWR Toluidine blue Sigma-Aldrich Trizma® base (Tris) Sigma-Aldrich Tris-HCl Sigma-Aldrich Triton X-100 GE Healthcare Tryptone Sigma-Aldrich Tween 20 Sigma-Aldrich Xylene cyanol Sigma-Aldrich Yeast extract BD

2.4 Solution and media

Ringer’s solution Ringer’s solution (Cardiomyocytes) pH=7.4 (RPE cells) pH=7.4 140 mM NaCl 125 mM NaCl

2 mM CaCl2 2.5 mM CaCl2 5.9 mM KCl 5 mM KCl

1 mM MgCl2 1 mM MgSO4 10 mM HEPES (pH=7.3) 20 mM HEPES (pH=7.3)

10 mM Glucose 1 mM KH2PO4

2 mM Sodium pyruvate 10 mM NaHCO3

Ringer’s solution RIPA buffer (RPE cells) Ca2+-free pH=7.4 130 mM NaCl 150 mM NaCl 5 mM KCl 50 mM Tris-HCl

1 mM MgSO4 1% Nonidet P-40 20 mM HEPES (pH=7.3) 0.1 % (w/v) SDS

1 mM KH2PO4 0.5% Sodium deoxycholate

10 mM NaHCO3 0.1-1 mM EGTA

MATERIAL

PBS-/- buffer PBS+/+ buffer 136 mM NaCl 136 mM NaCl 7 mM KCl 7 mM KCl

8.1 mM Na2HPO4 8.1 mM Na2HPO4

1.5 mM KH2PO4 1.5 mM KH2PO4

0.9 mM CaCl2

0.5 mM MgCl2

TBE buffer DNA loading buffer (5x) 90 mM Tris; pH=8.4 0.025 % (w/v) Bromphenol blue 90 mM Boric acid 100 mM EDTA 2 mM EDTA 20 % (w/v) Ficoll 400 0.025 % (w/v) Xylene cyanol

Stripping buffer (pH=2) HBS buffer (2×) 10 % (w/v) SDS 280 mM NaCl 25 mM Glycine 50 mM HEPES; pH 7.3

Running buffer (pH=8.3) Transfer buffer (pH=8.6) 192 mM Glycine 192 mM Glycine 25 mM Tris 25 mM Tris 0.1 % (w/v) SDS 10 % Isopropanol 10 g/l NaCl

Tris/SDS buffer (pH=6.8) Tris/SDS buffer (pH=8.8) 1.5 M Tris 0.5 M Tris 0.4 % (w/v) SDS 0.4 % (w/v) SDS

TBS (pH=7.4) TBST (pH=7.4) 150 mM Tris 150 mM Tris 50 mM NaCl 50 mM NaCl 0.1 % Tween 20

MATERIAL

LB medium (pH=7.4) Laemmli buffer (pH=6.8) 5 g/l Yeast extract 125 mM Tris 10 g/l Tryptone 4 % (w/v) SDS 20 % (w/v) Glycerin 0.02 % (w/v) Bromphenol blue

2.5 Odorants

Odorants were dissolved in DMSO for stock solutions and kept for long time storage at -20 °C or short time storage at +4 °C. For applications, the odorants were diluted in Ringer’s solution or medium to the appropriate concentration, so that the maximum DMSO content was 0.1%

Name Manufacturer Name Manufacturer 10-Undecenoic acid Symrise Ethanoic acid Henkel AG 1-Nonanol Symrise Ethyl-2-hydroxybenzoate Sigma-Aldrich 2-Decenoic acid Henkel AG Heptanoic acid Henkel AG 2-Ethylhexanoic acid Symrise Hexanoic acid Sigma-Aldrich 2-Hydroxybenzoic acid Symrise Methanoic acid Symrise 2-Nonenoic acid Symrise Methylnonanoate Symrise 3-Cyclohexanepropionic Symrise Nonanal Symrise acid 4-Methylnonanoic acid Sigma-Aldrich Nonanoic acid Sigma-Aldrich 5-Phenylpentanoic acid Sigma-Aldrich Octanoic acid Sigma-Aldrich α-Ionone Sigma-Aldrich Pentanal Henkel AG α-Lipoic acid Symrise Pentanoic acid Sigma-Aldrich β-Ionone Symrise Propionic acid Sigma-Aldrich Azelaic acid Symrise Tetradecanoic acid Sigma-Aldrich trans-3-Methyl-2-hexenoic Butyric acid Sigma-Aldrich Symrise acid Cinnamic acid Symrise Tridecanoic acid Henkel AG Decanal Sigma-Aldrich Undecanal Symrise Decanoic acid Sigma-Aldrich Undecanoic acid Sigma-Aldrich Dodecanoic acid Henkel AG

MATERIAL

2.6 Inhibitors

Name Manufacturer SQ-22,536 Sigma-Aldrich MDL-12,330A Sigma-Aldrich Pertussis toxin Calbiochem Gallein R&D Systems

2.7 Transfection reagent

Name Manufacturer Lipofectamine® RNAiMax Reagent Life technologies Lipofectamine® 2000 Transfection Reagent Life technologies

2.8 Kits and PCR mixes

Name Manufacturer cAMP-GloTM Assay Promega CyQUANT TM Proliferation Kit Life technologies Dual-Glo® Luciferase Assay System Promega ECL Prime Western Blotting Detection Reagent Amersham/GE Healthcare GoTaq® G2 GreenMaster Mix Promega GoTaq® qPCR Master Mix Promega iScriptTM cDNA Synthesis Kit Bio-Rad ™ Cell Surface Protein Isolation Kit Thermo Scientific Proteome Profiler Human Phospho-Kinase-Array Kit R&D Systems Pure YieldTM Plasmid Midi-Prep System Promega RNeasy Plus Mini Kit Qiagen The Coomassie Plus-The Better Bradford Assay Thermo Scientific TURBO DNA-freeTM Kit Life technologies Wizard© SV Gel & PCR Clean Up System Promega

MATERIAL

2.9 Enzyme

Name Manufacturer Alkaline Phosphatase (FastAP) Fermentas T4 DNA Ligase Fermentas Restriction endonuclease NotI Fermentas Restriction endonuclease MluI Fermentas

2.10 Antibodies and blocking peptide

2.10.1 Primary antibodies and blocking peptide

Name Manufacturer Anti-OR51E1, polyclonal, rabbit IgG Eurogentec OR51E1-blocking peptide Eurogentec Anti-OR51E2, polyclonal, rabbit IgG Eurogentec Anti-OR6B2/3, polyclonal, rabbit IgG Novus Biologicals Anti-OR2W3, polyclonal, rabbit IgG Sigma-Aldrich Anti-OR5P3, polyclonal, rabbit IgG Sigma-Aldrich Anti-OR10AD1, polyclonal, rabbit IgG Sigma-Aldrich Anti-Rho (4D2), monoclonal, mouse IgG Merck Millipore Anti-α-actinin (sacromeric), monoclonal, mouse IgG Sigma-Aldrich Anti-MelanA [A103], monoclonal, mouse IgG Abcam

Anti- Gαs/olf, polyclonal, rabbit IgG Santa Cruz Biotechnology Anti-adenylyl cyclase III, polyclonal, rabbit IgG Santa Cruz Biotechnology Anti-GAPDH, monoclonal, mouse IgG Abcam Anti-ERK1/2 (p44/42 MAPK), monoclonal, rabbit IgG Cell Signaling Technology Anti-Phospho-ERK 1/2, monoclonal, rabbit IgG Cell Signaling Technology Anti-Akt, monoclonal, rabbit IgG Cell Signaling Technology Anti-Phosopho-Akt, monoclonal, rabbit IgG Cell Signaling Technology

2.10.2 Secondary antibodies

Name Manufacturer Alexa Fluor®488 goat-anti-mouse IgG Life technologies Alexa Fluor®488 goat-anti-rabbit IgG Life technologies Alexa Fluor®546 goat-anti-mouse IgG Life technologies Alexa Fluor®546 goat-anti-rabbit IgG Life technologies Alexa Fluor®633 goat-anti-mouse IgG Life technologies

MATERIAL

Goat anti-Rabbit IgG (H + L)-HRP Conjugate Bio-Rad Goat anti-Mouse IgG (H + L)-HRP Conjugate Bio-Rad

2.11 DNA and protein standards

Name Manufacturer GeneRuler 1 kb DNA Ladder Thermo Scientific GeneRuler 50 bp DNA Ladder Thermo Scientific PageRuler Prestained Protein Ladder Thermo Scientific PageRuler Prestained Protein Plus Ladder Thermo Scientific

2.12 Primer sequences

Table 1. Primers used for gene expression analysis.

Sequence (5'-3') Gene forward reverse NANOG CAGCCCTGATTCTTCCACCAGTCCC TGGAAGGTTCCCAGTCGGGTTCACC TNNT2 ATGAGCGGGAGAAGGAGCGGCAGAA TCAATGGCCAGCACCTTCCTCCTCT OR51E1 CTCTTCTGGAGGAAGACTGG GTTACCTAGCACAGCAATAAGG GNAL CAGACCAGGACCTCCTCAGA AGGGACTCTCTCAGCCTGTT ADCY3 AAGGATTCAACCCTGGGCTC TCCAGCGTCGCATCTCATAG CNGA2 TACTCTGGGACCACCACTGA AACTATCCTGCGGAAGCCAC CNGA4 GAGGTGCTGAGCGAGTATCC CAGCCGTTCAATGCGGTAAG CNGB1 GTCTGAGGCAGCACCTGTAG CGTAGAGAAGGTGATCCCGC ACTB GTCTCCCCCTCCATCGTG TGGATGCCACAGGATTCCA GAPDH TCCCACCACCCTGTTGCTGTA ACCACAGTCCATGCCATCAC OR51E2 CTGAAAGGAACAGGCCGAAC GACCACGATGCAGTTTCCAA OR6B3 CAGCTCCCTGGTGTGCACCG CACCAGCTGGAGGCACAGCC OR10AD1 ACTGCCTGGTTCTTTGGGCTGA GCCAATCACTATGGGGGCCTCA OR6B2 CAAGCTCATCTCTGCCGTGT CAAGCCCAAGGCCTTTTTCA OR13J1 GAGCCGCTCAACAGAACAGA ATATCTAGCACGCTCACCGC OR2L13 CCAAGCCCAGTTACAGCAGA GGACAGGAAGTTGTACGCCA OR5P3 CATTGTGGCCACTGTGTGTG CTCTCTCTTCAGAGCCCCCT OR2L2 CTGTAGCACCCACCTCACTG AGCGCTTTGACTCTAACACAGA OR2A1/42 CCTGCTCCTCCCACCTCTGC CCCAGTGCTCTCCTCAGGGC OR2H2 TGTGTTCCCCAAATGCTGGT CCACTAGCCCAATGACCCAG OR2A4/7 GGTGCCCCGGATGCTGGTG GGGGTGGCAGATGGCCACG OR3A2 ACGAATCCGTTCAGTGGAGG GGGACCCCATTACCTCTCAG OR2M4 ATTCCCATGTCCTTCGAGCC AGGGTTCAGCATAGGGGTGA

MATERIAL

OR1Q1 GCTTCGCCGTCATGGAAAAC GTGTTGAGGTAGGTGCTGGT OR1F12 ACCATTATGGCCCTGCGCCT ATCAGCCCCACCGTAGCCAG OR5P2 GCTGGTTTTCTCATTGCTGTCTC GCCCCCTTAATCTCCTTGTTCCT OR2W3 CTGCCGGGGCTTGGTGTCAG TCCACCTCGTGGTGCCCACA OR6B3 Ex1 CTCATCAGAGGCATTCGTGG OR6B3 Ex2 CTTCTGTTGTGGAAACCGCA OR6B3 ORF CTCCACCAGGACAAAGAGGT

Table 2. Primers used for mutations. Name Sequence (5'-3') Flanking OR51E2 start fwd GCATATACGCGTATGAGTTCCTGCAACTTC OR51E2 stop rev GCATATGCGGCCGCTCACTTGCCTCCCACAGC Internal H104F fwd GTTCTTTATTTTTGCCCTCTCAGCCATTGAATC H104F rev CTGAGAGGGCAAAAATAAAGAACATCTGGGTAAG S107V fwd CATGCCCTCGTAGCCATTGAATCCACCATCCTGC S107V rev GATTCAATGGCTACGAGGGCATGAATAAAGAAC S111V fwd GCCATTGAAGTCACCATCCTGCTGGCCATGG S111V rev GCAGGATGGTGACTTCAATGGCTGAGAGGGCATG K185L fwd GGATGTAATGCTGTTGGCCTATGCAGACACTTTGC K185L rev GCATAGGCCAACAGCATTACATCCTGGTGGACAC K185R fwd GGATGTAATGCGGTTGGCCTATGCAGACACTTTGC K185R rev GCATAGGCCAACCGCATTACATCCTGGTGGACAC K185Q fwd GGATGTAATGCAGTTGGCCTATGCAGACACTTTGC K185Q rev GCATAGGCCAACTGCATTACATCCTG GTGGACAC K185M fwd GGATGTAATGATGTTGGCCTATGCAGACACTTTGC K185M rev GCATAGGCCAACATCATTACATCCTGGTGGACAC D190L fwd GGCCTATGCACTCACTTTGCCCAATGTGGTATATG D190L rev GGGCAAAGTGAGTGCATAGGCCAACTTCATTAC D190N fwd GGCCTATGCAAACACTTTGCCCAATGTGGTATATG D190N rev GGGCAAAGTGTTTGCATAGGCCAACTTCATTAC N194L fwd CACTTTGCCCTTAGTGGTATATGGTCTTACTGC N194L rev CATATACCACTAAGGGCAAAGTGTCTGCATAGG Y251F fwd ACTCGCCTTCTTTGTGCCACTTATTGGCCTCTC Y251F rev AAGTGGCACAAAGAAGGCGAGTACCACACCAATG I255W fwd GTGCCACTTTGGGGCCTCTCAGTGGTACACC I255W rev CTGAGAGGCCCCAAAGTGGCACATAGAAGGCGAG

MATERIAL

2.13 siRNA

Name Source OR51E1 Silencer® Pre-designed siRNA s44550 Life technologies Silencer® Select Negative Control No. 1 siRNA Life technologies

2.14 Plasmids

Name Source pCI mammalian expression vector Promega pCI-OR51E1 Addgene pCI-OR51E2 Addgene RTP1S Department of Cell Physiology hM3 Department of Cell Physiology pRL-TK-Renilla Promega pGL4.29-luciferase Promega pcDNA3-eGFP Department of Cell Physiology

2.15 Cell culture

2.15.1 Cell culture supplies

Name Manufacturer Dulbecco’s Modified Eagle Medium (DMEM) Life technologies Knockout™ DMEM Life technologies DMEM/F12 (+ Glutamax) Life technologies iCell Cardiomyocytes Plating Medium Cellular Dynamics International iCell Cardiomyocytes Maintenance Medium Cellular Dynamics International CD 293 Medium Life technologies Fetal bovine serum (FBS) Life technologies L-glutamine Life technologies Penicillin-Streptomycin (Pen/Strep; 10,000 U/ml) Life technologies Poly-L-lysine Sigma-Aldrich MEM Non-Essential Amino Acids Solution Life technologies Trypsin/EDTA Life technologies β-Mercaptoethanol Life technologies 48

MATERIAL

Dulbecco`s Phosphate Buffered Saline (DPBS) Life technologies Fibronectin Sigma Gelatin from porcine skin Sigma

2.15.2 Media and solution

hESC medium hIPSCs medium DMEM/F12 (+ Glutamax) Knockout™ DMEM 20 % FBS 20 % FBS 1 % MEM 1 % MEM 1 % Pen/Strep 1 % Pen/Strep 1 mM L-Glutamin 1 mM L-Glutamin 0.1 mM β-Mercaptoethanol 0.1 mM β-Mercaptoethanol

Hana3A/RPE medium Trypsin/EDTA DMEM 0.05 % Trypsin 10 % FBS 0.53 mM EDTA 1 % Pen/Strep (100x)

2.15.3 Stem cell-derived cardiomyocytes

The human cardiomyocytes were either differentiated from human embryonic stem cells (hESCs) (Hescheler et al., 1997) or from human induced pluripotent stem cells (hiPSCs). The hIPS cells have been obtained by reprogramming somatic skin cells (Takahashi et al., 2007; Yu et al., 2007). The stem cell-derived cardiomyocytes were provided by the working group of Prof. Dr. Hescheler (Department of Neurophysiology, University of Cologne, Germany). Moreover, hiPSC-derived cardiomyocytes (iCell®-CMs) were purchased from Cellular Dynamics International. Stem cell-derived cardiomyocytes represent a population of ventricular, atrial, and nodal cells and allow investigating, inter alia, cardiac hypertrophy, arrhythmia or cardiotoxicity in vitro (Doherty et al., 2013; Aggarwal et al., 2014; Drawnel et al., 2014; Talbert et al., 2014).

MATERIAL

2.15.4 RPE cells

Primary retinal pigment epthelial cells from different human donors (3-10 h postmortem) without any history of eye disease were obtained from the Eye Bank of Ludwig Maximilian University and were prepared as previously described (Kernt et al., 2009). The cells were provided by the group of PD Dr. Marcus Kernt (Department of Ophthalmology, Ludwig Maximilian University of Munich, Germany).

2.15.5 Hana3A cells

Hana3A cell line was kindly provided by Prof. H. Matsunami (Duke University Medical Center, Durham, NC, USA). Hana3A is a HEK 293T (Human Embryonic Kidney 293 T)- derived cell line stably expressing RTP1L (receptor transporting protein 1 long), RTP2

(receptor transporting protein 2), REEP1 (receptor accessory protein 1) and Gαolf, which supports the robust heterologous expression of ORs (Saito et al., 2004).

2.16 Human tissues

2.16.1 Heart tissue

Specimens of myocardial tissue were procured from patients undergoing heart transplantation. Patients gave informed consent to the scientific use of the explanted tissue, and the study was approved by the local ethics boards of the clinical and the experimental study contributors (Nr. 63-012). Heart specimens were collected at the Heart and Diabetes Center of NRW and were provided as tissue slices for immunohistochemical staining or specimen for RNA and protein isolation.

2.16.2 Retina tissue

Human retina samples (neuronal layer) were obtained from the Eye Bank of Ludwig Maximilian University for RNA-Sequencing analysis. For Western Blots and immunohistochemistry, human donor eyes (donor number 199, female, age 66) with no 50

MATERIAL

history of retinal disease were obtained from the Department of Ophthalmology, University Medical Center Mainz, Germany. Investigations of the RPE were performed with human retina normal tissue slides purchased from Abcam.

2.17 Competent bacterial strain

The large scale preparations of DNA was carried out using competent bacterial strain Escherichia coli (E. coli) XL1-Blue (genotype: recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac [F'proAB, lacIQ ZΔM15, Tn10 (Tetr)]) from the library of the Department of cell Physiology (RUB). The competent bacteria were made according to Hanahan's methods (Hanahan, 1983).

2.18 Databases

Name Source GEO DataSets http://www.ncbi.nlm.nih.gov/gds/ The Human Olfactory Data Explorer (HORDE) http://genome.weizmann.ac.il/horde/ PubMed http://www.ncbi.nlm.nih.gov/pubmed/ Sequence Read Archives (SRA) http://www.ncbi.nlm.nih.gov/sra/

2.19 Software

Application Software Ca2+ imaging TILLvisION (Till Photonics), Spike2® (Cambridge Electronic Design), Chart5® (ADInstruments) Image editing CorelDRAW X4 Image processing ImageJ (v1.46r) Next Generation Sequencing TopHat (v1.2.0), Cufflinks (v1.0.3), Cuffmerge and Cuffdiff (v1.3.0), IGV (Integrated Genomic Viewer) Primer design Primer Blast (NCBI) Sequencing analysis CLC Sequence Viewer 6 (CLC bio), BLAST (NCBI) Statistical analysis Microsoft Excel (Microsoft Office 2010); SigmaPlot (v12.3) Wound-healing assay TScratch (CSElab)

METHODS

3 METHODS

3.1 Cell culture

3.1.1 Culture and differentiation of human embryonic (hESC) and induced pluripotent stem cells (hiPSC) towards cardiomyocytes

Spontaneously beating clusters were generated by co-culturing the hES cell line HES-2 (Reubinoff et al., 2000) or the hiPS cell line Foreskin C1 (Yu et al., 2007) with inactivated visceral endoderm like cells (END-2) according to Passier et al. 2005 with own modifications (Passier et al., 2005). Briefly, HES-2 or hiPS colonies were cultivated for 7 days on irradiated CF1 mouse feeder cells under standard conditions (Madison, WI, USA, www.wicell.org), detached with 0.2% Collagenase IV (w/v) and distributed to a six well dish prepared with ~6*105 END-2 cells. The differentiation media consisted of DMEM/F12 (+ Glutamax) supplemented with 1 % fetal bovine serum, 1 % nonessential amino acids, 0.1 mM beta-mercaptoethanol, 50 U/ml and 50 µg/ml penicillin and streptomycin, respectively. Reagents, if not indicated, were purchased from Life technologies. From the third week of differentiation on, the medium content of FBS was increased to 2 %. Single cardiomyocytes were isolated from the beating clusters by a subsequent enzymatic digestion and plated on fibronectin (2.5 µg/ml DPBS) and gelatin (0.1 % in DPBS) coated coverslips for the Ca2+ measurements. The use of hESCs within this project has been permitted by the Robert Koch Institute, Berlin, Germany (permission number 1710-79-1-4-2-E05). The cell line Foreskin C1 utilized in this study was provided by James A. Thomson (University of Wisconsin, Madison, WI, USA) (Yu et al., 2007). hiPSC-derived cardiomyocytes (iCell®-CMs) were maintained by the standard protocols. Single cells were plated on the coated coverslips after dissociation according to the manufacturer’s guidelines. Stem cell-derived cardiomyocytes obtained from Department of Neurophysiology and iCell® CMs are not able to proliferate, so that they were maintained in appropriated medium at 37 °C, 6 % CO2 and 95 % humidity until use.

METHODS

3.1.2 Culture of RPE cells and Hana3A cells

The cell lines Hana3A and the primary cells RPE were cultured in the respective cell maintenance medium (Chapter: 2.15.2) in humidified incubator (37 °C, 6 % CO2). The cells were passaged at 80-90 % confluence, using the enzym trypsin. For this purpose, the cell culture medium was removed and the cells were washed twice with 5 ml preheated PBS-/- to remove excess medium residues. Afterwards cells were detached from the cell culture bottle bottom with 1 ml Trypsin/EDTA solution. The detached cells were collected in 5 ml of warm cell culture medium and centrifuged at 800 rpm for 3 min. After centrifugation, the supernatant was discarded and the cell pellet resuspended in 10 ml maintenance medium and transferred to T-75 cell culture flasks or seeded for the appropriated experiment.

3.2 Cell-based assays

3.2.1 Luciferase reporter assay

The Dual-Glo Luciferase Assay System was used to measure cellular responses as an indirect measure of receptor activation as previously described (Zhuang & Matsunami, 2008). Hana3A cells seeded on a poly-L-Lysine coated 96-well plate were transfected at 60-70 % confluence with Lipofectamine 2000 according to the manufacturer’s protocol using 18 µl Lipofectamine, 1 µg of RTP1S plasmid (Zhuang & Matsunami, 2007), 1 µg of pRL-TK- Renilla, 2 µg of pGL4.29-luciferase, 1 µg of hM3 (Li & Matsunami, 2011) and 5 µg of full- length rho4D2-tagged OR51E1 or full-length rho4D2-tagged OR51E2-WT/mutants in pCI for an entire well plate. 18-24 h after transfection, transfection medium was removed and replaced with the appropriate concentration of odorant, diluted in DMSO, 0.1 % DMSO (negative control) or 10 µM forskolin (positive control) in with 2 mM L-glutamine. Four hours after odor stimulation, luminescence was measured using the microplate reader Fusion. Firefly luminescence values were divided by the Renilla luciferase activity as control for transfection efficiency in a given well. The firefly-Renilla luciferase ratio was normalized against the lowest/highest luciferase ratios obtained for that experiment. Normalized luciferase activity was calculated by the formula [Luc/Ren(N)- Luc/Ren(lowest)] / [Luc/Ren(highest)-Luc/Ren(lowest)], where Luc/Ren(N) is the luminescence of firefly luciferase divided by luminescence of Renilla luciferase in a certain 53

METHODS

well; Luc/Renilla(lowest) is the lowest luciferase ratio of OR-transfected cells to negative control; Luc/Ren(highest) is the maximum luciferase ratio of OR-transfected cells to positive control of a plate. Mock-transfected cells were stimulated to exclude unspecific responses to the tested compounds. Data were analyzed with Microsoft Excel and SigmaPlot.

3.2.2 Cell proliferation assay

3 RPE cells were seeded in 96-well plates at density of 5x10 . After 24 h at 37 °C with 5 % CO2 cells were stimulated with different concentration of β-ionone or solvent DMSO (control) in DMEM. Cell proliferation was investigated after 5 days using the CyQUANT cell proliferation assay kit.

3.2.3 Cell migration assay: Scratch wound-healing assay

Confluent RPE cells grown in monolayers were scratched using a sterile 20-µl pipette tip and treated with β-ionone or solvent DMSO (control) in DMEM and DMEM+5 % FBS (positive control) for 48 h at 37 °C with 5 % CO2. The residual overgrowing gap of the migrating cells at 12 h, 24 h and 48 h was measured and quantified relative to the initial scratch area (0 hour) with the TScratch software.

3.2.4 Matrigel inversion assay

For measuring of cell invasiveness, Millicell® hanging cell culture inserts with 8-μm-pore polyethylene terephthalate membrane filter were coated with 25 μl Matrigel mixed with 25 μl basic medium at first. Then, cells were seeded at a density of 1×105 cells per well in the upper chambers with 200 μl serum-free basic medium (DMEM). In the lower well, 500 μl complete maintance medium (DMEM+5 % FBS) was placed as a source of chemoattractants. The cells were incubated in basic medium with 10 µM, 50 µM 100 µM β-ionone or with solvent (0.1 % DMSO) for 36 h at 37 °C. Cells migrated to the lower surface of the filter were fixed with 100 % methanol and stained with toluidine blue according to Lochter et al. (1997) (Lochter et

METHODS

al., 1997). The number of invasive cells was determined by counting stained cells and the average cell number per field for each well was calculated.

3.3 Molecular biology

3.3.1 RNA isolation

RNA isolation from human tissues and cells was performed using the RNeasy Plus Mini Kit according to the manufacturer’s protocol including DNaseI digestion. Tissue samples were previously homogenized in the associated lysis buffer using the Precellys®24 and Precellys Ceramic Kit. For Next Generation Sequencing (Section:3.3.8) the RNA samples were directly used and for PCR analysis (Section: 3.3.3) the RNA samples were treated with TURBO DNA-freeTM Kit according to the manufacturer’s instructions to avoid possible DNA contaminations. The RNA concentration and quality was determined using the NanoDrop ND-1000 spectrophotometer. The RNA was stored until further use at -80 °C.

3.3.2 Synthesis of complementary DNA

The preparation of complementary DNA (cDNA) from the recovered RNA was carried out by iScriptTM cDNA Synthesis Kit according to the manufacturer’s guidelines. For the respective cDNA samples (+RT), a corresponding negative control (-RT) was generated. The reaction mix of the negative control included all the components except the reverse transcriptase. For the reverse transcription, 1 µg RNA was used in a total volume of 20 µl. The obtained +/- RT samples were stored at -20 °C.

3.3.3 Reverse transcription polymerase chain reaction (RT-PCR)

PCR was performed using GoTaq® qPCR Master Mix according to manufacturer’s protocol with the Mastercycler ep Gradient S. RT-PCR was performed with cDNA synthesized as described in section 3.3.2 of the various cells and tissues. The used temperature cycle profile was: 5 min at 95 °C followed by 35-40 cycles of 45 s at 95 °C, 45 s at 60 °C and 45 s at 72 °C

METHODS

and a final extension of 10 min at 72 °C. Primers used for RT-PCR were generated for optimal annealing temperature of 60 °C. All experiments were conducted in triplicate.

3.3.4 Agarose gel electrophoresis

Agarose gel electrophoresis is a method to separate DNA fragments according to their size. DNA was loaded with the corresponding loading buffer to an agarose gel (1.5 % agarose in TBE buffer) spiced with 0.25 µg/µl ethidium bromide. By applying a voltage at 150 V, an electric field was generated, which led to the migration and thus to separation of the negatively-charged DNA towards the anode. To determine the size of the DNA fragments, a DNA ladders with defined fragment sizes was applied. DNA fragments can be detected as ethidium bromide intercalates into double-stranded DNA and elicits intense fluorescence after exposure with UV light (λ= 312 nm). The resulting DNA bands were photographed with a CCD camera.

3.3.5 Purification of DNA fragments

In order to extract and purify DNA fragments from agarose gel or to purify PCR products directly, the Wizard© SV Gel & PCR Clean Up System was used according to manufacturer’s guidelines.

3.3.6 DNA sequencing

To verify the sequence of the PCR products, they were sequenced after the purification based on the Sanger method. Sequencing was performed at the Department of Biochemistry (RUB) with the capillary electrophoresis sequencing 3130xl Genetic Analyzer Applied Biosystems. The analysis of the sequencing was carried out with the bioinformatic software CLC Sequence Viewer 6 and BLAST (NCBI).

METHODS

3.3.7 Cloning of OR51E2-mutants

3.3.7.1 Mutagenesis by Overlap Extension PCR Point mutations in OR51E2 were introduced at different positions using overlap extension PCR. Full-length rho4D2-tagged OR51E2 in pCI served as a template. Initial PCRs generate mutated gene segments, with overlapping complementary 3’ ends carrying the required point- mutation, which were then mixed and used as a template for a second PCR to create the full- length product using flanking primers. Full-length primers included NotI and MluI restriction sites for further cloning into pCI expression vector. The PCR was performed using GoTaq® G2 GreenMaster Mix according to manufacturer’s instructions and the following temperature cycle profile: 10 min at 95 °C followed by 35-40 cycles of 60 s at 95 °C, 60 s at 60 °C and 90 s at 72 °C and a final extension of 10 min at 72 °C The nucleotide sequence of the mutants was verified by sequencing.

Figure 7. Generation of OR51E2-mutants by Overlap Extension PCR. Internal primers (Mutation-Primer1/2) produce overlapping, complementary 3′ ends on the intermediate segments and introduce nucleotide substitutions for site-directed mutagenesis. Overlapping strands of these intermediate products (PCR-Product1 and PCR-Product2) hybridize at this 3′ region in a subsequent PCR and are extended to creat the full-length product (OR51E2-Mutant) amplified by flanking primers (Start/Stop-Primer). The final PCR product (OR51E2- Mutant) was further cloned into pCI vector, a mammalian expression vector.

METHODS

3.3.7.2 DNA restriction

The generated OR51E2-mutant PCR products were purified as described in section 3.3.5. The restriction endonucleases NotI and MluI were used for cloning of pCI-OR51E2-mutants constructs. The restriction of the PCR products and the pCI expression vector was performed according to the to manufacturer’s protocol with appropriate reaction buffers for 2 h at 37 °C. The resulting DNA fragments have an overhanging strand (sticky end). The restricted products were finally purified as described in section 3.3.5.

3.3.7.3 Dephosphorylation of the vector

In order to prevent re-ligation of the restricted vector, a dephosphorylation of the vector was performed using the FastAP Thermosensitive Alkaline Phosphatase according to manufacturer’s guidelines. The dephosphorylated restriction samples were subsequently purified such as PCR products (Section 3.3.5).

3.3.7.4 Ligation

The ligation of OR51E2-mutant fragments into the pCI vector was catalyzed by the enzyme T4 DNA ligase, which generates covalent bonds of neighboring 3’-hydroxyl and 5’-phosphate residues. The OR51E2-mutant fragments could only be inserted in one orientation due to the different restriction sites, which were placed in each primer. The ligation reaction was performed according to manufacturer’s guidelines.

3.3.7.5 Transformation and cultivation of competent bacteria

Chemically competent bacteria E. coli XL1-Blue were thawed on ice and incubated with the entire ligation mix for 20 min on ice. Subsequently, a heat shock step was carried out for 90 s at 42 °C. LB medium (1 ml) was added to the transformation mixtures and incubated for 1 h at 37 °C. Next, the mixture was centrifuged for 2 min at 8000 rpm and the supernatant was discarded up to 200 µl in which the cell pellet was resuspended. Finally, the cell suspension

METHODS

was plated on an agar plate containing ampicillin and incubated overnight at 37 °C. Only bacteria cells which integrated the expression plasmid, carrying an ampicillin resistance gene, can survive under ampicillin conditions.

3.3.7.6 Purification of plasmid DNA

For growing of the transformed bacteria, colonies were picked, each one placed in 250 ml LB medium containing ampicillin and incubated overnight in a shaking incubator at 37 °C and 220 rpm. Subsequently, the plasmid DNA was isolated and purified based on the principle of alkaline lysis (Birnboim & Doly, 1979). The Pure YieldTM Plasmid Midi-Prep System was used according to manufacturer’s protocol. The concentration of the plasmid DNA (pCI- OR51E2-mutants) was determined using the NanoDrop ND-1000 Spectrophotometer and then stored at -20 °C. Sequence analysis of the plasmid DNA was carried out as described in section 3.3.6.

3.3.8 mRNA-Sequencing (RNAseq)

The development of a new method of high-throughput sequencing, referred as Next Generation Sequencing (NGS), allows the parallel analysis of several million DNA molecules. In this work the Illumina/Solexa technology based on a sequencing method with reversible terminators (Bentley et al., 2008) was used. In this method, the isolated RNA is firstly fragmented into 200-250 bp long sequences and then converted to cDNA. Next, the cDNA is enriched using the solid phase amplification. For this purpose, a so-called bridge- PCR (bridge-amplification) is carried out, whereby a new complementary strand is formed using polymerases. In this process, one strand separates from an oligonucleotide and attaches to a nearby oligonucleotide. In this way, a bridge is formed and synthesized a new complementary strand. The cDNA molecules with identical sequence are arranged in spatial proximity in clusters. Following, the actual sequencing reaction is carried out. After separation of the complementary strands, fluorescently labeled nucleotides are attached by a DNA polymerase. The incorporated nucleotides can be differentiated based on the different fluorophores. Moreover, the nucleotides are equipped with reversible terminators, so that the addition of further nucleotides is prevented. After washing out of unbound nucleotides and

METHODS

documentation of fluorescence, the terminators and fluorophores are removed and the attachment to the next DNA molecule follows. This enables the parallel analysis of millions of DNA molecules. RNAs from human retinae and RPE cells were isolated as stated above (Section: 3.3.1). Sequencing of mRNA was performed by GENterprise Genomics (Mainz, Germany) on the Illumina NextSeq500 sequencing platform as paired-end reads with 101-nucleotide (data set Retina 3 and data sets of RPE) or with 151-nucleotide (data sets Retina 2 and Retina 4) length. The mRNAseq data were analyzed as described previously (Flegel et al., 2013). Raw sequence data were aligned to the human reference genome hg19 using TopHat (Trapnell et al., 2009). The ultra-fast short–read mapping program Bowtie served to arrange the alignment (Langmead et al., 2009). BAM-files were sorted and indexed using the Samtools software package (Li et al., 2009). FPKM (fragments per kilobase of exon per million fragments mapped) values were calculated using Cufflinks (Trapnell et al., 2010). Moreover, data sets from different human tissues were reanalyzed, which were available in the NCBI SRA archive or obtained from the Body Map 2.0 project from the NCBI GEO database (http://www.ncbi.nlm.nih.gov/gds/; accession number: GSE30611) and previously described (Flegel et al., 2013) and raw data from Flegel et al.(Flegel et al., 2015a).

Table 3. Summary of reanalyzed Next Generation Sequencing data. Tissue Source Peripheral retina SRR1067928, SRR1067936, SRR1067942, SRR1067948, SRR1067984 Macular retina SRR1067929, SRR1067939, SRR1067944, SRR1067970, SRR1067986 RPE/Choroid/Sclera SRR1067930, SRR1067934, SRR1067937, SRR1067940 Fetal RPE SRR447138 Fetal heart GSM1059495 Heart Body Map 2.0 project; (Flegel et al., 2013) Reference tissues (brain, colon, liver, lung, Body Map 2.0 project; (Flegel et al., 2013; skeletal muscle, testis, trigeminal and Flegel et al., 2015a) dorsal root ganglia)

The five peripheral retina data sets and the macular retina data sets were summarized and presented with the mFPKM. Differential expression analyses between peripheral and macular were performed with Cufflinks application Cuffdiff (Trapnell et al., 2012). Trigeminal ganglia data were pooled and presented with the mFPKM of four samples. All data sets were equivalently analyzed with the same parameters. The data sets were visualized and

METHODS

investigated by the Integrative Genomic Viewer for proving sequence alignments and correct mapping of reads for the top expressed genes. While the raw data analysis was performed on a Linux based computer further calculations were carried out with SigmaPlot 12.3.

3.4 siRNA transfection

RNA interference (RNAi) is a naturally occurring mechanism in eukaryotic cells in which RNA molecules inhibit expression of target genes (knock down). This mechanism is used in research in order to specifically regulate the expression of the gene of interest. It is based on the binding of short RNA fragments (small interfering RNA, siRNA) to target mRNA. The subsequent interaction with several enzymes leads to the cleavage of the double-strand RNA (mRNA/siRNA) into RNA fragments. This results in a suppression of the target gene expression. Stem cell-derived cardiomyocytes were transiently transfected with either 50 pmol targeted or negative control siRNAs (OR51E1 Silencer® Pre-designed siRNA s44550 and Silencer® Select Negative Control No. 1 siRNA) and 1 µg pcDNA3-eGFP plasmid as transfection control using Lipofectamine® RNAiMAX according to the manufacturers’ instructions.

3.5 Protein biochemistry

3.5.1 Protein isolation from cultured cells and human tissues

Cells were washed with PBS-/- and subsequently detached with a cell scraper in PBS-/-. Afterwards, cells were pelleted at 800 g for 3 min and the cell pellet was resuspended in RIPA buffer with Complete® protease inhibitor mixture for lysis. Tissue samples were directly homogenized in lysis buffer (RIPA) using the Precellys®24 and Precellys Ceramic Kit 1.4/1.8. After 30 min incubation at horizontal shakers at 8 °C, lysis of cells was completed by sonication. All steps were performed on ice to counteract proteinase activity. Homogenized cell suspension was centrifuged at 14000 rpm for 5 min at 4 °C and the supernatant containing total protein was stored at -20 °C until use. The Coomassie Plus-The Better Bradford Assay

METHODS

was used according to manufacturer’s guidelines for determination of the protein concentration.

3.5.1.1 Cell surface protein isolation

Biotinylation and isolation of cell surface proteins for Western Blot analysis were performed using the Thermo Scientific™ Pierce™ Cell Surface Protein Isolation Kit according to manufacturer’s instructions.

3.5.2 Sodium dodecylsulfate polyacrylamide gel electrophoresis

The dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) is used for separation of proteins according to their molecular size and charge along an electric field. First, the protein samples were mixed with appropriate amounts of 2x Laemmli buffer and 1:20 dithiothreitol (DTT) and then heated at 95 °C for 5 min. These steps lead to protein denaturation and imparted proteins a negative charge. Afterwards, the samples and a protein size marker were loaded onto a 10 % polyacrylamide gel. Electrophoresis was performed with MiniProtean II cell at 70–150 V.

3.5.3 Western Blot

The Western Blot was used for transfer of the electrophoretically separated proteins from the polyacrylamide gel to a nitrocellulose membrane and the subsequent protein detection with specific antibodies. Nitrocellulose membrane and gel were placed directly next to each other and surrounded by gel blot paper and fiber pads in the blotting chamber. As the proteins are negatively charged, they moved to the anode. The membrane is localized towards to the anode so that an exactly resembled protein distribution of the original acrylamide gel was transferred to the membrane. The transfer was done with the tank-blot-system from Biorad® by a voltage of 100 V for 30 min at 4 °C. Western Blot analysis was performed as described by Neuhaus et al. 2009 (Neuhaus et al., 2009), with the slight modification that the ECL™ Select Western Blotting Detection System and the Fusion-SL image acquisition system was used for the 62

METHODS

detection. The antibody dilution used here is shown in Table 4. Quantification of protein band intensities was performed using the software ImageJ.

Table 4. Dilution of the appropriated antibody. Antibodies Dilution Anti-OR51E1 1:250 Anti-OR51E2 1:250 Anti-AC-III/Gαs/olf 1:250 Anti-Phospho-Akt 1:1000 Anti-Akt 1:1000 Anti-Phospho-ERK1/2 1:1000 Anti-ERK1/2 1:1000 Anti-GAPDH 1:500 Anti-Rabbit/Mouse- HRP Conjubate 1:10000

3.5.4 Detecting of protein phosphorylation

Cells were grown in T25 flask until reaching 70-80 % confluence and afterward treated with the appropriate concentration of odorant diluted in DMSO (maximal final concentration 0.1 %) or control (0.1 % DMSO) for 5-30 min in a humidified incubator at 37 °C. After a washing step with PBS-/-, protein isolation was performed as described above. Detection of relative phosphorylation levels of specific kinases was conducted with the Proteome Profiler Human Phospho-Kinase Array Kit according to manufacturer’s protocol or by Western Blot with phospho-specific antibodies according to manufacturer’s instructions. Detection and was done as described in section 3.5.3. For quantification, the relative pixel intensities of odorant- stimulated samples were normalized to the relative pixel intensities of DMSO-treated samples.

METHODS

3.6 Immunofluorescence stainings

3.6.1 Immunohistochemistry of human retina

Immunohistochemical staining of human retina was performed in cooperation with the working group of Prof. Dr. Wolfrum (Department of Cell and Matrix Biology, Johannes Gutenberg-University, Germany) as described in the following section. Donor eyes were dissected and fixed in melting isopentane (~ -168 °C) and cryosectioned as described previously (Overlack et al., 2011). Sections were double stained with mouse monoclonal anti- centrin-3 (Trojan et al., 2008) in combination with affinity purified primary rabbit antibodies against olfactory receptors (1:50), followed by the appropriate secondary antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 568, respectively. Some samples were counterstained with the fluorescein labelled lectin peanut agglutinin (FITC-PNA, 1:400), which specifically labels the extracellular matrix sheath of cone photoreceptor cells (Wunderlich et al., 2015) and 4',6-diamidino-2-phenylindole, before mounting with Mowiol 4.88 and analyzing with a Leica DM 6000 B microscope. Images were processed with Leica deconvolution software and Adobe Photoshop CS (Adobe Systems).

3.6.2 Immunohistochemistry of human heart tissue

The human myocardial tissue slices were fixed with 4 % paraformaldehyde at 4 °C for 20 min. The specimens were washed and permeabilized in PBS-/-+ 0.1 % Triton X-100 (PBST). Blocking was performed in PBST+1% gelatin and 5 % goat serum for 1 h at room temperature. Then, the slices were incubated overnight with the primary antibody in PBST with 1 % gelatin at 4 °C. After PBST washing steps, secondary fluorescent IgGs and 40,6- diamidino-2-phenylindole (DAPI; dilution 1:300) were used for visualization. The secondary antibody incubation was performed for 45 min at room temperature. Afterwards, tissue slices were washed with PBST and covered with Prolong® Gold Antifade reagent. Micrographs were taken by using a LSM510 Meta confocal microscope. Immunizing peptide blocking experiment was performed to validate antibody specificity. Therefore, the anti-OR51E1 antibody was pre-incubated with blocking peptide at a ratio 1:7 for 30 min at room temperature before proceeding with the staining protocol.

METHODS

3.6.3 Immunocytochemistry

Stem cell-derived cardiomyocytes and RPE cells were seeded on coverslips and stained as described in section 3.6.2 with modified washing steps. These were performed with PBS-/- and 0.01 % Triton X-100. Immunfluorescence staining of Hana3A cells was performed as a control for antibody specificity or to evaluate cell-surface expression of the OR51E2 variants. The Hana3A cells were transfected as described in (Zhuang & Matsunami, 2008). The staining for antibody specificity was performed as mentioned above and detection of cell surface expression was done according to the live-cell immunocytochemical staining protocol established by Zhuang and Matsunami (Zhuang & Matsunami, 2008). Pictures of live-cell staining were taken with Zeiss Axioskop 2 fluorescence microscope and the Axiovision software.

Table 5 Dilution of antibodies used for immunofluorescence staining. Antibodies Dilution Anti-OR 1:50 Anti-FITC-PNA 1:400 Anti- α-actinin 1:500 Anti-MelanA 1:50 Anti-rho4D2 1:250 Alexa Fluor goat-anti- mouse/rabbit secondary 1:1000

3.7 Ca2+ imaging

The Ca2+ imaging method allows the measurement of intracellular Ca2+ dynamics using a ratiometric fluorescent dye such as Fura-2 which binds to free intracellular Ca2+. Stem cell-derived cardiomyocytes plated on glass were incubated for 25 min at room temperature and PRE cells were incubated for 30 min at 37 °C in loading buffer (pH 7.4) containing the corresponding Ringer’s solution and 7.5 μM Fura-2-AM. After removal of extracellular Fura-2 by washing with Ringer’s solution, ratiofluorometric Ca2+ imaging was performed using a Zeiss inverted microscope equipped for ratiometric imaging and a Polychrome V monochromator. The monochromator generated light with alternating monochromatic wavelength of 340 nm and 380 nm. Thereby, the fluorescence intensity reflects the bounded Ca2+. With increasing Ca2+ concentration and excitation at 340 nm, the

METHODS

fluorescence intensity increases. On the other hand, the fluorescence decreases at 380 nm.

Thus, by calculating the ratio of the two excitation wavelengths (ratio f340/f380) conclusions on the intracellular Ca2+ concentrations can be drawn. Images were acquired at 0.1 Hz (stem cell- derived cardiomyocytes) or 0.5 Hz (RPE cells), and integrated fluorescence ratios (f340/f380) were measured using TILLvisION software. Images were acquired in randomly selected fields of view. Odorants were pre-diluted in DMSO and then diluted in Ringer’s solution to the final concentration, so that the DMSO concentration did not exceed 0.1 % (v/v), which is tolerated by cardiomyocytes. Inhibitors and other substances were pre-diluted in DMSO unless otherwise by the manufacturer indicated. The data of Fura-2 Ca2+ transients of cardiomyocytes were analyzed with a script in Spike2® analysis software written by working group of Prof. Dr. Hescheler (Department of Neurophysiology, University of Cologne, Germany) and by Chart5®. The basic statistical analysis was performed with Microsoft Office Excel® and SigmaPlot.

3.8 Contractile force measurements of slice preparations of adult human ventricle

The contractile force measurements were performed in cooperation with Prof. Dr. Dendorfer (Walter Brendel Centre of Experimental Medicine, Ludwig-Maximilians-University, Germany). Myocardial slices of about 5x5 mm2 surface area were mounted to a horizontal organ bath (Mayflower, Hugo Sachs Elektroni) and were superfused with gassed Ringer’s solution (5 % CO2, 20 % O2, 37 °C) at 4 ml/min, as described previously (Brandenburger et al., 2011). Isometric contraction force was measured at a preload of 1.5 mN under continuous field stimulation (rate 0.5 s-1, pulse duration 3 ms) at a 1.5 fold excitation threshold. The relative alteration of twitch force before and after drug application was evaluated. For drug application, perfusion of the organ bath was stopped and stimuli dissolved in DMSO were added at 0.1 % v/v to the organ bath. Increasing concentrations of the same stimuli were tested in sequential applications which were separated by 4 min intervals of perfusion and equilibration, respectively. Preparations that developed less than 0.4 mN twitch force, or reacted with more than 5 % change in contractility to 0.1 % DMSO were discarded. Substances that caused less than 5 % alteration in twitch force at their maximum

METHODS

concentration (1 mM) were considered as inactive. Due to the transient action of some of the stimuli, their effects on twitch force were analyzed as minimum and final values during a 4 min period of exposure.

3.9 Determination of the fatty acid pattern in human serum epicardial adipose biopsies

The determination of the fatty acid pattern in the triglyceride and non-esterified fatty acid fraction from epicardial adipose biopsies and from serum was performed in cooperation with Prof. Dr. Schleicher (Division of Pathobiochemistry and Clinical Chemistry, University of Tuebingen, Germany). Epicardial adipose tissue samples were weighed and approximately 25 mg were homogenized using TissueLyser MM 300 (Qiagen) in 0.25 ml 1 % Triton X 100 in PBS-/-. Then, 1.25 ml 2-propanol, n-heptane and 2 mol/l phosphoric acid (40:20:1 by vol) were added to the tissue extract or to 0.25 ml serum samples and mixed by vortexing. After 10 min 0.5 ml toluene/methanol (4:1 by vol), 0.75 ml water was added, mixed by vortexing and after centrifugation at 4,000 rpm (8,175 g), the upper phase was dried under nitrogen. The lipids were dissolved in 75 µl CHCl3/CH3OH (2:1 by vol) and applied to a silica gel chromatography plate (Merck). The lipid fractions were separated using n-hexane, diethylether and acetic acid (160:40:6 by vol) as solvent. The lipid fractions were identified using a pooled control plasma which was also separated on each plate and lipid fractions were visualized by 2,7-dichlor-fluoresceine under ultraviolet light. The fractions were scraped off the TLC plate, transferred to screw-capped vials and dissolved in 2 ml methanol/toluene mixture (1:4 by vol) containing cis-13,16,19-docosatrienoic acid (10 µg/ml) as an internal standard. Trans-esterification was performed by incubation with acetyl chloride at 100 °C for

60 min. The cold sample was neutralized with 5 ml 6 % K2CO3 and shaked for 2 min, centrifuged and the upper phase was concentrated to a volume of 100 μl under nitrogen. The fatty acid methyl esters were measured by gas chromatography 7890A with a flame ionization detector (Agilent) and quantified using the corresponding fatty acids standards. All data analyses were performed using software package JMP 11.0 (SAS Institute).

RESULTS

4 RESULTS

4.1 Identification and functional characterization of olfactory receptors in the human heart

4.1.1 Olfactory receptor OR51E1 is expressed in the human heart and in stem cell-derived cardiomyocytes

Comparative transcriptome analyses of OR expression identified OR51E1 in various human tissues including heart (Fujita et al., 2007; Flegel et al., 2013). In the human adult and fetal heart OR51E1 is the highest expressed OR gene (adult: FPKM 1.50; fetal: FPKM 1.35) on a similar expression level as the beta-2 adrenergic receptor and the muscarinic acetylcholine receptor M2 (Figure 8A). On a rough scale, FPKM ≥ 0.1 corresponds to a weak expression level, FPKM ≥ 10 represents a moderate expression level and FPKM ≥ 100 indicates a high expression level. Apart from the expression level, OR51E1 is one of the few ORs, for which the ligand (nonanoic acid) has been identified (Saito et al., 2009; Adipietro et al., 2012). Therefore, in this study we focused on OR51E1 for functional characterization of ORs in the human heart. Firstly, we validated the results of the transcriptome analyses using reverse- transcriptase PCR (RT-PCR) and could detect transcripts of OR51E1 in the investigated septum and ventricle of the human heart (Figure 8B). For the detection of OR51E1 receptor proteins we performed Western Blot and immunohistochemical analysis using a custom-made OR51E1 antibody. The antibody specificity was demonstrated by co-immunocytochemical staining of Hana3A cells heterologously expressing rho-tagged OR51E1 (Master Thesis Julia Heckmann, Department of Cellphysiology, RUB, 2012) and by using a specific OR51E1- blocking peptide (Figure 8D). Western Blot analysis revealed OR51E1 protein expression in septum and ventricle of the human heart. Prostate cancer tissue served as a positive control for the detection of the OR51E1 protein (Wang et al., 2006a; Weng et al., 2006) (Figure 8C). Immunohistochemical analyses of human ventricular tissue sections further confirmed our results of myocardial OR51E1 protein expression. To study receptor activation, we used an established cardiac in vitro model, the hIPSCs and hESC-derived cardiomyocytes that are spontaneously electrically active (Synnergren et al., 2008). The expression of OR51E1 mRNA in different stem cell-derived cardiomyocytes was confirmed by RT-PCR (Figure 8B).

RESULTS

Figure 8. Expression of OR51E1 in the human heart tissue and stem-cell derived cardiomyocytes. (A) Expression pattern of ORs as revealed by next generation sequencing analyses. The heat map shows FPKM values for ORs and classical cardiac GPCRs (CHRM2, muscarinic acetylcholine receptor M2; AGTR1, angiotensin II receptor type 1; ADRB1, beta-1 adrenoceptor; ADRB2, beta-2 adrenoreceptor; ADRB3, beta-3 adrenoreceptor) found in human adult and fetal heart tissue. Dark blue indicates high expression (FPKM values higher than 10) and white indicates the absence of detectable transcripts. (B) Detection of OR51E1 transcripts in the left ventricle and septum of explanted human heart and in stem-cell derived cardiomyocytes by RT-PCR. Amplification of β-actin (ACTB) using intron-spanning primers served as a quality control of cDNA. Cardiac muscle troponin T (TNNT2) expression identified induced cardiomyocytes (CMs) and Nanog homeobox (NANOG) expression undifferentiated stem cells. HES2-CMs: human embryonic stem cell-derived cadiomyocytes, hIPS-CMs: human induced pluripotent stem cell-derived cardiomyocytes, (bc) indicates beating cell clusters in stem cell-derived cardiomyocytes that were excised for RNA preparation under optical control. OR51E1 gene is expressed in cardiac myocytes of embryonic and adult stem cell origin, not in undifferentiated stem cells. (C) Detection of OR51E1 protein in the left ventricle and septum of explanted human heart and prostate (control) by Western Blotting. The size of the OR51E1 monomeric (OR51E1-M) protein is 35 kDa and dimeric (OR51E1-D) 70 kDa. (D) Detection of OR51E1 protein in ventricular myocytes by immunohistochemical staining. Shown are confocal micrographs of OR51E1 immunostaining using an OR51E1 specific antibody in transversal cryosections of human left ventricle. Cardiomyocytes were identified by co- staining with an α-actinin-detecting antibody. Specificity of OR51E1-antibody labeling was controlled by blocking with immunizing OR51E1 peptide (lower panel). Bar indicates 15 µm.

RESULTS

4.1.2 Ligand screening on OR51E1

Previous de-orphanization studies have identified inter alia nonanoic acid as an activating ligand for OR51E1 (Saito et al., 2009; Adipietro et al., 2012). In order to characterize the molecular receptive field of OR51E1 in more detail we conducted luciferase reporter assay using Hana3A cells heterologously expressing OR51E1. Thereby, we identified 13 new agonists by testing an odorant concentration of 500 µM (except poorly soluble substances) to ensure receptor activation above threshold level (Figure 9A). Moreover, we identified an antagonist for OR51E1 (Figure 9B; C). OR51E1-activating substances are short- to middle- chain (C4-C14) saturated or monounsaturated acids (Figure 9D), some of them are dietary fats. Among the tested compounds, decanoic acid (C10:0) appears to be the most efficient agonist, whereas an increasing or decreasing chain length, insertion of branches or additional double bounds into the compound resulted in a reduced potency to activate the receptor (Figure 9A). Furthermore, our results indicate that the presence of one free terminal carboxyl group is crucial for receptor recognition since substitution by aldehyde, ester, amide or alcohol groups abolishes activation of the heterologously expressed receptor. In a screen for inhibitors we identified 2-ethylhexanoic acid as an antagonist of OR51E1, which significantly reduced the nonanoic acid induced luminescent signal. The half maximal inhibitory concentration (IC50) of 2-ethylhexanoic acid was calculated with 179 μM (200 µM nonanoic acid) (Figure 9B). We observed a significant shift of the dose-response curve for nonanoic acid with and without the antagonist. The EC50 value shifted significantly from 215 µM (± 16) to 375 µM (±41) (p=0.011). The OR51E1 activity induced by the saturating nonanoic acid concentration of 2 mM was not significantly reduced in the presence of 2-ethylhexanoic acid (400 µM), which indicates with the parallel shift in the dose-response curve a competitive antagonistic mechanism (Figure 9C).

RESULTS

Figure 9. Ligand spectrum of OR51E1. (A) Structurally related molecules were tested in Luciferase Reporter assay for their ability to activate heterologously expressed OR51E1, using nonanoic acid as a template (blue bar). Odorant concentrations of 500 µM were used (exception: dodecanoic acid [250 µM], tridecanoic acid [250 µM], tetradecanoic acid [100 µM]; because higher concentrations of odorant were not soluble; white bar). Red dashed line represents the response threshold. Bars represent the means of 3 experiments. Error bars represent the SEM. (B) Concentration-inhibition curve of 2-ethylhexanoic acid. Each response was normalized to the agonist nonanoic acid (200 µM) alone. Calculated IC50 was 192 μM. The curve shift was significant at concentrations higher than 100 µM 2-ethylhexanoic acid (* p<0.05). (C) Dose-response curves in the presence of OR51E1 antagonist. To determine receptor inhibiting properties of compounds, OR51E1-expressing cells were co-stimulated with a rising concentration of nonanoic acid and a fixed concentration of 2-ethylhexanoic acid (400 µM). Mean of cellular responses was measured by Luciferase Reporter assays in 4 biological replicates and normalized to the positive control (forskolin). 2-ethylhexanoic acid acts as competitive inhibitors on OR51E1. Significance was calculated by Student's t-test (*: p<0.05, **: p<0.01 and ***: p<0.001). Error bars represent the SEM. (D) Molecular receptive field of OR51E1. Structurally related molecules were tested in luciferase reporter assay for their ability to activate heterologously expressed OR51E1, using nonanoic acid as a template. Effective ligands are shown in the green field; inactive compounds are in the blue field. Receptor inhibiting substance is shown in a blue rectangular. The active analogue approach identifies a mono carboxyl functional group as key feature for OR51E1 activation; alkyl side chain length can vary from C4-C14, methyl substitutions are not tolerated at Cβ. Double bonds are tolerated at Cβ, but affect negatively the activating property of the compound at Cκ (e.g. undecanoic acid: activating, 10-undecenoic acid: inactive). Aromatic functional groups are not tolerated.

RESULTS

4.1.3 OR51E1-activation induces a negative chronotropic effect in human stem cell-derived cardiomyocytes

We next investigated the physiological function of the OR51E1 activated by its ligand nonanoic acid (Saito et al., 2009; Adipietro et al., 2012) on Ca2+ handling in stem cell-derived cardiomyocytes via the Ca2+ imaging method. Interestingly, short-term application (1 min) of nonanoic acid inhibits spontaneous Ca2+ transients in a dose-dependent manner. The muscarinic acetylcholine receptor agonist carbachol served as a positive control for a negative chronotropic effect (Hescheler et al., 1986; Wobus et al., 1991) (Figure 10A). Detailed statistical analyses of intracellular Ca2+ dynamics of stem-cell derived cardiomyocytes revealed that nonanoic acid significantly reduces the frequency of Ca2+ spikes and increases the time to peak, decay 50 and peak duration, whereas other parameters remain unaffected (Figure 10B). Dose-response curves showed that nonanoic acid reduces the frequency of Ca2+ spikes down to 60% compared to basal frequency in all three tested stem cell-derived cardiomyocyte types (EC50: 151 µM ±12) (Figure 10C). We next analyzed the effect of other OR51E1-agonists on iCell® cardiomyocytes. We tested decanoic, dodecanoic and tetradecanoic acid in Ca2+ imaging experiments and observed that all three fatty acids induced a negative chronotropic effect in human stem cell-derived cardiomyocytes in a dose- dependent manner (Figure 10D). Dodecanoic and tetradecanoic acid could only be tested in low concentrations, because higher concentrations were incompletely soluble. Notably, diluted OR51E1 ligands did not affect neutral pH of the applied solutions in the tested concentrations, nor did the solvent (DMSO) exhibit any effect when applied alone (Figure 10E). Compounds that were inactive on the heterologously expressed OR51E1 such as propionic or cinnamic acid did not affect the Ca2+ spike frequency of stem-cell derived cardiomyocytes (Figure 10F). Thus, the receptive field of heterologously expressed OR51E1 was in accordance with the ligand profile observed in stem cell-derived cardiomyocytes.

RESULTS

Figure 10. OR51E1-activation induces negative chronotropic effects in stem-cell derived cardiomyocytes. (A) Representative Ca2+ imaging trace of a Fura-2 loaded human-induced pluripotent stem cell-derived 2+ cardiomyocytes (hIPS-CMs). Cytosolic Ca levels were monitored as integrated f340/f380 fluorescence ratio expressed as a function of time. Horizontal bars indicate time and duration of stimulus application. In a randomly selected field of view, application of nonanoic acid inhibits spontaneous Ca2+ transients in a dose-dependent manner. Carbachol (10 µM) served as a positive control for negative chronotropy. (Representative Ca2+imaging trace kindly provided by Julia Heckmann) (B) Statistical analysis of the nonanoic acid (500 µM) effects on intracellular Ca2+ dynamics of cardiomyocytes. Relevant parameters of the Ca2+ transients during stimulus application were quantified by Spike2 software and normalized to basal. Analysis of the resulting Ca2+ transients revealed that the frequency, time to peak, decay 50 and peak duration are significantly changed during nonanoic acid stimulation. The mean baseline, amplitude, vmax peak and vmin peak remain unchanged. Means were averaged from 25-37 experiments. Error bars represent the SEM. Significance was calculated by Student's t-test or Mann-Whitney-U-test (*: p<0.05, **: p<0.01 and ***: p<0.001). (C) Nonanoic acid induced negative chronotropy is cell type-independent. Ca2+ spike frequency of iCell®-CMs, hIPS-CMs and HES2-CMs decreases dose-dependent up to ca. 60 %. The graph shows the percent change of the frequency from basal. Means were averaged from 5-37 experiments. (D) Negative chronotropic effect of iCell®-CMs to OR51E1 ligands: decanoic, dodecanoic and tetradecanoic acid. The data are shown as the means ± SEM (n>29). (E) The Ca2+ imaging trace of stem cell-derived cardiomyocytes is representative for the vehicle controls (0.1 % DMSO). Application of the solvent did not result in any changes in cytosolic Ca2+. Cytosolic Ca2+ levels were monitored as integrated 2+ f340/f380 fluorescence ratio expressed as a function of time. (F) Representative Ca imaging trace of exemplary selected odorants (500 µM) that activate heterologously expressed OR51E1 (nonanoic acid and 4- methylnonanoic acid) and odorants that are inactive (nonanal, cinnamic acid and propionic acid). The receptive field of heterologously expressed OR51E1 was in accordance with the ligand profile observed in stem cell- 2+ derived cardiomyocytes. Cytosolic Ca levels were monitored as integrated f340/f380 fluorescence ratio expressed as a function of time.

RESULTS

We confirmed by antagonist and receptor knock-down experiments that the observed effect of nonanoic acid primarily depends on OR51E1. For this purpose we used RNAi to silence endogenously expressed OR51E1 in stem cell-derived cardiomyocytes. First of all, we investigated the knock-down efficiency via immunocytochemical stainings. Cardiomyocytes were transfected with small interfering siRNA or scrambled scRNA as a negative control and a GFP-plasmid as a transfection control. Immunocytochemical analysis verified a reduction of the receptor expression level in vitro (Figure 11A). Subsequently, we performed Ca2+ imaging experiments with RNAi expressing cardiomyocytes. The nonanoic acid induced reduction in Ca2+ spike frequency effect was quantified, whereby the results of siRNA- and scRNA- expressing cells were compared to those of non-transfected control cells within the same experiment. The OR51E1-specific siRNA-knockdown resulted in a significant reduction of the nonanoic acid induced negative chronotropic effect, whereas the carbachol response remained unaffected (Figure 11B). To provide further supportive evidence for the receptor dependency of the observed nonanoic acid effect, we performed OR51E1 antagonist experiments. Co-application of antagonist 2-ethylhexanoic acid reversed nonanoic acid induced negative chronotropy, whereas the solely applied antagonist did not affect the Ca2+ spike frequency of stem-cell derived cardiomyocytes (Figure 11C). We therefore concluded that the observed negative chronotropic effect results from OR51E1 activation.

RESULTS

Figure 11. OR51E1 dependent induction of negative chronotropic effects in stem-cell derived CMs by nonanoic acid. (A) Knock-down of OR51E1 was verified by immunofluorescence staining. HES2-CMs were transfected with siRNA directed against OR51E1. As siRNA was co-transfected with a plasmid encoding for GFP, siRNA-expressing cells can be identified via GFP fluorescence. Immunostaining of HES2-CMs with anti- α-actinin (blue), anti-OR51E1 (red) antibodies and DAPI (4’,6-diamidino-2-phenylindole) staining (turquoise) was used to determine the number and location of cells. Control staining was performed without siRNA transfection (lower panel). Bar indicates 20 µm. (B) Ca2+ imaging experiments with siRNA-transfected HES2- CMs. Because the siRNA or scRNA-constructs were co-transfected with GFP-plasmid, siRNA/scRNA- expressing cells can be detected via GFP fluorescence (left panel). The middle panel shows representative Ca2+ traces of siRNA-transfected cardiomyocytes. Nonanoic acid induced negative chronotropy was abolished in OR51E1-siRNA expressing hIPS-CMs compared to scrambled OR51E1-siRNA (ctrl-siRNA) expressing cells and non-siRNA transfected cells (right panel). Carbachol (10 µM) served as control stimulus for negative chronotropy. Bars represent the mean of 12 independent transfection experiments, error bars represent the SEM. Significance was calculated by Student's t-test (*** p<0.001). Negative chronotropy induced by OR51E1 agonist results from OR51E1 activation. (Data kindly provided by Julia Heckmann) (C) Co-application of the OR51E1- antagonist 2-ethylhexanoic acid prevents nonanoic acid induced negative chronotropic effect in a Ca2+ imaging measurement of HES2-CMs. The blocking effect is reversible as nonanoic acid-induced negative chronotropy was restored after wash-out of the antagonist (left panel). Quantification of Ca2+ spike frequency of co- stimulated CMs with a constant concentration of nonanoic acid and a rising concentration of the antagonist in Ca2+ imaging experiments (right panel). The data are shown as the means ± SEM (n=14-30). Significance was calculated by Student's t-test (**: p<0.01). 75

RESULTS

4.1.4 OR51E1 signaling involves Gβγ

We next investigated the OR51E1 induced signaling mechanism in cardiomyocytes. In olfactory sensory neurons, the OR-activated signal transduction cascade involves the Gαolf subunit, adenylyl cyclase III (AC-III) and the cyclic-nucleotide gated (CNG) channel (subunits CNGA2, CNGA4 and CNGB1) (Mombaerts, 2004). RT-PCR results revealed that

Gαolf (GNAL) is expressed only in the human septum and AC-III (ADCY3) in the human ventricle, whereas olfactory CNG channel subunits were not detected at all (Figure 12A).

Protein expression of both, Gαolf and AC-III, in human heart tissue was confirmed by Western Blotting (Figure 12B). In stem cell-derived cardiomyocytes, which represent a population of ventricular, atrial, and nodal cells, we found RNA expression of three members of the canonical olfactory pathway, GNAL, ADCY3 and CNGA2, whereas olfactory CNGA4 and CNGB1 mRNA expression was not found. From comparison of expression profiles we conclude that the OR51E1-initiated signal transduction mechanism in cardiomyocytes differs from the canonical olfactory signaling pathway. We next aimed to pharmacologically characterize in vitro the nonanoic acid induced signaling that triggers the observed negative chronotropic effect. In pacemaker cells of the human heart, stimulation of the muscarinic acetylcholine receptor M2 by acetylcholine or carbachol mediates negative chronotropic and inotropic effects by coupling to a PTX-sensitive G protein

(Gi/Go), which results in the inhibition of adenylyl cyclase and thereby a decrease in cAMP level and protein kinase A phosphorylation (Rockman et al., 2002). Furthermore, the Gβγ subunit of the G protein activates G-protein regulated inward-rectifier potassium channels (GIRK), which cause a hyperpolarization of the cell membrane and move the sinoatrial node further from depolarization (Wang et al., 2013c). Thus, it takes longer for HCN channels to depolarize the cell, resulting in a reduced heart rate. Using the stem-cell derived cardiomyocyte model, we excluded that nonanoic acid activates the muscarinic receptor- induced pathway because the Gi/Go protein inhibitor pertussis toxin showed no effect on the nonanoic acid induced negative chronotropic effect in Ca2+ imaging experiments (Figure 12E). However, gallein, an inhibitor of G protein βγ subunit-dependent signaling, significantly abolished the nonanoic acid induced effect, probably also via GIRK (Figure 12C; D) (Wang et al., 2013c). This finding points towards an involvement of the G protein βγ subunit and thus confirms that a G protein-depended pathway is induced by OR51E1 in cardiomyocytes. Further Ca2+ imaging measurements under Ca2+-free conditions or with different established inhibitors for typical GPCR signaling effectors such as the adenylyl 76

RESULTS cyclase (MDL-12,330A) or phospholipase C (U-73122) affect spontaneous Ca2+ transients. Therefore, we were not able to draw any conclusion of the involvement of either AC or PLC in the OR51E1-initiated pathway (Figure 12F) (Itzhaki et al., 2011). Previous studies with the aim to investigate the pathway responsible for the intracellular Ca2+ cycling in cardiac pacemaker cells or stem cell-derived cardiomyocytes used various signal pathway inhibitors. They observed that a large number of classical inhibitors affect the Ca2+ transients as also observed in our data. The identification of the key player of the Ca2+ cycling is subject of ongoing research, indicating that Ca2+ handling depends on a network of ion channels and transporters (Choi et al, 2015; Satin et al., 2004; Lakatta et al., 2010).

Figure 12. OR51E1 signaling in CMs. (A) Detection of transcripts of OR-signaling pathway components including, Gαolf (GNAL), adenylyl cyclase III (ADCY3) and CNG channel subunits (CNGA2, CNGA4 and CNGB1) in ventricle and septum of explanted human heart and iCell®-CMs by RT-PCR. (B) Verification of Gαolf and AC-III protein expression in human heart tissue by Western Blot. (C) Representative recordings of Fura-2 loaded iCell®-CMs. Co-application of nonanoic acid (500 µM) and inhibitor gallein (10 µM). (D) Quantification of nonanoic acid induced negative chronotropic effects by pre-treating with or without gallein 77

RESULTS

(10 µM) in Ca2+ imaging experiments. The data are shown as the means ± SEM (n>40). Significance was calculated Student's t-test or Mann-Whitney-U-test (*: p<0.05, **: p<0.01 and ***: p<0.001). (E) Representative 2+ Ca imaging traces of stem cell-derived cardiomyocytes treated with the Gi protein inhibitor pertussis toxin (1 µg/ml). After pre-incubation (3 h) with pertussis toxin the carbachol (10 µM) induced reduction of Ca2+ transients is abolished whereas the reduction by nonanoic acid (500 µM) remains unaffected. (F) Representative Ca2+ imaging recording shows an example for a signaling inhibitor that affects spontaneous Ca2+ transients (adenylyl cyclase inhibitor MDL-12,330A, 20 µM).

4.1.5 OR51E1 agonists reduce contraction force of explanted heart preparations

To confirm the data from stem cell-derived cardiomyocytes, we measured the effect of OR51E1 on human cardiac tissue ex vivo. A total of 62 measurements were performed using 9 different myocardial samples, after periods of 1 - 8 days of slice cultivation. Mean developed force was 1.6 mN among all slices. Five measurements were excluded because of pronounced reactions to DMSO. Slices derived from any of the issue specimen were found suitable for the study, regardless of the etiology of heart failure and the duration of tissue culture. The investigated fatty acids showed a clear structure-activity relationship of their efficacy and kinetics of action (Figure 13A). These results are in accordance with the receptive field of heterologously expressed OR51E1. Small molecule fatty acids (C < 9) typically induced a transient fall in contractility that recovered by up to 60 % in the 4 min course of drug application. Larger molecules (C > 9) provoked a stable impairment of contractility down to 33 % of baseline force (Figure 13B; C).

RESULTS

Figure 13. Nonanoic acid induces transient negative inotropic effects in preparations of explanted human ventricles. (A) Summary of investigated odorants according to their ability to induce transient negative inotropic effects in preparations of explanted human ventricles. Application of DMSO (vehicle control) did not result in any changes of isometric contraction. Stimulation with odorants (1 mM) that activate heterologously expressed OR51E1 leads to a stable or transient (reduced after long time stimulation) change in twitch force. Low concentrations of these odorants were inactive or poorly active. Odorants that are not activating heterologously and endogenously in stem cell-derived cardiomyocytes expressed OR51E1 are also inactive in contractile force measurements. The mean from 2-4 independent preparations was calculated and normalized to contraction force developed at 0.5 Hz. (B) Nonanoic acid stimulation repetitively induced a dose-dependent decrease in contractile force of slice preparations (300 µm thickness) of adult human failing ventricle, which was reversible after washout. Twitch force was measured at 0.5 Hz electric stimulation (3 ms, 50 % above threshold). Application of nonanoic acid is indicated as blue horizontal bars. The solvent DMSO (0.1 %, grey bars) did not produce any effect on isometric contraction. (C) Dose dependency of nonanoic acid and decanoic acid induced decrease in twitch force of human ventricular slice preparations. The mean from 3 independent preparations was calculated and normalized to contraction force developed at 0.5 Hz electric stimulation. Error bars represent the SEM. (Data are produced in cooperation with Prof. Andreas Dendorfer)

RESULTS

4.1.6 OR51E1-agonists are present in human blood at receptor activating concentrations

Focusing next on potential endogenous ligands for OR51E1, we investigated the fatty acid profile in human plasma and epicardial adipose tissue. High resolution gaschromatographic analyses detected the free fatty acid (FFA) OR51E1-agonists dodecanoic acid (C12:0) and tetradecanoic acid (C14:0) in plasma of normal patients at concentrations that are able to activate recombinant OR51E1 (Table 6). We have further determined the fatty acid profile in epicardial adipose tissue, as a potential storage site for OR51E1 activating free fatty acids. We found OR51E1 agonists, particularly C12:0 and C14:0, in receptor activating quantities in epicardial adipose tissue, whereas the identified receptor antagonist was not detectable. Our findings provide the first evidence for an involvement of OR51E1 in the regulation of cardiac efficiency by circulating OR51E1-activating FFA and/or by FFA released from epicardial adipose tissue.

Table 6. Free fatty acid profile of human plasma and epicardial adipose tissue. Plasma free fatty acid concentration shown in µmol/l (n=19). Fatty acid composition of epicardial adipose tissue is expressed as percentage of all fatty acids shown (n=15). Data were presented as means±SD. Non-normally distributed data were transformed into logarithms for statistical analysis. (Data are produced in cooperation with Prof. Erwin Schleicher).

Fatty acid Plasma Epicardial adipose tissue [µmol/l] [% of total] Nonanoic acid (C9:0) 0.06±0.03 0.38±0.33 Decanoic acid (C10:0) 0.93±0.88 0.84±0.69 Undecanoic acid (C11:0) 0.20±0.15 2.22±1.85 Dodecanoic acid (C12:0) 3.60±1.76 4.16±2.46 Tridecanoic acid (C13:0) 0.53±0.35 0.15±0.09 Tetradecanoic acid (C14:0) 12.24±4.22 7.49±2.95 Pentadecanoic acid (C15:0) 1.91±0.62 1.67±2.57 Palmitic acid (C16:0) 109.47±29.93 33.61±2.97 Stearic acid (C18:0) 50.35±10.5 11.18±4.62 Oleic acid (C18:1N9) 163.69±51.79 38.30±4.49

RESULTS

4.2 Identification and functional characterization of olfactory receptors in the human eye

4.2.1 Identification of olfactory receptors in the neural retina

4.2.1.1 mRNAseq analysis of neural retina

We used mRNAseq to characterize the transcriptomes of three individual human retinae from healthy donors. In this study, we sequenced up to ~34 million reads. The data were analyzed with TopHat and Cufflinks software, and reads were mapped to the human reference genome (hg19). The quantitative expression values were calculated for each sample based on the number of fragments per kilobase of exon per million fragments mapped (FPKM). In total, we detected the expression of ~16,700 genes (FPKM ≥ 0.1) of 22,711 genes represented in the gene model. On a rough scale, FPKM ≥ 0.1 corresponds to a weak expression level, FPKM ≥ 10 represents a moderate expression level and FPKM ≥ 100 indicates a high expression level. For example, the weakly to moderately expressed TATA box binding protein (TBP) is detected at FPKM ~ 7 in the retina samples, whereas the strongly expressed glyceraldehyde-3-phosphate- dehydrogenase (GAPDH) gene reveals an expression value around FPKM 2500 (Figure 14).

Figure 14. Expression patterns of housekeeping genes in different human tissues. Shown is the housekeeping gene expression level of three retina samples, peripheral retina (pRetina) and (mRetina) and reference tissues [fRPE, brain, colon, liver, lung, skeletal muscle (S.Muscle), testis, trigeminal and dorsal root ganglia]. Exemplarily, the highly expressed genes glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-actin (ACTB) and ribosomal protein L29 (RPL29), the moderately expressed genes ribosomal protein L13A (RPL13A), β-glucuronidase (GUSB), transferrin receptor (TFRC), and the weakly expressed genes hypoxanthine phosphoribosyltransferase 1 (HPRT1) and TATA box binding protein (TBP) are demonstrated.

RESULTS

For analyses of the sample purity, we calculated the FPKM values for genes which were typically and specifically expressed in retina or retinal pigment epithelium. For example, the strongly expressed rhodopsin gene (RHO) had an expression value of FPKM ~2,900-3,800 (Figure 15B). As shown in Figure 15B common retina marker genes are exclusively expressed in our generated retina samples. In comparison, transcripts of typical retinal pigment epithelium-associated genes are relative weakly or not expressed in Retina1-3 (Figure 15C). We further tested the variability of human retinae transcriptome data sets and identified high correlations (r2=0.975-0.989) between our generated retina data (Figure 15A) and also between our data and the published data of peripheral (r2=0.855) and macular retinae (r2=0.805).

Figure 15. Comparison of mRNAseq data from retina samples and reference tissues. (A) Correlation of FPKM values between the three human retina data sets. The Pearson correlation values are indicated and a linear least squares regression is fitted. r2 is the coefficient of determination. (B) Expression of retinal marker proteins. The heatmap shows FPKM values of retina marker proteins in three whole retina samples compared peripheral retina (pRetina) and (mRetina) samples and reference tissues (fRPE, brain, colon, liver, lung, skeletal muscle, testis, trigeminal and dorsal root ganglia). (C) Expression of retinal pigment epithelium transcripts. The heatmap shows the expression of retinal pigment epithelium (RPE) marker genes in three whole retina samples compared with peripheral retina and macular retina samples, human fetal RPE (fRPE) and reference tissues (brain, colon, liver, lung, skeletal muscle, testis, trigeminal and dorsal root ganglia). Darker colors indicate high FPKM values and white indicates the absence of detectable transcripts.

RESULTS

4.2.1.2 Expression analysis of olfactory receptors

Next, we analyzed the expression of OR transcripts in human retinae compared to reference tissue samples (Figure 16). Initially, we identified 33 of 387 annotated OR genes in the three human retinae data sets (FPKM ≥ 0.1; Figure 16A). Thereby, the number of expressed OR transcripts is in the same range as in the brain, trigeminal and dorsal root ganglia (26-48 ORs), lower than in testis (55 ORs), however higher than in the other investigated reference tissues (fRPE, colon, liver, lung and skeletal muscle; 2-11 ORs). Including weakly expressed ORs (FPKM < 0.1) we detected 25 to 42 different potential OR transcripts per retina sample. The summarized FPKM values (sFPKM) of the expressed OR genes in retina (mean sFPKM value of samples retina 1-3; ~ 44 sFPKM) show that the overall OR expression levels in the retina is higher than in testis, TG and DRG (~ 23-32 sFPKM) (Figure 16B). Figure 16C demonstrates the OR expression profile sorted by the FPKM value of three whole retina samples from different donors in comparison to the available data from peripheral (pRetina) and macular (mRetina) retina (Li et al., 2014) (mFPKM values of five samples each). A significant difference of each OR transcripts pattern between peripheral and macula retina from the same donor was not observed (data not shown). The transcript properties and additional transcript information of our retina data sets are shown in detail for the most highly expressed OR genes (FPKM ≥ 0.3) in Figure 16C. In total, the expression of 14 potential OR transcripts was detectable across all analyzed retina samples, indicating a coherent donor- independent expression pattern of the highest transcripts. Further 9 OR transcripts were noticed in at least two different retina samples. Moreover, 12 of the 14 potential OR transcripts were also identified in macular retina and 9 in peripheral retina (mFPKM ≥ 0.1). The comparison of the OR expression profile of retina with the reference tissues revealed that the majority of potential OR transcripts are absent in reference tissues, excluding trigeminal and dorsal root ganglia. Around 60 % of the identified putative OR transcripts in retina were also present in the analyzed trigeminal ganglia and 48 % in dorsal root ganglia (mFPKM ≥ 0.1). A detailed analysis of the mapped reads of the mRNAseq data for the most highly expressed OR genes was performed using Integrative Genomic Viewer (IGV). OR6B3 exhibited the highest expression of all investigated ORs (mFPKM ~24). Beside retina, OR6B3 could be also detected in TG and DRG. Via the IGV, we confirmed the expression of OR6B3 and further endorsed also the expression of both 5´UTRs of OR6B3 (Flegel et al., 2015a) (Figure 16D; E). The ORFs of OR6B3 and OR6B2 are highly homolog (95 % identical nucleotides). For OR6B2, reads are maped only at positions where the sequence is nearly 83

RESULTS identical to OR6B3 and virtually not at positions that were specific for OR6B2. Therefore, the sequenced reads originate from the OR6B3 transcript and the expression of OR6B2 transcripts remains unclear. The transcript structures were analyzed by visualizing the read alignment of mRNAseq data sets using the Integrative Genomic Viewer (IGV). For OR2L13, we detected previously annotated 5’UTRs (data not shown). In addition to the coding exon, we observed the presence of non-translated upstream exons for OR2A1, OR2A7 and OR3A2. The detection of annotated 5’UTRs and the corresponding exon-spanning reads is a good proof for the presence of the OR-transcript. Furthermore, the visualization of OR1Q1 and OR2H2 revealed splicing events within their ORF, which are a typical feature of many OR-transcripts (Flegel et al., 2015b). Beside this, we identified that the whole genome region around ORF of OR10AD1, OR2H2, OR5P2 and OR5P3 is evenly coved with reads and no specific accumulation at the ORF is seen (Figure 16F). In these cases, mapped reads and calculated FPKM values might partially originate from overlapping transcripts of other non-annotated genes. Interestingly, OR5P3 and OR2M4 are according to the analyzed data exclusively present in retina and not in any of the reference tissue.

RESULTS

Figure 16. OR expression in the human retinae. (A) The bar diagram shows the number of potential OR transcripts that are expressed with a FPKM value ≥ 0.1. For pRetina, mRetina and TG, mFPKM values ≥ 0.1 were considered. (B) Each bar represents the summarized expression (sFPKM) of detected OR transcripts. (C) The heatmap shows FPKM values for the most abundant ORs compared with peripheral retina and macular 85

RESULTS

retina samples and reference tissues (fRPE, brain, colon, liver, lung, skeletal (s.) muscle, testis, TG and DRG). Darker colors indicate higher FPKM values and white indicates the absence of detectable transcripts. The ORs were sorted according to the mean FPKM ≥ 0.3 found in the Retinae 1-3 (from healthy donors 1-3). (D) Representation of read coverage of OR6B3 (Integrative Genomic Viewer). The gray segments indicate reads that were mapped onto the reference genome. The transcript is indicated by the blue bar (exon) and arrowhead shows the reading direction. Read coverage is shown above (detected and mapped counts/bases at each respective position). (E) Transcript structure of the OR6B3 identified in human retinae. Upper panel: schematic representations of the OR6B3 transcript. The gene is indicated by blue bars (exon) and thin lines (intron). The coding exon is indicated by ORF (open reading frame), splice junctions with red arcs, and arrows indicate the reading direction. Lower panel: 5’UTR-validation of OR-transcripts using RT-PCR with intron-spanning primers in the Retina3 sample. The expression of 5’UTRs of the OR transcripts were confirmed by RT-PCR with a forward primer located in the identified exon and a reverse primer located in the ORF of the respective OR. OR6B3: Exon1 (forward primer in exon 1 of 5’UTR and reverse in OR6B3 ORF); Exon2 (forward primer in exon 2 of 5’UTR and reverse primer in OR6B3 ORF).The amplified PCR products were confirmed by Sanger sequencing. (F) OR10AD1 is located within a cluster of reads. Representation of read coverage of OR10AD1 exon located in a highly expressed unidentified gene (Integrative Genomic Viewer). The gray segments indicate reads that were mapped onto the reference genome. The transcript is indicated by the blue bar (exon) and arrowhead shows the reading direction. Read coverage is shown above (detected and mapped counts/bases at each respective position).

We subsequently confirmed the presence of the putative OR transcripts in human retinae 1-3 shown in Figure 16C by RT-PCR (Figure 17).

Figure 17. RT-PCR validation of RNAseq results on OR expression. Gel electrophoresis of amplicons from Retina2 cDNA (+) and no reverse transcriptase cDNA controls (-) to exclude genomic DNA contamination. PCR results were verified by Sanger sequencing. In some cases, the primers amplified fragments that could originate from two highly homologous ORs. Then both names are written.

4.2.1.3 OR protein localization in the human retina

We studied the subcellular localization of selected ORs in situ cryosections through the mature human retina (Figures 18 - 21). The well-defined layering of the human neuronal retina makes it relatively simple to determine the spatial distribution of proteins in a retinal section even by light microscopy (Figures 18A, 18B, 19A, 20A and 21A). Indirect 86

RESULTS immunofluorescence of human retinal sections revealed expression of all four ORs (OR6B2/3, OR2W3, OR5P3, and OR10AD1) in the human retina (Figures 18C, 19B, 20B and 21B). To determine the subcellular localization, we counterstained sections with the nuclear/DNA marker DAPI and with antibodies against centrin 3, a well characterized marker of the connecting cilium, the basal body and the adjacent centriole of photoreceptor cell cilia (Trojan et al., 2008), thereby defining the photoreceptor compartments. Immunofluorescence staining with anti-OR6B2/3 revealed distinct labelling of photoreceptor inner segments, the outer plexiform layer, where the photoreceptor cell synapses contact the secondary neurons, bipolar and horizontal cells, and in ganglion cells (Figure 18B; D). Furthermore, faint staining was present in the inner plexiform layer.

Figure 18. Indirect immunofluorescence of OR6B2/3 in the human retina. (A; B) Scheme of a rod photoreceptor cell and the affiliated cells found in the retinal layers visualized in the DAPI (blue) overlay of the differential interference contrast (DIC) image of a cryosection through the human retina. (C) Indirect anti- OR6B2/3 (green) immunofluorescence, co-stained with the ciliary marker anti-centrin3 (Cen3, red) (D) reveals OR6B2/3 localization in the inner segment (IS) of photoreceptor cells situated between the connecting cilium (CC) and the nuclei of the outer nuclear layer (ONL). Additional distinct anti-OR6B2/3 immunofluorescence is present in the outer plexiform layer (OPL) and in ganglion cells (GC) of the ganglion cell layer (GCL). Faint staining is present in the inner plexiform layer (IPL). Abbreviations: Photoreceptor outer segment (OS), secondary neurons (2nd) and synaptic regions (S). Scale bar represent 20 µm. (Figure kindly provided by Prof. Uwe Wolfrum).

Indirect immunofluorescence staining of anti-OR2W3 resulted in intense immunofluorescence in a subset of photoreceptor cells (Figure 19A-G). Counter-staining with

RESULTS anti-centrin 3 demonstrated an outer segment localization of OR2W3 in these photoreceptor cells (Figure 19C; F; G). The low number, relative proximal position, and morphology of the according cells (rather thick inner segments) led us to the assumption that these cells were cone photoreceptors (Figure 19A; B; D; E). Counter-staining with FITC-labeled peanut agglutinin (FITC-PNA), a classical marker for cone photoreceptors specifically staining the extracellular sheath (Blanks & Johnson, 1984), affirmed the localization of OR2W3 in cone outer segments (Figure 19H-L).

Figure 19. Indirect immunofluorescence of OR2W3 in the human retina. (A-C) Triple staining of longitudinal section through a human retina. (A) Differential interference contrast (DIC) image, merged with DAPI staining (blue), visualizes the retinal layers. (B) Indirect immunofluorescence of anti-OR2W3 (green) (C) co-stained with the ciliary marker anti-Cen3 (red) reveals prominent localization of OR2W3 in a subset of photoreceptor cells. (D-G) Higher magnifications of the photoreceptor layer of triple stained human retina indicates staining of cone outer segments (COS) in the lower portion of the outer segment (OS) layer. (H-L) Counterstaining with the fluorescently labeled PNA (red), a molecular marker of the extracellular sheath of cones, affirmed OR2W3 (green) occurrence in cone photoreceptor outer segments. Abbreviations: Inner segment (IS), outer nuclear layer (ONL), outer plexiform layer (OPL), inner nuclear layer (INL), inner plexiform layer (IPL), ganglion cell layer (GCL) and cone inner segment (CIS). Scale bar: 25 µm (A-C), 20 µm (D; F), 5 µm (E, G) and 10 µm (H-L). (Figure kindly provided by Prof. Uwe Wolfrum).

RESULTS

We found punctate staining of anti-OR5P3 in all layers of the human retina with slight concentrations at the outer limiting membrane and the outer plexiform layer (Figure 20). In the photoreceptor layer, OR5P3 was present in the ciliary region and the inner segment of photoreceptor cells (Figure 20D-F). Higher magnification and co-staining with the ciliary marker anti-Cen3 demonstrated the association of OR5P3 with the ciliary base of photoreceptor cells (Figure 20G-I).

Figure 20. OR5P3 localization in human retina. (A-C) Triple fluorescent staining of anti-OR10AD1, anti Cen3 and DAPI of a longitudinal section of a human retina. (A) Differential interference contrast (DIC) image, merged with DAPI staining (blue), visualizes retinal layers. Anti-OR5P3 fluorescence (green) is present almost in all layers of the human retina, but more intense in the outer limiting membrane (OLM), the outer plexiform layer (OPL) and inner plexiform layer (INL). (D-I) Higher magnifications of the ciliary region (CR) of human retina. Counterstaining with the ciliary marker protein centrin3 (Cen3, red) reveals association of OR5P3 with the ciliary base. Abbreviations: Outer segment (OS), inner segment (IS), outer nuclear layer (ONL), inner nuclear layer (INL) and ganglion cell layer (GCL). Scale bar: 25 µm (A-C), 5 µm (E-G), 1 µm (G-I). (Figure kindly provided by Prof. Uwe Wolfrum).

We detected OR10AD1 in the ciliary region and at the nuclei in the outer and the inner nuclear layer as well as the ganglion cells of the human retina (Figure 21A-C). At higher 89

RESULTS magnification, co-staining with anti-Cen3 demonstrated OR10AD1 association with the base of photoreceptor cilia (Figure 21D-F). An overlay of indirect immunofluorescence of anti- OR10AD1 with the fluorescence of the nuclear DNA marker DAPI revealed the localization of OR10AD1 in the nuclear envelope of all nuclei of the human retina (Figure 21G-I). Interestingly, we observed the most intense indirect immunofluorescence of anti-OR10AD1 associated with the nuclei of the inner plexiform layer where the pericarya of the bipolar, horizontal and amacrine cells are located.

Figure 21. OR10AD1 localization in human retina. (A-C) Triple fluorescent staining of anti-OR10AD1, anti Cen3 and DAPI of a longitudinal section of a human retina. (A) Differential interference contrast (DIC) image, merged with DAPI staining (blue), visualizes retinal layers. (B) Indirect immunofluorescence of anti-OR10AD1 (green), merged with indirect immunofluorescence of anti-Cen3 in (C). (D-F) Higher magnifications of the ciliary region (CR) of the photoreceptor layer illustrate the localization of OR10AD1 at the base of photoreceptor cilia. (G-I) Higher magnification of a part of the inner nuclear layer (INL). OR10AD1 is localized in the nuclear envelope of all nuclei of the human retina. Abbreviations: Outer segment (OS), inner segment (IS), outer nuclear layer (ONL) outer plexiform layer (OPL), inner plexiform layer (IPL) and ganglion cell layer (GCL). Scale bar: 20 µm (A-C), 1 µm (D-F), 5 µm (G-I). (Figure kindly provided by Prof. Uwe Wolfrum).

RESULTS

4.2.2 Identification and functional characterization olfactory receptors in the human retinal pigment epithelial cells

4.2.2.1 Olfactory receptor OR51E2 is expressed in the human retinal pigment epithelium

To generate a more complete view on OR expression in the human eye, we studied OR expression in the retinal pigment epithelial layer, in addition to our analysis of OR expression in the neural retina as described in the previous chapters. We used mRNAseq to characterize the OR expression profile of primary RPE cells of three different healthy donors and compared them to reference tissue samples (self-generated data sets of retina and reanalyzed publicly available data set of fetal RPE and neural retina supporting tissues). Due to different sequencing settings (sequencing depth and read length) the derived FPKM values were not directly comparable. Nonetheless, according to our analyses OR51E2 is the highest expressed OR transcript in human adult RPE cells and fetal RPE as well as in neural retina supporting tissue consisting of RPE, choroid and sclera. In the human retina OR51E2 transcripts were not detectable. Via the IGV, we confirmed the gene expression of OR51E2 because of the existence of a non-translated upstream exon (Figure 22A). The detection of annotated 5’UTRs and the corresponding exon-spanning reads is a good proof for the presence of the OR- transcript (Section: 4.2.1.2) (Flegel et al., 2015a; Flegel et al., 2015b). Apart from the expression level, OR51E2 is one of the few human ORs, for which the ligands (β-ionone and androstenone derivatives) has been identified (Neuhaus et al., 2009) facilitating functional characterization of this receptor. Therefore, in this study we focused on investigating the function of OR51E2 in primary RPE cells as one example for ORs expressed in the human RPE. Firstly, we validated the results of the mRNAseq analyses using RT-PCR and could detect transcript expression of OR51E2 in primary human RPE cells (Figure 22B). To confirm the protein expression of OR51E2, immunofluorescence stainings with primary RPE cells were performed. We observed a predominant cytosolic protein localization of OR51E2 (Figure 22C), but no clear fluorescent signal was detectable at the plasma membrane. In order to deduce if OR51E2 is expressed at the plasma membrane in an amount, which may be too low for immunofluorescent detection, we analyzed surface preparations of primary RPE cells by Western Blot. Here, we detected protein localization at the plasma membrane of primary RPE cells (Figure 22D). Primary melanocytes served as positive control for the detection of OR51E2 protein (Gelis et al. 2016). Immunohistochemical analyses of histological section of 91

RESULTS human RPE, choroid and sclera further confirmed our results of OR51E2 protein expression in RPE (Figure 22E). Moreover, OR51E2 was also identified in another pigment layer of the eye: the choroid. Melan-A staining served to identify pigment cells (Figure 22E). Specificity of the OR51E2-antibody was demonstrated by co-immunocytochemical staining of Hana3A cells heterologously expressing rho-tagged OR51E2 (Figure 22F).

RESULTS

Figure 22. OR51E2 is expressed in human retinal pigment epithelial cells. (A) Representation of read coverage of OR51E2 transcripts detected in primary retinal pigment epithelial cells and visualized by the Integrative Genomic Viewer (upper panel). The gray segments indicate reads that were mapped onto the reference genome. The gene is indicated by blue bars (exon), thin line (intron) with arrowhead that shows the reading direction. Read coverage is shown above (detected and mapped counts/bases at each respective position). Summary of OR51E2 gene expression levels revealed from mRNAseq (shown as FPKM values) from RPE cells, RPE/Choroid/Sclera, fetal RPE (fRPE) and Retina1-3. (B) Detection of OR51E2 transcripts in primary RPE cells by RT-PCR. Gel electrophoresis of amplicons from primary RPE cell cDNA (+) and no reverse transcriptase cDNA controls (-) to exclude genomic DNA contamination. Premelanosome protein (PMEL) and Retinaldehyde-binding protein 1 (RLBP1) expression identifies RPE cells. Amplification of β-actin (ACTB) using intron-spanning primers served to control cDNA quality. (C) Immunofluorescence 93

RESULTS

confocal micrographs of RPE cells labelled with an OR51E2 specific antibody (green) and DAPI to visualize the nuclei (blue). An intracellular staining of OR51E2 can be observed. Bar indicates 50 µm. (D) Plasma membrane localization of OR51E2 in RPE cells verified by surface biotinylation and detection by Western Blot. A representative Western Blot of biotinylated membrane of RPE cells and melanocytes (NHEM) as positive control is shown. GAPDH served to control of enrichment of cell surface proteins. (E) Immunofluorescence confocal micrographs of a histological section of RPE, choroid (Ch) and sclera (S), co-labelled with an OR51E2- specific antibody (red) and a melanosome-specific antibody (anti-MelanA; green). Co-staining appears in yellow in the merged image. (F) Co-immunofluorescence staining of Hana3A cells transiently transfected with rho- tagged OR51E2. Detection of recombinant rho-OR51E2-protein was performed using an antibody against OR51E2 and an antibody against N-terminal rho-tag. Shown are confocal micrographs of OR51E2 staining in OR51E2 expressing Hana3A cells. Mock-transfected Hana3A cells served as negative control. Cell nuclei were stained with DAPI. Co-labelling (yellow) of OR51E2-expressing Hana3A cells indicates specificity of the custom-made used OR51E2-antibody.

4.2.2.2 OR51E2 activation in primary RPE cells

Activation of endogenous OR51E2 by the OR51E2 agonist β-ionone induces a rise in cytosolic Ca2+ in epidermal melanocytes and in prostate cancer cells (Neuhaus et al., 2009; Gelis et al., 2016). As a first step in functional characterization of OR51E2 in RPE cells, we analogously investigated the effects of short-term (2-5 min) β-ionone stimulation on the intracellular Ca2+ levels in primary RPE cells via the Ca2+ imaging method. Stimulation of Fura-2 loaded RPE cells with β-ionone also results repetitively in an increase of intracellular Ca2+ (Figure 23A), with no sensitization of the signal observed in repetitive stimulation. The β-ionone-induced cytosolic Ca2+ response was found to be dose-dependent in amplitude and cell number (Figure 23A; B). The EC50 value is 153 µM and the threshold concentration to trigger a cellular response by β-ionone was under 10 μM (Figure 23C). Notably, the solvent (0.1 % DMSO) did not exhibit any effect when applied alone (Figure 23D). We next aimed to confirm that the β-ionone-induced Ca2+ signal is dependent on activation of OR51E2. We therefore performed Ca2+ imaging experiments with the published OR51E2 antagonist α- ionone (Neuhaus et al., 2009). However, because the odorant α-ionone alone induced a intracellular Ca2+ rise in primary RPE cells, probably due to an activation of a so far unknown OR, the OR51E2 antagonist was not suitable to demonstrate the receptor dependency of the observed β-ionone response. It is worth to mention that RPE cells are more sensitive for β- ionone than for α-ionone. As shown in Figure 23D the amplitude of the Ca2+ signal evoked by 100 µM β-ionone is higher than that by 200 µM α-ionone.

RESULTS

Figure 23. OR51E2 activation induces Ca2+ signals in human RPE cells. (A) Representative Ca2+ imaging trace of a primary RPE cell. In a randomly selected field of view, β-ionone (100 μM) application induces a transient rise in intracellular Ca2+ in individual cells. ATP (100 µM) served as the positive stimulus to control 2+ cell viability. Cytosolic Ca levels were monitored as integrated f340/f380 fluorescence ratio expressed as a function of time. In prolonged stimulation the maximal signal amplitude is reached after 3 min application of β- ionone. After reaching the maximum peak, the cytosolic Ca2+ concentration decrease until the baseline level is sustained. β-ionone induces transient Ca2+ signals in primary RPE cells upon repetitive stimulation. (B) The β- ionone induced Ca2+ increase is dose-dependent. β-ionone was applied at different concentrations to ensure maximal number of responsive cells. The number of responsive cells was normalized to the number of ATP- responsive cells (positive control). Error bars represent the SEM (n=30-45 cells). (C) Dose-response curve of β- ionone induced Ca2+ signals. β-ionone was applied at different concentrations to ensure maximal signal amplitude generation. Signal amplitude at the first application was quantified by normalization to the maximal peak height evoked by ATP and is displayed as a function of the applied β-ionone concentration. The EC50 value is 153 µM. Error bars represent the SEM (n=30-45 cells). (D) The Ca2+ imaging trace is representative for the vehicle controls (0.1% DMSO). Application of the solvent did not result in any changes in cytosolic Ca2+ (upper panel). Representative Ca2+ imaging traces of RPE cells stimulated with β-ionone (100 µM) and α-ionone (200 μM). The OR51E2-specific inhibitor α-ionone induces a cytosolic Ca2+ alone. Co-application of the OR51E2-specific inhibitor α-ionone did not affect the β-ionone induced Ca2+ signals. Cytosolic Ca2+ levels are monitored as integrated f340/f380 fluorescence ratio expressed as a function of time (lower panel).

RESULTS

4.2.2.3 OR51E2 signaling in RPE cells

We next aimed to elucidate the signaling mechanism of OR51E2 in RPE cells. We used Ca2+ free Ringer’s solution to determine the origin of the agonist-evoked Ca2+ increase. The β- ionone-induced Ca2+ rise was completely absent after removal of the extracellular Ca2+, suggesting that the odorant-evoked response of RPE cells depends on extracellular Ca2+ and that the Ca2+ release from intracellular stores did not primarily contribute to the β-ionone induced Ca2+ signals (Figure 24A). Else than in prostate cancer cells (Neuhaus et al., 2009), the co-application of β-ionone with the adenylyl cyclase inhibitors SQ 22,536 (100 µM) significantly diminished β-ionone-induced Ca2+ responses in RPE cells (Figure 24A; B), indicating a major role of cAMP as a signal molecule in OR51E2 signaling in this cell type. Quantification of signal amplitudes from pooled experiments is shown in Figure 24C. As the Ca2+ imaging experiments suggested the involvement of cAMP, we examined whether β- ionone affects the intracellular cAMP level using a cAMP assay. We observed that the odorant application increases the cAMP level in a dose dependent manner up to a maximal response of 40 % relative to the response to the adenylyl cyclase activator forskolin, which served as positive control. In olfactory sensory neurons, ORs couple to Golf protein (the Gαolf subunit) resulting in activation of AC-III and thus the generation of cAMP that in turn leads to opening of CNG channel subunits CNGA2, CNGA4 and CNGB1 and thereby a Ca2+ influx (Mombaerts, 2004). According to our first results we assume that the OR51E2-initiated signal transduction mechanism in RPE cells is similar to the canonical olfactory signaling pathway.

Howerver, mRNAseq analysis revealed that AC-III (ADCY3) and Gαolf (GNAL) are expressed.

RT-PCR results verified the GNAL and ADCY3, which products Gαolf and AC-III were detected on protein level by Western Blotting in RPE cells (Figure 24F). As mRNAseq and RT-PCR analyses showed that most CNG subunits were only low or not expressed in RPE cells we excluded that OR51E2 employs the same signaling mechanism than in OSNs. In detail, the CNG channel subunits CNGA4 and CNGB1 were found at mRNA level in RPE cells, but the mRNA expression of subunit CNGA2 was again not detectable (Figure 24E). Therefore, we concluded that the OR51E2 induced signaling cascade depends on the cellular context.

RESULTS

Figure 24. OR51E2 signaling in RPE cells. (A) Representative Ca2+ imaging trace of Fura-2 loaded RPE cells. β-ionone-induced signaling depends on extracellular Ca2+. β-ionone (500 μM) applied under Ca2+free conditions (+1 mM EGTA) did not evoke Ca2+ signals. Cytosolic Ca2+ concentration is monitored as integrated fluorescence ratio as a function of time. (B) Pre-incubation with AC inhibitor SQ-22,536 (100 µM) abolished the β-ionone (500 µM) -induced Ca2+ signal in Ca2+ imaging experiments. (C) Quantification of Ca2+ signal amplitudes in Ca2+ free conditions (+1 mM EGTA) (n = 5 experiments, each with 4-9 cells) and in SQ 22,536 (100 mM) experiments (n=5, each with 5-9 cells), normalized to the RPE cell responses to control stimulations within the same experiments (β-ionone in Ca2+ containing buffer). The data are shown as the means ± SEM. Data significance was calculated using Student’s t-test referring to the β-ionone induced Ca2+ signal in control applications. (**: p<0.01). (D) β-ionone induces an intracellular increase in cytosolic cAMP in RPE cells after 15 min stimulation in a dose-dependent manner. The cAMP level was normalized to the AC activator forskolin (positiv control). Error bars represent the SEM (n=3, each with 3 cells). Significance was calculated Student's t- test (*: p<0.05, **: p<0.01 and ***: p<0.001). (E) Detection of transcripts of OR-signaling pathway components including Gαolf (GNAL), AC-III (ADCY3) and CNG channel subunits in RPE cells via mRNAseq and RT-PCR. (F) Verification of Gαolf and AC-III protein expression in RPE cells by Western Blot.

4.2.2.4 Effect of OR51E2 agonist β-ionone on proliferation and migration

OR51E2 has been shown to be involved in the regulation of cell growth, migration and invasiveness of skin melanocytes, melanoma cells and prostate cancer cells (Neuhaus et al., 2009; Sanz et al., 2014; Gelis et al., 2016). Therefore, we investigated the effect of the OR51E2 ligand β-ionone on migrative and proliferative properties of primary of RPE cells. To study cell migration in vitro a wound scratch assay was performed. Exposure of RPE cells to β-ionone (10 µM and 100 µM) for 24 h and 36 h significantly induced the acceleration of

RESULTS the regeneration rate of the RPE cell monolayer compared to control conditions (cell stimulated with solvent; 0.1 % DMSO) (Figure 25A). Beside migration, we could also observe that β-ionone promotes RPE cell proliferation. RPE cells were treated for five days in basal medium (DMEM) containing different concentrations of β-ionone, and the DNA content was determined to reveal the cell number. Long-term β-ionone stimulation increased the cell number in a significant and dose-dependent manner, even at sub-micromolar concentrations. The maximal effect on proliferation (~30% increase in cell number) was noticed after treatment with 10 μM β-ionone. This effect on the cellular proliferation rate was less pronounced at higher concentration, but still observable compared to control cells (Figure 25B). Next, we assessed the impact of β-ionone on RPE cell invasiveness. When counting cells that had migrated through the matrigel-coated filter towards a cell attractant stimulus (DMEM+5 % FBS), no significant change in the number of invasive cells was observed after 36 h treatment with β-ionone (Figure 25C). In order to determine the signaling pathway that promotes proliferation and migration in RPE cells, we analyzed the activation of protein kinases, which mediate the regulation of various cellular processes introduced by external signals (Hecquet et al., 2002; Chan et al., 2013; Qin et al., 2013; Cheng et al., 2014; Su et al., 2014; Du et al., 2015; Wang et al., 2015). Using the Proteome Profiler Human Phospho- Kinase Array Kit we investigated the phosphorylation of 43 different protein kinases in stimulated versus control cells. RPE cells were incubated for 10 min with β-ionone or solvent (0.1 % DMSO), and the phosphorylation levels of various kinases were determined. Stimulation with the odorant increased the phosphorylation of 3 kinases (ERK1/2, Extracellular-signal-regulated kinases 1/2; Akt, Protein kinase B; PRAS40, proline-rich Akt/PKB substrate 40 kDa) by at least twofold (Figure 25D). Western Blot experiments were performed to confirm these results, verifying a time-dependent phosphorylation of ERK1/2 and Akt (Figure 25E).

RESULTS

Figure 25. Activation of OR51E2 promotes proliferation and migration of RPE cells. (A) Wound scratch assay with RPE cells in the presence of 10 µM, 100 µM or 0.1 % DMSO (control). Open wound area after 12, 24 and 36 h was shown relativ to the orginal wound area at time point 0 h. 100 µM β-ionone significantly enhances cell migration compared to control conditions (0.1 % DMSO) (right and left panel). The data are shown as the means ± SEM. Data significance was calculated using Student’s t-test (*: p<0.05, **: p<0.01 and ***: p<0.001). (B) Proliferation of RPE cells after treatment with increasing concentrations (1 µM, 5 µM, 10 µM, 50 µM and 100 µM) of β-ionone for 5 days compared to control conditions. The relative cell number was determined by measurement of the DNA content. The data are shown as the mean of four independent experiments with five technical replicates and were normalized to the cell number in control experiments. Significance was calculated by Student’s t-test referring to cell number of untreated control cells. The data are shown as the means ± SEM (*: p<0.05, **: p<0.01 and ***: p<0.001). (C) Invasiveness of RPE cells through a gel coated matrix was not affected after treatment with β-ionone (100 µM) for 36 h compared to control experiments (cells treated with 0.1 % DMSO). In both cases cell invasiveness could not be observed. (D) OR51E2 agonist β-ionone induces phosphorylation of protein kinases in RPE cells. The Human Phospho-Kinase Array was plotted with proteins from the RPE cells stimulated with β-ionone (500 µM; lower panel) or control (0.1% DMSO; upper panel) for 10 min. The specific antibodies against phosphorylated protein kinases are spotted in duplicate. The colored 99

RESULTS

boxes mark areas where at least a twofold increase in the protein signal intensities between β-ionone-treated cells and solvent-treated cells (control) were observed. The pixel intensities of duplicates were averaged and β- ionone-induced phosphorylation was normalized to the control. Phosphorylation of extracellular-signal-regulated kinases 1/2 (ERK1/2), Protein kinase B (Akt) and proline-rich Akt/PKB substrate 40 kDa (PRAS40) was enhanced relative to the control (right panel; n=1). (E) Western Blot analysis verifies the phosphorylation of ERK1/2 (T202/Y204, T185/Y187) and Akt kinases (S473) in RPE cells after 10 min and 30 min stimulations with β-ionone (500 µM) or stimulation with the solvent (0.1 % DMSO; control) (n=2).

4.3 Structural characterization of OR51E2

The odorant receptor OR51E2 is current the best characterized human OR in non-olfactory tissues. Potential clinical relevance of this receptor was demonstrated in prostate cancer (Neuhaus et al., 2009; Sanz et al., 2014) as well as normal and cancerous pigment cells of the skin (Gelis et al., 2016). The results of the present thesis indicate a function of OR51E2 in controlling growth of retinal pigment cells (see chapter 4.2.2). However, the so far identified ligand β-ionone and antagonist -ionone (Neuhaus et al., 2009) both lack the potency that is required for a potential clinical application targeting OR51E2. Therefore, we aim to identify high-affinity ligands for this particular OR. Conventional GPCR ligand docking approaches using receptor homology modeling are hampered by the relatively low sequence homology of ORs and related GPCR with a solved X-ray structure. To overcome poor sequence identity it is therefore crucial to test and refine a generated OR homology model, e.g. by incorporating experimental data from activation analysis of point-mutated receptors, in order to provide a valid basis for computational ligand prediction. Prior to this work, Dr. Steffen Wolf (Department of Biophysics, RUB) created an inactive ligand free rhodopsin-based OR51E2 homology model to determine the β-ionone binding site. The putative binding site, which appeared during the docking runs, is positioned within the center of the 7TM helix bundle between helices III, IV, V, and VI as shown in Figure 26. The position is in good agreement with that of the ionone ring of retinal within rhodopsin (Okada et al., 2004). Based on these results, amino acids surrounding this site were selected for experimental point mutation analysis to verify the binding site. The experimental analysis should reveal which amino acids are necessary for ligand binding and what kind of interactions take place. The amino acids chosen for experimental analysis (Figure 26) were His104, Ser107, and Ser111 in helix III; Lys185, Asp190, and Asn194 in helix V; and Tyr251 in helix VI.

100

RESULTS

Figure 26. OR51E2 structural model with a close-up of the central binding site. Protein backbone in grey, β- ionone in its best docking posture in the inactive protein state in orange sticks, surrounding putative ligand binding residues in blue sticks. Helices numbered in roman numbers. The displayed structure is the initial inactive protein model used for ligand docking. Mutation of all displayed residues had an effect on ligand binding and protein activation (Table 7). We therefore propose this position within the protein model as the β- ionone binding site. (Figure kindly provided by Dr. Steffen Wolf).

Using overlap extension PCR point mutations were introduced into the OR51E2 ORF and the sequences were afterwards cloned into a pCI expression vector in a way that a rho-tag is fused to the N-terminus of the OR51E2 sequences. The plasmid encoding for the full-length rho4D2-tagged OR51E2-sequences (mutated and wild type) were transiently transfected into Hana3A cells and the function of the expressed receptor variants was analyzed using luciferase reporter assay. The inserted rho-tag is described to enhance cell surface expression of ORs and could be used for receptor detection by specific antibodies. To ensure that the introduced mutations do not affect the membrane localization that is required for activation, live-cell immunocytochemical stainings using an anti-rho4D2 antibody were performed. Live- cell immunocytochemical stainings demonstrated that all 12 mutant receptors were functionally expressed in Hana3A cells (Figure 27).

101

RESULTS

Figure 27. Cell-surface expression of wild type and mutant OR51E2 receptors. Heterologous expression of rhodopsin-tagged wild type (WT) and point- mutated OR51E2 in transfected Hana3A cells was detected by the anti-rhodopsin antibody 4D2 and a secondary antibody labelled with the fluorescent dye Alexa Fluor 488 (green). Mock-transfected (pCI vector) Hana3A cells served as a negative control.

In order to analyze the effect of the respective mutations on the experimentally observable receptor function, dose-response curves for the activation of each recombinant receptor mutant by β-ionone were generated (Figure 28).

102

RESULTS

Figure 28. Dose-response curves of OR51E2 variants. Responses of cells transfected either with a plasmid encoding for wild type (WT) and point-mutated OR51E2, respectively, or the empty vector (pCI) to β-ionone as measured by luciferase assay. Receptor activation was normalized to the response to forskolin (10 µM). Dose- response curves were fitted by a Hill equation. A maximum of 250 µM odorant concentration was used, because higher concentrations of β-ionone exhibited toxic effects on the cells as cells detached during odorant stimulation. Red dashed line represents the response threshold (set at 10% of total forskolin response). Error bars indicate the SEM of 4-15 replicates.

103

RESULTS

Mutant receptor activities were quantified and compared to the wild type receptor. We focused on parameters such as threshold concentration to evoke a response and the maximal receptor activation (Emax). EC50 values were not considered for this activation analysis because concentrations of β-ionone required for the exact determination of EC50 values were higher than applicable in our luciferase assays. Each analyzed putative ligand binding residue was targeted by at least one mutation that showed an impact on both threshold and Emax. Thus, we could experimentally confirm the proposed position of the ligand binding cavity in the

OR51E2 homology model. Emax gives information on the mutant receptor’s ability to adopt to the activated conformations as a result of ligand recognition, while the activation threshold is a measure of the binding affinity of the ligand to the receptor. Interestingly, we observed not only mutants with decreased thresholds/Emax, but also neutral point mutations as well as mutants with increased thresholds/Emax (“hyperactive” mutants). As control, an I255W mutation was introduced. This mutation takes place close to the proposed binding site, but the respective native side chain does not make a direct contact with the docked ligand, nor does it interfere with the neighboring helices (Figure 26). As expected, the I255W mutant exhibits a near native threshold and Emax, which further confirms the proposed protein homology model and the binding position for β-ionone.

Table 7. Effects of mutation of the residues flanking the central binding site on β-ionone binding (measured as threshold, i.e. a 10 % signaling output level of 10 µM forskolin) and subsequently maximal receptor activation (Emax) ± SEM (n=4-15). Colour coding: hyperactive mutants (Emax >110 % of WT) in yellow; unaffected mutants (threshold 170-140 µM and Emax 110-80 % of WT) in white; affected mutants (threshold 210-170 µM and Emax 80-40 % of WT) in green; inactive mutants (threshold >210 µM and Emax <40 % of WT) in blue. A decrease in Emax is coupled to an increase in threshold concentration

104

DISCUSSION

5 DISCUSSION

5.1 Identification and functional characterization of olfactory receptors in the human heart

5.1.1 Expression of OR51E1 in the human heart

A variety of ORs is expressed in diverse non-olfactory human tissues, among the brain, the lung, the kidney or the prostate (Vanderhaeghen et al., 1997; Feldmesser et al., 2006; Zhang et al., 2007; Flegel et al., 2013). However, their functional role has only been investigated in a few tissues (Spehr et al., 2003; Braun et al., 2007; Neuhaus et al., 2009; Zhang et al., 2012b; Zhao et al., 2013). OR51E1 was primarily identified in prostate and is overexpressed in prostate cancer (Weigle et al., 2004; Fuessel et al., 2006; Weng et al., 2006). Further studies demonstrated the expression of OR51E1 in various healthy and pathologically altered tissues, whereas the function still remains unknown (Cui et al., 2013; Flegel et al., 2013; Giandomenico et al., 2013). In the human heart a broad spectrum of ORs was found on RNA level, whereas the odorant receptor OR51E1 was identified as the highest expressed OR by transcriptome analysis

(Flegel et al., 2013). Our results of transcriptome analysis not only confirmed this result but additionally show that OR51E1 is the highest expressed OR in the human fetal heart. Additionally, the prenatal expression of ectopic ORs was described for rodent developing heart, suggesting a potential role during cardiac development and for avian embryo indicating an important role in cell recognition during embryogenesis (Drutel et al., 1995; Dreyer, 1998; Ferrand et al., 1999). The occurrence of OR51E1 mRNA during early stages of fetal development points towards possible functions in heart development, accordingly to the proposed role of odorant receptor OL1 in the rodent heart (Drutel et al., 1995). Here, we focused on the expression of OR51E1 in the adult human cardiac ventricles and stem cell-derived cardiomyocytes, which we used as cardiac in vitro model for the functional analysis of the odorant receptor OR51E1 on cellular and molecular level. We detected transcripts of OR51E1 by RT-PCR in human heart tissue and stem cell-derived cardiomyocytes, but not in initial stem cells. Additionally, the expression of OR51E1 could also be validated at protein level in human heart tissue using Western Blot and immunocytochemical analysis.

105

DISCUSSION

5.1.2 Activation of OR51E1 in cardiomyocytes

We observed that stimulation of cardiomyocytes with OR51E1-agonist leads to inhibition of the spontaneous Ca2+ transients. We showed that this negative chronotropic effect is dose- dependent in a micromolar-to-millimolar range. Detailed analyses revealed that regardless of which type of stem cell-derived cardiomyocytes (hESC- and hiPSC-derived) was investigated, the nonanoic acid induced effect remained unchanged. We tested whether other medium-chain fatty acids (MCFA) also reduce the frequency of Ca2+ spikes and found that the OR51E1 agonists decanoic, dodecanoic and tetradecanoic acid elicited similar effects as nonanoic acid, whereas compounds that were inactive on the heterologously expressed OR51E1 did not affect the Ca2+ spike frequency. We next aimed to investigate the OR51E1 induced signaling cascade. In olfactory receptor neurons activation of an olfactory receptor leads to an activation of adenylyl cyclase III via the Gαolf protein. AC-III in turn activate via cAMP CNG-channels (Nakamura & Gold, 1987; Jones & Reed, 1989; Bakalyar & Reed, 1990). The OR signal transduction pathway in non- olfactory tissues varies depending on the tissue. For the most non-olfactory tissues, which express ORs, the initiated pathway is still unknown but the few examples of determined pathway differ from the classical olfactory signaling cascade (Braun et al., 2007; Busse et al., 2014). Our results implicate that OR51E1 couples to a G protein βγ subunit-dependent signaling pathway. The G protein βγ subunits interact with effector molecules, such as phospholipases, adenylyl cyclase and ion channels, in a manner that leads to their activation or inhibition (Clapham & Neer, 1997). Therefore, it is not surprising that the βγ subunit is discussed as a drug target inter alia for preventing heart failure (Smrcka et al., 2008; Lin & Smrcka, 2011). OR signaling via βγ subunits was previously described in olfactory sensory neurons and was also shown for the ectopically expressed OR51E2, a paralog of OR51E1, in prostate cancer cells (Ukhanov et al., 2011; Sanz et al., 2014). The classical cardiac GPCRs such as the muscarinic acetylcholine receptor M2 and adrenergic receptors act also via the βγ subunit in the heart (Smrcka, 2008). Interestingly, bitter taste receptor agonists elicit G protein βγ-dependent negative inotropy in the murine heart (Foster et al., 2014). Thus, we suggest that OR51E1 activation leads to GIRK channel opening via Gβγ subunit. This leads to a hyperpolarization of the cell, which counteracts the HCN channel induced depolarization, resulting in a reduction of the Ca2+ spike frequency. We also found that OR51E1 agonists evoked negative inotropic effects on explanted heart preparations. The reduction of contractility of adult human myocardium stimulated with 106

DISCUSSION

MCFA was dose-dependent and occurred at a similar dose range as the negative chronotropic effect in stem cell derived cardiomyocytes, possibly indicating the involvement of a similar G-protein βγ-mediated signal transduction. It is well recognized that βγ-subunits contribute to the depression of contractility in failing myocardium by targeting the β-adrenergic receptor kinase to the membrane-bound receptors thereby mediating autologous β-receptor desensitization (Pitcher et al., 1992; Shah et al., 2001). However, it is unlikely that this mechanism would be responsible for the reduction in contractility provoked by MCFAs in our study, since these responses developed with a fast kinetics, and in the absence of exogenous β-receptor stimulation. There are alternative targets by which G-protein βγ-subunits reduce contractility of failing myocardium in a manner independently of β-receptor sensitization (Li et al., 2003). G-protein βγ-coupled receptors may activate phospholipase C-β, ERK1/2 and the PI3-kinase γ isoform (Naga Prasad et al., 2000; Kamal et al., 2011), the latter of which in particular has been identified as a negative regulator of cardiac contractility (Crackower et al., 2002). It is therefore tempting to speculate that the negative inotropic effect of the G-protein βγ-coupled OR51E1 receptor may be mediated by PI3-kinase γ activation.

5.1.3 Possible role of OR51E1 in the heart

De-orphanization studies on the recombinant OR51E1 revealed nonanoic acid, which has an unpleasant rancid odor, as activating ligand (Saito et al., 2009; Adipietro et al., 2012). In the present study, we could identify beside nonanoic acid further MCFA as specific OR51E1- activators. The specificity of recombinant OR51E1 for MCFA was provided testing a verity of structurally related substances that did not activate the receptor. OR51E1 activating MCFA consist of a 4–14 carbon chain and are mainly provided by food digestion and lipolysis in adipose tissue. In contrast to long-chain fatty acids, intakes of short- and medium-chain fatty acids were not significantly associated with the risk of coronary heart disease (Hu et al., 1999). A number of studies have described that fatty acids not only serve as energy sources but can also act as signaling molecules (Ichimura et al., 2014; Offermanns, 2014). Detailed high resolution analysis of free fatty acids in human plasma revealed the presence of OR51E1 agonists at concentrations that are able to activate recombinant OR51E1. Thus, OR51E1 is one of the few de-orpanized ORs with an odorant that is also present in the in the human body. We have further determined the fatty acid profile in epicardial adipose tissue, as a potential storage site for OR51E1 activating FFA. Recent data indicate a possible role of 107

DISCUSSION adipose tissue in modulating cardiac function (Iacobellis & Sharma, 2007). It was reported that cardiac adipocytes are able to release substances that suppress the contraction of cardiomyocytes by attenuating intracellular Ca2+ levels (Lamounier-Zepter, 2006). We found medium-chain free fatty acids, which may act as OR51E1 agonists in epicardial adipose tissue. We therefore hypothesize that apart from a dietary intake, OR51E1-activating MCFA in plasma may be released from adipocytes. Previously, the fatty profile has been determined in epicardial adipose tissue, however the MCFA content has not been reported in detail (Pezeshkian & Mahtabipour, 2013). A great number of reports showed that FFA-sensing GPCRs play important roles in mediating a variety of physiological processes such as regulation of energy metabolism mediated by the secretion of hormones and by the regulation of the sympathetic nerve systems and taste preferences. Moreover they showed a potential as therapeutic targets for various metabolic and inflammatory disorders including obesity, type 2 diabetes, atherosclerosis, cardiovascular diseases, ulcerative colitis, Crohn’s disease and irritable bowel disease (Takahashi et al., 2007; Ulven, 2012; Bindels et al., 2013; Dranse et al., 2013; Suzuki et al., 2013; Hara et al., 2014; Ichimura et al., 2014; Milligan et al., 2014). The ligand spectrum of the free fatty acid receptors (FFAR) known to date is only partially overlapping to that of OR51E1. Among FFAR family, FFAR1 (known as GPR40) and FFAR4 (known as GPR120 and O3FAR1) are classified as medium- to long-chain fatty acid- activated receptors (FFAR1: >C12; FFAR4: C14-C18) (Hirasawa et al., 2004; Briscoe et al., 2006). FFAR2 and FFAR3 (known as GPR43 and GPR41) respond to short-chain fatty acids that have less than 5 carbon atoms (Brown et al., 2003). Nonetheless, a potential role of FFAR4 in the cardioprotective effect of eicosapentaenoic acid was recently described (Eclov et al., 2015). Only the free fatty acid receptor GPR84 (C9-C14) is activated by nonanoic acid, whereby nonanoic acid displays the weakest ligand (Wang et al., 2006c). According to our transcriptome analyses and as previously described all five receptors are not or only very weakly expressed on mRNA level (FPKM values lower than 0.1) in the human heart (Hirasawa et al., 2004). Thus, OR51E1 is the highest expressed orphan MCFA-sensing receptor. Because of the fact, that OR51E1 antagonist and knock-down experiments abolished nonanoic acid-induced effect completely, we propose the observed action of MCFA on cardiomyocytes is primarily mediated by OR51E1, but the involvement of other FFARs in sensing OR51E1-activating MCFA cannot be fully excluded in an in vivo situation. Effects of MCFA on cardiac function were previously reviewed by Francois Labarthe and colleagues (Labarthe et al., 2008). The authors suggested that MCFAs not only provide a very 108

DISCUSSION efficient source of energy production, but also may positively modulate cardiac disease progression under consideration of the heart’s energy status and contractile dysfunction. In animal heart models, MCFA were reported to improve diabetic cardiomyopathy, prevent cardiac hypertrophy and recover metabolism and contractile function after transient ischemia (Madden et al., 1995; Chatham & Forder, 1997; Montessuit et al., 2000; Finck et al., 2003; Labarthe et al., 2005; Allard et al., 2007). The role of OR51E1 in MCFA-mediated benefits on cardiac function or disease progression remains elusive, but would be of interest for further studies. Moreover, polyunsaturated fatty acids (PUFAs), such as arachidonic and eicosapentaenoic acid, have been shown to affect Ca2+ handling of cardiomyocytes in vitro (Xiao et al., 1997; Mamas & Terrar, 2001; Liu, 2007). PUFAs induce negative inotropy and inhibit Ca2+ transients, which leads the consideration of PUFAs as antiarrhythmic agents. Furthermore, arachidonic acid was described to counteract the β-adrenergic receptor induced stimulation and was consequently considered to act also cardiac protective (Petit-Jacques & Hartzell, 1996; Mamas & Terrar, 2001). At present, a putative negative inotropic effect of OR51E1 in vivo might be of clinical relevance, but remains to be tested in the clinical setting. In conclusion, our data demonstrate a significant progress towards the characterization of the functional role of ORs in the human heart. We could show that activation of OR51E1 by endogenous MCFA induces negative inotropy on human explanted heart preparations and leads to negative chronotropy in stem cell-derived cardiomyocytes as well as in rodent cardiomyocytes, which could be reversed by our identified OR51E1 antagonist. OR51E1 may play a role in the regulation of cardiac efficiency. An involvement in pathophysiological processes of heart diseases can only be speculated in the absence of data from animal models or patient studies.

109

DISCUSSION

5.2 Identification and functional characterization of olfactory receptors in the human eye

5.2.1 Detection of olfactory receptors in the neural retina

Several studies have demonstrated that ORs are ectopically expressed in various human tissues (Feldmesser et al., 2006; Zhang et al., 2007; Flegel et al., 2013). This knowledge served as a basis for functional studies, which demonstrate the potential of ORs as drug targets (Neuhaus et al., 2009; Busse et al., 2014; Maßberg et al., 2015; Manteniotis et al., 2016). Here, we describe for the first time the expression of OR mRNAs and the localization of OR proteins in the mature human retina. We generated three RNAseq data sets of three individual human retinae, analyzed the transcriptomes and compared our data with reanalyzed RNAseq datasets of the peripheral and the macular human retina from the NCBI SRA archive (Li et al., 2014), as well as reference tissues. The data revealed the expression of ~33 putative OR transcripts with an mFPKM value > 0.1 in the human retina. 14 ORs were constantly expressed in all analyzed retinas and 9 in retina samples of the peripheral and macula retina. Our results indicate a conserved OR expression pattern in the human retina as already described for the olfactory epithelium, trigeminal/dorsal root ganglia (TR/DRG) and spermatozoa/testis of humans (Fuessel et al., 2006; Flegel et al., 2015a; Flegel et al., 2015b). Interestingly, OR13J1, OR1B1, OR2L13 and OR6B3 appear to be neuron-specific as they were found predominantly in neuronal tissues, namely the neuronal retina as shown in the present study, the TG/DRG and the brain (Flegel et al., 2015a). Because the expression profile of ORs in the retina was not investigated until today, it was previously assumed that OR2L13 and OR6B3 are exclusively present in the TG and DRG (Flegel et al., 2015a). According to our current findings, we can extend the OR2L13 and OR6B3 expression profile to another sensory system, the retina. The assumption that these particular receptors have a vital function apart from olfaction is supported by the fact that these ORs were only weakly expressed in the human olfactory epithelium (Keydar et al., 2013; Verbeurgt et al., 2014). Visualization of OR gene read coverage using Integrative Genomic Viewer confirmed the presence of OR6B3 in the human retina, whereby it also showed the 5´UTRs leader sequence of OR6B3 (Flegel et al., 2015a). The sequences of OR6B2 and OR6B3 are highly homologous (95%). Detailed analysis of unique mapping reads indicates that OR6B3 but not OR6B2 is expressed in the human retina, which is also supported by RT-PCR analysis.

110

DISCUSSION

The FPKM value of OR6B3 in retina is between 21 and 35, whereas the FPKM values of ORs expressed in the reference tissues are < 10. In the case of TG and retina, OR6B3 is also the highest expressed OR in terms of FPKM. To the best of our knowledge such consistantly high FPKM values have not been observed for an ectopically expressed OR so far. Immunohistochemical staining of human DRG indicated that OR6B3 (or OR6B2 respectively) is predominantly localized in the satellite glia cells (Flegel et al., 2015a). In the human eye, we did not detect OR6B3 protein in glia cells but in retinal neurons: in photoreceptor inner segments, in bipolar and horizontal cells and at the synapse between photoreceptor cells and the later 2nd neurons in the outer plexiform layer, as well as the ganglion cells. Since endogenous agonists are unknown, no reliable conclusions concerning the functional role of OR6B3 can be drawn at this point of time. Nevertheless, the atypically high expression of an OR on RNA and protein level as well as the broad localization in retina indicates a high and general relevance. A comparison between the peripheral and the macula retina showed no significant differences in the OR expression pattern, implicating that ORs are ubiquitously expressed in the human retina. However, OR2W3 is exclusively localized in cone photoreceptors and had a higher expression level in mRetina than in peripheral retina. This is consistent with the high concentration of cones in the macula retina. However, the expression is not significant higher according to the differential expression performed with the Cufflinks application Cuffdiff. This could be explained by the fact that cones are more numerous in macula than in the periphery but still a minority (< 10% of total in the anatomical macula) (Li et al., 2014). OR2W3 is a broadly expressed OR (Flegel et al., 2013; Flegel et al., 2015b). It has been detected in various human tissues such as colon, lung and testis. Nevertheless, in some cases OR2W3 was only found as a chimeric transcript with the E3 ubiquitin-protein ligase TRIM58, of which the function is unknown (Flegel et al., 2013). However, in the datasets generated from three human donor retinae in the present study, we did not observe chimeric transcripts with TRIM58. The present immunohistochemical analyses revealed the localization of OR2W3 protein in the outer segment of cone photoreceptor cells. As the olfactory cilia of olfactory neurons, the photoreceptor outer segments resemble specifically modified primary sensory cilia (Fliegauf et al., 2007) harboring all components of the signal transduction cascade of their specific modality (DeMaria & Ngai, 2010; Pugh & Lamb, 2000). Hence, as seven transmembrane proteins OR2W3 and the cone opsins are most probably localized next to each other in the photosensitive outer segment membranes of cones. It will be of particular further interest to reveal how these GPCRs, cone opsins and OR2W3, may crosstalk in their 111

DISCUSSION function in cone photoreceptor cells. An essential function of OR2W3 in the maintenance of photoreceptor cells is supported by a recent study which demonstrated that a missense mutation in OR2W3 is associated with the human inherited photoreceptor degenerative disorder retinitis pigmentosa (Ma et al., 2015). Although a subsequent commentary on this study has relativized the data obtained by whole exon sequencing (Di Zhang & Huang, 2015) the present findings on the specific localization of OR2W3 protein together with the disease relevance strengthens that OR2W3 is of importance for cone photoreceptor function in the human retina. Accordingly, OR2W3 would be an interesting target for further functional studies as well as the identification of (endogenous) agonists besides nerol (Flegel et al., 2015b), a monoterpene found in many essential oils. Further ORs were found to be ectopically expressed exclusively in the human retina, indicating a specialized function in retina. One of them, OR5P3, is localized to the base of the photoreceptor connecting cilium, which corresponds to the transition zone of prototypic cilia (Roepman & Wolfrum, 2007) controlling ciliary import and export. In periciliary region at the ciliary base the transport complexes of the intraflagellar transport (IFT) are assembled for the cargo delivery into the cilium (Sedmak & Wolfrum, 2010; Lechtreck, 2015), which is essential for photoreceptor maintenance. OR5P3 may participate at the machinery within the ciliary base. Remarkably, almost one-quarter of known photoreceptor degeneration genes are associated with ciliary structure or function (Wright et al., 2010). OR5P3 has been previously de-orphanized (Saito et al., 2009; Li & Matsunami, 2011). The activating ligands carvone and coumarin are natural substances contained in plants like caraway, dill, vanilla grass and tonka beans and are present in food, pharmaceutical and cosmetic industry (Emami & Dadashpour, 2015; Decarvalho & Dafonseca, 2006). Therefore, de-orphaned OR5P3 could be an interesting target for functional studies. In addition, we identified for the first time the presence of non-translated upstream exons for OR2A1 and OR3A2. For OR2A7, we observed previously described exon sharing with ARHGEF34P (Rho guanine nucleotide exchange factor (GEF) 34, pseudogene) (Flegel et al., 2013). Tissue-dependent alternative usage of upstream exons has already been demonstrated (Asai et al., 1996; Flegel et al., 2013). Furthermore, we observed in some cases unexpected accumulation of multiple reads around the ORF. We propose two alternative possibilities: the OR gene is located in a cluster of unknown or unannotated genes which transripts overlap with the OR gene or the OR gene is located downstream of a high expressed gene which termination was incomplete. We assume that the first option applies to OR10AD1 and the

112

DISCUSSION second to OR5P3, OR5P2 and OR2H2, which does not exclude that the transcripts are functional. Moreover, we could detect OR5P3 and OR10AD1 also on protein level. Immunohistochemical staining revealed that OR10AD1 is associated with photoreceptor cilia analog to OR5P3 and additionally localizes to the nuclear envelope of all nuclei of the human retina. Localization of GPCRs to the nuclear membrane has been shown for different cells and tissues. Few examples of class A GPCRs, which also include ORs, are the muscarinic acetylcholine receptor in the cornea, α- and β-adrenergic receptors in cardiomyocytes and the apelin receptor in the cerebellum (Cavanagh & Colley, 1989; Buu et al., 1993; Lind & Cavanagh, 1995; Lee et al., 2004; Boivin et al., 2006; Huang et al., 2007; Vaniotis et al., 2011; Tadevosyan et al., 2012). This study firstly uncovered the presence of an OR in the nuclear envelope. To date, OR presence beyond cytoplasmic membrane was only described for OR2A4 localized to cytokinetic structures of HeLa cells, OR51E2 in vesicles throughout the cytosol of skin melanocytes and for further ORs in sperm (Zhang et al., 2012; Flegel et al., 2015b; Gelis et al., 2016). Most of the ‘classical’ downstream molecules, which are associated with GPCR signaling at the plasma membrane such as the G protein, adenylyl cyclase and Ca2+ channels have also been found in the nucleus (Yamamoto et al., 1998; Zhang et al., 2001; Gobeil et al., 2002; Boivin et al., 2005; Bootman et al., 2009).

Interestingly, the alpha-subunit of the G protein (Gαolf) canonically coupled to ORs is also expressed in photoreceptor cells (Zigman et al., 1993). Gαolf is not only involved in canonical olfactory receptor signaling but also mediates dopamine D1 receptor signaling in the striatum of the cortex (Zhuang et al., 2000). Thus, OR mediated signaling pathways may crosstalk with the dopaminergic system in the retina, which regulates as a counterpart to the melatonin system the circadian rhythms in the eye. OR10AD1 was found in various tissues on mRNA level, but protein localization was not studied (Flegel et al., 2013). Therefore, we could not conclude whether OR10AD1 is in general present at nuclear envelope in many tissues or only in retina. OR10AD1 is an orphan receptor; endogenous agonists are supposed to be synthesized within the cell or internalized from the extracellular space. In conclusion, we described for the first time OR expression in the human retina. We identified OR6B3 as one of the highest ectopically expressed OR in terms of FPKM, that is also detectable on protein level. We observed that some odorant receptors are expressed in various and other in specific cell types or regions of the retina. The specific localizations within the neuronal retina in general and on the subcellular level of the photoreceptor cells implicate distinct functions of ORs outside the olfactory epithelium (similar to spermatozoa, Flegel et al. 2015b). Projections from retinal ganglion cells onto brain regions that are 113

DISCUSSION concerned with the integration of classical olfactory information have been described in several species (Levine et al., 1991; Cooper et al., 1994; Morin & Blanchard, 1999; Morin & Studholme, 2014), although their specific role remains elusive. For subsequent studies, an understanding of the functional role of ORs in the retina would be of particular interest for the basic science community interested in cell signaling and sensoric systems and may additionally offer opportunities for the development of novel therapies in the field of ophthalmology.

5.2.2 Identification and functional characterization of olfactory receptors in human retinal pigment epithelial cells

5.2.2.1 Expression of OR51E2 in the human RPE

Comparative transcriptome analyses revealed that OR51E2 is expressed in various human tissue such as prostate, colon, heart and breast. OR51E2 is not only broadly expressed, but it is also one of the highest expressed ORs at mRNA transcript level (Flegel et al., 2013). In addition, OR51E2 was also identified in epidermal melanocytes and derived melanoma cells, in which activation of OR51E2 affects cell-type specific physiological processes such as pigmentation (Gelis et al., 2016). Beside the basal layer of the epidermis, further cellular layers exist in the human body, which contain pigmented granules. These include the RPE, iris pigment epithelium and the choroid in the human eye. In the present study, we were able to elucidate the gene expression of OR51E2 in pigment cells of the eye with a focus on RPE cells. The analysis of mRNAseq data generated by Next Generation Sequencing revealed the gene expression of OR51E2 in primary RPE cells of three different donors. Moreover, OR51E2 is the highest expressed OR in the RPE cells when comparing the FPKM, whereas this receptor was not detectable in the human retina. The mRNA expression of OR51E2 was confirmed by reanalyzing online available mRNAseq datasets of fetal RPE and neural retina supporting tissue (RPE/Choroid/Sclera). Because fetal RPE showed the lowest number of detectable OR transcripts (Section: 4.2.1.2), the comparatively high expression of OR51E2 points towards a possible role in RPE development. Moreover, the prenatal expression of ectopic ORs was described in the developing rodent heart and human fetal heart, suggesting a potential role during cardiac development. A study on avian embryos indicates an important role of ORs in cell recognition during embryogenesis (via the so called “area code”) (Drutel et 114

DISCUSSION al., 1995; Dreyer, 1998; Ferrand et al., 1999). Additionally, the expression of OR51E2 in RPE cells could be validated by RT-PCR. The localization of OR51E2 protein at the plasma membrane and in the cytosol of human RPE cells was confirmed using immunocytochemical and Western Blot analyses. This finding leads to the assumption that receptor activation potentially occurs at the plasma membrane as well as at intracellular membranes. Intracellular localization of GPCRs in RPE cells was previously shown for the GPCR ocular albinism type 1 (OA1), which is predominantly localized at the membranes of melanosomes, the organelles of pigment synthesis, and late endosomes/lysosomes. At the plasma membrane, only low amounts of this receptor were detectable. OA1 functions in the regulation of melanosome biogenesis and the secretion of growth factors by transducing signals through activation of heterotrimeric G-proteins at the cytoplasmatic side of the organelle membrane (Schiaffino et al., 1999; Schiaffino & Tacchetti, 2005; Lopez et al., 2008; Giordano et al., 2011). In addition, immunohistochemical staining of retina sections including neural retina supporting tissues (RPE/Choroid/Sclera) confirmed our results of OR51E2 protein expression in the RPE and demonstrated the expression of OR51E2 in two pigment layers, the RPE and the choroid, but not in the sclera. Because we did not detect OR51E2 expression in the neural retina and sclera, we hypothesize a receptor expression specifically in the pigment cells of the human eye.

5.2.2.2 Activation of OR51E2 in RPE cells

OR51E2 is one of the few de-orphanized human ORs. The identified carotenoid-derived volatile agonist β-ionone has a characteristic violet-like smell (Neuhaus et al., 2009). The OR51E2 agonist β-ionone is a product from the oxidative cleavage of carotenoids such as beta-carotene and lycopene catalyzed by β,β-carotene-9,10-dioxygenase 2 (BCDO2). BCDO2 belongs to the carotenoid oxygenase family as well as β-carotene 15, 15'-monooxygenase

(BCDO1), which key function is the conversion of provitamin A carotenoids to vitamin A, Vitamin A is crucial for physiological functions such as vision, embryonic development and cell differentiation (Amengual et al., 2013). The expression of BCDO2 was detected in various human tissues such as cardiac and skeletal muscle cells, the intestine, the prostate and highly in the RPE. Thus, we assume that β-ionone as a cleavage product of BCDO2 enzyme, which is strongly expressed in RPE cells, could activate intracellular localized OR51E2. Moreover it is conceivable that potential OR51E2 activating products of BCDO2 reach the 115

DISCUSSION

RPE via the blood flow and may bind to OR51E2 at the plasma membrane. In addition, BCDO2 enzyme was shown to be expressed in tissues that are not sensitive to vitamin A deficiency. It was therefore suggested that BCDO2 may also be involved in physiological processes other than vitamin A synthesis, pointing towards a potential biological function of the cleaved products such as β-ionone (Lindqvist et al., 2005). The functional role of the β- ionone activated OR51E2 was previously described for prostate cancer cells, epidermal melanocytes and melanoma cells. Recent studies show that OR51E2 regulates proliferation, migration, invasiveness and pigmentation of various cell types. Therefore, OR51E2 represents an interesting therapeutic target for the development of novel therapies to treat cancer or pigmentation disorders. As described previously, the activation of OR51E2 in these cells by β-ionone leads to an increase in intracellular Ca2+ (Neuhaus et al., 2009; Gelis et al., 2016). However, this β-ionone-induced Ca2+ response differs in response kinetics compared to prostate cancer cells, epidermal melanocytes as well Hana3A cells heterologously expressing OR51E2. Hana3A cells expressing recombinant OR51E2 show a fast (time to peak: 20 ms) transient Ca2+ signal upon β-ionone stimulation, whereas application of β-ionone in skin melanocytes and prostate cancer cells caused a slow (time to peak: 5-10 min) but robust increase in intracellular Ca2+. In prostate cancer cells the Ca2+ signal sustains at maximum peak level even after the stimulus is switched off (Neuhaus et al., 2009; Gelis et al., 2016). In RPE cells the maximal amplitude was reached after an average of 3 min continuous β-ionone application, followed by a decrease in signal independently of the presence of the ligand. When reaching basal Ca2+ level (after approximately 2 min) the cells were again responsive 2+ for odorant stimulation. The EC50 value of the β-ionone-induced Ca increase in RPE cells, however, is comparable to that in epidermal melanocytes (whereas the dose-response relationship in prostate cancer cells was not described in the respective study). The different response kinetics observed in Ca2+ imaging experiments could be a result of the initiation of different signaling pathways, which seem to depend on the cellular context in which OR51E2 is expressed. Only in RPE cells, the cytosolic Ca2+ rise depends mainly on extracellular Ca2+ influx. In prostate cancer cells, OR51E2 activation leads to the opening of transient receptor potential vanilloid type 6 channel via a member of the src kinase family (Spehr et al., 2011). In melanocytes of the skin, the pharmacological investigation proved difficult due to the side effects of the tested inhibitors. However, the involvement of cAMP and TRP channels as well as a partly Ca2+increase from intracellular stores was suggested (Gelis et al., 2016). The β- ionone-induced Ca2+ rise in RPE cells is mediated by cAMP as a key messenger as shown by pharmacological investigations in Ca2+ experiments and cAMP assays. In OSNs, the OR- 116

DISCUSSION induced signal cascade also involves the activation of AC-III and the subsequent synthesis of cAMP, which in turn opens CNG channels (Nakamura & Gold, 1987; Jones & Reed, 1989; Bakalyar & Reed, 1990). The olfactory specific types of the G protein and AC-III were identified at mRNA and protein level in RPE cells, but not all of the three CNG subtypes. Instead, we identified rod and cone specific CNG channel subtypes. However, in the RPE these specific subtypes are expressed only at very low amounts according to our mRNAseq data. Moreover cAMP is a poor agonist for these CNG channels, because their key activator is cyclic guanosine monophosphate (Kaupp & Seifert, 2002). Thus, we conclude that the β- ionone-induced pathway in RPE cells uses similar components as in OSNs with the main difference being the Ca2+ channel type, which mediates the observed Ca2+ influx. We suppose that in RPE cells cAMP leads to activation of protein kinase A, which in turn opens the L- type Ca2+ (Rosenthal & Strauss, 2002) channels or activates TRP channels as shown in epidermal melanocytes and prostate cancer cells. Further pharmacological investigations with specific inhibitors against these components are necessary for a clear statement. In addition to the effect on cytosolic Ca2+ homeostasis, we describe the β-ionone-induced activation of several downstream protein kinases. In prostate cancer cells, OR51E2 activation results in an activation of protein tyrosine kinase 2 beta (Pyk2), which in turn leads to a phosphorylation of p38 mitogen-activated protein kinases (Neuhaus et al., 2009; Wiese et al., 2015). In epidermal melanocytes, stimulation with β-ionone leads to an activation of extracellular signal-regulated kinase (ERK1/2; p42/p44 MAPK) and p38 MAPK (Gelis et al., 2016). In order to elucidate the effect of β-ionone on protein kinases in RPE cells, we used the Proteome Profiler Human Phospho-Kinase Array Kit to analyze in parallel the phosphorylation of 43 different protein kinases, the results of which were confirmed by Western Blot analysis. Upon β-ionone treatment of RPE cells ERK1/2 was activate, a finding which is consistent with the result published for skin melanocytes. Additionally, we observed an increased phosphorylation of Akt and of its substrate PRAS40 (Malla et al., 2015) that in turn verifies the Akt activation. A variety of studies described the physiological effect of Akt and ERK1/2 activation in RPE cells. In both cases activation leads to promotion of migration and proliferation of RPE cells (Hecquet et al., 2002; Chan et al., 2013; Qin et al., 2013; Su et al., 2014; Du et al., 2015). Moreover, Akt activation is involved in the protection of RPE cells from oxidative stress (Cheng et al., 2014; Wang et al., 2015). Furthermore, the involvement of the second messenger Ca2+ in the regulation of RPE functions such as proliferation, secretion of the growth factor vascular endothelial growth factor (VEGF) and pigmentation

117

DISCUSSION additionally points towards a potential role of OR51E2 in mediating pigment cell growth (Smith-Thomas et al., 1998; Reichhart & Strauss, 2014).

5.2.2.3 Possible role of OR51E2 in the RPE cells

The observed affects of β-ionone on Ca2+ homeostasis and protein kinase activation is in accordance with the observation that an OR51E2-activation by β-ionone leads to an increase in proliferation and migration of primary RPE cells. Involvement of OR51E2 in the secretion process of growth factors such as pigment epithelium-derived factor (PEDF) and VEGF, as well as in the protection from oxidative stress was investigated but revealed no effect of β- ionone stimulation (data not shown). A reduced proliferation rate as a result of OR51E2 activation was observed in melanocytes, melanoma cells and prostate cancer cells (Neuhaus et al., 2009; Rodriguez et al., 2014; Sanz et al., 2014; Gelis et al., 2016) (Dissertation Lian Gelis, Department of Cellphysiology, RUB, 2009). Interestingly, OR51E2 activation in RPE cells leads to an opposite effect, namely to an increased proliferation. Different physiological outcomes of activating the same OR in different cell types were previously observed for OR2AT4. The activation of OR2AT4 by its agonist sandalore results in an enhanced proliferation of keratinocytes, whereas activation of the same receptor in chronic myelogenous leukemia cells leads to a reduced proliferation and induces apoptosis (Busse et al., 2014; Manteniotis et al., 2016). Moreover, the regulation of migration and invasiveness via OR51E2 was also described in melanoma and prostate cancer cells (Sanz et al., 2014) (Dissertation Lian Gelis, Department of Cellphysiology, RUB, 2009). The stimulation of RPE cells with the OR51E2 agonist leads to enhanced migration, whereas the invasiveness of RPE cells was unaffected. A recent study described the involvement of OR51E2 in pigmentation of melanocytes (Gelis et al., 2016). Due to the fact that we observed a cell type-specific OR51E2 expression in the investigated pigment cells of the eye, but not in retina and sclera, the analysis of the involvement of OR51E2 in cell pigmentation would be of particular interest. However, the pigmentation ability of primary RPE cells disappears during preparation and cultivation (Kernt et al., 2010). Therefore, it is impossible to analyze the role of OR51E2 in this physiological process in primary human RPE cells. Taken together, we could detect for the first time that OR51E2 is the most highly expressed OR in human adult and fetal RPE. Moreover, we identified protein expression of OR51E2 in a further pigment cell layer of the eye, the choroid. We demonstrated that the OR51E2 agonist 118

DISCUSSION

β-ionone induces an intracellular Ca2+ increase and phosphorylation of the protein kinases Act and ERK1/2. We were also able to show that adenylyl cylase and cAMP primarily mediate the Ca2+ increase as a result of OR51E2 activation. Lastly, we provided insights into the functional role of OR51E2 in RPE cell physiology, which is the regulation of proliferation and migration. Based on these findings we suggest that OR51E2 acts similar to growth factor receptors in RPE cells and induce proliferative/wound-healing responses. Therefore, we conclude that OR51E2 represents a promising therapeutic target protein for the treatment of proliferative RPE disorders such as proliferative vitreoretinopathy (Andrews et al., 1999; Pennock et al., 2014).

5.3 Structural characterization of OR51E2

OR51E2, also referred to as the prostate-specific G protein-coupled receptor, was first detected in the prostate before it was classified as an olfactory receptor by sequence homology (Xu et al., 2000; Wang et al., 2006a; Xu et al., 2006). Meanwhile, the expression of other ORs was detected in cancer tissues, for example the OR51E1 receptor in prostate cancer, small intestine neuroendocrine carcinomas and lung carcinoids or the OR1A2 receptor in liver cancer cells (Weigle et al., 2004; Fuessel et al., 2006; Wang et al., 2006a; Cui et al., 2013; Giandomenico et al., 2013; Maßberg et al., 2015). Moreover, current studies show that the presence of OR51E2 is not limited to the prostate the receptor is also expressed in various healthy human tissues (Flegel et al., 2013). Nevertheless, due to the upregulated expression of OR51E2 in prostate cancer tissue compared to the healthy prostate, the interest in this receptor as a biomarker for cancer detection has increased in recent years (Xu et al., 2000; Xia et al., 2001; Wang et al., 2006a). Neuhaus et al. (2009) not only confirmed that OR51E2 is overexpressed in prostate cancer cells, the group also showed that OR51E2 activation by the specific agonist β-ionone leads to an inhibition of tumor cell proliferation (Neuhaus et al., 2009). Prostate cancer is the 2nd most common cause of cancer, and the 6th leading cause of cancer-related death in men worldwide (Center et al., 2012). Based on the data presented in the literature OR51E2 is therefore a new promising marker for the diagnosis and may present a novel drug target for the therapy of prostate cancer. Further studies by the research group of Dr. Lian Gelis (Department of Cell physiology, RUB) identified OR51E2 in human melanocytes and melanoma cells and observed the involvement of OR51E2 in the regulation of cell proliferation, apoptosis and pigmentation. These results suggest that this OR could 119

DISCUSSION further more be an interesting target for the pharmaceutical treatment of pigmentation disorders or skin cancer. The results of present thesis show that OR51E2 is also expressed in pigment cells of RPE in the retina, mediating cellular growth. The ability to design molecular therapeutics specific for OR51E2, the prerequisites of molecular pharmacology for ORs need to be characterized. The few de-orphanized human ORs have mostly a broad ligand spectrum such as OR2W1 or OR1A1 (Firestein, 2001; Saito et al., 2009). Contrary to the seemingly unspecific ligand recognition, ORs can also exhibit remarkable ligand specificity. Previously, nonanoic acid has been identified as OR51E1 agonist and in this work we identified the structurally related odorant 2-ethylhexanoic acid as an antagonist of OR51E2. Another example for the OR-antagonistic effect of odorants was presented with α-ionone, which competitively antagonizes OR51E2 activation by β-ionone (Neuhaus et al., 2009; Saito et al., 2009). This agonist/antagonist pair acts on OR51E2 with similar or nearly identical chemical scaffolds. For deeper understanding of the underlying mechanism of ligand recognition in ORs, which is necessary to differentiate between these pharmacological subclasses, the investigation of the ligand binding site in particular ORs is essential. For ORs, it is assumed that ligand binding is primarily mediated via non-covalent bonds such as hydrogen bonds and van der Waals interactions (Lai et al., 2005; Gelis et al., 2012). Odorant recognition and binding within the OR family is mediated by highly variable amino acids residues (Buck & Axel, 1991; Firestein, 2001). Due to the interactions between ligand and receptor residues, the ligand binding induces a conformational change of the receptor protein. As a result of the activated receptor conformation, an intracellular signal transduction cascade is initiated and triggers a cellular response. Nevertheless, the particular ligand recognition properties of ORs are not completely clarified up to date. There are different theories: the ligand recognition is based on the shape of the compound (so-called “odotopes”) (Shepherd, 1994; Kraft et al., 2000; Doszczak et al., 2007; Rinaldi, 2007; Sanz et al., 2008; Block et al., 2015), molecular vibrations (Franco et al., 2011; Solov'yov et al., 2012; Gane et al., 2013) a combination of both (Brookes et al., 2012) or a combination of shape recognition and matching protein– ligand dynamics (Gelis et al., 2012), which can be assessed by dynamic homology modeling as performed in the present study. Insights into the nature of molecular interactions that are required for agonist/antagonist recognition enable the computational prediction of high- affinity agonist/antagonist for the development of OR-based drugs. For OR51E2, although a promising target, the known odorant ligand β-ionone appears not potent enough for a clinical application (EC50 value in the micro molar range) (Neuhaus et al., 2009). Ligand optimization for OR51E2 could be facilitated by using computer-based drug design. The first step is the 120

DISCUSSION generation and refinement of a homology model, which was performed in collaborative work with the research group of Dr. Steffen Wolf and Prof. Dr. Gerwert (Department of Biophysics, RUB). In order to determine the β-ionone binding site an inactive ligand free OR51E2 homology model was created based on rhodopsin. Rhodopsin was chosen as a template because it is the only class A GPCR so far with a solved X-ray structure that binds a hydrophobic ligand and because previous modeling of OR2AG1 proved rhodopsin to be an appropriate structural template for OR-Modeling (Gelis et al., 2012; Wolf & Grünewald, 2015). During the docking runs a putative binding site appeared which is positioned within the center of the 7TM helix bundle between helices III, IV, V, and VI. This is in agreement with the current opinion that hypervariable regions, which are primarily located in the transmembrane domains III-V, mediate selective odorant binding (Pilpel & Lancet, 1999; Gaillard et al., 2004; Man et al., 2004; Gelis et al., 2012). In order to experimentally verify this position and to provide data for the refinement of the OR51E2 homology model, amino acids surrounding this predicted site were selected for point mutation analysis. The putative ligand binding residues were replaced by amino acids with opposite or similar physicochemical properties to provide insights into the molecular interactions between the receptor and the ligand. The chosen amino acids were His104, Ser107, and Ser111 in helix III; Lys185, Asp190, and Asn194 in helix V; and Tyr251 in helix VI. Four point mutations (K185M, D190N, N194L, Y251F) resulted in a drastic inhibition of receptor activity. Therefore, the experimental results imply an essential role of Lysine 185, Aspartic acid 190, Asparagine 194 and Tyrosine 251 in ligand recognition by OR51E2. These residuals are located in helix V and VI. In the previous computational studies of OR51E2, a covalent bonding of the ligand β-ionone by the lysine at position 185 (Lys185) was postulated (Dissertation Steffen Wolf, Department of Biophysics, RUB, 2009), a hypothesis, which could not be addressed by theoretical approaches. The calculated distance and angle of the terminal amine group of Lys185 to the carbonyl group of β-ionone would allow the formation of a nucleophilic addition similar to retinal in rhodopsin (Nakayama & Khorana, 1991). In Rhodopsin, 11-cis-retinal forms a Schiff base linkage to lysine 296 in helix VII (Brady et al., 2005). An exchange from Lys185 to methionine prevents this bonding. The experimental data generated in this study revealed an abolished activity of the K185M mutant and the lysine to leucine mutant implicate that β- ionone is covalently linked to OR51E2 via Schiff base. However, the exchange of lysine by glutamine, which maintains polarity and hydrogen bonding capacity while preventing the 121

DISCUSSION formation of a Schiff base resulted in a partially active K185Q receptor in luciferase activity assays Therefore, the results from site-directed mutagenesis and functional analysis exclude a covalent bonding via Schiff base. A mutation retaining the charge distribution at the same position (K185R) resulted in a fully active receptor in experimental analysis and demonstrated that the targeting of position 185 itself does not affect receptor functionality but that polar interactions (possibly hydrogen bonds) to residue 185 are crucial for ligand recognition and OR51E2 activation. Moreover, results from the present study indicate a role of Asp190 in ligand binding. An exchange from a charged side chain to an uncharged or nonpolar side chain affected the receptor activity (D190N; D190L). This leads to the conclusion that the polarity is important for receptor activation, but not for the ability to form hydrogen bonds as the D190N mutant, which retains the hydrogen bonding capability, is proved to be inactive in experimental analysis. Experimental results further revealed the N194L mutant as inactive indicating that the formation of hydrogen bonds with the keto group of β-ionone is required for ligand binding. Interesting insights were revealed by the Y251F mutation. The chemical difference between tyrosine and phenylalanine is the absence of the phenolic OH-group in phenylalanine. The resulting loss of hydrogen bonding capability in the Y251F mutant supposedly accounts for the observed diminished activation properties of the mutant receptor. Thus, we conclude that the hydrogen bonding capability of the tyrosine side chain seems to be the structural determinant for ligand-induced protein activation. An interesting side issue is that in the sequence alignment used for creating the OR51E1 homology model, Tyr251 is found at the position of Trp265 in rhodopsin, which is position 6.48 according to Ballesteros-Weinstein numbering (Sealfon, 1995). This position is known as “rotameric toggle switch” in rhodopsin- like GPCRs (Shi et al., 2002), which is crucial for the outward movement of helix VI, leading to G-protein binding and activation (Rasmussen et al., 2011). The introduction of the mutations H104F and S111V affected the activatability of the receptor partially, without achieving complete inhibition. In both cases, the mutation causes the shift to a nonpolar and uncharged side chain and the loss of hydrogen bond capacity. Therefore, we suggest that His104 and Ser111 mediate ligand binding in OR51E2, possibly via hydrogen bonding. Nevertheless, these residues seem to be of a subordinate importance for ligand binding, as their substitution can be compensated by other ligand-binding residues. Another interesting result of this analysis is presented by the mutation of Ser107 to valine, which resulted in a hyperactive receptor. We therefore propose that Ser107 plays a significant 122

DISCUSSION role in receptor activation, independently of the polarity. MD simulation of the S107V mutant could reveal the molecular mechanism that accounts for the observed hyperactivation. As expected, introduction of the I255W mutation showed no effect on the ligand-induced receptor activity. This mutation presents a control as it targets close to the proposed binding site, but the respective native side chain does not make a direct contact with the docked ligand in MD simulations, nor does it interfere with the neighboring helices. In summary, the results of the present mutation analysis confirmed the position of the ligand (-ionone) binding site in OR51E2. Experimentally validated ligand binding residues that are crucial for ligand- induced receptor activation are located in transmembrane domain III, V and VI. From the results of activation analysis of point-mutated receptors, we propose that polar ligand-binding residues His104, Ser111, Lys185, Asp190, Asn194, Tyr251 form stable hydrophilic interactions with the ligand or with other polar amino acids of the ligand binding pocket, which thereby enable the optimal positioning of the ligand for ligand recognition and receptor activation. Lys185 binds the ligand -ionone not covaently via Schiff base. These constraints will be used to refine the generated OR51E2 homology model, which will then be substracted to MD simulations of the dynamics of ligand-protein interactions. This study may not only contribute to an understanding how the receptor discriminates between the stereoisomers - and -ionone, which represents the receptor’s agonist and antagonis but will provide a robust homology model for the prediction of novel ligands for OR51E2, an OR with a high diagnostic and/or therapeutic potential.

123

SUMMARY

6 SUMMARY

The superfamily of G protein-coupled receptors (GPCRs) is involved in the regulation of various physiological processes. GPCRs are activated by a broad spectrum of extracellular signals such as odorants and transmit these signals across the plasma membrane into cellular responses. About 60% of marketed drugs exert their function by targeting GPCRs. The largest group of GPCRs is the olfactory receptor (OR) gene family, which mediates olfaction in the olfactory epithelium but are additionally widely expressed in non-olfactory tissues (referred to as ectopic expression). Recently, ORs came into the focus of drug development, as ectopically expressed ORs were shown to perform regulatory tasks within human tissues. These include the chemotaxis of sperm, the proliferation of prostate cancer cells and the induction of wound- healing. However, the physiological role of ORs in most ectopic tissues remains largely unclear to date. Therefore, the central objective of the present work was the identification and functional characterization of ORs in two human tissues: the heart and eye. The first part of this thesis focuses on the functional investigation of the olfactory receptor OR51E1 in human cardiomyocytes. Initial Next Generation Sequencing (NGS) analysis revealed the OR expression pattern in the adult and fetal human heart and identified the fatty acid-sensing OR51E1 as the most highly expressed OR in both cardiac development stages. The expression of OR51E1 was validated at mRNA and protein level in the explanted ventricles and stem-cell derived cardiomyocytes. The extensive characterization of the OR51E1 ligand profile by luciferase reporter gene activation assays confirmed the described ligand nonanoic acid and identified 2-ethylhecanoic acid as a receptor antagonist, and various structurally related fatty acids as novel OR51E1 ligands, some of which were detected at receptor activating concentrations in plasma and epicardial. Functional characterization of the endogenous receptor was carried out by Ca2+ imaging of human stem-cell derived cardiomyocytes, as a representative human heart model system. Application of OR51E1 activating compounds induced negative chronotropic effects that depended on activation of the olfactory receptor. OR51E1 signaling was shown to involve Gβγ, which supposedly also mediate the observed a negative inotropic action of OR51E1-agonists in cardiac trabeculae and slice preparations of human explanted ventricles. Thus, the results of this study implicate OR51E1 as a potential regulator of cardiac function in humans. Antagonists of OR51E1 may offer a novel therapeutic opportunity for the treatment of heart failure in the future. The second project of this thesis investiated the the OR expression profile in the human eye. NGS 124

SUMMARY transcriptome analyses detected 33 OR transcripts in the neural retina, of which OR6B3 is one of the most highly expressed ORs in terms of FPKM. Immunohistochemical stainings of retina sections localized OR2W3 to the photosensitive outer segment membranes of cones. OR6B3 was found in photoreceptor inner segments, bipolar and horizontal cells and the synapses between photoreceptor cells and later 2nd neurons in the outer plexiform layer, as well as in ganglion cells. OR5P3 and OR10AD1 were detected at the base of the photoreceptor connecting cilium, and OR10AD1 additionally localized to the nuclear envelope of all nuclei of the human retina. This cell type-specific expression of ORs in the retina indicates unique biological functions of the receptors. The OR51E2 receptor, which is well characterized in prostate cancer cells and epidermal pigment cells, was identified as the most highly expressed OR in human fetal and adult retinal pigment epithelial (RPE) cells when comparing FPKM values. Immunofluorescence staining and Western Blot analyses revealed OR51E2 subcellular protein localization throughout the cytosol and at the plasma membrane. membrane of RPE cells. Additionally, immunohistological analysis showed the expression of OR51E2 in pigment cells not only of the RPE but also of the choroid. Results of Ca2+ experiments suggest a potential role of OR51E2 in controlling Ca2+ homeostasis of RPE cells. Downstream signaling of OR51E2 involves the activation of extracellular-signal- regulated kinases 1/2 (ERK1/2) and protein kinase B (Akt) as shown by phosphokinase assays.The activation of extracellular-signal-regulated kinases 1/2 and protein kinase B these protein kinases likely accounts for the demonstrated promotion of migration and proliferation of RPE cells upon stimulation with the OR51E2 ligand -ionone. Taken together, these findings suggest an involvement of OR51E2 in RPE development and the regulation of cell growth. The outcome to this second substudy underlines the potential of OR51E2 for clinical application, which would require the identification of high-affinity receptor agonists and antagonists. To provide a validated basis for computer-based drug design, the aim of this third project was the structural characterization of the OR51E2 ligand binding site via mutation and activation analysis. These insights serve as constraints in dynamic OR51E2 homology modeling in order to refine the receptor model. Importantly, the experimental results excluded a covalent ligand binding mode that was initially assumed. The analyses of dose-response relationships of site-directed receptor mutants identified six amino acid residues in transmembrane helices III, V and VI as structural determinants for odotope recognition. From our results we conclude that polar ligand-binding residues His104, Ser111, Lys185, Asp190, Asn194 and Tyr251 form stable hydrophilic interactions such as hydrogen bonds with the 125

SUMMARY ligand and/or other residues of the ligand binding site. Thus, a ligand-induced rearrangement of such a protein-internal hydrogen bond network likely results in the activated conformation of the receptor. Molecular dynamics simulations of the refined OR51E2 homology model will allow for the characterization of an OR51E2-specific mode of protein / ligand action. This will be incorporated into an OR51E2-based drug design scheme for the optimization of activating/inhibition ligand properties. In a nutshell, the present study provides the basis for the prediction of novel compounds targeting OR51E2, an OR with a high diagnostic and/or therapeutic potential.

126

ZUSAMMENFASSUNG

7 ZUSAMMENFASSUNG

Die Superfamilie der G protein-gekoppelten Rezeptoren (G protein coupled receptors, GPCRs) ist in die Regulation zahlreicher physiologischer Prozesse involviert. GPCRs werden durch ein breites Spektrum externer Signale (beispielsweise Duftstoffe) aktiviert und übersetzen diese in intrazelluläre Antworten. Etwa 40% aller auf dem Markt verfügbaren Medikamente entfalten ihre Wirkung über GPCRs. Die größte GPCR Gruppe bildet die Genfamilie der Riechrezeptoren (olfactory receptors, ORs). ORs vermitteln die Wahrnehmung von Düften in der Nase, kommen aber auch in nicht-olfaktorischen Geweben vor (sog. ektopische Expression). Ektopisch exprimierte ORs erlangen zunehmend Relevanz für die Medikamentenforschung, da aktuelle Studien auf eine regulatorische Rolle in diversen Geweben hinweisen. Diese umfassen die Chemotaxis von Spermien, die Proliferation von Prostatakarzinomzellen und die Induktion von Wundheilungsprozessen. Allerdings ist die physiologische Funktion der meisten ektposich exprimierten ORs bis heute unklar. Daher war das Ziel der vorliegenden Arbeit die Identifizierung und funktionale Charakterisierung von Riechrezeptoren in zwei humanen Geweben, im Herzen und im Auge. Der erste Teil dieser Dissertationsschrift beschreibt die funktionale Analyse des Riechrezeptors OR51E1 in humanen Kardiomyozyten. Initiale Next Generation Sequencing (NGS) Untersuchungen des OR Expressionsmusters im adulten und fetalen Herzen identifizierten den Fettsäure-Rezeptor OR51E1 als den am Höchsten exprimierten ORs in beiden kardialen Entwicklungsstadien. Die Expression von OR51E1 konnte sowohl auf mRNA als auch auf Proteinebene in explantierten Ventrikeln und in von Stammzellen abgeleiteten Kardiomyozyten nachgewiesen werden. Eine umfassende Charakterisierung des Ligandenspektrums von OR51E1 anhand von Luciferase Reporter Assays bestätigte den bereits beschriebenen Agonisten Nonansäure und identifizierte 2-Ethylhexansäure als Antagonisten für den Rezeptor, sowie zahlreiche Strukturverwandte Fettsäuren als neue OR51E1 Liganden. Das Vorkommen einiger OR51E1 aktivierenden Fettsäuren konnte in Plasma und epikardialen Fettdepots gezeigt werden. Die funktionale Charakterisierung des endogenen Rezeptors erfolgte durch Ca2+ Imaging Analysen von aus Stammzellen abgeleiteten Kardiomyozyten, die als repräsentatives humanes Herz-Modellsystem dienten. Die Applikation von OR51E1 aktivierenden Substanzen erzeugte Rezeptorabhängig negativ chronotrope Effekte in Kardiomyozyten. Pharmakologische Untersuchungen des durch OR51E1 induzierten Signaltransduktionmechanismus deuten auf 127

ZUSAMMENFASSUNG

eine Beteiligung von Gβγ hin, wodurch unter anderem die beobachtete negativ inotrope Wirkung von OR51E1-Agonisten auf Herztrabekel und Schnittpräparate aus explantierten Ventriklen vermitteln könnte. Zusammenfassend implizieren die vorliegenden Ergebnisse, dass OR51E1 an der Regulation der Herzfunktion beteiligt ist. Folglich bieten OR51E1 Antagonisten möglicherweise neue therapeutische Ansätze für die Behandlung von Herzversagen. Das zweite Teilprojekt der vorliegenden Arbeit behandelt die Expression von Riechrezeptoren im humanen Auge. Anhand von NGS Analysen gelang der Nachweis von 33 OR Transkripten in der neuralen Retina, wobei OR6B3 in den Retinae dreier Spender jeweils den höchsten FPKM Wert aufwies. Immunohistochemische Färbungen von Retinaschnitten zeigten die Lokalisation von OR2W3 in den photosensitiven Außenmembranen der Zapfen. OR6B3 konnte in Bipolarzellen und Horizontalzellen und den Synapsen zwischen Photorezeptorzellen und den Neuronen zweiten Grades der äußeren plexiformen Schicht, sowie in Ganglienzellen detektiert werden. OR5P3 und OR10AD1 wurden an der Basis der Verbindungszilien der Photorezeptoren nachgewiesen, und OR10AD1 außerdem in der Kernhülle aller Nuclei der humanen Retina. Dieses Zelltyp-spezifische OR Expressionsmuster deutet auf individuelle Funktionen von Riechrezeptoren in der Retina hin. In fetalen wie auch adulten retinalen Pigmentepithelzellen (RPE) wiesen vorgenommene NGS Analysen den OR51E2 Rezeptor, dessen physiologische Bedeutung in Prostatakarzinomzellen und epidermalen Pigmentzellen bereits beschrieben wurde, als den am Höchsten exprimierten OR aus. Immunfluoreszenz Färbungen detektierten die Expression von OR51E2 nicht nur in Pigmentzellen des RPE, sondern auch des Choroids. In primären RPE Zellen konnte der Rezeptor durch Western Blot Analysen in Membranpräparationen nachgewiesen werden, was auf eine Lokalisation an der Zelloberfläche schließen lässt. Die Ergebnisse von Ca2+ Experimenten deuten auf eine potentielle Funktion von OR51E2 in der Regulation der Homeostase von RPE Zellen hin. Wie anhand von Phosphokinase Arrays gezeigt werden konnte, umfasst der durch OR51E2 initiierte Signalweg die Aktivierung der extracellular-signal-regulated kinases 1/2 (ERK1/2) und der Proteinkinase B. Diese Proteinkinasen vermitteln wahrscheinlich die beobachtete Steigerung der Migration und Proliferation von RPE Zellen als Folge der Stimulation durch den OR51E2 Liganden -ionone. Diese Ergebnisse deuten auf eine Beteiligung von OR51E2 bei der Entwicklung des RPE und der Regulation des Zellwachstums von RPE Zellen hin. Die Erkenntnisse aus dem zweiten Teilprojekt unterstreichen das Potential von OR51E2 für die klinische Anwendung, welche zunächst die Identifizierung von hoch-affinen Rezeptor Agonisten und Antagonisten erfordern würde. Um eine valide Grundlage für Computer- 128

ZUSAMMENFASSUNG basiertes Medikamenten Design zu schaffen, war das Ziel des dritten Teilprojekts der vorliegenden Arbeit die strukturelle Analyse der Liganden-Bindetasche von OR51E2. Die Ergebnisse aus Mutations- und Aktivierungsstudien sollen zur Optimierung des OR51E2 Homologiemodells als Eckpunkte in die Modellierung einfließen. Interessanterweise schließen die experimentellen Daten eine kovalente Ligandeneinbindung, wie sie ursprünglich angenommen wurde, aus. Analysen der Dosis-Wirkungsbeziehungen von punktmutierten Rezeptor Varianten ermöglichten die Identifizierung von sechs Aminosäuren in den Transmembranhelices III, V und VI als strukturelle Determinanten für die Erkennung des Odotopes. Die Ergebnisse lassen den Schluss zu, dass die polaren Residuen His104, Ser111, Lys185, Asp190, Asn194 und Tyr251 stabile hydrophile Wechselwirkungen wie Wasserstoffbrückenbindungen mit dem Liganden und/oder weiteren Residuen der Ligandenbindetasche eingehen. Mutmaßlich resultiert die Liganden-induzierte Neuanordnung eines solchen Protein-internen Netzwerkes aus Wasserstoffbrücken in der aktivierten Rezeptorskonformation. Moleküldynamik Simulationen des optimierten OR51E2 Homologiemodells sollen detaillierten Aufschluss über die OR51E2-spezifischen Wechselwirkungen von Protein und Ligand geben und Struktur-basiertes Wirkstoff Design für die Verbesserung von OR51E2 aktivierenden/inhibierenden Substanzeigenschaften ermöglichen. Zusammenfassend bilden die vorliegenden Ergebnisse der experimentellen Arbeiten die Grundlage für die Computer-gestützte Vorhersage von Liganden für den klinisch relevanten Riechrezeptor OR51E2.

129

REFERENCES

8 REFERENCES

Accili, EA, Proenza, C, Baruscotti, M, DiFrancesco, D. 2002. From funny current to HCN channels: 20 years of excitation. News in physiological sciences : an international journal of physiology produced jointly by the International Union of Physiological Sciences and the American Physiological Society 17: 32–37.

Adipietro, KA, Mainland, JD, Matsunami, H. 2012. Functional evolution of mammalian odorant receptors. PLoS genetics 8: e1002821.

Aggarwal, P, Turner, A, Matter, A, Kattman, SJ, Stoddard, A, Lorier, R, Swanson, BJ, Arnett, DK, Broeckel, U, Hosoda, T. 2014. RNA Expression Profiling of Human iPSC-Derived Cardiomyocytes in a Cardiac Hypertrophy Model. PloS one 9: e108051.

Alioto, TS, Ngai, J. 2005. The odorant receptor repertoire of teleost fish. BMC genomics 6: 173.

Allard, MF, Parsons, HL, Saeedi, R, Wambolt, RB, Brownsey, R. 2007. AMPK and metabolic adaptation by the heart to pressure overload. American Journal of Physiology - Heart and Circulatory Physiology 292: H140–H148.

Amengual, J, Widjaja-Adhi, MAK, Rodriguez-Santiago, S, Hessel, S, Golczak, M, Palczewski, K, Lintig, J von. 2013. Two carotenoid oxygenases contribute to mammalian provitamin A metabolism. The Journal of biological chemistry 288: 34081–34096.

Amoore, JE. 1967. Specific anosmia: a clue to the olfactory code. Nature 214: 1095–1098.

Amoore, JE, Venstrom, D, Davis, AR. 1968. Measurement of specific anosmia. Perceptual and motor skills 26: 143–164.

Anderson, RH, Yanni, J, Boyett, MR, Chandler, NJ, Dobrzynski, H. 2009. The anatomy of the cardiac conduction system. Clinical anatomy (New York, N.Y.) 22: 99–113.

Andrews, A, Balciunaite, E, Leong, FL, Tallquist, M, Soriano, P, Refojo, M, Kazlauskas, A. 1999. Platelet-derived growth factor plays a key role in proliferative vitreoretinopathy. Investigative ophthalmology & visual science 40: 2683–2689.

Anselmi, C, Buonocore, A, Centini, M, Facino, RM, Hatt, H. 2011. The human olfactory receptor 17-40: requisites for fitting into the binding pocket. Computational biology and chemistry 35: 159–168.

Ansoleaga, B, Garcia-Esparcia, P, Llorens, F, Moreno, J, Aso, E, Ferrer, I. 2013. Dysregulation of brain olfactory and taste receptors in AD, PSP and CJD, and AD-related model. Neuroscience 248: 369–382.

Araneda, RC, Kini, AD, Firestein, S. 2000. The molecular receptive range of an odorant receptor. Nature neuroscience 3: 1248–1255.

130

REFERENCES

Asai, H, Kasai, H, Matsuda, Y, Yamazaki, N, Nagawa, F, Sakano, H, Tsuboi, A. 1996. Genomic structure and transcription of a murine odorant receptor gene: differential initiation of transcription in the olfactory and testicular cells. Biochemical and biophysical research communications 221: 240–247.

Asano, K, Bohlmeyer, TJ, Westcott, JY, Zisman, L, Kinugawa, K, Good, M, Minobe, WA, Roden, R, Wolfel, EE, Lindenfeld, J, David Port, J, Perryman, MB, Clevel, J, Lowes, BD, Bristow, MR. 2002. Altered expression of endothelin receptors in failing human left ventricles. Journal of molecular and cellular cardiology 34: 833–846.

Bakalyar, HA, Reed, RR. 1990. Identification of a specialized adenylyl cyclase that may mediate odorant detection. Science (New York, N 250: 1403–1406.

Balakirev, ES, Ayala, FJ. 2003. Pseudogenes: are they "junk" or functional DNA? Annual review of genetics 37: 123–151.

Benarroch, EE. 2013. HCN channels: function and clinical implications. Neurology 80: 304– 310.

Bentley, DR, Balasubramanian, S, Swerdlow, HP, Smith, GP, Milton, J, Brown, CG, Hall, KP, Evers, DJ, Barnes, CL, Bignell, HR, Boutell et al. 2008. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 456: 53–59.

Bers, DM. 2002. Cardiac excitation-contraction coupling. Nature 415: 198–205.

Bindels, LB, Dewulf, EM, Delzenne, NM. 2013. GPR43/FFA2: physiopathological relevance and therapeutic prospects. Trends in Pharmacological Sciences 34: 226–232.

Birnboim, HC, Doly, J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic acids research 7: 1513–1523.

Blanks, JC, Johnson, LV. 1984. Specific binding of peanut lectin to a class of retinal photoreceptor cells. A species comparison. Investigative ophthalmology & visual science 25: 546–557.

Block, E, Jang, S, Matsunami, H, Sekharan, S, Dethier, B, Ertem, MZ, Gundala, S, Pan, Y, Li, S, Li, Z, Lodge, SN, Ozbil, M, Jiang, H, Penalba, SF, Batista, VS, Zhuang, H. 2015. Implausibility of the vibrational theory of olfaction. Proceedings of the National Academy of Sciences of the United States of America 112: E2766-74.

Boivin, B, Lavoie, C, Vaniotis, G, Baragli, A, Villeneuve, L, Ethier, N, Trieu, P, Allen, BG, Hebert, TE. 2006. Functional beta-adrenergic receptor signalling on nuclear membranes in adult rat and mouse ventricular cardiomyocytes. Cardiovascular research 71: 69–78.

Boivin, B, Villeneuve, LR, Farhat, N, Chevalier, D, Allen, BG. 2005. Sub-cellular distribution of endothelin signaling pathway components in ventricular myocytes and heart: lack of preformed caveolar signalosomes. Journal of molecular and cellular cardiology 38: 665–676.

131

REFERENCES

Bootman, MD, Fearnley, C, Smyrnias, I, MacDonald, F, Roderick, HL. 2009. An update on nuclear calcium signalling. Journal of cell science 122: 2337–2350.

Brady, S, Siegel, G, Albers, RW, Price, D. 2005. Basic Neurochemistry: Molecular, Cellular and Medical Aspects: Elsevier Science.

Brandenburger, M, Wenzel, J, Bogdan, R, Richardt, D, Nguemo, F, Reppel, M, Hescheler, J, Terlau, H, Dendorfer, A. 2011. Organotypic slice culture from human adult ventricular myocardium. Cardiovascular Research 93: 50–59.

Braun, T, Voland, P, Kunz, L, Prinz, C, Gratzl, M. 2007. Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology 132: 1890–1901.

Briscoe, CP, Peat, AJ, McKeown, SC, Corbett, DF, Goetz, AS, Littleton, TR, McCoy, DC, Kenakin, TP, Andrews, JL, Ammala, C, Fornwald, JA, Ignar, DM, Jenkinson, S. 2006. Pharmacological regulation of insulin secretion in MIN6 cells through the fatty acid receptor GPR40: identification of agonist and antagonist small molecules. British Journal of Pharmacology 148: 619–628.

Bristow, MR, Ginsburg, R, Minobe, W, Cubicciotti, RS, Sageman, WS, Lurie, K, Billingham, ME, Harrison, DC, Stinson, EB. 1982. Decreased catecholamine sensitivity and beta- adrenergic-receptor density in failing human hearts. The New England journal of medicine 307: 205–211.

Bristow, MR, Ginsburg, R, Umans, V, Fowler, M, Minobe, W, Rasmussen, R, Zera, P, Menlove, R, Shah, P, Jamieson, S. 1986. Beta 1- and beta 2-adrenergic-receptor subpopulations in nonfailing and failing human ventricular myocardium: coupling of both receptor subtypes to muscle contraction and selective beta 1-receptor down-regulation in heart failure. Circulation Research 59: 297–309.

Brookes, JC, Horsfield, AP, Stoneham, AM. 2012. The swipe card model of odorant recognition. Sensors (Basel, Switzerland) 12: 15709–15749.

Brown, AJ, Goldsworthy, SM, Barnes, AA, Eilert, MM, Tcheang, L, Daniels, D, Muir, AI, Wigglesworth, MJ, Kinghorn, I, Fraser, NJ, Pike, NB, Strum, JC, Steplewski, KM, Murdock, PR, Holder, JC, Marshall, FH, Szekeres, PG, Wilson, S, Ignar, DM, Foord, SM, Wise, A, Dowell, SJ. 2003. The Orphan G Protein-coupled Receptors GPR41 and GPR43 Are Activated by Propionate and Other Short Chain Carboxylic Acids. Journal of Biological Chemistry 278: 11312–11319.

Brunet, LJ, Gold, GH, Ngai, J. 1996. General anosmia caused by a targeted disruption of the mouse olfactory cyclic nucleotide-gated cation channel. Neuron 17: 681–693.

Buck, L, Axel, R. 1991. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65: 175–187.

Burrell, KM, Molenaar, P, Dawson, PJ, Kaumann, AJ. 2000. Contractile and arrhythmic effects of endothelin receptor agonists in human heart in vitro: blockade with SB 209670. The Journal of pharmacology and experimental therapeutics 292: 449–459.

132

REFERENCES

Bushdid, C, Magnasco, MO, Vosshall, LB, Keller, A. 2014. Humans can discriminate more than 1 trillion olfactory stimuli. Science (New York, N.Y.) 343: 1370–1372.

Busse, D, Kudella, P, Grüning, N, Gisselmann, G, Ständer, S, Luger, T, Jacobsen, F, Steinsträßer, L, Paus, R, Gkogkolou, P, Böhm, M, Hatt, H, Benecke, H. 2014. A synthetic sandalwood odorant induces wound-healing processes in human keratinocytes via the olfactory receptor OR2AT4. The Journal of investigative dermatology 134: 2823–2832.

Buu, NT, Hui, R, Falardeau, P. 1993. Norepinephrine in neonatal rat ventricular myocytes: association with the cell nucleus and binding to nuclear alpha 1- and beta-adrenergic receptors. Journal of molecular and cellular cardiology 25: 1037–1046.

Bylund, DB, Eikenberg, DC, Hieble, JP, Langer, SZ, Lefkowitz, RJ, Minneman, KP, Molinoff, PB, Ruffolo, RR, JR, Trendelenburg, U. 1994. International Union of Pharmacology nomenclature of adrenoceptors. Pharmacological reviews 46: 121–136.

Cavanagh, HD, Colley, AM. 1989. The molecular basis of neurotrophic keratitis. Acta ophthalmologica 192: 115–134.

Center, MM, Jemal, A, Lortet-Tieulent, J, Ward, E, Ferlay, J, Brawley, O, Bray, F. 2012. International variation in prostate cancer incidence and mortality rates. European urology 61: 1079–1092.

Chan, C, Chang, H, Wang, V, Huang, C, Hung, C. 2013. Inhibitory effects of resveratrol on PDGF-BB-induced retinal pigment epithelial cell migration via PDGFRβ, PI3K/Akt and MAPK pathways. PloS one 8: e56819.

Chatham, JC, Forder, JR. 1997. Relationship between cardiac function and substrate oxidation in hearts of diabetic rats. The American journal of physiology 273: H52-8.

Cheng, L, Cheng, L, Bi, H, Zhang, Z, Yao, J, Zhou, X, Jiang, Q. 2014. Alpha-melanocyte stimulating hormone protects retinal pigment epithelium cells from oxidative stress through activation of melanocortin 1 receptor-Akt-mTOR signaling. Biochemical and biophysical research communications 443: 447–452.

Cherezov, V, Rosenbaum, DM, Hanson, MA, Rasmussen, SGF, Thian, FS, Kobilka, TS, Choi, H, Kuhn, P, Weis, WI, Kobilka, BK, Stevens, RC. 2007. High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor. Science (New York, N.Y.) 318: 1258–1265.

Chien, EYT, Liu, W, Zhao, Q, Katritch, V, Han, GW, Hanson, MA, Shi, L, Newman, AH, Javitch, JA, Cherezov, V, Stevens, RC. 2010. Structure of the human dopamine D3 receptor in complex with a D2/D3 selective antagonist. Science (New York, N.Y.) 330: 1091–1095.

Choi, SW, Lee, H, Moon, S, Park, S, Kim, HJ, Kim, K, Zhang, YH, Youm, JB, Kim, SJ. 2015. Spontaneous inward currents reflecting oscillatory activation of Na+/Ca2+ exchangers in human embryonic stem cell-derived cardiomyocytes. Pflügers Archiv - European Journal of Physiology: 1–14.

133

REFERENCES

Clapham, DE, Neer, EJ. 1997. G PROTEIN βγ SUBUNITS. Annual Review of Pharmacology and Toxicology 37: 167–203.

Cooper, HM, Parvopassu, F, Herbin, M, Magnin, M. 1994. Neuroanatomical pathways linking vision and olfaction in mammals. Psychoneuroendocrinology 19: 623–639.

Crackower, MA, Oudit, GY, Kozieradzki, I, Sarao, R, Sun, H, Sasaki, T, Hirsch, E, Suzuki, A, Shioi, T, Irie-Sasaki, J, Sah, R, Cheng, HM, Rybin, VO, Lembo, G, Fratta, L, Oliveira- dos-Santos, AJ, Benovic, JL, Kahn, CR, Izumo, S, Steinberg, SF, Wymann, MP, Backx, PH, Penninger, JM. 2002. Regulation of myocardial contractility and cell size by distinct PI3K-PTEN signaling pathways. Cell 110: 737–749.

Cui, T, Tsolakis, AV, Li, S, Cunningham, JL, Lind, T, Öberg, K, Giandomenico, V. 2013. Olfactory receptor 51E1 protein as a potential novel tissue biomarker for small intestine neuroendocrine carcinomas. European journal of endocrinology / European Federation of Endocrine Societies 168: 253–261.

Decarvalho, C, Dafonseca, M. 2006. Carvone: Why and how should one bother to produce this terpene. Food Chemistry 95: 413–422.

DeMaria, S, Ngai, J. 2010. The cell biology of smell. The Journal of cell biology 191: 443– 452.

Di Zhang, Huang, X. 2015. Further Consideration of the Association Between OR2W3 Mutation and Retinitis Pigmentosa. Investigative ophthalmology & visual science 56: 8028.

Ding, J, Johnson, LV, Herrmann, R, Farsiu, S, Smith, SG, Groelle, M, Mace, BE, Sullivan, P, Jamison, JA, Kelly, U, Harrabi, O, Bollini, SS, Dilley, J, Kobayashi, D, Kuang, B, Li, W, Pons, J, Lin, JC, Bowes Rickman, C. 2011. Anti-amyloid therapy protects against retinal pigmented epithelium damage and vision loss in a model of age-related macular degeneration. Proceedings of the National Academy of Sciences of the United States of America 108: E279-87.

Dixon, RA, Kobilka, BK, Strader, DJ, Benovic, JL, Dohlman, HG, Frielle, T, Bolanowski, MA, Bennett, CD, Rands, E, Diehl, RE, Mumford, RA, Slater, EE, Sigal, IS, Caron, MG, Lefkowitz, RJ, Strader, CD. 1986. Cloning of the gene and cDNA for mammalian beta- adrenergic receptor and homology with rhodopsin. Nature 321: 75–79.

Doherty, KR, Wappel, RL, Talbert, DR, Trusk, PB, Moran, DM, Kramer, JW, Brown, AM, Shell, SA, Bacus, S. 2013. Multi-parameter in vitro toxicity testing of crizotinib, sunitinib, erlotinib, and nilotinib in human cardiomyocytes. Toxicology and applied pharmacology 272: 245–255.

Dohlman, HG, Thorner, J, Caron, MG, Lefkowitz, RJ. 1991. Model systems for the study of seven-transmembrane-segment receptors. Annual review of biochemistry 60: 653–688.

Doszczak, L, Kraft, P, Weber, H, Bertermann, R, Triller, A, Hatt, H, Tacke, R. 2007. Prediction of perception: probing the hOR17-4 olfactory receptor model with silicon analogues of bourgeonal and lilial. Angewandte Chemie (International ed. in English) 46: 3367–3371.

134

REFERENCES

Dranse, HJ, Kelly, MEM, Hudson, BD. 2013. Drugs or diet? - Developing novel therapeutic strategies targeting the free fatty acid family of GPCRs. British Journal of Pharmacology 170: 696–711.

Drawnel, FM, Boccardo, S, Prummer, M, Delobel, F, Graff, A, Weber, M, Gérard, R, Badi, L, Kam-Thong, T, Bu, L, Jiang, X, Hoflack, J, Kiialainen, A, Jeworutzki, E, Aoyama, N, Carlson, C, Burcin, M, Gromo, G, Boehringer, M, Stahlberg, H, Hall, BJ, Magnone, MC, Kolaja, K, Chien, KR, Bailly, J, Iacone, R. 2014. Disease modeling and phenotypic drug screening for diabetic cardiomyopathy using human induced pluripotent stem cells. Cell reports 9: 810–821.

Dreyer, WJ. 1998. The area code hypothesis revisited: olfactory receptors and other related transmembrane receptors may function as the last digits in a cell surface code for assembling embryos. Proceedings of the National Academy of Sciences of the United States of America 95: 9072–9077.

Drutel, G, Arrang, JM, Diaz, J, Wisnewsky, C, Schwartz, K, Schwartz, JC. 1995. Cloning of OL1, a putative olfactory receptor and its expression in the developing rat heart.

Du, Z, Hu, L, Zhao, G, Wang, Q, Xu, Q, Jiang, N, Lin, J. 2015. Protein tyrosine phosphatase 1B regulates migration of ARPE-19 cells through EGFR/ERK signaling pathway. International journal of ophthalmology 8: 891–897.

Eclov, JA, Qian, Q, Redetzke, R, Chen, Q, Wu, SC, Healy, CL, Ortmeier, SB, Harmon, E, Shearer, GC, O’Connell, TD. 2015. EPA, not DHA, prevents fibrosis in pressure overload- induced heart failure: potential role of free fatty acid receptor 4. Journal of Lipid Research 56: 2297–2308.

Emami, S, Dadashpour, S. 2015. Current developments of coumarin-based anti-cancer agents in medicinal chemistry. European Journal of Medicinal Chemistry 102: 611–630.

Feingold, EA, Penny, LA, Nienhuis, AW, Forget, BG. 1999. An olfactory receptor gene is located in the extended human beta-globin gene cluster and is expressed in erythroid cells. Genomics 61: 15–23.

Feldmesser, E, Olender, T, Khen, M, Yanai, I, Ophir, R, Lancet, D. 2006. Widespread ectopic expression of olfactory receptor genes. BMC genomics 7: 121.

Ferrand, N, Pessah, M, Frayon, S, Marais, J, Garel, JM. 1999. Olfactory receptors, Golf alpha and adenylyl cyclase mRNA expressions in the rat heart during ontogenic development. Journal of molecular and cellular cardiology 31: 1137–1142.

Finck, BN, Han, X, Courtois, M, Aimond, F, Nerbonne, JM, Kovacs, A, Gross, RW, Kelly, DP. 2003. A critical role for PPARalpha-mediated lipotoxicity in the pathogenesis of diabetic cardiomyopathy: modulation by dietary fat content. Proceedings of the National Academy of Sciences of the United States of America 100: 1226–1231.

Firestein, S. 2001. How the olfactory system makes sense of scents. Nature 413: 211–218.

135

REFERENCES

Flegel, C, Manteniotis, S, Osthold, S, Hatt, H, Gisselmann, G. 2013. Expression profile of ectopic olfactory receptors determined by deep sequencing. PloS one 8: e55368.

Flegel, C, Schöbel, N, Altmüller, J, Becker, C, Tannapfel, A, Hatt, H, Gisselmann, G. 2015a. RNA-Seq Analysis of Human Trigeminal and Dorsal Root Ganglia with a Focus on Chemoreceptors. PloS one 10: e0128951.

Flegel, C, Vogel, F, Hofreuter, A, Schreiner, BSP, Osthold, S, Veitinger, S, Becker, C, Brockmeyer, NH, Muschol, M, Wennemuth, G, Altmüller, J, Hatt, H, Gisselmann, G. 2015b. Characterization of the Olfactory Receptors Expressed in Human Spermatozoa. Frontiers in molecular biosciences 2: 73.

Fliegauf, M, Benzing, T, Omran, H. 2007. When cilia go bad: cilia defects and ciliopathies. Nature reviews. Molecular cell biology 8: 880–893.

Floriano, WB, Vaidehi, N, Goddard, WA3. 2004. Making sense of olfaction through predictions of the 3-D structure and function of olfactory receptors. Chemical senses 29: 269–290.

Foster, SR, Blank, K, See Hoe, LE, Behrens, M, Meyerhof, W, Peart, JN, Thomas, WG. 2014. Bitter taste receptor agonists elicit G-protein-dependent negative inotropy in the murine heart. The FASEB Journal 28: 4497–4508.

Foster, SR, Roura, E, Molenaar, P, Thomas, WG. 2015. G protein-coupled receptors in cardiac biology. Old and new receptors. Biophysical Reviews 7: 77–89.

Franco, MI, Turin, L, Mershin, A, Skoulakis, EMC. 2011. Molecular vibration-sensing component in Drosophila melanogaster olfaction. Proceedings of the National Academy of Sciences of the United States of America 108: 3797–3802.

Fredriksson, R, Lagerstrom, MC, Lundin, L, Schioth, HB. 2003. The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Molecular pharmacology 63: 1256–1272.

Fuessel, S, Weigle, B, Schmidt, U, Baretton, G, Koch, R, Bachmann, M, Rieber, EP, Wirth, MP, Meye, A. 2006. Transcript quantification of Dresden G protein-coupled receptor (D- GPCR) in primary prostate cancer tissue pairs. Cancer letters 236: 95–104.

Fujita, Y, Takahashi, T, Suzuki, A, Kawashima, K, Nara, F, Koishi, R. 2007. Deorphanization of Dresden G protein-coupled receptor for an odorant receptor. Journal of receptor and signal transduction research 27: 323–334.

Gaillard, I, Rouquier, S, Giorgi, D. 2004. Olfactory receptors. Cellular and molecular life sciences : CMLS 61: 456–469.

Gane, S, Georganakis, D, Maniati, K, Vamvakias, M, Ragoussis, N, Skoulakis, EMC, Turin, L. 2013. Molecular vibration-sensing component in human olfaction. PloS one 8: e55780.

Garcia-Esparcia, P, Schlüter, A, Carmona, M, Moreno, J, Ansoleaga, B, Torrejón-Escribano, B, Gustincich, S, Pujol, A, Ferrer, I. 2013. Functional genomics reveals dysregulation of

136

REFERENCES

cortical olfactory receptors in Parkinson disease: novel putative chemoreceptors in the human brain. Journal of neuropathology and experimental neurology 72: 524–539.

Gaudin, JC, Breuils, L, Haertle, T. 2001. New GPCRs from a human lingual cDNA library. Chemical senses 26: 1157–1166.

Gelis, L, Wolf, S, Hatt, H, Neuhaus, EM, Gerwert, K. 2012. Prediction of a ligand-binding niche within a human olfactory receptor by combining site-directed mutagenesis with dynamic homology modeling. Angewandte Chemie (International ed. in English) 51: 1274– 1278.

Gelis, L, Jovancevic, N, Veitinger, S, Mandal, B, Arndt, HD, Neuhaus; EM and Hatt, H. 2016 Functional Characterization of the Odorant Receptor 51E2 in Human Melanocytes (Journal of Biological Chemistry; in revision)

Gelis, L. 2009 Function of odorant receptors in non-neuronal human cells. Dissertation

Gerkin, RC, Castro, JB. 2015. The number of olfactory stimuli that humans can discriminate is still unknown. eLife 4: e08127.

Giandomenico, V, Cui, T, Grimelius, L, Oberg, K, Pelosi, G, Tsolakis, AV. 2013. Olfactory receptor 51E1 as a novel target for diagnosis in somatostatin receptor-negative lung carcinoids. Journal of Molecular Endocrinology 51: 277–286.

Gilad, Y, Man, O, Glusman, G. 2005. A comparison of the human and chimpanzee olfactory receptor gene repertoires. Genome research 15: 224–230.

Gilad, Y, Wiebe, V, Przeworski, M, Lancet, D, Pääbo, S. 2004. Loss of olfactory receptor genes coincides with the acquisition of full trichromatic vision in primates. PLoS biology 2: E5.

Giordano, F, Simoes, S, Raposo, G. 2011. The ocular albinism type 1 (OA1) GPCR is ubiquitinated and its traffic requires endosomal sorting complex responsible for transport (ESCRT) function. Proceedings of the National Academy of Sciences of the United States of America 108: 11906–11911.

Glusman, G, Clifton, S, Roe, B, Lancet, D. 1996. Sequence analysis in the olfactory receptor gene cluster on human chromosome 17: recombinatorial events affecting receptor diversity. Genomics 37: 147–160.

Go, AS, Mozaffarian, D, Roger, VL, Benjamin, EJ, Berry, JD, Blaha, MJ, Dai, S, Ford, ES, Fox, CS, Franco, S, Fullerton, HJ, Gillespie, C, Hailpern, SM, Heit, JA, Howard, VJ, Huffman, MD, Judd, SE, Kissela, BM, Kittner, SJ, Lackland, DT, Lichtman, JH, Lisabeth, LD, Mackey, RH, Magid, DJ, Marcus, GM, Marelli, A, Matchar, DB, McGuire, DK, Mohler, ER, Moy, CS, Mussolino, ME, Neumar, RW, Nichol, G, Pandey, DK, Paynter, NP, Reeves, MJ, Sorlie, PD, Stein, J, Towfighi, A, Turan, TN, Virani, SS, Wong, ND, Woo, D, Turner, MB. 2014. Executive summary: heart disease and stroke statistics--2014 update: a report from the American Heart Association. Circulation 129: 399–410.

137

REFERENCES

Go, Y, Niimura, Y. 2008. Similar numbers but different repertoires of olfactory receptor genes in humans and chimpanzees. Molecular biology and evolution 25: 1897–1907.

Gobeil, F, Dumont, I, Marrache, AM, Vazquez-Tello, A, Bernier, SG, Abran, D, Hou, X, Beauchamp, MH, Quiniou, C, Bouayad, A, Choufani, S, Bhattacharya, M, Molotchnikoff, S, Ribeiro-Da-Silva, A, Varma, DR, Bkaily, G, Chemtob, S. 2002. Regulation of eNOS expression in brain endothelial cells by perinuclear EP(3) receptors. Circulation research 90: 682–689.

Granier, S, Manglik, A, Kruse, AC, Kobilka, TS, Thian, FS, Weis, WI, Kobilka, BK. 2012. Structure of the δ-opioid receptor bound to naltrindole. Nature 485: 400–404.

Griffin, CA, Kafadar, KA, Pavlath, GK. 2009. MOR23 promotes muscle regeneration and regulates cell adhesion and migration. Developmental cell 17: 649–661.

Gross-Isseroff, R, Ophir, D, Bartana, A, Voet, H, Lancet, D. 1992. Evidence for genetic determination in human twins of olfactory thresholds for a standard odorant. Neuroscience letters 141: 115–118.

Gu, X, Karp, PH, Brody, SL, Pierce, RA, Welsh, MJ, Holtzman, MJ, Ben-Shahar, Y. 2014. Chemosensory functions for pulmonary neuroendocrine cells. American journal of respiratory cell and molecular biology 50: 637–646.

Haga, K, Kruse, AC, Asada, H, Yurugi-Kobayashi, T, Shiroishi, M, Zhang, C, Weis, WI, Okada, T, Kobilka, BK, Haga, T, Kobayashi, T. 2012. Structure of the human M2 muscarinic acetylcholine receptor bound to an antagonist. Nature 482: 547–551.

Hall, SE, Floriano, WB, Vaidehi, N, Goddard, WA. 2004. Predicted 3-D structures for mouse I7 and rat I7 olfactory receptors and comparison of predicted odor recognition profiles with experiment. Chemical senses 29: 595–616.

Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. Journal of molecular biology 166: 557–580.

Hanson, MA, Roth, CB, Jo, E, Griffith, MT, Scott, FL, Reinhart, G, Desale, H, Clemons, B, Cahalan, SM, Schuerer, SC, Sanna, MG, Han, GW, Kuhn, P, Rosen, H, Stevens, RC. 2012. Crystal structure of a lipid G protein-coupled receptor. Science (New York, N.Y.) 335: 851– 855.

Hara, T, Ichimura, A, Hirasawa, A. 2014. Therapeutic Role and Ligands of Medium- to Long- Chain Fatty Acid Receptors. Frontiers in Endocrinology 5: 107.

Hatt, H, Gisselmann, G, Wetzel, CH. 1999. Cloning, functional expression and characterization of a human olfactory receptor. Cellular and molecular biology (Noisy-le- Grand, France) 45: 285–291.

Headrick, JP, Pepe, S, Peart, JN. 2012. Non-analgesic effects of opioids: cardiovascular effects of opioids and their receptor systems. Current pharmaceutical design 18: 6090– 6100.

138

REFERENCES

Heckmann, J. 2012. Functional characterization of olfactory receptors in human cardiomyocytes. Master thesis

Hecquet, C, Lefevre, G, Valtink, M, Engelmann, K, Mascarelli, F. 2002. Activation and role of MAP kinase-dependent pathways in retinal pigment epithelial cells: ERK and RPE cell proliferation. Investigative ophthalmology & visual science 43: 3091–3098.

Henderson, R, Unwin, PN. 1975. Three-dimensional model of purple membrane obtained by electron microscopy. Nature 257: 28–32.

Hennig, AK, Ogilvie, JM, Ohlemiller, KK, Timmers, AM, Hauswirth, WW, Sands, MS. 2004. AAV-mediated intravitreal gene therapy reduces lysosomal storage in the retinal pigmented epithelium and improves retinal function in adult MPS VII mice. Molecular therapy : the journal of the American Society of Gene Therapy 10: 106–116.

Hescheler, J, Fleischmann, BK, Lentini, S, Maltsev, VA, Rohwedel, J, Wobus, AM, Addicks, K. 1997. Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis. Cardiovascular Research 36: 149–162.

Hescheler, J, Kameyama, M, Trautwein, W. 1986. On the mechanism of muscarinic inhibition of the cardiac Ca current. Pflügers Archiv : European journal of physiology 407: 182–189.

Hirasawa, A, Tsumaya, K, Awaji, T, Katsuma, S, Adachi, T, Yamada, M, Sugimoto, Y, Miyazaki, S, Tsujimoto, G. 2004. Free fatty acids regulate gut incretin glucagon-like peptide-1 secretion through GPR120. Nature Medicine 11: 90–94.

His, W. 1893. Die Thätigkeit des Embryonalen Herzens und deren Bedeutung für die Lehre von der Herzbewegung beim Erwachsenen.

Ho, J, Perez-Aguilar, JM, Gao, L, Saven, JG, Matsunami, H, Eckenhoff, RG. 2015. Molecular recognition of ketamine by a subset of olfactory G protein–coupled receptors. Science signaling 8: ra33.

Hollenstein, K, Kean, J, Bortolato, A, Cheng, RKY, Doré, AS, Jazayeri, A, Cooke, RM, Weir, M, Marshall, FH. 2013. Structure of class B GPCR corticotropin-releasing factor receptor 1. Nature 499: 438–443.

Hopkins, AL, Groom, CR. 2002. The druggable genome. Nature reviews. Drug discovery 1: 727–730.

Hu, FB, Stampfer, MJ, Manson, JE, Ascherio, A, Colditz, GA, Speizer, FE, Hennekens, CH, Willett, WC. 1999. Dietary saturated fats and their food sources in relation to the risk of coronary heart disease in women. The American journal of clinical nutrition 70: 1001– 1008.

Huang, Y, Wright, CD, Merkwan, CL, Baye, NL, Liang, Q, Simpson, PC, O'Connell, TD. 2007. An alpha1A-adrenergic-extracellular signal-regulated kinase survival signaling pathway in cardiac myocytes. Circulation 115: 763–772.

139

REFERENCES

Iacobellis, G, Sharma, AM. 2007. Epicardial adipose tissue as new cardio-metabolic risk marker and potential therapeutic target in the metabolic syndrome. Current pharmaceutical design 13: 2180–2184.

Ichimura, A, Hasegawa, S, Kasubuchi, M, Kimura, I. 2014. Free fatty acid receptors as therapeutic targets for the treatment of diabetes. Frontiers in Pharmacology 5: 226.

Itzhaki, I, Rapoport, S, Huber, I, Mizrahi, I, Zwi-Dantsis, L, Arbel, G, Schiller, J, Gepstein, L. 2011. Calcium handling in human induced pluripotent stem cell derived cardiomyocytes. PloS one 6: e18037.

Jaakola, V, Griffith, MT, Hanson, MA, Cherezov, V, Chien, EYT, Lane, JR, Ijzerman, AP, Stevens, RC. 2008. The 2.6 angstrom crystal structure of a human A2A adenosine receptor bound to an antagonist. Science (New York, N.Y.) 322: 1211–1217.

Jaeger, SR, McRae, JF, Bava, CM, Beresford, MK, Hunter, D, Jia, Y, Chheang, SL, Jin, D, Peng, M, Gamble, JC, Atkinson, KR, Axten, LG, Paisley, AG, Tooman, L, Pineau, B, Rouse, SA, Newcomb, RD. 2013. A Mendelian trait for olfactory sensitivity affects odor experience and food selection. Current biology : CB 23: 1601–1605.

Jiang, Y, Li, YR, Tian, H, Ma, M, Matsunami, H. 2015. Muscarinic acetylcholine receptor M3 modulates odorant receptor activity via inhibition of β-arrestin-2 recruitment. Nature communications 6: 6448.

Jones, DT, Reed, RR. 1989. Golf: an olfactory neuron specific-G protein involved in odorant signal transduction. Science (New York, N.Y.) 244: 790–795.

Kamal, FA, Smrcka, AV, Blaxall, BC. 2011. Taking the heart failure battle inside the cell: small molecule targeting of Gβγ subunits. Journal of molecular and cellular cardiology 51: 462–467.

Kandel, ER, Kandel-Schwartz-Jessell-Siegelbaum-Hudspeth, eds. 2013. Principles of neural science. New York, NY: McGraw-Hill Medical.

Kang, N, Bahk, YY, Lee, N, Jae, Y, Cho, YH, Ku, CR, Byun, Y, Lee, EJ, Kim, M, Koo, J. 2015. Olfactory receptor Olfr544 responding to azelaic acid regulates glucagon secretion in α-cells of mouse pancreatic islets. Biochemical and biophysical research communications.

Kaoukis, A, Deftereos, S, Raisakis, K, Giannopoulos, G, Bouras, G, Panagopoulou, V, Papoutsidakis, N, Cleman, MW, Stefanadis, C. 2013. The role of endothelin system in cardiovascular disease and the potential therapeutic perspectives of its inhibition. Current topics in medicinal chemistry 13: 95–114.

Karreth, FA, Reschke, M, Ruocco, A, Ng, C, Chapuy, B, Léopold, V, Sjoberg, M, Keane, TM, Verma, A, Ala, U, Tay, Y, Wu, D, Seitzer, N, Velasco-Herrera, MDC, Bothmer, A, Fung, J, Langellotto, F, Rodig, SJ, Elemento, O, Shipp, MA, Adams, DJ, Chiarle, R, Pandolfi, PP. 2015. The BRAF pseudogene functions as a competitive endogenous RNA and induces lymphoma in vivo. Cell 161: 319–332.

140

REFERENCES

Katada, S, Hirokawa, T, Oka, Y, Suwa, M, Touhara, K. 2005. Structural basis for a broad but selective ligand spectrum of a mouse olfactory receptor: mapping the odorant-binding site. The Journal of neuroscience : the official journal of the Society for Neuroscience 25: 1806– 1815.

Kaupp, UB, Seifert, R. 2002. Cyclic nucleotide-gated ion channels. Physiological reviews 82: 769–824.

Keller, A, Vosshall, LB. 2008. Better smelling through genetics: mammalian odor perception. Current opinion in neurobiology 18: 364–369.

Kernt, M, Neubauer, AS, Liegl, R, Eibl, KH, Alge, CS, Lackerbauer, CA, Ulbig, MW, Kampik, A. 2009. Cytoprotective effects of a blue light-filtering intraocular lens on human retinal pigment epithelium by reducing phototoxic effects on vascular endothelial growth factor-alpha, Bax, and Bcl-2 expression. Journal of cataract and refractive surgery 35: 354–362.

Kernt, M, Neubauer, AS, Liegl, RG, Hirneiss, C, Alge, CS, Wolf, A, Ulbig, MW, Kampik, A. 2010. Sorafenib prevents human retinal pigment epithelium cells from light-induced overexpression of VEGF, PDGF and PlGF. The British journal of ophthalmology 94: 1533– 1539.

Keydar, I, Ben-Asher, E, Feldmesser, E, Nativ, N, Oshimoto, A, Restrepo, D, Matsunami, H, Chien, M, Pinto, JM, Gilad, Y, Olender, T, Lancet, D. 2013. General Olfactory Sensitivity Database (GOSdb): Candidate Genes and their Genomic Variations. Human Mutation 34: 32–41.

Kim, S, Yoon, YC, Lee, AS, Kang, N, Koo, J, Rhyu, M, Park, J. 2015. Expression of human olfactory receptor 10J5 in heart aorta, coronary artery, and endothelial cells and its functional role in angiogenesis. Biochemical and biophysical research communications 460: 404–408.

Kimbrel, EA, Lanza, R. 2015. Current status of pluripotent stem cells: moving the first therapies to the clinic. Nature reviews. Drug discovery 14: 681–692.

Kishida, T, Kubota, S, Shirayama, Y, Fukami, H. 2007. The olfactory receptor gene repertoires in secondary-adapted marine vertebrates: evidence for reduction of the functional proportions in cetaceans. Biology letters 3: 428–430.

Klasen, K, Corey, EA, Kuck, F, Wetzel, CH, Hatt, H, Ache, BW. 2010. Odorant-stimulated phosphoinositide signaling in mammalian olfactory receptor neurons. Cellular signalling 22: 150–157.

Kleene, SJ, Gesteland, RC. 1991. Calcium-activated chloride conductance in frog olfactory cilia. The Journal of neuroscience : the official journal of the Society for Neuroscience 11: 3624–3629.

Kraft, Bajgrowicz, Denis, Frater. 2000. Odds and Trends: Recent Developments in the Chemistry of Odorants Note on trademarks: Words which we know or have reason to believe constitute registered trademarks (R) are designated as such. However, neither the

141

REFERENCES

presence nor absence of such designation should be regarded as affecting the legal status of any trademark. Note on perfume analysis: The quoted percentages of perfume raw materials in market products are rounded figures. They are often derived from area percentages from the GC (FID) analysis, and are thus subject to analytical error. Angewandte Chemie (International ed. in English) 39: 2980–3010.

Krautwurst, D, Yau, KW, Reed, RR. 1998. Identification of ligands for olfactory receptors by functional expression of a receptor library. Cell 95: 917–926.

Kristiansen, K. 2004. Molecular mechanisms of ligand binding, signaling, and regulation within the superfamily of G-protein-coupled receptors: molecular modeling and mutagenesis approaches to receptor structure and function. Pharmacology & therapeutics 103: 21–80.

Kruse, AC, Hu, J, Pan, AC, Arlow, DH, Rosenbaum, DM, Rosemond, E, Green, HF, Liu, T, Chae, PS, Dror, RO, Shaw, DE, Weis, WI, Wess, J, Kobilka, BK. 2012. Structure and dynamics of the M3 muscarinic acetylcholine receptor. Nature 482: 552–556.

La Cruz, O de, Blekhman, R, Zhang, X, Nicolae, D, Firestein, S, Gilad, Y. 2009. A signature of evolutionary constraint on a subset of ectopically expressed olfactory receptor genes. Molecular biology and evolution 26: 491–494.

Labarthe, F, Gélinas, R, Des Rosiers, C. 2008. Medium-chain Fatty Acids as Metabolic Therapy in Cardiac Disease. Cardiovascular Drugs and Therapy 22: 97–106.

Labarthe, F, Khairallah, M, Bouchard, B, Stanley, WC, Des Rosiers, C. 2005. Fatty acid oxidation and its impact on response of spontaneously hypertensive rat hearts to an adrenergic stress: benefits of a medium-chain fatty acid. American journal of physiology 288: H1425-36.

Lai, PC, Bahl, G, Gremigni, M, Matarazzo, V, Clot-Faybesse, O, Ronin, C, Crasto, CJ. 2008. An olfactory receptor pseudogene whose function emerged in humans: a case study in the evolution of structure-function in GPCRs. Journal of structural and functional genomics 9: 29–40.

Lai, PC, Singer, MS, Crasto, CJ. 2005. Structural activation pathways from dynamic olfactory receptor-odorant interactions. Chemical senses 30: 781–792.

Lakatta, EG, Maltsev, VA, Vinogradova, TM. 2010. A coupled SYSTEM of intracellular Ca2+ clocks and surface membrane voltage clocks controls the timekeeping mechanism of the heart's pacemaker. Circulation Research 106: 659–673.

Lamounier-Zepter, V. 2006. Human adipocytes attenuate cardiomyocyte contraction: characterization of an adipocyte-derived negative inotropic activity. The FASEB Journal 20: 1653–1659.

Langmead, B, Trapnell, C, Pop, M, Salzberg, SL. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome biology 10: R25.

142

REFERENCES

Laska, M, Seibt, A, Weber, A. 2000. 'Microsmatic' primates revisited: olfactory sensitivity in the squirrel monkey. Chemical senses 25: 47–53.

Launay, G, Sanz, G, Pajot-Augy, E, Gibrat, J. 2012a. Modeling of mammalian olfactory receptors and docking of odorants. Biophysical Reviews 4: 255–269.

Launay, G, Téletchéa, S, Wade, F, Pajot-Augy, E, Gibrat, J, Sanz, G. 2012b. Automatic modeling of mammalian olfactory receptors and docking of odorants. Protein engineering, design & selection : PEDS 25: 377–386.

Lechtreck, KF. 2015. IFT-Cargo Interactions and Protein Transport in Cilia. Trends in biochemical sciences 40: 765–778.

Lee, DK, Lanca, AJ, Cheng, R, Nguyen, T, Ji, XD, Gobeil, F, Chemtob, S, George, SR, O'Dowd, BF. 2004. Agonist-independent nuclear localization of the Apelin, angiotensin AT1, and bradykinin B2 receptors. The Journal of biological chemistry 279: 7901–7908.

Levine, JD, Weiss, ML, Rosenwasser, AM, Miselis, RR. 1991. Retinohypothalamic tract in the female albino rat: a study using horseradish peroxidase conjugated to cholera toxin. The Journal of comparative neurology 306: 344–360.

Li, H, Handsaker, B, Wysoker, A, Fennell, T, Ruan, J, Homer, N, Marth, G, Abecasis, G, Durbin, R. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, England) 25: 2078–2079.

Li, M, Jia, C, Kazmierkiewicz, KL, Bowman, AS, Tian, L, Liu, Y, Gupta, NA, Gudiseva, HV, Yee, SS, Kim, M, Dentchev, T, Kimble, JA, Parker, JS, Messinger, JD, Hakonarson, H, Curcio, CA, Stambolian, D. 2014. Comprehensive analysis of gene expression in human retina and supporting tissues. Human molecular genetics 23: 4001–4014.

Li, YR, Matsunami, H. 2011. Activation state of the M3 muscarinic acetylcholine receptor modulates mammalian odorant receptor signaling. Science signaling 4: ra1.

Li, Z, Laugwitz, K, Pinkernell, K, Pragst, I, Baumgartner, C, Hoffmann, E, Rosport, K, Münch, G, Moretti, A, Humrich, J, Lohse, MJ, Ungerer, M. 2003. Effects of two Gbetagamma-binding proteins--N-terminally truncated phosducin and beta-adrenergic receptor kinase C terminus (betaARKct)--in heart failure. Gene therapy 10: 1354–1361.

Lin, Y, Smrcka, AV. 2011. Understanding Molecular Recognition by G protein Subunits on the Path to Pharmacological Targeting. Molecular pharmacology 80: 551–557.

Lind, GJ, Cavanagh, HD. 1995. Identification and subcellular distribution of muscarinic acetylcholine receptor-related proteins in rabbit corneal and Chinese hamster ovary cells. Investigative ophthalmology & visual science 36: 1492–1507.

Lindqvist, A, He, Y, Andersson, S. 2005. Cell type-specific expression of beta-carotene 9',10'- monooxygenase in human tissues. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society 53: 1403–1412.

143

REFERENCES

Liu, SJ. 2007. Inhibition of L-type Ca2+ channel current and negative inotropy induced by arachidonic acid in adult rat ventricular myocytes. American journal of physiology. Cell physiology 293: C1594-604.

Liu, W, Chun, E, Thompson, AA, Chubukov, P, Xu, F, Katritch, V, Han, GW, Roth, CB, Heitman, LH, Ijzerman, AP, Cherezov, V, Stevens, RC. 2012. Structural basis for allosteric regulation of GPCRs by sodium ions. Science (New York, N.Y.) 337: 232–236.

Lochter, A, Srebrow, A, Sympson, CJ, Terracio, N, Werb, Z, Bissell, MJ. 1997. Misregulation of Stromelysin-1 Expression in Mouse Mammary Tumor Cells Accompanies Acquisition of Stromelysin-1-dependent Invasive Properties. Journal of Biological Chemistry 272: 5007– 5015.

Lopez, VM, Decatur, CL, Stamer, WD, Lynch, RM, McKay, BS. 2008. L-DOPA is an endogenous ligand for OA1. PLoS biology 6: e236.

Ma, X, Guan, L, Wu, W, Zhang, Y, Zheng, W, Gao, Y, Long, J, Wu, N, Wu, L, Xiang, Y, Xu, B, Shen, M, Chen, Y, Wang, Y, Yin, Y, Li, Y, Xu, H, Xu, X, Li, Y. 2015. Whole-exome sequencing identifies OR2W3 mutation as a cause of autosomal dominant retinitis pigmentosa. Scientific reports 5: 9236.

Madden, MC, Wolkowicz, PE, Pohost, GM, McMillin, JB, Pike, MM. 1995. Acylcarnitine accumulation does not correlate with reperfusion recovery in palmitate-perfused rat hearts. The American journal of physiology 268: H2505-12.

Mainland, JD, Keller, A, Li, YR, Zhou, T, Trimmer, C, Snyder, LL, Moberly, AH, Adipietro, KA, Liu, WLL, Zhuang, H, Zhan, S, Lee, SS, Lin, A, Matsunami, H. 2014a. The missense of smell: functional variability in the human odorant receptor repertoire. Nature neuroscience 17: 114–120.

Mainland, JD, Lundström, JN, Reisert, J, Lowe, G. 2014b. From molecule to mind: an integrative perspective on odor intensity. Trends in neurosciences 37: 443–454.

Malla, R, Ashby, CR, Narayanan, NK, Narayanan, B, Faridi, JS, Tiwari, AK. 2015. Proline- rich AKT substrate of 40-kDa (PRAS40) in the pathophysiology of cancer. Biochemical and biophysical research communications 463: 161–166.

Malnic, B, Hirono, J, Sato, T, Buck, LB. 1999. Combinatorial receptor codes for odors. Cell 96: 713–723.

Mamas, MA, Terrar, DA. 2001. Actions of arachidonic acid on contractions and associated electrical activity in guinea-pig isolated ventricular myocytes. Experimental physiology 86: 437–449. Man, O, Gilad, Y, Lancet, D. 2004. Prediction of the odorant binding site of olfactory receptor proteins by human-mouse comparisons. Protein science : a publication of the Protein Society 13: 240–254.

Manglik, A, Kruse, AC, Kobilka, TS, Thian, FS, Mathiesen, JM, Sunahara, RK, Pardo, L, Weis, WI, Kobilka, BK, Granier, S. 2012. Crystal structure of the µ-opioid receptor bound to a morphinan antagonist. Nature 485: 321–326.

144

REFERENCES

Manteniotis, S, Wojcik, S, Brauhoff, P, Möllmann, M, Petersen, L, Göthert, JR, Schmiegel, W, Dührsen, U, Gisselmann, G, Hatt, H. 2016. Functional characterization of the ectopically expressed olfactory receptor 2AT4 in human myelogenous leukemia. Cell Death Discovery 2.

Maßberg, D, Simon, A, Häussinger, D, Keitel, V, Gisselmann, G, Conrad, H, Hatt, H. 2015. Monoterpene (-)-citronellal affects hepatocarcinoma cell signaling via an olfactory receptor. Archives of biochemistry and biophysics 566: 100–109.

Menashe, I, Lancet, D. 2006. Variations in the human olfactory receptor pathway. Cellular and molecular life sciences : CMLS 63: 1485–1493.

Milligan, G, Ulven, T, Murdoch, H, Hudson, BD. 2014. G-protein-coupled receptors for free fatty acids: nutritional and therapeutic targets. British Journal of Nutrition 111: S3-S7.

Mombaerts, P. 2001. The human repertoire of odorant receptor genes and pseudogenes. Annual review of genomics and human genetics 2: 493–510.

Mombaerts, P. 2004. Genes and ligands for odorant, vomeronasal and taste receptors. Nature reviews. Neuroscience 5: 263–278.

Montessuit, C, Papageorgiou, I, Tardy-Cantalupi, I, Rosenblatt-Velin, N, Lerch, R. 2000. Postischemic recovery of heart metabolism and function: role of mitochondrial fatty acid transfer. Journal of applied physiology (Bethesda, Md 89: 111–119.

Morin, LP, Blanchard, JH. 1999. Forebrain connections of the hamster intergeniculate leaflet: comparison with those of ventral lateral geniculate nucleus and retina. Visual neuroscience 16: 1037–1054.

Morin, LP, Studholme, KM. 2014. Retinofugal projections in the mouse. The Journal of comparative neurology 522: 3733–3753.

Munger, SD, Leinders-Zufall, T, Zufall, F. 2009. Subsystem organization of the mammalian sense of smell. Annual review of physiology 71: 115–140.

Naga Prasad, SV, Esposito, G, Mao, L, Koch, WJ, Rockman, HA. 2000. Gbetagamma- dependent phosphoinositide 3-kinase activation in hearts with in vivo pressure overload hypertrophy. The Journal of biological chemistry 275: 4693–4698.

Nakamura, T, Gold, GH. 1987. A cyclic nucleotide-gated conductance in olfactory receptor cilia. Nature 325: 442–444.

Nakayama, TA, Khorana, HG. 1991. Mapping of the amino acids in membrane-embedded helices that interact with the retinal chromophore in bovine rhodopsin. The Journal of biological chemistry 266: 4269–4275.

Nef, P, Hermans-Borgmeyer, I, Artières-Pin, H, Beasley, L, Dionne, VE, Heinemann, SF. 1992. Spatial pattern of receptor expression in the olfactory epithelium. Proceedings of the National Academy of Sciences of the United States of America 89: 8948–8952.

145

REFERENCES

Neuhaus, EM, Zhang, W, Gelis, L, Deng, Y, Noldus, J, Hatt, H. 2009. Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. The Journal of biological chemistry 284: 16218–16225.

Niimura, Y, Nei, M. 2005. Evolutionary dynamics of olfactory receptor genes in fishes and tetrapods. Proceedings of the National Academy of Sciences of the United States of America 102: 6039–6044.

Offermanns, S. 2014. Free Fatty Acid (FFA) and Hydroxy Carboxylic Acid (HCA) Receptors. Annual Review of Pharmacology and Toxicology 54: 407–434.

Okada, T, Sugihara, M, Bondar, A, Elstner, M, Entel, P, Buss, V. 2004. The retinal conformation and its environment in rhodopsin in light of a new 2.2 A crystal structure. Journal of molecular biology 342: 571–583.

Oldham, WM, Hamm, HE. 2008. Heterotrimeric G protein activation by G-protein-coupled receptors. Nature reviews. Molecular cell biology 9: 60–71.

Overlack, N, Kilic, D, Bauss, K, Märker, T, Kremer, H, van Wijk, E, Wolfrum, U. 2011. Direct interaction of the Usher syndrome 1G protein SANS and myomegalin in the retina. Biochimica et biophysica acta 1813: 1883–1892.

Palczewski, K, Kumasaka, T, Hori, T, Behnke, CA, Motoshima, H, Fox, BA, Le Trong, I, Teller, DC, Okada, T, Stenkamp, RE, Yamamoto, M, Miyano, M. 2000. Crystal structure of rhodopsin: A G protein-coupled receptor. Science (New York, N.Y.) 289: 739–745.

Park, DS, Fishman, GI. 2011. The cardiac conduction system. Circulation 123: 904–915.

Parmentier, M, Libert, F, Schurmans, S, Schiffmann, S, Lefort, A, Eggerickx, D, Ledent, C, Mollereau, C, Gerard, C, Perret, J. 1992. Expression of members of the putative olfactory receptor gene family in mammalian germ cells. Nature 355: 453–455.

Passier, R, Oostwaard, DW, Snapper, J, Kloots, J, Hassink, RJ, Kuijk, E, Roelen, B, de la Riviere, Aart Brutel, Mummery, C. 2005. Increased cardiomyocyte differentiation from human embryonic stem cells in serum-free cultures. Stem cells (Dayton, Ohio) 23: 772– 780.

Pennock, S, Haddock, LJ, Mukai, S, Kazlauskas, A. 2014. Vascular endothelial growth factor acts primarily via platelet-derived growth factor receptor α to promote proliferative vitreoretinopathy. The American journal of pathology 184: 3052–3068.

Petit-Jacques, J, Hartzell, HC. 1996. Effect of arachidonic acid on the L-type calcium current in frog cardiac myocytes. The Journal of Physiology 493 (Pt 1): 67–81.

Pezeshkian, M, Mahtabipour, M. 2013. Epicardial and subcutaneous adipose tissue Fatty acids profiles in diabetic and non-diabetic patients candidate for coronary artery bypass graft. BioImpacts : BI 3: 83–89.

146

REFERENCES

Pfeuffer, E, Mollner, S, Lancet, D, Pfeuffer, T. 1989. Olfactory adenylyl cyclase. Identification and purification of a novel enzyme form. The Journal of biological chemistry 264: 18803–18807.

Pierce, KL, Premont, RT, Lefkowitz, RJ. 2002. Seven-transmembrane receptors. Nature reviews. Molecular cell biology 3: 639–650.

Pilpel, Y, Lancet, D. 1999. The variable and conserved interfaces of modeled olfactory receptor proteins. Protein science : a publication of the Protein Society 8: 969–977.

Pitcher, JA, Inglese, J, Higgins, JB, Arriza, JL, Casey, PJ, Kim, C, Benovic, JL, Kwatra, MM, Caron, MG, Lefkowitz, RJ. 1992. Role of beta gamma subunits of G proteins in targeting the beta-adrenergic receptor kinase to membrane-bound receptors. Science (New York, N.Y.) 257: 1264–1267.

Pluznick, JL, Protzko, RJ, Gevorgyan, H, Peterlin, Z, Sipos, A, Han, J, Brunet, I, Wan, L, Rey, F, Wang, T, Firestein, SJ, Yanagisawa, M, Gordon, JI, Eichmann, A, Peti-Peterdi, J, Caplan, MJ. 2013. Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation. Proceedings of the National Academy of Sciences of the United States of America 110: 4410–4415.

Pronin, A, Levay, K, Velmeshev, D, Faghihi, M, Shestopalov, VI, Slepak, VZ. 2014. Expression of olfactory signaling genes in the eye. PloS one 9: e96435.

Pugh, E. N., Jr., and T. Lamb. 2000. Phototransduction in vertebrate rods and cones: Molecular mechanism of amplification, recovery and light adaptation, Molecular mechanism in visual transduction. Elsevier Science Publishers: p. 183–255.

Qin, D, Zheng, X, Jiang, Y. 2013. Apelin-13 induces proliferation, migration, and collagen I mRNA expression in human RPE cells via PI3K/Akt and MEK/Erk signaling pathways. Molecular vision 19: 2227–2236.

Rasche, S, Toetter, B, Adler, J, Tschapek, A, Doerner, JF, Kurtenbach, S, Hatt, H, Meyer, H, Warscheid, B, Neuhaus, EM. 2010. Tmem16b is specifically expressed in the cilia of olfactory sensory neurons. Chemical senses 35: 239–245.

Rasmussen, SGF, Choi, H, Rosenbaum, DM, Kobilka, TS, Thian, FS, Edwards, PC, Burghammer, M, Ratnala, VRP, Sanishvili, R, Fischetti, RF, Schertler, GFX, Weis, WI, Kobilka, BK. 2007. Crystal structure of the human beta2 adrenergic G-protein-coupled receptor. Nature 450: 383–387.

Rasmussen, SGF, DeVree, BT, Zou, Y, Kruse, AC, Chung, KY, Kobilka, TS, Thian, FS, Chae, PS, Pardon, E, Calinski, D, Mathiesen, JM, Shah, STA, Lyons, JA, Caffrey, M, Gellman, SH, Steyaert, J, Skiniotis, G, Weis, WI, Sunahara, RK, Kobilka, BK. 2011. Crystal structure of the beta2 adrenergic receptor-Gs protein complex. Nature 477: 549– 555.

Reichhart, N, Strauss, O. 2014. Ion channels and transporters of the retinal pigment epithelium. Experimental eye research 126: 27–37.

147

REFERENCES

Reubinoff, BE, Pera, MF, Fong, CY, Trounson, A, Bongso, A. 2000. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nature biotechnology 18: 399–404.

Rinaldi, A. 2007. The scent of life. The exquisite complexity of the sense of smell in animals and humans. EMBO reports 8: 629–633.

Rockman, HA, Koch, WJ, Lefkowitz, RJ. 2002. Seven-transmembrane-spanning receptors and heart function. Nature 415: 206–212.

Rodriguez, M, Luo, W, Weng, J, Zeng, L, Yi, Z, Siwko, S, Liu, M. 2014. PSGR promotes prostatic intraepithelial neoplasia and prostate cancer xenograft growth through NF-κB. Oncogenesis 3: e114.

Roepman, R, Wolfrum, U. 2007. Protein networks and complexes in photoreceptor cilia. Sub- cellular biochemistry 43: 209–235.

Rosenthal, R, Strauss, O. 2002. Ca2+-channels in the RPE. Advances in experimental medicine and biology 514: 225–235.

Rouquier, S, Giorgi, D. 2007. Olfactory receptor gene repertoires in mammals. Mutation research 616: 95–102.

Rovati, GE, Capra, V, Neubig, RR. 2007. The Highly Conserved DRY Motif of Class A G Protein-Coupled Receptors: Beyond the Ground State. Molecular Pharmacology 71: 959– 964.

Saito, H, Chi, Q, Zhuang, H, Matsunami, H, Mainland, JD. 2009. Odor coding by a Mammalian receptor repertoire. Science signaling 2: ra9.

Saito, H, Kubota, M, Roberts, RW, Chi, Q, Matsunami, H. 2004. RTP family members induce functional expression of mammalian odorant receptors. Cell 119: 679–691.

Sanz, G, Leray, I, Dewaele, A, Sobilo, J, Lerondel, S, Bouet, S, Grébert, D, Monnerie, R, Pajot-Augy, E, Mir, LM. 2014. Promotion of cancer cell invasiveness and metastasis emergence caused by olfactory receptor stimulation. PloS one 9: e85110.

Sanz, G, Thomas-Danguin, T, Hamdani, EH, Le Poupon, C, Briand, L, Pernollet, J, Guichard, E, Tromelin, A. 2008. Relationships between molecular structure and perceived odor quality of ligands for a human olfactory receptor. Chemical senses 33: 639–653.

Satin, J, Kehat, I, Caspi, O, Huber, I, Arbel, G, Itzhaki, I, Magyar, J, Schroder, EA, Perlman, I, Gepstein, L. 2004. Mechanism of spontaneous excitability in human embryonic stem cell derived cardiomyocytes. The Journal of Physiology 559: 479–496.

Schiaffino, MV, d'Addio, M, Alloni, A, Baschirotto, C, Valetti, C, Cortese, K, Puri, C, Bassi, MT, Colla, C, Luca, M de, Tacchetti, C, Ballabio, A. 1999. Ocular albinism: evidence for a defect in an intracellular signal transduction system. Nature genetics 23: 108–112.

148

REFERENCES

Schiaffino, MV, Tacchetti, C. 2005. The ocular albinism type 1 (OA1) protein and the evidence for an intracellular signal transduction system involved in melanosome biogenesis. Pigment cell research / sponsored by the European Society for Pigment Cell Research and the International Pigment Cell Society 18: 227–233.

Schmidt, RF, Lang, F, eds. 2007. Physiologie des Menschen. Mit Pathophysiologie. Berlin, Heidelberg: Springer Medizin Verlag Heidelberg.

Schmidt, RF, Schaible, H, Birbaumer, N, eds. 2006. Neuro- und Sinnesphysiologie. Berlin, Heidelberg: Springer Medizin Verlag Heidelberg.

Schmiedeberg, K, Shirokova, E, Weber, H, Schilling, B, Meyerhof, W, Krautwurst, D. 2007. Structural determinants of odorant recognition by the human olfactory receptors OR1A1 and OR1A2. Journal of structural biology 159: 400–412.

Schöneberg, T, Schulz, A, Biebermann, H, Hermsdorf, T, Römpler, H, Sangkuhl, K. 2004. Mutant G-protein-coupled receptors as a cause of human diseases. Pharmacology & therapeutics 104: 173–206.

Scicchitano, P, Carbonara, S, Ricci, G, Mandurino, C, Locorotondo, M, Bulzis, G, Gesualdo, M, Zito, A, Carbonara, R, Dentamaro, I, Riccioni, G, Ciccone, MM. 2012. HCN channels and heart rate. Molecules (Basel, Switzerland) 17: 4225–4235.

Sealfon, SC, ed. 1995. Receptor molecular biology. San Diego: Acad. Press.

Sedmak, T, Wolfrum, U. 2010. Intraflagellar transport molecules in ciliary and nonciliary cells of the retina. The Journal of cell biology 189: 171–186.

Shah, AS, White, DC, Emani, S, Kypson, AP, Lilly, RE, Wilson, K, Glower, DD, Lefkowitz, RJ, Koch, WJ. 2001. In vivo ventricular gene delivery of a beta-adrenergic receptor kinase inhibitor to the failing heart reverses cardiac dysfunction. Circulation 103: 1311–1316.

Shepherd, GM. 1994. Discrimination of molecular signals by the olfactory receptor neuron. Neuron 13: 771–790.

Shi, L, Liapakis, G, Xu, R, Guarnieri, F, Ballesteros, JA, Javitch, JA. 2002. Beta2 adrenergic receptor activation. Modulation of the proline kink in transmembrane 6 by a rotamer toggle switch. The Journal of biological chemistry 277: 40989–40996.

Shimamura, T, Shiroishi, M, Weyand, S, Tsujimoto, H, Winter, G, Katritch, V, Abagyan, R, Cherezov, V, Liu, W, Han, GW, Kobayashi, T, Stevens, RC, Iwata, S. 2011. Structure of the human histamine H1 receptor complex with doxepin. Nature 475: 65–70. Singer, MS. 2000. Analysis of the molecular basis for octanal interactions in the expressed rat 17 olfactory receptor. Chemical senses 25: 155–165.

Singer, MS, Shepherd, GM. 1994. Molecular modeling of ligand-receptor interactions in the OR5 olfactory receptor. Neuroreport 5: 1297–1300.

149

REFERENCES

Siu, FY, He, M, Graaf, C de, Han, GW, Yang, D, Zhang, Z, Zhou, C, Xu, Q, Wacker, D, Joseph, JS, Liu, W, Lau, J, Cherezov, V, Katritch, V, Wang, M, Stevens, RC. 2013. Structure of the human glucagon class B G-protein-coupled receptor. Nature 499: 444–449.

Smith-Thomas, L, Haycock, JW, Metcalfe, R, Boulton, M, Ellis, S, Rennie, IG, Richardson, PS, Palmer, I, Parsons, MA, Mac Neil, S. 1998. Involvement of calcium in retinal pigment epithelial cell proliferation and pigmentation. Current eye research 17: 813–822.

Smrcka, AV. 2008. G protein βγ subunits: Central mediators of G protein-coupled receptor signaling. Cellular and Molecular Life Sciences 65: 2191–2214.

Smrcka, AV, Lehmann, DM, Dessal, AL. 2008. G protein betagamma subunits as targets for small molecule therapeutic development. Combinatorial chemistry & high throughput screening 11: 382–395.

Solov'yov, IA, Chang, P, Schulten, K. 2012. Vibrationally assisted electron transfer mechanism of olfaction: myth or reality? Physical chemistry chemical physics : PCCP 14: 13861–13871.

Spehr, J, Gelis, L, Osterloh, M, Oberland, S, Hatt, H, Spehr, M, Neuhaus, EM. 2011. G protein-coupled receptor signaling via Src kinase induces endogenous human transient receptor potential vanilloid type 6 (TRPV6) channel activation. The Journal of biological chemistry 286: 13184–13192.

Spehr, M, Gisselmann, G, Poplawski, A, Riffell, JA, Wetzel, CH, Zimmer, RK, Hatt, H. 2003. Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science (New York, N.Y.) 299: 2054–2058.

Spehr, M, Wetzel, CH, Hatt, H, Ache, BW. 2002. 3-phosphoinositides modulate cyclic nucleotide signaling in olfactory receptor neurons. Neuron 33: 731–739.

Stephan, AB, Shum, EY, Hirsh, S, Cygnar, KD, Reisert, J, Zhao, H. 2009. ANO2 is the cilial calcium-activated chloride channel that may mediate olfactory amplification. Proceedings of the National Academy of Sciences of the United States of America 106: 11776–11781.

Stevens, RC, Cherezov, V, Katritch, V, Abagyan, R, Kuhn, P, Rosen, H, Wüthrich, K. 2013. The GPCR Network: a large-scale collaboration to determine human GPCR structure and function. Nature reviews. Drug discovery 12: 25–34.

Strader, CD, Fong, TM, Graziano, MP, Tota, MR. 1995. The family of G-protein-coupled receptors. The FASEB Journal 9: 745–754.

Strauss, O. 2005. The retinal pigment epithelium in visual function. Physiological reviews 85: 845–881. Stryer, L, Bourne, HR. 1986. G proteins: a family of signal transducers. Annual review of cell biology 2: 391–419.

Su, C, Chan, C, Chen, H, Wu, C, Hsiao, C, Lee, P, Lin, VC, Hung, C. 2014. Lutein inhibits the migration of retinal pigment epithelial cells via cytosolic and mitochondrial Akt

150

REFERENCES

pathways (lutein inhibits RPE cells migration). International journal of molecular sciences 15: 13755–13767.

Suzuki, M, Takaishi, S, Nagasaki, M, Onozawa, Y, Iino, I, Maeda, H, Komai, T, Oda, T. 2013. Medium-chain Fatty Acid-sensing Receptor, GPR84, Is a Proinflammatory Receptor. Journal of Biological Chemistry 288: 10684–10691.

Synnergren, J, Akesson, K, Dahlenborg, K, Vidarsson, H, Améen, C, Steel, D, Lindahl, A, Olsson, B, Sartipy, P. 2008. Molecular signature of cardiomyocyte clusters derived from human embryonic stem cells. Stem cells (Dayton, Ohio) 26: 1831–1840.

Tadevosyan, A, Vaniotis, G, Allen, BG, Hébert, TE, Nattel, S. 2012. G protein-coupled receptor signalling in the cardiac nuclear membrane: evidence and possible roles in physiological and pathophysiological function. The Journal of Physiology 590: 1313–1330.

Takahashi, K, Tanabe, K, Ohnuki, M, Narita, M, Ichisaka, T, Tomoda, K, Yamanaka, S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131: 861–872.

Talbert, DR, Doherty, KR, Trusk, PB, Moran, DM, Shell, SA, Bacus, S. 2014. A Multi- parameter In Vitro Screen in Human Stem Cell-Derived Cardiomyocytes Identifies Ponatinib-Induced Structural and Functional Cardiac Toxicity. Toxicological Sciences 143: 147–155.

Tan, Q, Zhu, Y, Li, J, Chen, Z, Han, GW, Kufareva, I, Li, T, Ma, L, Fenalti, G, Li, J, Zhang, W, Xie, X, Yang, H, Jiang, H, Cherezov, V, Liu, H, Stevens, RC, Zhao, Q, Wu, B. 2013. Structure of the CCR5 chemokine receptor-HIV entry inhibitor maraviroc complex. Science (New York, N.Y.) 341: 1387–1390.

Tawara, S. 1906. Das Reizleitungnssystem des Säugetierherzens: Fischer.Jena

Thompson, AA, Liu, W, Chun, E, Katritch, V, Wu, H, Vardy, E, Huang, X, Trapella, C, Guerrini, R, Calo, G, Roth, BL, Cherezov, V, Stevens, RC. 2012. Structure of the nociceptin/orphanin FQ receptor in complex with a peptide mimetic. Nature 485: 395–399.

Toops, KA, Tan, LX, Lakkaraju, A. 2014. A detailed three-step protocol for live imaging of intracellular traffic in polarized primary porcine RPE monolayers. Experimental eye research 124: 74–85.

Tortora, GJ, Derrickson, B, eds. 2011. Principles of anatomy & physiology: Vol 2 - Maintenance and continuity of the Human Body. Hoboken, N.J: Wiley.

Tortora, GJ, Derrickson, B, eds. 2012. Principles of anatomy & physiology. Hoboken, NJ: Wiley.

Touhara, K. 2007. Deorphanizing vertebrate olfactory receptors: recent advances in odorant- response assays. Neurochemistry international 51: 132–139.

Trapnell, C, Pachter, L, Salzberg, SL. 2009. TopHat: discovering splice junctions with RNA- Seq. Bioinformatics (Oxford, England) 25: 1105–1111.

151

REFERENCES

Trapnell, C, Roberts, A, Goff, L, Pertea, G, Kim, D, Kelley, DR, Pimentel, H, Salzberg, SL, Rinn, JL, Pachter, L. 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature protocols 7: 562–578.

Trapnell, C, Williams, BA, Pertea, G, Mortazavi, A, Kwan, G, van Baren, MJ, Salzberg, SL, Wold, BJ, Pachter, L. 2010. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature biotechnology 28: 511–515.

Trappe, H. 2010. Concept of the five 'A's for treating emergency arrhythmias. Journal of emergencies, trauma, and shock 3: 129–136.

Trojan, P, Krauss, N, Choe, H, Giessl, A, Pulvermüller, A, Wolfrum, U. 2008. Centrins in retinal photoreceptor cells: regulators in the connecting cilium. Progress in retinal and eye research 27: 237–259.

Ukhanov, K, Brunert, D, Corey, EA, Ache, BW. 2011. Phosphoinositide 3-Kinase-Dependent Antagonism in Mammalian Olfactory Receptor Neurons. Journal of Neuroscience 31: 273– 280.

Ulfig, N, ed. 2011. Kurzlehrbuch Histologie. Stuttgart: Thieme.

Ulven, T. 2012. Short-chain free fatty acid receptors FFA2/GPR43 and FFA3/GPR41 as new potential therapeutic targets. Frontiers in Endocrinology 3. van den Brink, Olivier W V, Delbridge, LM, Rosenfeldt, FL, Penny, D, Esmore, DS, Quick, D, Kaye, DM, Pepe, S. 2003. Endogenous cardiac opioids: enkephalins in adaptation and protection of the heart. Heart, lung & circulation 12: 178–187.

Vanderhaeghen, P, Schurmans, S, Vassart, G, Parmentier, M. 1997. Molecular cloning and chromosomal mapping of olfactory receptor genes expressed in the male germ line: evidence for their wide distribution in the human genome. Biochemical and biophysical research communications 237: 283–287.

Vaniotis, G, Allen, BG, Hébert, TE. 2011. Nuclear GPCRs in cardiomyocytes: an insider's view of β-adrenergic receptor signaling. American Journal of Physiology - Heart and Circulatory Physiology 301: H1754–H1764.

Veitinger, T, Riffell, JR, Veitinger, S, Nascimento, JM, Triller, A, Chandsawangbhuwana, C, Schwane, K, Geerts, A, Wunder, F, Berns, MW, Neuhaus, EM, Zimmer, RK, Spehr, M, Hatt, H. 2011. Chemosensory Ca 2+ Dynamics Correlate with Diverse Behavioral Phenotypes in Human Sperm. Journal of Biological Chemistry 286: 17311–17325.

Verbeurgt, C, Wilkin, F, Tarabichi, M, Gregoire, F, Dumont, JE, Chatelain, P, Newcomb, RD. 2014. Profiling of Olfactory Receptor Gene Expression in Whole Human Olfactory Mucosa. PloS one 9: e96333.

Vogl, A, Noe, J, Breer, H, Boekhoff, I. 2000. Cross-talk between olfactory second messenger pathways. European journal of biochemistry / FEBS 267: 4529–4535.

152

REFERENCES

Wacker, D, Wang, C, Katritch, V, Han, GW, Huang, X, Vardy, E, McCorvy, JD, Jiang, Y, Chu, M, Siu, FY, Liu, W, Xu, HE, Cherezov, V, Roth, BL, Stevens, RC. 2013. Structural features for functional selectivity at serotonin receptors. Science (New York, N.Y.) 340: 615–619.

Wang, C, Jiang, Y, Ma, J, Wu, H, Wacker, D, Katritch, V, Han, GW, Liu, W, Huang, X, Vardy, E, McCorvy, JD, Gao, X, Zhou, XE, Melcher, K, Zhang, C, Bai, F, Yang, H, Yang, L, Jiang, H, Roth, BL, Cherezov, V, Stevens, RC, Xu, HE. 2013a. Structural basis for molecular recognition at serotonin receptors. Science (New York, N.Y.) 340: 610–614.

Wang, C, Wu, H, Katritch, V, Han, GW, Huang, X, Liu, W, Siu, FY, Roth, BL, Cherezov, V, Stevens, RC. 2013b. Structure of the human smoothened receptor bound to an antitumour agent. Nature 497: 338–343.

Wang, J, Weng, J, Cai, Y, Penland, R, Liu, M, Ittmann, M. 2006a. The prostate-specific G- protein coupled receptors PSGR and PSGR2 are prostate cancer biomarkers that are complementary to alpha-methylacyl-CoA racemase. The Prostate 66: 847–857.

Wang, J, Wu, X, Simonavicius, N, Tian, H, Ling, L. 2006b. Medium-chain Fatty Acids as Ligands for Orphan G Protein-coupled Receptor GPR84. Journal of Biological Chemistry 281: 34457–34464.

Wang, K, Jiang, Y, Wang, W, Ma, J, Chen, M. 2015. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress. Biochemical and biophysical research communications 468: 541–547.

Wang, X, Liang, B, Skibsbye, L, Olesen, S, Grunnet, M, Jespersen, T. 2013c. GIRK Channel Activation Via Adenosine or Muscarinic Receptors Has Similar Effects on Rat Atrial Electrophysiology. Journal of Cardiovascular Pharmacology 62: 192–198.

Warne, T, Serrano-Vega, MJ, Baker, JG, Moukhametzianov, R, Edwards, PC, Henderson, R, Leslie, AGW, Tate, CG, Schertler, GFX. 2008. Structure of a beta1-adrenergic G-protein- coupled receptor. Nature 454: 486–491.

Weigle, B, Fuessel, S, Ebner, R, Temme, A, Schmitz, M, Schwind, S, Kiessling, A, Rieger, MA, Meye, A, Bachmann, M, Wirth, MP, Rieber, EP. 2004. D-GPCR: a novel putative G protein-coupled receptor overexpressed in prostate cancer and prostate. Biochemical and biophysical research communications 322: 239–249.

Weng, J, Wang, J, Hu, X, Wang, F, Ittmann, M, Liu, M. 2006. PSGR2, a novel G-protein coupled receptor, is overexpressed in human prostate cancer. International journal of cancer. Journal international du cancer 118: 1471–1480.

Wetzel, CH, Oles, M, Wellerdieck, C, Kuczkowiak, M, Gisselmann, G, Hatt, H. 1999. Specificity and sensitivity of a human olfactory receptor functionally expressed in human embryonic kidney 293 cells and Xenopus Laevis oocytes. The Journal of neuroscience : the official journal of the Society for Neuroscience 19: 7426–7433.

153

REFERENCES

White, JF, Noinaj, N, Shibata, Y, Love, J, Kloss, B, Xu, F, Gvozdenovic-Jeremic, J, Shah, P, Shiloach, J, Tate, CG, Grisshammer, R. 2012. Structure of the agonist-bound neurotensin receptor. Nature 490: 508–513.

Wiese, H, Gelis, L, Wiese, S, Reichenbach, C, Jovancevic, N, Osterloh, M, Meyer, HE, Neuhaus, EM, Hatt, HH, Radziwill, G, Warscheid, B. 2015. Quantitative phosphoproteomics reveals the protein tyrosine kinase Pyk2 as a central effector of olfactory receptor signaling in prostate cancer cells. Biochimica et biophysica acta 1854: 632–640.

Williams, AR. 1973. A possible alteration in the permeability of ascites cell membranes after exposure to acoustic microstreaming. Journal of cell science 12: 875–885.

Wobus, AM, Wallukat, G, Hescheler, J. 1991. Pluripotent mouse embryonic stem cells are able to differentiate into cardiomyocytes expressing chronotropic responses to adrenergic and cholinergic agents and Ca2+ channel blockers. Differentiation; research in biological diversity 48: 173–182.

Wolf, S, Grünewald, S. 2015. Sequence, structure and ligand binding evolution of rhodopsin- like G protein-coupled receptors: a crystal structure-based phylogenetic analysis. PloS one 10: e0123533.

Wolf, S. 2009. Simulationen zur Struktur und Funktion heptahelikaler Transmembranproteine. Dissertation.

Wong, ST, Trinh, K, Hacker, B, Chan, GC, Lowe, G, Gaggar, A, Xia, Z, Gold, GH, Storm, DR. 2000. Disruption of the type III adenylyl cyclase gene leads to peripheral and behavioral anosmia in transgenic mice. Neuron 27: 487–497.

Wright, AF, Chakarova, CF, Abd El-Aziz, MM, Bhattacharya, SS. 2010. Photoreceptor degeneration: genetic and mechanistic dissection of a complex trait. Nature Reviews Genetics 11: 273–284.

Wu, B, Chien, EYT, Mol, CD, Fenalti, G, Liu, W, Katritch, V, Abagyan, R, Brooun, A, Wells, P, Bi, FC, Hamel, DJ, Kuhn, P, Handel, TM, Cherezov, V, Stevens, RC. 2010. Structures of the CXCR4 chemokine GPCR with small-molecule and cyclic peptide antagonists. Science (New York, N.Y.) 330: 1066–1071.

Wu, H, Wacker, D, Mileni, M, Katritch, V, Han, GW, Vardy, E, Liu, W, Thompson, AA, Huang, X, Carroll, FI, Mascarella, SW, Westkaemper, RB, Mosier, PD, Roth, BL, Cherezov, V, Stevens, RC. 2012a. Structure of the human κ-opioid receptor in complex with JDTic. Nature 485: 327–332.

Wu, H, Wang, C, Gregory, KJ, Han, GW, Cho, HP, Xia, Y, Niswender, CM, Katritch, V, Meiler, J, Cherezov, V, Conn, PJ, Stevens, RC. 2014. Structure of a class C GPCR metabotropic glutamate receptor 1 bound to an allosteric modulator. Science (New York, N.Y.) 344: 58–64.

Wu, J, Xie, N, Zhao, X, Nice, EC, Huang, C. 2012b. Dissection of aberrant GPCR signaling in tumorigenesis--a systems biology approach. Cancer genomics & proteomics 9: 37–50.

154

REFERENCES

Wunderlich, KA, Tanimoto, N, Grosche, A, Zrenner, E, Pekny, M, Reichenbach, A, Seeliger, MW, Pannicke, T, Perez, M. 2015. Retinal functional alterations in mice lacking intermediate filament proteins glial fibrillary acidic protein and vimentin. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 29: 4815–4828.

Xia, C, Ma, W, Wang, F, Hua Sb, Liu, M. 2001. Identification of a prostate-specific G-protein coupled receptor in prostate cancer. Oncogene 20: 5903–5907.

Xiao, Y, Gomez, AM, Morgan, JP, Lederer, WJ, Leaf, A. 1997. Suppression of voltage-gated L-type Ca2+ currents by polyunsaturated fatty acids in adult and neonatal rat ventricular myocytes. Proceedings of the National Academy of Sciences 94: 4182–4187.

Xin, M, Olson, EN, Bassel-Duby, R. 2013. Mending broken hearts: cardiac development as a basis for adult heart regeneration and repair. Nature reviews. Molecular cell biology 14: 529–541.

Xu, LL, Stackhouse, BG, Florence, K, Zhang, W, Shanmugam, N, Sesterhenn, IA, Zou, Z, Srikantan, V, Augustus, M, Roschke, V, Carter, K, McLeod, DG, Moul, JW, Soppett, D, Srivastava, S. 2000. PSGR, a novel prostate-specific gene with homology to a G protein- coupled receptor, is overexpressed in prostate cancer. Cancer research 60: 6568–6572.

Xu, LL, Sun, C, Petrovics, G, Makarem, M, Furusato, B, Zhang, W, Sesterhenn, IA, McLeod, DG, Sun, L, Moul, JW, Srivastava, S. 2006. Quantitative expression profile of PSGR in prostate cancer. Prostate cancer and prostatic diseases 9: 56–61.

Yamamoto, S, Kawamura, K, James, TN. 1998. Intracellular distribution of adenylate cyclase in human cardiocytes determined by electron microscopic cytochemistry. Microscopy research and technique 40: 479–487.

Yamazaki, T, Komuro, I, Kudoh, S, Zou, Y, Shiojima, I, Hiroi, Y, Mizuno, T, Maemura, K, Kurihara, H, Aikawa, R, Takano, H, Yazaki, Y. 1996. Endothelin-1 is involved in mechanical stress-induced cardiomyocyte hypertrophy. The Journal of biological chemistry 271: 3221–3228.

Young, JM, Endicott, RM, Parghi, SS, Walker, M, Kidd, JM, Trask, BJ. 2008. Extensive copy-number variation of the human olfactory receptor gene family. American journal of human genetics 83: 228–242.

Yu, J, Vodyanik, MA, Smuga-Otto, K, Antosiewicz-Bourget, J, Frane, JL, Tian, S, Nie, J, Jonsdottir, GA, Ruotti, V, Stewart, R, Slukvin, II, Thomson, JA. 2007a. Induced pluripotent stem cell lines derived from human somatic cells. Science (New York, N.Y.) 318: 1917– 1920.

Zhang, C, Srinivasan, Y, Arlow, DH, Fung, JJ, Palmer, D, Zheng, Y, Green, HF, Pandey, A, Dror, RO, Shaw, DE, Weis, WI, Coughlin, SR, Kobilka, BK. 2012a. High-resolution crystal structure of human protease-activated receptor 1. Nature 492: 387–392.

155

REFERENCES

Zhang, JH, Barr, VA, Mo, Y, Rojkova, AM, Liu, S, Simonds, WF. 2001. Nuclear localization of G protein beta 5 and regulator of G protein signaling 7 in neurons and brain. The Journal of biological chemistry 276: 10284–10289.

Zhang, K, Zhang, J, Gao, Z, Zhang, D, Zhu, L, Han, GW, Moss, SM, Paoletta, S, Kiselev, E, Lu, W, Fenalti, G, Zhang, W, Müller, CE, Yang, H, Jiang, H, Cherezov, V, Katritch, V, Jacobson, KA, Stevens, RC, Wu, B, Zhao, Q. 2014. Structure of the human P2Y12 receptor in complex with an antithrombotic drug. Nature 509: 115–118.

Zhang, X, Bedigian, AV, Wang, W, Eggert, US. 2012b. G protein-coupled receptors participate in cytokinesis. Cytoskeleton (Hoboken, N.J.) 69: 810–818.

Zhang, X, La Cruz, O de, Pinto, JM, Nicolae, D, Firestein, S, Gilad, Y. 2007. Characterizing the expression of the human olfactory receptor gene family using a novel DNA microarray. Genome biology 8: R86.

Zhao, W, Ho, L, Varghese, M, Yemul, S, Dams-O'Connor, K, Gordon, W, Knable, L, Freire, D, Haroutunian, V, Pasinetti, GM. 2013a. Decreased level of olfactory receptors in blood cells following traumatic brain injury and potential association with tauopathy. Journal of Alzheimer's disease : JAD 34: 417–429.

Zhuang, H, Matsunami, H. 2007. Synergism of Accessory Factors in Functional Expression of Mammalian Odorant Receptors. Journal of Biological Chemistry 282: 15284–15293.

Zhuang, H, Matsunami, H. 2008. Evaluating cell-surface expression and measuring activation of mammalian odorant receptors in heterologous cells. Nature Protocols 3: 1402–1413.

Zhuang, X, Belluscio, L, Hen, R. 2000. G(olf)alpha mediates dopamine D1 receptor signaling. The Journal of neuroscience : the official journal of the Society for Neuroscience 20: RC91.

Zigman, JM, Westermark, GT, LaMendola, J, Boel, E, Steiner, DF. 1993. Human G(olf) alpha: complementary deoxyribonucleic acid structure and expression in pancreatic islets and other tissues outside the olfactory neuroepithelium and central nervous system. Endocrinology 133: 2508–2514.

156

APPENDIX

9 APPENDIX

9.1 List of abbreviations

AC-III adenylyl cyclase type III ATP adenosine triphosphate AR adrenergic receptor AV node atrioventricular node cAMP cyclic adenosine monophosphate cDNA complementary deoxyribonucleic acid Ch choroid CM cardiomyocytes CNG cyclic nucleotide- gated DNA deoxyribonucleic acid DMSO Dimethyl sulfoxide DRG dorsal root ganglion DTT Dithiothreitol EC50 half maximal effective concentration EGTA ethylene glycol tetraacetic acid ERK extracellular signal-regulated kinase FFA free fatty acid FPKM fragments per kilobase of exon per million fragments mapped fRPE fetal retinal pigment epithelium GFP Green fluorescent protein Gi inhibitory heterotrimeric G protein GIRK G protein-coupled inwardly-rectifying potassium channels GCL ganglion cell layer Golf olfactory heterotrimeric G protein GPCR G protein-coupled receptors Gs stimulatory heterotrimeric G protein HCN hyperpolarization-activated cyclic nucleotide-gated channels Hg19 human reference genome 19 HEK human embryonic kidney cells hESC human embryonic stem cell hIPSC human induced pluripotent stem cell HRP Horseradish peroxidase IC50 half maximal inhibitory concentration IGV Integrative Genomic Viewer INL inner nuclear layer IPL inner plexiform layer IS inner segment kDa kilodalton LNCAP prostate cancer cell line mAChR2 muscarinic acetylcholine receptor M2 MCFA medium chain fatty acid MD molecular dynamics NCX Na+/Ca2+ exchanger 157

APPENDIX

NFL Nerve fiber layer NGS next generation sequencing ONL outer nuclear layer OPL outer plexiform layer OR olfactory receptor OS outer segment OSN olfactory sensory neurons PBS phosphate buffered saline PCR polymerase chain reaction pen/strep penicillin/streptomycin PKA protein kinase A PLC phospholipase C PSGR prostate specific G protein-coupled receptor PUFA polyunsaturated fatty acid REEP receptor expression-enhancing proteins RNA ribonucleic acid RPE retinal pigment epithelium RT reverse transcriptase RYR ryanodine receptors SA node sinoatrial node SEM standard error of mean SERCA sarco-endoplasmic reticulum calcium-ATPase SR sarcoplasmic reticulum TG trigeminal ganglia TM transmembrane UTR untranslated region

158

APPENDIX

9.2 List of figures

Figure 1. Phylogenetic tree of the human GPCR superfamily. Figure 2. Structure of ORs. Figure 3. The human olfactory system. Figure 4. Anatomy of the human heart. Figure 5. The human eye and the retinal cell types. Figure 6. Histology and functions of the retinal pigment epithelium (RPE). Figure 7. Generation of OR51E2-mutants by Overlap Extension PCR. Figure 8. Expression of OR51E1 in the human heart tissue and stem-cell derived cardiomyocytes. Figure 9. Ligand spectrum of OR51E1. Figure 10. OR51E1-activation induces negative chronotropic effects in stem-cell derived cardiomyocytes. Figure 11. OR51E1 dependent induction of negative chronotropic effects in stem-cell derived CMs by nonanoic acid. Figure 12 OR51E1 signaling in CMs. Figure 13. Nonanoic acid induces transient negative inotropic effects in preparations of explanted human ventricles. Figure 14. Expression patterns of housekeeping genes in different human tissues. Figure 15. Comparison of mRNAseq data from retina samples and reference tissues. Figure 16. OR expression in the human retinae. Figure 17. RT-PCR validation of RNAseq results on OR expression. Figure 18. Indirect immunofluorescence of OR6B2/3 in the human retina. Figure 19. Indirect immunofluorescence of OR2W3 in the human retina. Figure 20. OR5P3 localization in human retina. Figure 21. OR10AD1 localization in human retina. Figure 22. OR51E2 is expressed in human retinal pigment epithelial cells. Figure 23. OR51E2 activation induces Ca2+ signals in human RPE cells. Figure 24. OR51E2 signaling in RPE cells. Figure 25. Activation of OR51E2 promotes proliferation and migration of RPE cells. Figure 26. OR51E2 structural model with a close-up of the central binding site. Figure 27. Cell-surface expression of wild type and mutant OR51E2 receptors. Figure 28. Dose-response curves of OR51E2 variants. 159

APPENDIX

9.3 List of tables

Table 1. Primers used for gene expression analysis. Table 2. Primers used for mutations. Table 3. Summary of reanalyzed Next Generation Sequencing data. Table 4. Dilution of the appropriated antibody. Table 5 Dilution of antibodies used for immunofluorescence staining. Table 6. Free fatty acid profile of human plasma and epicardial adipose tissue. Table 7. Effects of mutation of the residues flanking the central binding site on β-ionone binding.

160

APPENDIX

9.4 Curriculum vitae

Personal Information

Name: Nikolina Jovancevic E-Mail: [email protected] Date of birth: 31.12.1986 Place of birth: Zadar, Croatia Nationality: German

Academic career

Since 2012 Ph.D research fellow at the International Graduate School of Biology Thesis work: Department of Cellphysiology, Ruhr- University Bochum, Germany Topic:‘Functional and structural characterization of olfactory receptors in human heart and eye’ Supervisor: Prof. Dr. Dr. Dr. med. H. Hatt

03/2012 Graduation Master of Science in Biology Supervisor of diploma thesis: Prof. Dr. Dr. Dr. Hanns Hatt, Department of Cellular Physiology, Ruhr-University Bochum Topic of thesis: ‘Overexpression and purification of recombinant olfactory receptor proteins in human cell lines ’

2009 – 2012 Student of Biology at the Ruhr-University Bochum, Germany

05/2009 Graduation Bachelor of Science in Molecular Biology Company Rhein Biotech GmbH, Düsseldorf Topic of thesis: ‘Production of glycoproteins with reduced glycochains in the yeast Hansenula polymorpha’

2005 – 2009 Sudent of Molecular Biologie at the University of Applied Sciences, Fachhochschule Gelsenkirchen

School training

2003-2005 Käthe-Kollwitz-Berufskolleg, Oberhausen

1997-2003 Friedrich Ebert Realschule, Oberhausen

1993-1997 Steinbrinkschule, Elementary School, Oberhausen

161

APPENDIX

9.5 Publication list

First authorship

Functional Characterization of the Odorant Receptor 51E2 in Human Melanocytes Lian Gelis, Nikolina Jovancevic, Lian Gelis, Sophie Veitinger, Bhubaneswar Mandal, Hans- Dieter Arndt, Eva M. Neuhaus and Hanns Hatt (Journal of Biological Chemistry; in revision)

Dynamical Binding Modes Determine Agonistic and Antagonistic Ligand Effects in the Prostate-Specific G-Protein Coupled Receptor (PSGR) Steffen Wolf, Nikolina Jovancevic, Lian Gelis, Sebastian Pietsch, Hanns Hatt and Klaus Gerwert (Scientific Reports; submitted)

Medium-chain Fatty Acids Modulate Myocardial Function via a Cardiac Odorant Receptor Nikolina Jovancevic, Andreas Dendorfer, Matthias Matzkies, Marketa Kovarova, Julia Heckmann, Markus Osterloh, Mario Böhm, Lea Weber, Filomain Nguemo, Judith Semmler, Jürgen Hescheler, Hendrik Milting, Erwin Schleicher, Lian Gelis and Hanns Hatt (Circulation Research; submitted)

Deep Sequencing of human retinae reveals expression of odorant receptors in the eye Nikolina Jovancevic, Kirsten Wunderlich, Claudia Haering, Caroline Flegel, Désirée Maßberg, Markus Weinrich, Lea Weber, Anselm Kampig, Günter Gisselmann, Uwe Wolfrum, Hanns Hatt and Lian Gelis (Investigative Ophthalmology & Visual Science; submitted)

Functional Characterization of the Odorant Receptor 51E2 in Human RPE cells Nikolina Jovancevic, Markus Weinrich, Annika Simons, Soumaya Khalfaoui, Markus Kernt, Anselm Kampig, Günter Gisselmann, Hanns Hatt and Lian Gelis (in preparation)

Co-authorship Functional Characterization of Olfactory Receptors in Human Prostate Epithelial Cells Désirée Maßberg, Nikolina Jovancevic, Annika Simon, Anne Offermann, Aria Baniahmad, Sven Perner, Thanakorn Pungsrinont, Katarina Luko, Burkhardt Ubrig, Markus Heiland, Stathis Philippou, Janine Altmüller, Günter Gisselmann, Lian Gelis und Hanns Hatt (Oncotarget; in revision)

Quantitative phosphoproteomics reveals the protein tyrosine kinase Pyk2 as a central effector of olfactory receptor signaling in prostate cancer cells. Heike Wiese, Lian Gelis, Sebastian Wiese, Christa Reichenbach, Nikolina Jovancevic , Markus Osterloh, Helmut E. Meyer, Eva M. Neuhaus, Hanns Hatt, Gerald Radziwill, Bettina Warscheid (Biochim Biophys Acta. 2015 Jun;1854(6):632-40)

162

APPENDIX

9.6 Danksagung An dieser Stelle möchte ich mich bei all jenen bedanken, die einen wesentlichen Beitrag zum Gelingen meiner Promotionsarbeit geleistet haben.

Mein ganz besonderer Dank gilt meinem Doktorvater Herrn Prof. Hanns Hatt, der es mir ermöglichte an diesem interessanten Promotionsthema ohne irgendwelche Einschränkungen arbeiten zu können. Dafür dass es kein „Nein“ oder „das geht aber nicht“ gabe, sondern ich immer Versuche, die ich unbedingt machen wollte, ausprobieren durfte, auch wenn sie zum Scheitern verurteilt waren und dass wenn ich vor einem Problem stand, ich mich auf Prof. Hatts Lösungsvorschläge verlassen konnte oder er kannte direkt die richtige Person, die man fragen konnte. Zudem hat er mich immer motiviert und war zudem ein witziger Gesprächspartner. Somit danke an den besten Chef, den ich je hatte oder vermutlich haben werde.

Herrn Prof. Stefan Wiese danke ich für das Interesse an dieser Promotionsarbeit, die Übernahme des Korreferats und für das Wissen, dass ich bei Problemen hätte zu ihm kommen können.

Bei meiner Betreuerin-Chefin-großen Schwestern-Freundin Dr. Lian Gelis möchte ich mich im Besonderen bedanken. Wir waren ein tolles Team während ihrer Zeit am Lehrstuhl und sind es glücklicherweise auch geblieben, deswegen möchte ich mich sowohl für die Unterstützung, Motivation und Freundschaft für die Zeit vor Bayer, währenddessen und bis zum Schluss bedanken. Wir haben uns einfach super ergänzt trotzt oder grade wegen unserer speziellen Arbeitsweise/Zeitplanung. Ich bin sehr glücklich darüber, dass ich durch Lians Schule gegangen bin. Ich hätte es einfach nicht besser treffen können.

Zudem möchte ich mich bei Dr. Elena Guschina für die anfängliche Betreuung, Freundschaft und Hilfe bedanken.

Im Besonderen möchte ich mich auch bei den tollen Teresis bedanken. Genauer gesagt, möchte ich mich bei Dr. Teresa Tsai fürs Korrekturlesen auch zu unpassendsten Zeiten, dafür dass sie eine super Bürofreundin war und dass sie mir immer zugehört hat, wenn ich mich abreagieren musste. Sowie bei Dr. Desiree Massberg möchte ich mich für die Hilfe bis in den letzten Stunden, für die Diskussionen, Freundschaft und dass sie da war als ich sie dringend gebraucht habe, bedanken.

Für jegliche Hilfestellungen bei meinen zahlreichen wissenschaftlichen Fragen möchte ich mich bei Dr. Günter Gisselmann bedanken.

Für die Kooperationsbereitschaft möchte ich mich bei Prof. Andreas Dendorfer, Prof. Klaus Gerwert, Prof. Jürgen Hescheler, Prof. Anselm Kampig, Prof. Hendrik Milting und Prof. Uwe Wolfrum bedanken. Da durch diese Zusammenarbeit die Projekt erst möglich waren bzw. den besonderen Schliff bekommen haben. Dabei möchte ich mich besonders bei Dr.Steffen Wolf,

163

APPENDIX

Dr. Kirsten Wunderlich und Matthias Matzkies für die Zusammenarbeit und für das schnelle und freundlich beantworten meiner zahlreichen (vielleicht manchmal nervigen) Fragen/Mails bedanken. Ich danke auch den Postdoc und Doktoranten der anderen Lehrstühlen an der RUB für den wissenschaftlichen Austausch und die Zusammenarbeit.

Des Weiteren möchte ich mich für die finanzielle Unterstützung bei der Heinrich und Alma Vogelsang Stiftung bedanken.

Weiterhin möchte ich mich bei Thomas Lichtleitner, Simon Pyschny Franziska Mößler, Jasmin Gerkrath, Frau Müller, Farideh Salami, Andrea Stoeck für jegliche technische Unterstützung bedanken. Vor allem weil sie mit viel Humor mir die langweiligen Arbeiten abgenommen haben und tolle Arbeitskollegen/Freunde sind/waren. Zudem danke ich Frau Ulrike Thomes für die Unterstützung in administrativen Angelegenheiten.

Mein herzlichster Dank gilt meine Uni-Mädels (Lea, Ninthu, Claudia, Ivy, Caro etc.). Wir hatten eine schöne Zeit zusammen und es hätte meiner Meinung nach in dieser Konstellation immer so weiter gehen können. Insbesondere möchte ich mich aber bei meiner Uni-Ehefrau Jazz bedanken. Für den ganzen Spaß, die Verrücktheiten, die Unterstützung und für die tolle Freundschaft während der letzten Jahre und hoffentlich auch der nächsten 100 Jahre bedanken. Bei den Jungs (Paul, Fabian Stavros, Leopoldo, meinen Lieblingszombie Paul etc.) möchte ich mich für die Zeit, während der sich mich nicht zur Weißglut getrieben haben, sonder mit ihrem Humor zum Lachen gebracht haben, führ die die spaßige Ablenkung und natürlich für die wissenschaftlichen Diskussionen bedanken. Im Besonderen möchte ich mich bei dem besten Uni-Ehemann Benni für die guten und schlechten Tage an den er einfach nur da war bedanken. Desweiteren danke ich Philipp für die tolle Freundschaft und in Kombination mit Marian für die beste Mensabegleitung und die alternativen Gespräche.

Für die freundliche Arbeitsatmosphäre, Hilfsbereitschaft und positive Ablenkung möchte ich den Kids/Studenten (Annika, Markus, Jasmine, Klaudia, Julia, Felix, Adian, Max, Irina etc.) bedanken und hier ins Besondere bei Sebastian für sein motivierendes charmantes Lächeln und die positive Ablenkung während der stressigen Schreibphase. Zudem Danke ich meinen Master-Mädels (Soumaya, Sherife, Julia etc) und vor allem Dilijana für die super Freundschaft und dafür dass sie der beste fitness coach in der letzten Zeit war.

Nicht zuletzt möchte ich mich aus tiefsten Herzen bei meinen direkten und indirekten Verwandten, die mich immer unterstützt und motiviert haben, bedanken. Vor allem möchte ich mich bei den tollsten Eltern der Welt, meinen Eltern, dafür bedanken, dass sie mir den Rücken freigehalten haben und immer mit so viel Humor und Liebe Unterstützt haben. Bei meiner Schwester, der besten Schwester der Welt, möchte ich mich für die Unterstützung, Verrücktheit und dafür dass sie gesorgt hat, dass ich noch ein Leben neben der Uni habe bedanken. Genauso bedanke ich mich bei meinen Cousinen, Cousins und ins Besondern bei meinen Neffen (Luka und Leon) für die ganze positive Energie. Hvala vam za sve! 164

APPENDIX

9.7 Erklärung

Hiermit erkläre ich, dass ich die Arbeit selbständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völlig übereinstimmende Exemplare. Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den

Nikolina Jovancevic

165