Molecular Dissection of G-Protein Coupled Receptor Signaling and Oligomerization

Home , Adenosine A2B receptor, Bradykinin receptor, Cyclic AMP receptors, GABA receptor, Gs alpha subunit, Neuromedin U receptor

MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR SIGNALING AND OLIGOMERIZATION

MICHAEL RIZZO A Dissertation Submitted to the Graduate Faculty of WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY Biology December, 2019 Winston-Salem, North Carolina

Approved By: Erik C. Johnson, Ph.D. Advisor Wayne E. Pratt, Ph.D. Chair Pat C. Lord, Ph.D. Gloria K. Muday, Ph.D. Ke Zhang, Ph.D.

ACKNOWLEDGEMENTS

I would first like to thank my advisor, Dr. Erik Johnson, for his support, expertise, and leadership during my time in his lab. Without him, the work herein would not be possible. I would also like to thank the members of my committee, Dr. Gloria Muday, Dr.

Ke Zhang, Dr. Wayne Pratt, and Dr. Pat Lord, for their guidance and advice that helped improve the quality of the research presented here.

I would also like to thank members of the Johnson lab, both past and present, for being valuable colleagues and friends. I would especially like to thank Dr. Jason Braco,

Dr. Jon Fisher, Dr. Jake Saunders, and Becky Perry, all of whom spent a great deal of time offering me advice, proofreading grants and manuscripts, and overall supporting me through the ups and downs of the research process.

Finally, I would like to thank my family, both for instilling in me a passion for knowledge and education, and for their continued support. In particular, I would like to thank my wife Emerald – I am forever indebted to you for your support throughout this process, and I will never forget the sacrifices you made to help me get to where I am today.

TABLE OF CONTENTS

ACKNOWLEDGEMENTS………………………………………………………………ii

TABLE OF CONTENTS………………………………………………………………...iii

LIST OF ABBREVIATIONS…………………………………………………………….v

LIST OF TABLES………………………………………………………………………..x

LIST OF FIGURES………………………………………………………………………xi

ABSTRACT……………………………………………………………………………..xii

CHAPTER I: G-protein coupled receptors– A review of structure-function relationships critical for receptor signaling ……………………………………..………………………1

REFERENCES…………………………………………………………………..37

CHAPTER II: Unexpected role of a conserved domain in extracellular loop 1 in G protein coupled receptor trafficking……………………………………………………...56

ABSTRACT……………………………………………………………………...57

INTRODUCTION……………………………………………………………….58

METHODS………………………………………………………………………60

RESULTS………………………………………………………………………..63

DISCUSSION……………………………………………………………………68

REFERENCES…………………………………………………………………..72

iii

CHAPTER III: Homodimerization of Drosophila Class A neuropeptide GPCRs:

Evidence for conservation of GPCR dimerization throughout metazoan evolution…….89

ABSTRACT……………………………………………………………………..90

INTRODUCTION……………………………………………………………….91

METHODS………………………………………………………………………97

RESULTS………………………………………………………………………100

DISCUSSION…………………………………………………………………..104

REFERENCES…………………………………………………………………108

CHAPTER IV: Conclusions and future directions……………….…………………….125

REFERENCES…………………………………………………………………129

CURRICULUM VITAE………………………………………………………………..130

LIST OF ABBREVIATIONS

5HT 5 Hydroxytryptophan

A2A Adenosine receptor 2A

A3 Adenosine Adenosine receptor 3

AC Adenylyl cyclase

AKHR AKH receptor

AM Adrenomedullin

AMP Adenosine monophosphate

ANOVA Analysis of variance statistical models

AOI Area of interest

AstCR2 Drosophila allatostatin C receptor 2

AT1R Angiotensin 1 receptor

B1AR Adrenergic receptor beta 1

B2AR Adrenergic receptor beta 2

BiFC Biomolecular fluorescence complementation

BK 2R Bradykinin receptor 2

BLAST Basic local alignment search tool

BN-PAGE Blue native polyacrylamide gel electrophoresis

BRET Bioluminescent resonance energy transfer

C5aR Complement component 5a receptor

cAMP Cyclic adenosine monophosphate

CCR 2b Chemokine receptor type 2b

CCR 5 Chemokine receptor type 5

CFP Cyan flourescent protein cGMP Cyclic guanosine monophosphate

CGRP Calcitonin gene-related peptide

CHO Chinese hamster ovary cells

CLR Calcitonin-like receptor

Co-IP Co-immunoprecipitation

CPS Counts per second

CRD Cysteine-rich domain

CRE cAMP response elements

CREB cAMP response element-binding protein

CRZR Corazonin receptor

CXCR4 C-X-C chemokine receptor type 4

D2R Dopamine receptor D2

DAF Abnormal Dauer formation

DAG Diacylglycerol

DMEM Dulbecco’s modified Eagle medium

EL Extracellular loop

EPAC Exchange protein activated by cyclic-AMP

ER Endoplasmic reticulum

FRET Fluorescent resonance energy transfer

FSHR Follicle stimulating hormone receptor

GABA Gamma aminobutyric acid

GALR1 Galanin receptor

GPCR G protein-coupled receptor

GDP Guanosine diphosphate

GEF Guanine nucleotide exchange factor

GFP Green fluorescent protein

GIPs GPCR interacting protein

GIRK G protein-gated inwardly rectifying potassium

GMP Guanosine monophosphate

GnRH Gonadotropin releasing hormone

GRKs G protein-coupled receptor kinases

GRP Gastrin-releasing peptide

GTP Guanosine triphosphate

H1R Histamine receptor 1

H2R Histamine receptor 2

HA Hemaglutinin

HEK Human embryonic kidney cells

IP 3 Inositol triphosphate

LH Luteinizing hormone

LK Leucokinin

M1R Muscarinic acetylcholine receptor 1

M3R Muscarinic acetylcholine receptor 3

MAPK Mitogen activated protein kinase mGlu 2R Metabotropic glutamate receptor 2

NFkB Nuclear factor kappa-light-chain-enhancer of B cells

vii

NK1R Neurokinin 1 Receptor

NK2R Neurokinin 2 Receptor

NKA Neurokinin A

NMU Neuromedin U

NPFR Drosophila NPF receptor

NPY Neuropeptide Y

ORF Open reading frame

OX 1 Orexin receptor 1

PCR Polymerase chain reaction

PIP 2 Phosphatidylinositol 4,5-bisphosphate

PK1R Drosophila pyrokinin receptor 1

PKA Protein kinase A

PKC Protein kinase C

PLC Phospholipase C

ProcR Proctolin receptor

PSD-95 Postsynaptic density protein 95

RAMPs Receptor-activity modifying proteins

RCP Receptor component protein

RGS Regulators of G-protein signaling

SpIDA Spatial intensity distribution analysis

SPRINP Single primer reactions in parallel

SRE-Luc Serum response element

SSTR2 Somatostatin receptor 2

viii

T1R1 Taste receptor type 1 receptor 1

T1R3 Taste receptor type 1 receptor 3

T2R Taste receptor type 2

TKR86C Tachykinin receptor at 86C

TM Transmembrane domain

TR-FRET Time-resolved fluorescence resonance energy transfer

TRH Thyrotropin-releasing hormone

TSHR Thyroid stimulating hormone receptor

VFT Venus fly trap domain

WGA Wheat germ agglutinin

YFP Yellow fluorescent protein

α2b -AR Alpha-2B adrenergic receptor

β2AR Beta-2 adrenergic receptor

LIST OF TABLES

Table II.1: Comparison of representative extracellular loop 1 sequences across Class A

GPCR subfamilies………………………………………………………………………77

Table III.1: Receptors utilized in FRET dimer screen………………………………...122

Table III.2: List of primers used for directional cloning of receptor cDNA into pcDNA3

CFP or pcDNA3 YFP expression vectors………………………………………………123

LIST OF FIGURES

FIGURE I.1: Two-state model of GPCR activation……………………………………54

FIGURE I.2: Functional importance of GPCR heterodimerization…………………….55

FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan residue exhibits high conservation in Class A GPCR receptor subfamilies…………….79

FIGURE II.2: Mutagenesis of conserved tryptophan residue in LKR ECL1 ablates receptor signaling………………………………………………………………………..80

FIGURE II.3: Leucine substitution for the conserved tryptophan residue in extracellular loop 1 leads to a loss of function in multiple receptor types…………………………….82

FIGURE II.4: Substitution of the conserved tryptophan residue to leucine ablates constitutive activity in a constitutively active AKHR mutant…………………………...84

FIGURE II.5: The WxFG motif is critical for proper receptor trafficking..……………85

FIGURE II.6: Putative tertiary structures of wild type LKR and mutant W101L are superimposed to identify gross changes in receptor topology…………………………...88

FIGURE III.1: Demonstration of acceptor-photobleaching FRET assay……………..116

FIGURE III.2: Verification of experimental system………………………………….117

FIGURE III.3: Multiple Drosophila Class A neuropeptide receptors exhibit FRET responses consistent with homodimerization…………………………………………...119

FIGURE III.S1: Verification of signaling in fluorophore tagged receptors...... 124

ABSTRACT

G protein coupled receptors (GPCRs) are a superfamily of transmembrane proteins responsible for transducing extracellular stimuli into intracellular responses.

GPCRs are indispensable to a vast variety of distinct physiologies and behaviors and represent approximately 50% of all human drug targets. However, considerable debate exists as to the structural basis for GPCR activation, with a classical monomeric (two state model) conflicting with a growing number of reports indicating that these receptors form higher order functional oligomers. These receptor-receptor interactions can impact receptor trafficking, ligand sensitivity, desensitization, and strength of effector response.

As such, an understanding of GPCR oligomerization is indispensable to our overall understanding of receptor dynamics. Additionally, the specific molecular events underlying receptor activation and signaling remain incompletely understood. Since the initial discovery of the GPCR receptor family, a number of conserved amino acid motifs have been identified that have been shown to play specific and critical roles in GPCR activation, intracellular G-protein coupling, and receptor desensitization. Still, many of these motifs remain incompletely described, with some motifs having only been evaluated in a small subset of receptors, and experimental evidence suggests that in some cases, these conserved motifs may have divergent roles in specific receptor subfamilies.

As such, the conservation of these motifs throughout GPCR evolution represents and interesting and unresolved aspect of GPCR function.

The goal of this research was two-fold. In one study, I utilized a combination of bioinformatics, site-directed mutagenesis, signaling assays, and fluorescent microscopy techniques to evaluate the functional role and evolutionary conservation of a specific

xii amino acid motif, the WxFG motif, which is present in approximately 90% of all Class A receptors. Our investigation showed that, in contrast to previous studies of this motif, disruption of the WxFG motif results in trafficking defects across a range of GPCRs representing multiple Class A GPCR subfamilies, regardless of taxa. A second study evaluated whether Drosophila GPCRs, specifically a subset of neuropeptide receptors, assembled as higher order structures at the plasma membrane. While there have been many receptors shown to assemble as dimers or oligomers at the plasma membrane since the phenomenon was first recognized over two decades ago, the majority of these studies focused on vertebrate GPCRs, and the question of whether invertebrate GPCRs show similar phenotypes has been poorly evaluated, and to date, no Drosophila GPCR has been empirically demonstrated to assemble as a dimer. To gain a deeper understanding of

GPCR molecular assembly, I evaluated multiple Drosophila receptors utilizing FRET microscopy to determine both the prevalence of GPCR dimerization among Drosophila neuropeptide receptors, and determine whether dimerization is conserved across taxa in specific receptor subfamilies. This investigation showed that all Drosophila GPCRs tested were able to assemble as homodimers when expressed in a heterologous expression system, suggesting that not only do Drosophila GPCRs likely assemble as higher order structures at the plasma membrane, but also that the phenomenon of receptor dimerization is an ancient property of the receptor superfamily that has been conserved throughout GPCR evolution. Taken together, these investigations further our understanding of the molecular events underlying GPCR signaling, and suggest that many aspects of receptor function are not taxa specific, and are likely fundamental

xiii features of GPCR function that have been conserved throughout the evolution of this receptor superfamily.

xiv

CHAPTER I: G protein-coupled receptors– A review of structure-function relationships critical for receptor signaling.

G protein-coupled receptors, or GPCRs, are the largest cell surface receptor superfamily in humans 1. They are characterized by a conserved molecular structure, with seven transmembrane domains, an extracellular N terminus, and an intracellular C terminus. Their primary function is to transduce a variety of extracellular stimuli, including but not limited to light, ions, small molecules, steroids, and peptides, into appropriate intracellular responses 2. These receptors play a critical role in a variety of physiologies and behaviors including but not limited to vision, gustation, olfaction, stress response, cellular communication, reproduction, and development. GPCRs are further classified based on structural and sequence homology into one of six classes: the Class A, rhodopsin-like receptors, which represent the largest and most diverse class of GPCRs, the Class B, secretin-like receptors, the Class C, metabotropic glutamate-like receptors, the Class D, fungal mating type receptors, the Class E, cyclic AMP receptors found in

Dictostelium slime molds, and the Class F, Frizzled/Smoothened receptors 3. Given the extent that GPCRs mediate cellular communication and function across an incredible range of biological systems, as well as their therapeutic importance, as approximately

50% of all drugs on market target a GPCR, it is unsurprising that they have been a significant research focus since the first GPCR was molecularly cloned in 1986 4,5 . This research, along with the sequencing of multiple genomes , has led to number of individual GPCRs being identified, with the human genome alone encoding approximately 800 different receptors 1. Despite this, the mechanisms associated with

GPCR activation and signaling remain incompletely understood., Accumulating evidence

1 shows that many GPCRs exhibit the ability to form dimeric or oligomeric structures with other GPCRs. Oligomeric association results in a variety of impacts on trafficking, signaling, and overall function. This observation suggests that GPCRs themselves may represent allosteric regulators of other GPCRs, and that the functional unit for many

GPCRs may be two receptors assembled as a dimer, rather than individual receptor monomers 6. This phenomenon is further complicated by the fact that a single receptor may form dimers with either other identical receptors (homodimers) or unrelated GPCRs

(heterodimers), complicating issues such as ligand selectivity and intracellular receptor coupling. This chapter will serve to review the events associated with GPCR signaling and common intracellular GPCR pathways, as well as specific amino acid motifs that have been identified as playing critical roles in GPCR activation and signaling. I will also review allosteric modulation of GPCRs and GPCR dimerization, as well as discuss the impact of these phenomena on GPCR function. We will begin with an overview of the molecular events associated with GPCR activity.

Classical Model of GPCR Activation

The receptor superfamily is named for the intracellular machinery they couple to

– a heterotrimeric G-protein consisting of α and βγ subunits. In the inactive receptor state, the α subunit of the heterotrimeric G-protein is bound to a GDP molecule, and the α and

βγ remain together in complex with one another. Receptor activation, either through ligand binding to the extracellular surface of the receptor or other noncanonical mechanisms ( e.g ., light, mechanical stimuli) induces a conformational change in the receptor 7. This event allows the receptor to function as a guanine-nucleotide exchange factor (GEF), removing the GDP bound to the α subunit and replacing it with a GTP.

This GTP binding event activates the α subunit, allowing it to dissociate from the GPCR and βγ subunits and translocate within the cell to elicit a variety of second messenger responses 8. GPCRs are generally characterized by the α subunit they interact with, the three most common being G αs, G αi/o, and G αq, which activate different intracellular signaling pathways.

Signaling through G α subunits – types and cellular functions

Stimulated Gαs subunits increase the activity of adenylate cyclase (AC), a membrane bound enzyme responsible for the production of cAMP 9. This, in turn, increases the activity of cAMP-dependent protein kinase (PKA), which phosphorylates a number of different intracellular targets to elicit a variety of cellular responses, one of the most notable is the activation of CREB, a transcription factor which binds to cyclic AMP response elements (CRE) to modulate the transcription of various genes. As such, CREB activity is a key regulator in a variety of physiologies, such as the suppression of the oncogene c-fos and the maintenance of circadian rhythms through changes in expression of timeless and period genes 10,11 . Changes in intracellular cAMP concentrations also act to modulate the activity of ion channels, leading to changes in membrane potential and cell excitability. Cyclic AMP levels also contribute to a number of physiological effects, such as the mobilization of energy stores through the breakdown of glycogen, stress response, modulation of heart rate, insect diuresis, and the formation and maintenance of memory 12–16 . Cyclic AMP levels also modulate the activity of intracellular exchange proteins, such as exchange protein activated by cAMP (EPAC), which translocates to the plasma membrane following activation and produces a range of cell specific responses 17 .

Taken together, the activation of AC by GPCRs has significant impacts on many aspects of cell physiology and function.

In contrast to the G αs subunit, another subset of G α subunits, G αi/o, act as an antagonist to AC, inhibiting the production of cAMP and in turn downregulating PKA and CREB activity 18 . Downregulation of cyclic AMP is a hallmark of many inhibitory neurotransmitters, such as GABA 19 , and as such serves to regulate a variety of physiologies and behaviors, including organismal stress responses and sleep onset 20 . The combination of both Gαi and Gαs coupled GPCRs in a single cell affords the ability to precisely regulate intracellular cAMP levels and mediate subsequent downstream effects through the additive effects of these receptor types.

Another major subset of heterotrimeric G-proteins is the G αq subunit family. G αq subunits function by acting on phospholipase C (PLC), a membrane bound enzyme responsible for the cleavage of phosphatidylinositol 4,5-bisphosphate (PIP 2) into inositol

21 triphosphate (IP 3) and diacylglycerol (DAG) . IP 3 acts on the endoplasmic reticulum, causing it to release calcium into the cytoplasm, increasing the intracellular concentration of calcium and in turn increasing the activity of protein kinase C (PKC) 22 . DAG remains within the plasma membrane but is a direct activator of PKC and also facilitates PKC’s translocation to the plasma membrane. PKC phosphorylates a variety of intracellular targets, leading to significant changes in cellular physiology. These events include activation of MAPK/ERK pathway, which in turn leads to significant changes in gene expression and regulation of the cell cycle and cellular proliferation 23 . Additionally, many cellular secretion events are calcium dependent, and as such the release of sequestered calcium ions from the endoplasmic reticulum can lead to the secretion of

4 neuropeptides and other molecules involved in cellular communication 24 . PKC also activates the NFkB protein complex, a key regulator of gene expression with myriad cell- specific effects, including the suppression of anti-apoptotic genes and the activation of pro-inflammatory genes 25 .

Other G α subunits fulfill cell-specific functions. For example, the activation of

Rhodopsin by light activates the α subunit transducin, which is responsible for the breakdown of cyclic GMP (cGMP) through modulation of phosphodiesterase activity in photoreceptor-expressing cells 26 . This change in cGMP levels is critical for the processing of visual stimuli. Similarly, stimulation of gustatory GPCRs activate the G α subunit gustducin, a transducin homolog, which increases cGMP degradation. This signaling is interpreted by the brain as specific tastes, and depends upon cell type 27 .

Gustducin removes the inhibition of cAMP phosphodiesterase, reducing cAMP concentrations in taste receptor-expressing cells. The modulation of cAMP and cGMP in these cells is responsible for the processing and interpretation of taste stimuli, a critical function which allows organisms to discriminate between palatable and potentially harmful foods27 .

Signaling through Gβγ subunits – types and cellular functions

In addition to G α subunit dependent signaling, the β and γ subunits also contribute to GPCR mediated intracellular effects following receptor activation. Unlike the G α subunit, which translocates to various intracellular targets in the cytoplasm, the β and γ subunits remained tethered to the plasma membrane in both their inactive and active states. Additionally, the β and γ subunits do not dissociate from one another, and as such, the heterodimer of the two subunits represents the functional unit involved in signaling.

Following receptor activation and the dissociation of the activated G α subunit of the heterotrimeric G-protein, the βγ subunit acts on different membrane-bound targets to elicit cell- and receptor- specific responses. Some of these actions involve the modulation of a family of G-protein-activated inwardly rectifying potassium (K +) channels, or

GIRKs. The βγ subunits bind directly to intracellular residues on GIRKs, as resolved by

FRET analysis, which in turn activates the ion channel 28 . This regulation in turn impacts cell excitability and alters the function of neurons and cardiac muscle 29 . These interactions are also facilitated by a family of proteins, the regulators of G-protein signaling (RGS). RGS proteins are GTPase activating proteins which facilitate GTP hydrolysis in the Gα subunit and are critical for controlling GPCR signal termination.

Many RGS proteins exhibit significant homology to the γ subunit of the βγ complex and research has shown that RGS proteins can directly interact with the β subunit of the heterotrimeric G-protein, forming a β-RGS complex, and potentially replacing the γ subunit 30 . Additionally, recent work has shown that RGS-insensitive mice display significantly reduced GIRK activity when the μ-opioid receptor was activated, further indicating a functional association of these proteins and inhibition of βγ dependent signaling 31. βγ subunits inhibit the actions of multiple voltage-gated calcium (Ca 2+ ) channels in a voltage independent manner 28 . As these channels are primarily expressed in neurons, this inhibition can prevent the occurrence of action potentials in these cells, and in turn modulate the activity of various neural circuits and their corresponding behavioral and physiological outputs.

βγ subunits have also been shown to directly interact with second-messenger producing molecules such as PLC and adenylate cyclase (AC) to modulate second

6 messenger production in a similar manner to G α subunits. βγ subunits act directly on AC to activate or inhibit the production of intracellular cAMP both in concert with or opposing the actions of corresponding G α subunits 32 , which can in turn modulate cAMP dependent signaling pathways described previously such as CREB activated gene transcription. In a similar manner, βγ subunits also bind directly to phospholipase C

33,34 isoforms to both activate and inhibit PLC activity . This in turn modulates IP 3 and

DAG production, and subsequent calcium release from intracellular endoplasmic reticulum stores. Taken together, βγ subunits play a major role in regulating cell- excitability and physiological changes stemming from GPCR activation.

GPCR signal termination and endosomal signaling

GPCR signal termination involves both the sequestration of the receptor-ligand complex from the cell surface and the termination of G-protein signaling. G-protein signaling is terminated through the innate GTPase activity which G α subunits possess 35 .

As such, the bound GTP molecule is hydrolyzed following activation and the molecule loses its enzymatic activity and returns to an inactive state upon GTP hydrolysis. This facilitates the re-association of the G α and Gβγ subunits of the heterotrimeric G protein complex. Next, sequestration of the activated G-protein coupled receptor is facilitated by phosphorylation events following the dissociation of the heterotrimeric G-protein complex and the recruitment of arrestins, a family of cytoplasmic proteins responsible for targeting GPCRs to early endosomes 35 . Specifically, following the dissociation of the heterotrimeric G-protein complex, phosphorylation sites on the intracellular face of the

GPCR are exposed. These sites are phosphorylated by a family of serine/threonine kinases known as G-protein coupled receptor kinases (GRKs). Phosphorylation of the

7 receptor causes the recruitment of arrestins to the GPCR. Arrestins act to block GPCR signal transduction in two major ways: first, by physically obstructing the association of heterotrimeric G-proteins with the activated GPCRs, and second, targeting the arrestin-

GPCR complex to clathrin-coated pits for eventual removal of the GPCR from the plasma membrane 35 . The GPCR is encapsulated into an endosome and the fate of the

GPCR is either to be recycled back to the plasma membrane following receptor-ligand dissociation, or ultimately targeted for degradation via lysosomes. These internalization events alter the overall sensitivity of the cell to the specific GPCR ligand by decreasing the number of receptor molecules present at the plasma membrane, a process known as desensitization, although it should be noted that visual rhodopsin undergoes desensitization through a different mechanism 36 . Additionally, recent evidence suggests that some GPCRs signal directly through the arrestin-endosome complex, indicating that arrestins may serve in both GPCR signal termination as well as signal transduction, with specific roles including the activation of the MAPK/ERK pathway, and the inhibition of nF-kB activity 37 . Specifically, the β-arrestin 1 subunit regulates the thyrotropin- stimulating hormone receptor’s (TSHR) downstream effects on cholesterol metabolism 38 .

Additionally, recruitment of arrestin to the D 2 dopamine receptor (D 2R) is responsible for cocaine-induced hyperlocomotion, but not incentive motivation in this experimental paradigm 39 . Taken together, this suggests that the arrestin-endosome complex may function along with canonical cAMP/Ca 2+ pathways to mediate the full array of GPCR dependent intracellular signaling.

The “two-state” model and its shortcomings

The predominant mechanism used to describe GPCR activation is the “two-state model”, wherein the receptor occupies two distinct states, R(inactive) and R*(active)

(Figure 1). In this model, the inactive receptor exists at the plasma membrane coupled to intracellular heterotrimeric G-proteins. Ligand binding to the extracellular face of the receptor induces conformational changes throughout the receptor, allowing it to act as a guanine-nucleotide exchange factor (GEF) and in turn facilitate the “swapping” of a bound GDP molecule for a GTP molecule from the alpha subunit of the heterotrimeric G protein associated with the receptor. This event activates the heterotrimeric G-protein complex, allowing it to dissociate from the receptor and act on myriad intracellular targets to transduce the extracellular signal generated by the ligand into an appropriate cellular response. Signal termination results from the innate GTPase activity of the G α subunit, as it eventually hydrolyzes GTP to GDP and returns to an inactive state. While this model accounts for the basics of GPCR activation and signal transduction, it has become clear that the two-state model first proposed for GPCR activation fails to account for a great deal of reported results since its first proposal 8.

GPCRs exhibit a classic sigmoidal dose-response curve for both ligand binding and receptor activity, which suggests allosteric modulation of receptor signaling and cooperativity. If, in fact, GPCRs only occupied two conformational states – ligand-bound and ligand-unbound, dose response curves for ligand binding and receptor activity should be hyperbolic, rather than sigmoidal. Indeed, many allosteric modulators of GPCR signaling have been identified in the past three decades, collectively referred to as GPCR interacting proteins (GIPs) that in many cases are critical for proper receptor function 40 .

For example, the human calcitonin-like receptor (CLR) requires the interactions of multiple GIPs to appropriately transduce signals from its endogenous ligands adrenomedullin (AM) and calcitonin gene-related peptide (CGRP) 41 . First, the receptor must associate with receptor activity modulating proteins (RAMPs) to efficiently traffic to the plasma membrane. Coupling to RAMP1 confers greater receptor specificity to

CGRP, while coupling to RAMP2 or RAMP3 confers greater receptor specificity to AM, suggesting that these allosteric interactions are capable of modifying the CLR ligand- binding site to alter specificity to these disparate ligands 42 . Additionally, CLR must interact with a second allosteric modulator, receptor component protein (RCP), to transduce signals from either ligand. Thus, the receptor not only requires allosteric interactions for proper signal transduction, but is also able to change its conformational state to selectively bind one ligand over another, and must therefore exhibit multiple active states.

Another shortcoming of the two-state model is its presupposition that, in a ligand- unbound state, the receptor exists in an “off” conformation incapable of activating an associated heterotrimeric G-protein. In reality, many GPCRs exhibit constitutive activity even in the absence of ligand, suggesting that many GPCRs do not exist in a truly “off” state when expressed 43,44 . This has led to speculation that GPCRs act as “rheostats” rather than simple on-off switches 45 . Under this paradigm, GPCRs can exist in multiple conformational states with multiple intermediate states between “inactive” and “active”.

The exact state then would result from intramolecular interactions within the receptor, allosteric interactions with other proteins, ligand binding, and ligand identity 45 . Some

GPCRs have also been shown to activate multiple intracellular G protein pathways, an

10 example of this being the gonadotropin releasing hormone (GnRH) receptor, which potentiates both cyclic AMP and Ca 2+ signaling when activated, suggesting that the receptor is capable of adopting multiple conformations to specifically accommodate multiple G proteins and intracellular signaling pathways 46 . This selectivity in G protein recruitment can also be controlled by ligand identity, as is the case with the neurokinin 2

(NK2) receptor. NK2 endogenously binds to neurokinin A (NKA), a gene product of the preprotachykinin gene that also gives rise to substance P 47 . Full length NKA elicits both calcium and cAMP responses from NK2 receptor activation, yet a C-terminally truncated form of NKA (NKA4-10) only elicits calcium responses upon binding to NK2, suggesting that this receptor is also capable of adopting multiple active conformations in a ligand-dependent manner 48 . Indeed, the idea of a GPCR occupying multiple “activated” conformations has gained considerable traction and is supported by structural modeling, however no GPCR crystal structures for a single receptor bound independently to multiple ligands have yet been determined 49 .

Conserved Amino Acid Motifs in Class A GPCRs

As our understanding of GPCRs has grown, a number of conserved amino acid motifs have been identified which are critical for discrete aspects of receptor function.

Amino acid motifs are sequences of amino acids that exhibit both high sequence conservation within a specific protein family, and generally participate in a common function. For GPCRs, the majority of these motifs have been identified and described for

Class A GPCRs, which is not unsurprising given that Class A GPCRs are the largest

GPCR subclass. For Class A GPCRs, conserved amino acid motifs identified and described to date include the E/DRY motif located at the base of TM3, the WxFG motif

11 located in EL1, the CWxP motif located in TM6, and the NPxxY motif located on TM7.

Much of our understanding of the function of these motifs is derived from mutagenesis studies, wherein conserved amino acid residues are mutated and resulting changes in receptor function are documented. These approaches, coupled with GPCR crystal structure analysis, have led to each of these conserved amino acid motifs being associated with specific aspects of receptor function. In this section, I will briefly review common aspects of receptor function associated with these specific motifs.

E/DRY motif – The Ionic lock

The E/DRY motif, located at the base of TM3, was first identified in Rhodopsin and later functionally characterized through investigations of the β2 adrenergic receptor

50 (β 2AR) . The most critical role for this motif is stabilizing the inactive conformation of

Class A receptors through interactions between the positively charged arginine residue

(conserved in 96% of Class A GPCRs) in the DRY motif in TM3 and a conserved, negatively charged amino acid (usually glutamate or aspartate) in TM6 51 . This interaction forms an “ionic lock” which keeps TM3 and TM6 in close proximity to one another when the receptor is not bound to ligand. Ligand binding is thought to break this lock through conformational changes in the receptor, leading to TM6 moving away from TM3 and forming an intracellular pocket through which the GPCR can interact with and activate heterotrimeric G proteins 52 . This hypothesis is supported by multiple lines of evidence.

First, increased distance between TM3 and TM6 is correlated with higher constitutive receptor activity in β adrenergic receptors 53 . Additionally, multiple studies have shown that disruption of the ionic lock through mutagenesis leads to an increase in constitutive activity, lending further support to the notion that this motif serves to stabilize the

12 inactive receptor state 54–56 . A salt bridge formed between the aspartate and arginine residues in the DRY motif has been identified in crystal structures of inactive GPCRs, and disruption of this interaction is a critical event related to receptor activation, implicating this motif in multiple receptor-stabilizing interactions 57 . In addition to its apparent role in stabilizing the inactive receptor state, it has been reported that the conserved arginine in the DRY motif is responsible for coupling the receptor to intracellular G-proteins, with a naturally occurring mutation (Arg ‰ His) in the human vasopressin type two receptor giving rise to a receptor incapable of stimulating adenylate cyclase, resulting in persistent nephrogenic diabetes insipidus in individuals bearing this mutation 58 . A similar Arg ‰ His mutation in the human gonadotropin releasing hormone

(GnRH) receptor leads to hypogonadotropic hypogonadism, but in contrast to the vasopressin receptor, this mutant receptor is unable to bind ligand, suggesting that this motif may exhibit receptor specific functions beyond stabilization of the inactive receptor state 59 .

WxFG motif – an extracellular domain critical to receptor trafficking

Another amino acid motif that has been shown to play a critical role in overall receptor function is the WxFG motif found on extracellular loop 1 (EL1) 60 . This motif, initially described by Klco et al. in 2006, is relatively understudied in comparison to the extensive literature exploring the DRY motif, but appears to play a critical role in proper trafficking of the receptor from the ER-Golgi complex to the plasma membrane 60,61 .

Present in approximately 90% of Class A GPCRs, the WxFG motif was originally reported to play a critical role in ligand-mediated activation of the C5a complement component receptor. Mutagenesis of the conserved tryptophan residue in this domain

13 yielded a nonfunctional C5a receptor unable to respond to ligand, but apparently did not impact ligand binding, as purified membranes containing W102A mutant C5a receptor variants were still capable of binding ligand (although only at ~20% of wild type receptor maximal occupancy), but did not transduce ligand binding into an appropriate intracellular response 61 . A W102F C5a receptor variant was capable of binding both ligand and activating intracellular responses at levels nearly indistinguishable from wild type, prompting the hypothesis that an aromatic, bulky amino acid at the “W” position was necessary for wild type receptor function 61 .

A subsequent study by our laboratory of eight Class A GPCRs from disparate subfamilies by our laboratory instead showed that this motif was critical for wild type receptor trafficking 60 . Using a comparison of wild type and WxxxL mutant receptors fused to a C-terminal YFP molecule, we showed that not only were WxxxL mutants incapable of responding to ligand, but that these receptors remained trapped in the ER-

Golgi complex and were not appropriately trafficked to the cell surface if an aromatic amino acid was not present at the “W” position 60 . These findings, while seemingly in conflict with the original report on C5aR receptor function, can be reconciled through a comparison of the methodologies used in these two studies. While Klco et al. showed that the W102A mutant C5a receptor did not signal in response to ligand, ligand binding to the receptor was performed on purified cell membranes, which would have captured receptors trapped in the ER-Golgi complex as well as the plasma membrane. Thus, the ability of the receptor to still bind ligand is largely unimportant as it appears mutant receptors do not reach their appropriate intracellular target (the plasma membrane) in order to respond to extracellular ligand presentation. A possible mechanism for this

14 trafficking defect was suggested by our research, as computer modeling of wild type and

WxxxL mutant receptors showed distortion of the receptor’s natural conformation, with the N terminus apparently “pushed” further away from the body of the receptor. Other reports suggest that this particular conserved tryptophan residue in EL1 interacts with and potentially stabilizes a cysteine mediated disulfide bridge between EL1 and EL2 in crystal structures of the β2AR, and thus receptor mutants may exhibit overall instability compared to wild type 62 . It is also important to note that a conserved cysteine residue in

EL1 downstream from the WxFG motif has been previously shown to form a disulfide bond with another conserved cysteine residue helps maintain receptor architecture, and it could be the case that mutagenesis of the WxFG motif interferes with this disulfide bond formation 63 . Taken together, these reports suggest that this motif plays a critical role in

GPCR function through appropriate trafficking of the receptor to the plasma membrane, while further research is necessary to fully determine the molecular mechanisms involved with this process.

CWxP motif – “rotamer toggle switch”

A third amino acid motif critical to GPCR function is the CWxP motif, present on

TM6. This motif is highly conserved amongst class A GPCRs, with cysteine and tryptophan conserved in over 70% of Class A, non-olfactory GPCRs, while proline is conserved in a remarkable 98% of non-olfactory receptors 64 . Crystal structure and molecular modeling studies have shown that this conserved proline residue induces a large bend in TM6, whose outward motion during receptor activation contributes to the formation of the G-protein binding pocket on the intracellular face of the receptor 65,66 .

Mutagenesis studies on the β 2AR revealed that this outward motion away from TM3 is

15 also associated with a change in the rotamer state of the conserved cysteine and tryptophan residues in this motif, giving rise to its classification as a “rotamer toggle switch” 66 . This change in side chain orientation is hypothesized to stabilize the receptor in an active conformation. The functional role of this motif in receptor activation is further supported by studies of the thyrotropin stimulating hormone receptor, where substitution of arginine for the conserved cysteine residue in this motif was associated with increased constitutive receptor activity 67 .

Still, the function of this motif does not appear to be universal amongst class A

GPCRs. While crystal structure studies of the β 2AR indicate that the conserved tryptophan residue in this motif does adopt different side chain orientations in active receptor conformations compared to inactive states, the crystal structure of a constitutively active rhodopsin receptor did not find a similar correlation with the rotamer position of the conserved tryptophan residue and active or inactive receptor conformations 68,69 . This, along with the absence of this conserved tryptophan residue in

~30% of Class A GPCRs, suggests that this rotamer switch model of receptor activation may not be uniform amongst Class A GPCRs, and other mechanisms must therefore stabilize the transition between active and inactive receptor states. The dearth of available GPCR crystal structures of receptors in an active conformation further complicates this, as it is currently impossible to determine the prevalence of rotamer rearrangements of CWxP motif residues amongst all class A GPCRs. Still, the high degree of conservation exhibited by this motif and experimental evidence from β 2AR investigations suggest that it does play a critical role in GPCR function in at least a subset of Class A GPCRs.

NPXXY – a conserved motif with multiple functional roles

Another conserved amino acid motif that has been shown to play a significant role in GPCR function is the NPXXY motif found on the base of TM7. This motif exhibits remarkable conservation amongst GPCRs, with the conserved tyrosine residue being

70 present in 92% of all class A receptors . Early studies on the β 2AR identified that the conserved tyrosine in this motif was necessary for agonist-induced receptor desensitization, with Tyr ‰Ala mutant receptors exhibiting no internalization in response to prolonged agonist exposure 71 . This mutant receptor exhibited no significant defects in ligand binding or adenylate cyclase activation, suggesting a singular role for this motif in arrestin-mediated desensitization. Interestingly, mutations of the conserved asparagine and proline residues to alanine in the same β 2AR resulted in a significant reduction in ligand sensitivity, suggesting that this motif may stabilize the inactive receptor state to facilitate ligand binding in addition to its role in receptor desensitization 72 . However, further studies of disparate GPCRs indicated that this motif did not play a universal role in GPCR desensitization. Substitutions of the conserved tyrosine residue in the B 2

Bradykinin receptor resulted in constitutive internalization of the receptor, along with a loss of signaling capabilities 73 . Additionally, the gastrin-releasing peptide (GRP) receptor showed no significant defects in receptor internalization following a similar Tyr ‰Ala substitution, indicating that the conserved tyrosine residue in this motif is unlikely to mediate receptor desensitization in all class A GPCRs 74 .

More recent reports suggest that, similar to the CWXP motif, the conserved tyrosine residue in this motif may function as a “toggle switch” contributing to the receptor adopting an active conformation following ligand binding 70 . Specifically, crystal

17 structure studies of opsin molecules thought to mimic the active state of rhodopsin have indicated that, in the active state of the receptor, the conserved tyrosine residue changes its rotamer configuration and inserts into the space occupied by TM6 in the inactive receptor conformation. This conformational change is believed to stabilize the active conformation of the receptor 75 . This hypothesis is further supported by a recent investigation of the α1b and β 2 adrenergic receptors that demonstrated reduced signaling through targeted mutagenesis, and is consistent with a stabilization of the inactive state of

76 these receptors . It is important to note that previous studies of the β 2AR showed that mutagenesis of this conserved tyrosine residue to alanine resulted in desensitization defects, suggesting that amino acid identity at this position plays a critical role in wild type receptor function. Given the distinct functional roles of this motif in different receptor backgrounds, further investigation is necessary to determine whether the

NPXXY motif exhibits a conserved functional role in all class A GPCRs, or whether its function is receptor-specific.

GPCR dimerization – allosteric modulation of GPCR signaling through receptor- receptor interactions.

Efforts to fully elucidate GPCR function are complicated by the property of many receptors in this family to form higher order structures: dimers and oligomers, with other

GPCR members. Since the first GPCR dimer was reported in 1998, multiple studies describe that many GPCRs exhibit extensive dimerization, at times with multiple GPCR subtypes, and these events lead to alteration in signaling, ligand selectivity, receptor desensitization, and other aspects of receptor physiology. This section will review GPCR

18 oligomerization and discuss the functional consequences of these interactions in overall

GPCR function.

The earliest functional characterization of GPCR dimerization was described in

GABA B receptors. Specifically, the GABA BR1 gene product, when heterologously expressed in HEK293T cells, remained trapped in the endoplasmic reticulum. However, when GABA BR1 was coexpressed with the GABA BR2 receptor encoded by a different

77 gene, GABA BR1 cell surface expression was observed . Subsequent work . revealed the mechanism for this phenomenon – dimerization between GABA BR1 and GABA BR2

78 masked a C-terminal RXR ER retention motif present on the GABA BR1 receptor . Thus, the functional receptor for the GABA B receptor subclass was revealed to be a heterodimer of two related receptors, rather than a receptor protomer, providing the first evidence for a functional role of dimerization in GPCR signaling.

Since these initial studies, a wealth of data has supported the capacity of multiple

GPCRs to assemble as dimers and higher order oligomers. This section will expound on the mechanisms of dimerization and the functional implications of this phenomenon.

Mechanisms of GPCR dimerization

The molecular mechanisms underlying GPCR dimerization differ by receptor class, the most well characterized of which is the Class C, metabotropic glutamate-like receptors. These receptors contain an extended N-terminal domain known as a Venus flytrap (VFT) module, which is unique amongst GPCR subclasses and serves a number of different functions for Class C receptors. In contrast to Class A receptors, where TM domains contribute to ligand recognition, Class C GPCRs ligand binding occurs solely

19 through this extended N-terminal VFT domain 79 . Interestingly, this same VFT domain is responsible for forming the dimerization interface for most Class C receptors, which function as obligate dimers 80 . Most Class C GPCR N-termini contain multiple cysteine- rich domains (CRDs), located between the VFT and TM1, which are able to crosslink the receptor to its dimeric partner through interactions between these extended N-termini, leading to the formation of stable receptor dimers 81 . Exceptions to this disulfide-linkage mechanism do exist, most notably exemplified by the GABA B receptors. The N-termini of these receptors, while involved in ligand binding similar to other Class C receptors, lack CRDs. As a result, dimerization for these receptors cannot involve N-terminal disulfide linkages, rather, dimerization occurs through interactions between the C- terminal tails of GABA B receptors. The RXR ER-retention motif found on GABABR1 binds to an unrelated coiled-coil domain found on the C-terminus of GABA BR2, masking this domain and allowing for the functional expression of the GABA B heterodimer at the cell surface 81 .

In contrast to the rather uniform mechanisms underlying Class C GPCR dimerization, our understanding of the interfaces underlying Class A and B receptor dimerization remains incomplete. Dimerization between receptors of these two classes does not involve covalent linkages between dimer partners, as is often found in Class C receptors, and as such, these receptors often exist as transient, rather than stable, dimers at the cell surface 82 . Dimerization of Class A GPCRs often relies on interactions between

TM domains of the receptors involved, with multiple interactions between disparate TM regions having been reported. Crystal structure analysis of the chemokine receptor

CXCR4 showed that the receptor assembles as homodimer with an interface involving

20 both TM5 and TM6 from each receptor subunit 83 . Here, dimer stabilization is mediated primarily through hydrophobic interactions between residues in these domains 83 . In contrast, disulfide-trapping experiments on the unrelated 5HT2c receptor also showed a homodimeric interface involving TM5 of each protomer, but rather than TM6 also contributing to dimerization as seen with the CXCR4 receptor, the 5HT2c homodimer involves interactions between TM4 domains in each dimeric counterpart, constituting an overall TM4/TM5 dimeric interface between the receptors 84 . Recent work on the adenosine A 2A receptor and D 2 dopamine receptor heterodimer suggests that a similar interaction between TM4 and TM5 on these receptors stabilizes the heterodimer 85 .

Additionally, atomic force microscopy investigations of mouse rhodopsin also suggested that the receptor dimerized through TM4-TM5 interactions between receptor protomers 86 .

Interestingly, crystal structure analysis of the human Class F smoothened receptor also showed that the receptor formed a homodimer similarly stabilized by interactions between TM4 and TM5, indicating that this interface may be common to multiple GPCR homo- and heterodimers, regardless of class 87 . Such an interaction likely arose early in

GPCR evolution, given the significant evolutionary distance between Class A and Class

F GPCRs 88 . Beyond the TM5-TM6 and TM4-TM5 interfaces described above, additional

Class A GPCR dimeric interfaces have been identified. Crystal structure analysis of the

B1 adrenergic receptor (B 1AR) revealed a TM1-TM2-C terminus interface responsible for stabilizing the B 1AR homodimer, along with the previously described TM4-TM5 interface 89 . Taken together, these findings suggest that Class A GPCRs dimerize through a variety of dimerization interfaces, with the specific receptor regions involved likely varying greatly amongst the superfamily.

In contrast to Class A and Class C GPCRs, limited evidence exists regarding mechanisms underlying Class B GPCR dimerization. A study utilizing spatial intensity distribution analysis (SpIDA) on the human secretin receptor revealed a critical role for

TM4-TM4 interactions in stabilizing secretin receptor dimers, with mutagenesis of amino acid residues within this domain significantly reducing receptor dimerization 90 .

Interestingly, a similar role for TM4-TM4 interactions in stabilizing Class B receptor dimerization was found in an investigation of rabbit calcitonin receptor homodimers, a related Class B receptor 91 . These findings suggest that a common TM4-TM4 dimeric interface may unify Class B GPCR dimerization, though this hypothesis requires evaluation in a greater diversity of Class B receptors before it can be fully supported. It is interesting to note that, for each receptor subclass, disparate receptor domains seem to contribute to higher order assembly, and as such, it is unlikely a unifying mechanism of dimerization exists for GPCRs. Additionally, in contrast to Class A, B, and C GPCRs, putative dimerization domains for Class D, E, and F GPCRs, beyond the smoothened receptor, have not been explored, and as such, models for dimerization amongst these receptor types remains incomplete.

Impacts of GPCR dimerization on receptor function

Many reports have shown that GPCR dimerization impacts receptor function and signaling, highlighting the necessity of identifying homo- and heterodimer GPCR complexes. The nature in which oligomerization impacts function exhibits incredible diversity, particularly amongst heterodimeric complexes, which will be discussed herein.

Allosteric modulation through homodimerization

Many of the effects associated with GPCR dimerization, including receptor transactivation and trans-desensitization, are absent in GPCR homodimers as a result of identical protomers constituting the dimeric unit. Still, evidence suggests that homodimeric GPCRs do not signal similarly to monomeric counterparts, and homodimeric assembly impacts overall receptor function. The strongest evidence for this supports homodimeric GPCRs functioning as negative allosteric modulators to their protomeric counterpart. In this model, ligand binding to one of the two protomers in a

GPCR homodimer decreases the likelihood of a second ligand binding. This phenomenon has been shown in multiple GPCRs, including the human thyrotropin (TSH) and

92,93 luteinizing hormone (LH) receptors, as well as the A 3 adenosine receptor . This phenomenon of negative cooperativity among dimer partners is not limited to homodimers, and has been observed in chemokine receptor heterodimers involving the

CCR 5 and CCR 2b receptors, suggesting that allosteric modulation of dimer partners is a hallmark of GPCR dimerization in general 94 . These findings are interesting as they suggest that dimerization may explain, at least in part, the sigmoidal dose-response curves associated with GPCR ligand binding and signaling. Negative cooperativity among dimer partners has been demonstrated in native tissues, in addition to the cell culture systems commonly used. A study of oxytocin receptors in rat mammary glands utilizing time-resolved (TR) FRET indicated that not only did these receptors assemble as homodimers in vivo , but additionally that agonist-binding to a homodimer decreased overall receptor affinity for agonist, suggesting that, once a receptor dimer has bound a ligand molecule, its affinity for binding an additional ligand molecule is significantly

23 decreased 95 . This phenomenon of negative cooperativity has interesting implications for

GPCR signaling and function. Negative cooperativity amongst GPCR homodimers could serve to buffer cells against abrupt increases in extracellular ligand concentration 96 . This would effectively alter a cell’s affinity for ligand in a concentration-dependent manner, preventing overstimulation in response to excessive ligand presentation, although this has never been empirically demonstrated. It is interesting to note that, while theoretically possible, no instance of positive cooperativity, which could potentially intensify cellular responses to extracellular ligands, has been demonstrated for any GPCR dimers to date.

Trafficking

GPCR dimerization has also been shown to play a significant role in receptor trafficking and cell-surface targeting in multiple receptors. The best example of this phenomenon is the previously mentioned GABA B receptor heterodimer, wherein dimerization is required for cell-surface expression of the mature receptor 77,78 . The necessity of receptor dimerization for wild-type receptor function has since been demonstrated in multiple additional Class C GPCRs, including the T 1R taste receptor and metabotropic glutamate 2 (mGlu 2) receptors, suggesting that this is a hallmark of the receptor subfamily 97–99 . In contrast, numerous studies of Class A and B GPCRs, when forcibly expressed as monomers in detergent micelles or reconstituted nanodiscs, are still capable of both ligand binding and receptor activation, suggesting that dimerization as a requirement for receptor trafficking and function may be limited to Class C receptors 97,100 . This is likely explained by the mechanical differences that distinguish

Class C receptor dimer formation from other GPCR subclasses. Class C receptor dimers are stabilized by disulfide bonds between individual protomer molecules, which are

24 formed during receptor maturation in the ER 101 . In contrast, Class A receptors, largely stabilized by hydrophobic interactions between residues found in TM regions of the receptor, likely exist as a dynamic population of monomers, dimers, and higher order oligomers at the cell surface, with relatively short half-lives in each structure, and as such it seems less likely that receptors would co-traffic as dimers during maturation 102 .

Interestingly, dimerization of the Class A 5HT 2c receptor was observed in both the ER and Golgi complexes during receptor maturation when expressed in HEK-293 cells, suggesting a possible role for receptor dimerization in trafficking of Class A receptors, but additional study is necessary to determine whether this is required for cell-surface expression of a functional receptor 103 . Still, the available evidence suggests that the necessity of GPCR dimerization for proper GPCR trafficking is limited to Class C receptors.

Receptor transactivation

A particularly interesting phenomenon related to GPCR heterodimers is receptor transactivation. In this scenario, ligand binding to one protomer in a GPCR heterodimer can lead to signaling through the other protomer (Figure 2). One exemplar of this phenomenon is the human bradykinin receptor 2 (BK 2R) – B2AR heterodimer. When expressed independently, BK 2R signals through the Gαq intracellular pathway, while

104,105 B2AR acts through the Gαs signaling pathway . However, when these receptors are coexpressed, bradykinin stimulation results in signaling through both Gαq and Gαs intracellular pathways in a B 2AR dependent manner, suggesting that Gαs stimulation

106 results from transactivation of the B 2AR protomer . Interestingly, isoproterenol stimulation of cells co-expressing these two receptors did not result in activation of the

Gαq, suggesting that transactivation of this receptor pair exhibits asymmetry. The phenomenon of transactivation is also demonstrated in the GABA BR1/GABA BR2 receptor heterodimer, where ligand binding to GABA BR1 stimulates intracellular

77 signaling through its partner, GABA BR2 . Similar transactivation was identified in an investigation of the luteinizing hormone receptor (LHR). Specifically, ligand-binding deficient and signaling deficient variants of LHR were co-expressed in populations of

HEK-293 cells. When these variants were co-expressed, wild type luteinizing hormone signaling was restored, whereas no LH signaling was observed in cell populations expressing a single mutant receptor variant 107 . These findings suggest that the LHR homodimer exhibits transactivation following ligand binding to a single protomer. The possibility of transactivation between individual protomers of a GPCR heterodimer potentially complicate assigning a canonical signaling pathway to an individual GPCR, as non-canonical signaling through transactivation could result in cell- and tissue- specific responses to particular ligands.

Transdesensitization

In addition to transactivation, GPCR dimerization has also been implicated in receptor transdesensitization, wherein ligand binding to one receptor in a heterodimer facilitates the internalization of its heterodimeric partner (Figure 2). This phenomenon is best exemplified by the μ-opioid receptor/CCR5 chemokine receptor heterodimer pair.

When these receptors are co-expressed in CHO cells, bidirectional transdesensitization was observed, with μ-opioid receptor pre-stimulation ablating CCR5-dependent chemotaxis responses, and similar μ-opioid receptor mediated chemotaxis ablated in cells pre-treated with CCR5 agonists. Interestingly, receptor desensitization was not mediated

26 through receptor internalization, as CCR5 ligand stimulation did not significantly impact

μ-opioid receptor internalization and vice versa. The phenomenon of trans-desensitization is also exemplified by the H 1 and H 2 histamine receptor heterodimer. Upon expression of these two receptors in CHO cells, pre-incubation with the H 1R ligand 2,3- trifluoromethylphenylhistamine abolished the subsequent H 2R responses to amthamine,

108 an H 2R agonist . Similar to the phenomenon of trans-activation, trans-desensitization provides non-canonical regulatory mechanisms for the cell to fine tune cellular responses to extracellular signals.

Ligand sensitivity and biased signaling

In addition to intracellular signaling, dimerization can also differentially impact ligand selectivity. In mammals, specific combinations of GPCRs homo- or heterodimers are responsible for detecting bitter, umami , and sweet taste sensations 98 . Homodimers of one of the two main families of GPCR gustatory receptors, Tas 2Rs or T 2Rs, are responsible for transducing bitter taste sensation. In the other family of mammalian gustatory GPCRs heterodimers formed between T 1R family members are responsible for transducing sweet (T 1R2-T1R3 heterodimer) and umami (T 1R1-T1R3) tastes. This example indicates how dimerization amongst these receptors can play a critical role in determining ligand sensitivity. GPCR dimerization has also been shown to impact intracellular signaling. In the case of the Ciona intestinalis GnRH receptors, heterodimerization between GnRH receptors significantly alters second messenger production following ligand challenge 109 .

Heterodimerization of GPCRs has also been implicated in neuronal signaling and mood disorders, particularly schizophrenia, as in the case of the 5HT 2A R-mGlu 2R

110 heterodimer . Researchers found that disruption of the 5HT 2A R-mGlu 2R heterodimer through knocking out the mGlu 2R receptor in mice led to a loss of 5-HT induced behaviors when challenged with hallucinogenic 5-HT receptor agonists 111 . This particular heterodimer is significantly upregulated in post-mortem brain tissue from schizophrenic patients when compared to normal brains, further suggesting a critical physiological role for this heterodimer in mood management and sensory perception 110 .

Methods to detect GPCR dimers and oligomers

A multitude of experimental approaches have been developed or adapted to detect

GPCR dimerization in living cells. These methods include biochemical approaches, such as co-immunoprecipitation (Co-IP), and microscopy analysis, such as Fluorescent

Resonance Energy Transfer (FRET), Bioluminescent Resonance Energy Transfer

(BRET), and Biomolecular Fluorescent Complementation (BiFC). In most cases, a combination of methodologies is employed to diminish the likelihood of false positive reports of dimerization amongst GPCRs. These approaches, and their respective benefits and pitfalls, will be explored in the following section.

Biochemical resolution of GPCR dimers.

Since their initial discovery, the most common biochemical approach to detect

GPCR dimers and higher order oligomers has been co-immunoprecipitation analysis 112 .

Co-immunoprecipitation involves epitope tagging one or both GPCRs suspected of forming a dimer, with the most commonly utilized epitopes for this approach being HA,

FLAG, and Myc. Receptors are then expressed in heterologous cell systems or transgenic organisms. Tissue is then harvested and placed in a column containing an antibody

28 against one of the epitope tags found on the modified receptors. Following pull-down, the bound protein fraction is then eluted and resolved through Western blot analysis, where the second receptor in the suspected dimer is probed with an epitope or receptor-specific antibody. Positive results indicate association between the two receptors within the cell.

There are multiple potential pitfalls regarding a Co-IP approach to resolve GPCR dimers. A positive result is not a definitive indication that the receptors involved directly interact with one another – the possibility exists that these receptors are integrated in a larger complex by other proteins. Additionally, GPCRs are transmembrane receptors, and are notoriously difficult to work with through Western blot analysis. Also, receptor expression in native tissue may be too low to resolve through Co-IP and Western

Blot analysis, and as such, this approach is best suited to cell-culture systems where receptor overexpression may occur, thus opening the possibility that assays may capture interactions that do not occur when receptors are expressed at physiological levels in native tissues. As such, Co-IP approaches are often complemented by other methodologies, such as FRET, to increase confidence in findings from such studies.

In addition to co-immunoprecipitation, a less common biochemical approach used to resolve GPCR dimers is blue native polyacrylamide gel electrophoresis (BN-PAGE).

This methodology utilizes weak detergents, unlike SDS commonly utilized in conventional Western blot analysis, to preserve protein complexes in their native state, eliminating the need for a co-immunoprecipitation column 113 . Coomassie blue dye is also added to samples in BN-PAGE to confer a negative charge to proteins, as this dye does not disrupt multiprotein complexes, allowing for their resolution through gel electrophoresis. This methodology has been successfully utilized in studies of the M 1

114 115 muscarinic receptor and the OX 1 orexin receptor , among others, to probe the oligomeric states of these GPCRs, as the minimal disruption of multiprotein complexes with this approach allows for visualization of the fraction of receptors that exist as monomers vs dimers and higher order oligomers, a distinct advantage over conventional

Co-IP approaches. Additionally, the individual components of the multiprotein complexes visualized through this approach can be subsequently dissected through conventional SDS-PAGE, revealing the constituent proteins of a putative oligomer 116 .

This approach, similar to Co-IP, still requires receptors be engineered to possess an epitope tag, and cannot be utilized to assess dynamic aspects of GPCR dimerization, such as dimer half-life and ontogeny. Still, BN-PAGE utilizes a more streamlined methodology than Co-IP analysis and it remains a valuable tool in probing GPCR dimers and oligomers.

There are significant drawbacks for each of the approaches listed above. First, both methodologies require cells to be lysed and harvested, and thus cannot be employed for investigations of GPCR dimerization dynamics in living cells. Additionally, in many cases, receptors must be overexpressed in order to be appropriately resolved through

Western blot analysis, raising the possibility that these assays detect interactions between receptors that are not physiologically relevant 112 . Also, as these methodologies do not distinguish between direct receptor-receptor interactions and their incorporation in larger protein complexes, these methodologies are often complemented by microscopy-based approaches to further verify their findings.

Microscopy-based approaches to resolve GPCR dimerization

A number of microscopic techniques have been adapted to probe the existence and organization of putative GPCR oligomers. Historically, the most common technique utilized in this regard has been Fluorescent Resonance Energy Transfer (FRET). This methodology, first proposed by Theodor Förster in 1948, involves energy transfer between complementary fluorophores through dipole-dipole interactions, with one fluorophore acting as an energy donor and another acting as an energy acceptor 117 . For this energy transfer to occur, both fluorophores must be in close proximity to one another, with the upper limit for detection of FRET being ~100 Å distance between the two fluorophores involved. Additionally, the excitation spectrum for the acceptor fluorophore must overlap with the emission spectrum for the donor fluorophore, even though the energy transfer between molecules does not rely on emitted photons from the donor fluorophore 118 . Furthermore, while not a specific requirement for FRET, the emission spectra of the fluorophores utilized must have sufficient separation to allow for the resolution of one fluorophore from the other when visualized. Common fluorophore pairs utilized in FRET analysis (listed as donor/acceptor) are Cyan Fluorescent Protein (CFP)/

Yellow Fluorescent Protein (YFP), Cerulean/Venus, and Cy3/Cy5 119 . Multiple methods to determine FRET efficiency, or the fraction of donor fluorophores that transfer energy to acceptor molecules, exist, including time resolved FRET (TR-FRET), acceptor photobleaching, and sensitized emission 120 . Sensitized emission FRET, perhaps the simplest of these methodologies, involves co-expressing donor and acceptor-tagged proteins in the same cell and exciting only the donor fluorophore. Under ideal conditions

(no cross-talk between fluorescent proteins), any subsequent emission from the acceptor

31 fluorophore would be the direct result of non-radiative energy transfer from the donor to the acceptor molecule. FRET efficiency can be determined by comparing acceptor fluorescence in co-transfected cells with the fluorescent spectra of cells expressing only the donor or acceptor tagged molecule. This method, while straightforward, suffers from complications due to the significant cross-talk exhibited by most FRET pair fluorescent proteins, and as such, requires multiple filter combinations and post-processing corrections to be employed to accurately analyze FRET efficiencies.

A more robust quantitative FRET methodology is acceptor photobleaching FRET.

This methodology relies on the fact that, if a FRET response is occurring between a donor and acceptor fluorophore, the donor emission spectra is “quenched” by non- radiative energy transfer to the acceptor fluorophore. Following initial image acquisition, the acceptor fluorophore is photobleached by high intensity laser pulses, eliminating energy transfer between the donor and acceptor fluorophores, which can be visualized as an increase in donor fluorescence following acceptor photobleaching 120 . This methodology eliminates many issues involving cross talk between fluorophores, as long as the donor fluorophore is not bleached by the acceptor photobleaching pulse, as the increase in donor fluorescence is directly proportional to the fraction of donor molecules transferring energy to acceptor fluorophores, which is useful when quantifying differential FRET responses.

Time resolved FRET (TR-FRET) is another methodology that seeks to maximize signal to noise ratios by using lanthanide fluorophores for both donor and acceptor molecules 121 . In contrast to GFP derived fluorophores, which possess fluorescent lifetimes ranging from approximately 2-4 nanoseconds, lanthanide fluorophores possess

32 much longer fluorescent lifetimes (~1 millisecond), which allows for a delay of approximately 50 microseconds to be added between donor excitation and emission signal acquisition 121 . During this delay, any background autofluorescence from tissue will dissipate, resulting in increased signal to noise ratios in TR-FRET data when compared to other FRET methodologies. The large distances between peak excitation and emission wavelengths in the lanthanide fluorophores used in TR-FRET studies also minimizes cross-talk and bleedthrough between the donor and acceptor fluorophores, further increasing signal to noise ratios with this methodology 122 . As such, TR-FRET remains a useful and robust methodology for determining the oligomeric state of GPCRs.

All FRET methodologies suffer from inherent and methodological pitfalls. For example, intermolecular FRET efficiency is directly dependent on the stoichiometry of the donor and acceptor-tagged proteins of interest. As such, many FRET studies bias the likelihood of donor-acceptor interactions by transfecting a greater ratio of acceptor- tagged receptors than donor-tagged receptors. This increases the likelihood of donor- tagged proteins interacting with acceptor tagged proteins at the cell surface, increasing observed FRET efficiencies. However, the stochastic incorporation of plasmids inherent to transient transfections can lead to large cell to cell variance in observed FRET efficiencies. Additionally, FRET relies on the three-dimensional positioning and orientation of the fluorophores involved, and as such, the location of the fluorophore fusion with the receptor molecule, and any interactions, such as ligand binding, that impact the conformation of the receptor can potentially influence observed FRET efficiencies without reflecting a change in receptor-receptor interactions. FRET efficiencies are also impacted by membrane curvature and overall receptor density,

33 calling into question the results of FRET studies which rely on overexpression of tagged receptors in a heterologous expression system 123 . As such, FRET studies are often paired with biochemical assays, such as Co-IP, to increase confidence in their findings.

A similar methodology to FRET commonly used to probe the oligomeric states of various GPCRs is bioluminescent resonance energy transfer (BRET). This methodology involves tagging of the donor molecule with a luciferase variant, which will typically emit ~480nm photons following addition of a luciferin substrate. This emitted photon is capable of exciting a fluorophore on the acceptor molecule, typically a GFP or YFP variant, resulting in subsequent photon emission between 510-530nm depending on the acceptor fluorophore used 124 . Similar to FRET, the donor luciferase molecule must be within 100 Å of the acceptor fluorophore for BRET interactions to occur. One specific advantage of this methodology over conventional FRET methods is the separation of emission spectra between donor and acceptor molecules, increasing signal to noise ratio 125 . Additionally, BRET does not rely on laser stimulation of a donor fluorophore molecule, greatly reducing background autofluorescence and further enhancing signal acquisition 125 . However, BRET suffers from similar complications as FRET analysis, being highly dependent on receptor density, with receptor overexpression capable of greatly increasing observed BRET responses 121 . Also, BRET signals are difficult to detect at low receptor expression levels, limiting its value in studying receptor-receptor interactions in native tissues 121 .

An additional microscopy-based approach to resolve GPCR-GPCR interactions is biomolecular fluorescent complementation, or BiFC. This methodology involves the generation of tagged acceptor and donor receptors with complementary fragments of a

34 fluorophore molecule, most commonly a GFP-derived fluorophore 126 . When expressed alone, the fluorophore fragments attached to either the donor or acceptor receptor are unable to adopt a conformation capable of producing fluorescence. However, colocalization of the complementary fluorophore fragments within approximately 7 nm leads to a functional reconstitution of the split fluorophore molecule, which can be visualized through fluorescent microscopy 127 . A specific advantage of this methodology over both BRET and FRET approaches in the ability to resolve BiFC interactions at low receptor densities that may more accurately reflect physiological expression levels than receptor overexpression commonly seen in both BRET and FRET investigations 128 .

Additionally, BiFC does not suffer from issues such as crosstalk or bleedthrough between acceptor and donor fluorophores, as is common with FRET investigations. This does not mean that BiFC is without its flaws. One major issue regarding BiFC analysis of receptor-receptor interactions is that fluorescent complementation of acceptor and donor fragments may occur as a result of “kiss and run” interactions between donor and acceptor molecules, rather than reflecting stable interactions between the receptors involved. This also renders this methodology incapable of studying dynamic protein- protein interactions, as fluorescent complementation is a largely irreversible event 129 .

These concerns, similar to BRET and FRET based investigations, result in receptor- receptor interactions suggested by BiFC being further verified by additional methodologies, such as Co-IP, to increase confidence in BiFC results 129 . Thus, similar to other microscopy-based approaches, BiFC offers specific advantages and disadvantages to resolving GPCR-GPCR interactions within the cell. Altogether, multiple microscopy- based methodologies to resolve GPCR dimers exist, each of which offering specific

35 benefits and tradeoffs in contrast to others, leading to complementary methodologies such as co-immunoprecipitation to be utilized to increase confidence in FRET, BRET, and

BiFC studies.

Conclusion

Since the initial cloning of the β2AR nearly four decades ago, much progress has been made towards a comprehensive understanding of GPCR function. It is now clear that this receptor superfamily exhibits greater complexity in activation and signaling than can be predicted by the classical two-state model. Additionally, as the number of annotated GPCR dimers and oligomers continues to grow, the question of whether a monomer or higher order structure represents the functional receptor unit for many

GPCRs remains the subject of much debate. Furthermore, receptor-receptor interactions within a dimer can giving lead to transactivation or transdesensitization, which can complicate efforts to assign specific downstream signaling pathways to individual

GPCRs. As such, continued investigation of conserved GPCR sequence motifs, as well as allosteric modulators of GPCR signaling, may elucidate fundamental molecular interactions and events underlying GPCR function and activity and further our understanding of this protein superfamily.

REFERENCES

1. Krishnan, A., Almén, M. S., Fredriksson, R. & Schiöth, H. B. The Origin of

GPCRs: Identification of Mammalian like Rhodopsin, Adhesion, Glutamate and

Frizzled GPCRs in Fungi. PLoS One 7, e29817 (2012).

2. Hanlon, C. D. & Andrew, D. J. Outside-in signaling – a brief review of GPCR

signaling with a focus on the Drosophila GPCR family. J Cell Sci 128 , 3533–3542

(2015).

3. Hu, G.-M., Mai, T.-L. & Chen, C.-M. Visualizing the GPCR Network:

Classification and Evolution. Sci. Rep. 7, 15495 (2017).

4. Dixon, R. A. F. et al. Cloning of the gene and cDNA for mammalian β-adrenergic

receptor and homology with rhodopsin. Nature 321 , 75–79 (1986).

5. Thomsen, W., Frazer, J. & Unett, D. Functional assays for screening GPCR

targets. Curr. Opin. Biotechnol. 16 , 655–665 (2005).

6. Ferré, S. et al. G Protein-Coupled Receptor Oligomerization Revisited: Functional

and Pharmacological Perspectives. doi:10.1124/pr.113.008052.

7. Xu, J. et al. GPR68 Senses Flow and Is Essential for Vascular Physiology Article

GPR68 Senses Flow and Is Essential for Vascular Physiology. Cell 173 , 762-

767.e16 (2018).

8. S-H Park, P., Lodowski, D. T. & Palczewski, K. Activation of G Protein-Coupled

Receptors: Beyond Two-State Models and Tertiary Conformational Changes

OVERVIEW OF G PROTEIN-COUPLED RECEPTOR STRUCTURE.

doi:10.1146/annurev.pharmtox.48.113006.094630.

9. Bray, P. et al. Human cDNA clones for four species of G alpha s signal

transduction protein. Proc. Natl. Acad. Sci. U. S. A. 83 , 8893–7 (1986).

10. Ahn, S. et al. A dominant-negative inhibitor of CREB reveals that it is a general

mediator of stimulus-dependent transcription of c-fos. Mol. Cell. Biol. 18 , 967–77

(1998).

11. Lim, C. et al. Functional role of CREB-binding protein in the circadian clock

system of Drosophila melanogaster. Mol. Cell. Biol. 27 , 4876–90 (2007).

12. Obel, L. F. et al. Brain glycogen—new perspectives on its metabolic function and

regulation at the subcellular level. Front. Neuroenergetics 4, 3 (2012).

13. Ichiki, T. Role of cAMP Response Element Binding Protein in Cardiovascular

Remodeling Good, Bad, or Both? (2006)

doi:10.1161/01.ATV.0000196747.79349.d1.

14. Alig, J. et al. Control of heart rate by cAMP sensitivity of HCN channels. Proc.

Natl. Acad. Sci. 106 , 12189–12194 (2009).

15. Morgan, P. J. & Mordue, W. Cyclic AMP and locust diuretic hormone action.

Hormone induced changes in cAMP levels offers a novel method for detecting

biological activity of uncharacterized peptide. Insect Biochem. 15 , 247–257

(1985).

16. Kandel, E. R. The molecular biology of memory: cAMP, PKA, CRE, CREB-1,

CREB-2, and CPEB . http://www.molecularbrain.com/content/5/1/14 (2012)

doi:10.1186/1756-6606-5-14.

17. Sands, W. A., Woolson, H. D., Milne, G. R., Rutherford, C. & Palmer, T. M.

Exchange protein activated by cyclic AMP (Epac)-mediated induction of

suppressor of cytokine signaling 3 (SOCS-3) in vascular endothelial cells. Mol.

Cell. Biol. 26 , 6333–46 (2006).

18. Taussig, R. & Gilman, A. G. Mammalian membrane-bound adenylyl cyclases. J.

Biol. Chem. 270 , 1–4 (1995).

19. Padgett, C. L. & Slesinger, P. A. GABAB Receptor Coupling to G-proteins and

Ion Channels. Adv. Pharmacol. 58 , 123–147 (2010).

20. Iannacone, M. J. et al. The RFamide receptor DMSR-1 regulates stress-induced

sleep in C. elegans. Elife 6, (2017).

21. Harden, T. K., Waldo, G. L., Hicks, S. N. & Sondek, J. Mechanism of activation

and inactivation of Gq/phospholipase C-β signaling nodes. Chem. Rev. 111 , 6120–

9 (2011).

22. Heydorn, A. et al. Identification of a novel site within G protein alpha subunits

important for specificity of receptor-G protein interaction. Mol. Pharmacol. 66 ,

250–9 (2004).

23. Goldsmith, Z. G. & Dhanasekaran, D. N. G Protein regulation of MAPK networks.

Oncogene vol. 26 3122–3142 (2007).

24. Liu, K. peing et al. Calcium receptor-induced serotonin secretion by parafollicular

cells: Role of phosphatidylinositol 3-kinase-dependent signal transduction

pathways. J. Neurosci. 23 , 2049–2057 (2003).

25. Gough, N. R. Connecting GPCRs to NF-κB. Sci. STKE 2007 , tw12–tw12 (2007).

26. K-K Fung, B. Characterization of Transducin from Bovine Retinal Rod Outer

Segments I. SEPARATION AND RECONSTITUTION OF THE SUBUNITS* . THE

JOURNAL OF BIOLOGICAL CHEMISTRY Printed in U.S.A vol. 258

http://www.jbc.org/.

27. Spielman, A. I. Gustducin and its Role in Taste. J. Dent. Res. 77 , 539–544 (1998).

28. Dascal, N. Ion-channel regulation by G proteins. Trends in Endocrinology and

Metabolism vol. 12 391–398 (2001).

29. Walsh, K. B. Targeting GIRK channels for the development of new therapeutic

agents. Front. Pharmacol. OCT , 64 (2011).

30. Snow, B. E. et al. A G protein γ subunit-like domain shared between RGS11 and

other RGS proteins specifies binding to Gβ5 subunits. Proc. Natl. Acad. Sci. 95 ,

13307–13312 (1998).

31. McPherson, K. B. et al. Regulators of G-Protein Signaling (RGS) Proteins

Promote Receptor Coupling to G-Protein-Coupled Inwardly Rectifying Potassium

(GIRK) Channels. J. Neurosci. 38 , 8737–8744 (2018).

32. Taussig, R., Quarmby, L. M. & Gilman, A. G. THE JOURNAL OF BIOLOGICAL

CHEMISTRY Regulation of Purified Type I and Type I1 Adenylylcyclases by G

Protein Br Subunits* Plasmid Construction-To facilitate purification of type I

adeny-lylcyclase, we constructed a recombinant baculovims encoding a type . vol.

268 http://www.jbc.org/content/268/1/9.full.pdf (1993).

33. Litosch, I. G-protein inhibition of phospholipase C-beta 1 in membranes: role of

G-protein beta gamma subunits. Biochem. J. 319 ( Pt 1) , 173–8 (1996).

34. Wu, D., Katz, A. & Simon, M. I. Activation of phospholipase C beta 2 by the

alpha and beta gamma subunits of trimeric GTP-binding protein. Proc. Natl. Acad.

Sci. U. S. A. 90 , 5297–301 (1993).

35. Gurevich, V. V & Gurevich, E. V. GPCR Signaling Regulation: The Role of

GRKs and Arrestins. Front. Pharmacol. 10 , 125 (2019).

36. Palczewski, K. & Saari, J. C. Activation and inactivation steps in the visual

transduction pathway. Curr. Opin. Neurobiol. 7, 500–504 (1997).

37. Smith, J. S. & Rajagopal, S. The β-Arrestins: Multifunctional Regulators of G

Protein-coupled Receptors. J. Biol. Chem. 291 , 8969–77 (2016).

38. Niu, S. et al. Beta-Arrestin 1 Mediates Liver Thyrotropin Regulation of

Cholesterol Conversion Metabolism via the Akt-Dependent Pathway. Int. J.

Endocrinol. 2018 , 1–12 (2018).

39. Donthamsetti, P. et al. Arrestin recruitment to dopamine D2 receptor mediates

locomotion but not incentive motivation. Mol. Psychiatry 1 (2018)

doi:10.1038/s41380-018-0212-4.

40. Bockaert, J., Fagni, L., Dumuis, A. & Marin, P. GPCR interacting proteins (GIP).

Pharmacol. Ther. 103 , 203–221 (2004).

41. Dickerson, I. M. Role of CGRP-receptor component protein (RCP) in CLR/RAMP

function. Curr. Protein Pept. Sci. 14 , 407–15 (2013).

42. McLatchie, L. M. et al. RAMPs regulate the transport and ligand specificity of the

calcitonin-receptor-like receptor. Nature 393 , 333–339 (1998).

43. Martin, A. L., Steurer, M. A. & Aronstam, R. S. Constitutive Activity among

Orphan Class-A G Protein Coupled Receptors. PLoS One 10 , e0138463 (2015).

44. Seifert, R. & Wenzel-Seifert, K. Constitutive activity of G-protein-coupled

receptors: cause of disease and common property of wild-type receptors. Naunyn.

Schmiedebergs. Arch. Pharmacol. 366 , 381–416 (2002).

45. Kobilka, B. K. & Deupi, X. Conformational complexity of G-protein-coupled

receptors. Trends Pharmacol. Sci. 28 , 397–406 (2007).

46. Liu, F. et al. Involvement of both G(q/11) and G(s) proteins in gonadotropin-

releasing hormone receptor-mediated signaling in L beta T2 cells. J. Biol. Chem.

277 , 32099–108 (2002).

47. Harmar, A. J. et al. cDNA sequence of human β-preprotachykinin, the common

precursor to substance P and neurokinin A. FEBS Lett. 208 , 67–72 (1986).

48. Palanche, T. et al. The Neurokinin A Receptor Activates Calcium and cAMP

Responses through Distinct Conformational States. J. Biol. Chem. 276 , 34853–

34861 (2001).

49. Wacker, D., Stevens, R. C. & Roth, B. L. How Ligands Illuminate GPCR

Molecular Pharmacology. Cell vol. 170 414–427 (2017).

50. Ballesteros, J. A. et al. Activation of the β2-Adrenergic Receptor Involves

Disruption of an Ionic Lock between the Cytoplasmic Ends of Transmembrane

Segments 3 and 6. J. Biol. Chem. 276 , 29171–29177 (2001).

51. Pruitt, M. M., Lamm, M. H. & Coffman, C. R. Molecular dynamics simulations on

the Tre1 G protein-coupled receptor: exploring the role of the arginine of the NRY

motif in Tre1 structure. BMC Struct. Biol. 13 , 15 (2013).

52. Ballesteros, J. A. et al. Activation of the beta 2-adrenergic receptor involves

disruption of an ionic lock between the cytoplasmic ends of transmembrane

segments 3 and 6. J. Biol. Chem. 276 , 29171–7 (2001).

53. Bhattacharya, S., Salomon-Ferrer, R., Lee, S. & Vaidehi, N. Conserved

Mechanism of Conformational Stability and Dynamics in G-Protein-Coupled

Receptors. J. Chem. Theory Comput. 12 , 5575–5584 (2016).

54. Rovati, G. E., Rie Capra, V. & Neubig, R. R. The Highly Conserved DRY Motif

of Class A G Protein-Coupled Receptors: Beyond the Ground State. Mol.

Pharmacol. 71 , 959–964 (2007).

55. Rasmussen, S. G. F. et al. Mutation of a Highly Conserved Aspartic Acid in the β

2 Adrenergic Receptor: Constitutive Activation, Structural Instability, and

Conformational Rearrangement of Transmembrane Segment 6. Mol. Pharmacol.

56 , 175–184 (2018).

56. Alewijnse, A. E. et al. The effect of mutations in the DRY motif on the

constitutive activity and structural instability of the histamine H(2) receptor. Mol.

Pharmacol. 57 , 890–898 (2000).

57. Vogel, R. et al. Functional Role of the “Ionic Lock”—An Interhelical Hydrogen-

Bond Network in Family A Heptahelical Receptors. J. Mol. Biol. 380 , 648–655

(2008).

58. Rosenthal, W., Antaramian, A., Gilbert, S. & Birnbaumer, M. Nephrogenic

diabetes insipidus. A V2 vasopressin receptor unable to stimulate adenylyl cyclase .

Journal of Biological Chemistry vol. 268

http://www.jbc.org/content/268/18/13030.full.pdf (1993).

59. Costa, E. M. F. et al. Two Novel Mutations in the Gonadotropin-Releasing

Hormone Receptor Gene in Brazilian Patients with Hypogonadotropic

Hypogonadism and Normal Olfaction 1. J. Clin. Endocrinol. Metab. 86 , 2680–

2686 (2001).

60. Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. Unexpected

role of a conserved domain in the first extracellular loop in G protein-coupled

receptor trafficking. Biochem. Biophys. Res. Commun. 503 , 1919–1926 (2018).

61. Klco, J. M., Nikiforovich, G. V & Baranski, T. J. Genetic Analysis of the First and

Third Extracellular Loops of the C5a Receptor Reveals an Essential WXFG Motif

in the First Loop. J. Biol. Chem. 281 , 12010–12019 (2006).

62. Hulme, E. C. GPCR activation: a mutagenic spotlight on crystal structures. Trends

Pharmacol. Sci. 34 , 67–84 (2013).

63. De Filippo, E. et al. Role of extracellular cysteine residues in the adenosine A2A

receptor. Purinergic Signal. 12 , 313–329 (2016).

64. Olivella, M., Caltabiano, G. & Cordomí, A. The role of Cysteine 6.47 in class A

GPCRs. BMC Struct. Biol. 13 , 3 (2013).

65. Weis, W. I. & Kobilka, B. K. The Molecular Basis of G Protein–Coupled Receptor

Activation. Annu. Rev. Biochem. 87 , 897–919 (2018).

66. Shi, L. et al. Modulation of the proline kink in transmembrane 6 by a rotamer

toggle switch. J. Biol. Chem. 277 , 40989–96 (2002).

67. Biebermann, H. et al. New Pathogenic Thyrotropin Receptor Mutations Decipher

Differentiated Activity Switching at a Conserved Helix 6 Motif of Family A

GPCR. J. Clin. Endocrinol. Metab. 97 , E228–E232 (2012).

68. Standfuss, J. et al. The structural basis of agonist-induced activation in

constitutively active rhodopsin. Nature 471 , 656–60 (2011).

69. Cherezov, V. et al. High-resolution crystal structure of an engineered human

beta2-adrenergic G protein-coupled receptor. Science 318 , 1258–65 (2007).

70. Katritch, V., Cherezov, V. & Stevens, R. C. Structure-Function of the G Protein–

Coupled Receptor Superfamily. Annu. Rev. Pharmacol. Toxicol. 53 , 531–556

(2013).

71. Barak, L. S. et al. A highly conserved tyrosine residue in G protein-coupled

receptors is required for agonist-mediated β2-adrenergic receptor sequestration. J.

Biol. Chem. 269 , 2790–2795 (1994).

72. Barak, L. S., Ménard, L., Ferguson, S. S. G., Colapietro, A. M. & Caron, M. G.

The Conserved Seven-Transmembrane Sequence NP(X)2,3Y of the G-Protein-

Coupled Receptor Superfamily Regulates Multiple Properties of the β2-Adrenergic

Receptor. Biochemistry 34 , 15407–15414 (1995).

73. Kalatskaya, I. et al. Mutation of tyrosine in the conserved NPXXY sequence leads

to constitutive phosphorylation and internalization, but not signaling, of the human

B2 bradykinin receptor. J. Biol. Chem. 279 , 31268–76 (2004).

74. Slice, L. W. et al. The conserved NPX(n)Y motif present in the gastrin-releasing

peptide receptor is not a general sequestration sequence. J. Biol. Chem. 269 ,

21755–21761 (1994).

75. Rosenbaum, D. M., Rasmussen, S. G. F. & Kobilka, B. K. The structure and

function of G-protein-coupled receptors. Nature 459 , 356–363 (2009).

76. Ragnarsson, L., Andersson, Å., Thomas, W. G. & Lewis, R. J. Mutations in the

NPxxY motif stabilize pharmacologically distinct conformational states of the

α1B- and β2-adrenoceptors. Sci. Signal. 12 , eaas9485 (2019).

77. White, J. H. et al. Heterodimerization is required for the formation of a functional

GABA(B) receptor. Nature 396 , 679–682 (1998).

78. Margeta-Mitrovic, M., Jan, Y. N. & Jan, L. Y. A Trafficking Checkpoint Controls

GABAB Receptor Heterodimerization. Neuron 27 , 97–106 (2000).

79. Chun, L., Zhang, W. & Liu, J. Structure and ligand recognition of class C GPCRs.

Acta Pharmacol. Sin. 33 , 312–323 (2012).

80. Grushevskyi, E. O. et al. Stepwise activation of a class C GPCR begins with

millisecond dimer rearrangement. Proc. Natl. Acad. Sci. U. S. A. 116 , 10150–

10155 (2019).

81. Møller, T. C., Moreno-Delgado, D., Pin, J.-P. & Kniazeff, J. Class C G protein-

coupled receptors: reviving old couples with new partners. Biophys. Reports 3, 57–

63 (2017).

82. Milligan, G., Ward, R. J. & Marsango, S. GPCR homo-oligomerization . Current

Opinion in Cell Biology vol. 57 40–47 (2019).

83. Wu, B. et al. Structures of the CXCR4 chemokine GPCR with small-molecule and

cyclic peptide antagonists. Science 330 , 1066–71 (2010).

84. Mancia, F., Assur, Z., Herman, A. G., Siegel, R. & Hendrickson, W. A. Ligand

sensitivity in dimeric associations of the serotonin 5HT2c receptor. EMBO Rep.

(2008) doi:10.1038/embor.2008.27.

85. Borroto-Escuela, D. O. et al. Mapping the interface of a GPCR Dimer: A structural

model of the A2A Adenosine and D2 dopamine receptor heteromer. Front.

Pharmacol. (2018) doi:10.3389/fphar.2018.00829.

86. Fotiadis, D. et al. The G protein-coupled receptor rhodopsin in the native

membrane. FEBS Lett. 564 , 281–288 (2004).

87. Petersen, J. et al. Agonist-induced dimer dissociation as a macromolecular step in

G protein-coupled receptor signaling. Nat. Commun. 8, 226 (2017).

88. Wolf, S. & Grünewald, S. Sequence, Structure and Ligand Binding Evolution of

Rhodopsin-Like G Protein-Coupled Receptors: A Crystal Structure-Based

Phylogenetic Analysis. PLoS One 10 , e0123533 (2015).

89. Huang, J., Chen, S., Zhang, J. J. & Huang, X. Y. Crystal structure of oligomeric β

1-adrenergic G protein-coupled receptors in ligand-free basal state. Nat. Struct.

Mol. Biol. (2013) doi:10.1038/nsmb.2504.

90. Ward, R. J., Pediani, J. D., Harikumar, K. G., Miller, L. J. & Milligan, G. Spatial

intensity distribution analysis quantifies the extent and regulation of

homodimerization of the secretin receptor. Biochem. J. 474 , 1879–1895 (2017).

91. Harikumar, K. G., Ball, A. M., Sexton, P. M. & Miller, L. J. Importance of lipid-

exposed residues in transmembrane segment four for family B calcitonin receptor

homo-dimerization. Regul. Pept. 164 , 113–119 (2010).

92. May, L. T., Bridge, L. J., Stoddart, L. A., Briddon, S. J. & Hill, S. J. Allosteric

interactions across native adenosine-A 3 receptor homodimers: Quantification

using single-cell ligand-binding kinetics. FASEB J. 25 , 3465–3476 (2011).

93. Urizar, E. et al. Glycoprotein hormone receptors: Link between receptor

homodimerization and negative cooperativity. EMBO J. 24 , 1954–1964 (2005).

94. El-Asmar, L. et al. Evidence for negative binding cooperativity within CCR5-

CCR2b heterodimers. Mol. Pharmacol. 67 , 460–9 (2005).

95. Albizu, L. et al. Time-resolved FRET between GPCR ligands reveals oligomers in

native tissues. Nat. Chem. Biol. 6, 587–594 (2010).

96. Ferré, S. et al. G Protein–Coupled Receptor Oligomerization Revisited: Functional

and Pharmacological Perspectives. Pharmacol. Rev. 66 , 413 LP – 434 (2014).

97. Vischer, H. F., Castro, M. & Pin, J. P. G protein-coupled receptor multimers: A

question still open despite the use of novel approaches. Mol. Pharmacol. (2015)

doi:10.1124/mol.115.099440.

98. Zhao, G. Q. et al. The Receptors for Mammalian Sweet and Umami Taste. Cell

115 , 255–266 (2003).

99. El Moustaine, D. et al. Distinct roles of metabotropic glutamate receptor

dimerization in agonist activation and G-protein coupling. Proc. Natl. Acad. Sci.

U. S. A. 109 , 16342–7 (2012).

100. Pioszak, A. A., Harikumar, K. G., Parker, N. R., Miller, L. J. & Xu, H. E. Dimeric

arrangement of the parathyroid hormone receptor and a structural mechanism for

ligand-induced dissociation. J. Biol. Chem. 285 , 12435–44 (2010).

101. Robinson, P. J., Pringle, M. A., Woolhead, C. A. & Bulleid, N. J. Folding of a

single domain protein entering the endoplasmic reticulum precedes disulfide

formation. J. Biol. Chem. (2017) doi:10.1074/jbc.M117.780742.

102. Dijkman, P. M. et al. Dynamic tuneable G protein-coupled receptor monomer-

dimer populations. Nat. Commun. (2018) doi:10.1038/s41467-018-03727-6.

103. Herrick-Davis, K., Weaver, B. A., Grinde, E. & Mazurkiewicz, J. E. Serotonin 5-

HT2C receptor homodimer biogenesis in the endoplasmic reticulum: real-time

visualization with confocal fluorescence resonance energy transfer. J. Biol. Chem.

281 , 27109–16 (2006).

104. King, K., Dohlman, H. G., Thorner, J., Caron, M. G. & Lefkowitz, R. J. Control of

yeast mating signal transduction by a mammalian beta 2-adrenergic receptor and

Gs alpha subunit. Science 250 , 121–3 (1990).

105. Tamma, G., Carmosino, M., Svelto, M. & Valenti, G. Bradykinin signaling

counteracts cAMP-elicited aquaporin 2 translocation in renal cells. J. Am. Soc.

Nephrol. (2005) doi:10.1681/ASN.2005020190.

106. Haack, K. K. V et al. A novel bioassay for detecting GPCR heterodimerization:

Transactivation of beta 2 adrenergic receptor by bradykinin receptor. J. Biomol.

Screen. (2010) doi:10.1177/1087057109360254.

107. Rivero-Müller, A. et al. Rescue of defective G protein - Coupled receptor function

in vivo by intermolecular cooperation. Proc. Natl. Acad. Sci. U. S. A. (2010)

doi:10.1073/pnas.0906695106.

108. Alonso, N. et al. Cross-desensitization and cointernalization of H1 and H2

histamine receptors reveal new insights into histamine signal integration. Mol.

Pharmacol. (2013) doi:10.1124/mol.112.083394.

109. Sakai, T. et al. Evidence for differential regulation of GnRH signaling via

heterodimerization among GnRH receptor paralogs in the protochordate, Ciona

intestinalis. Endocrinology 153 , 1841–1849 (2012).

110. González-Maeso, J. et al. Identification of a serotonin/glutamate receptor complex

implicated in psychosis. Nature 452 , 93–97 (2008).

111. Moreno, J. L., Holloway, T., Albizu, L., Sealfon, S. C. & González-Maeso, J.

Metabotropic glutamate mGlu2 receptor is necessary for the pharmacological and

behavioral effects induced by hallucinogenic 5-HT2A receptor agonists. Neurosci.

Lett. 493 , 76–9 (2011).

112. Szidonya, L., Cserzo, M. & Hunyady, L. Dimerization and oligomerization of G-

protein-coupled receptors: Debated structures with established and emerging

functions. Journal of Endocrinology (2008) doi:10.1677/JOE-07-0573.

113. Schägger, H. & von Jagow, G. Blue native electrophoresis for isolation of

membrane protein complexes in enzymatically active form. Anal. Biochem. 199 ,

223–231 (1991).

114. Marquer, C. et al. Influence of MT7 toxin on the oligomerization state of the M1

muscarinic receptor1. Biol. Cell (2010) doi:10.1042/bc20090171.

115. Xu, T. R., Ward, R. J., Pediani, J. D. & Milligan, G. The orexin OX 1 receptor

exists predominantly as a homodimer in the basal state: Potential regulation of

receptor organization by both agonist and antagonist ligands. Biochem. J. (2011)

doi:10.1042/BJ20110230.

116. Fiala, G. J., Schamel, W. W. A. & Blumenthal, B. Blue native polyacrylamide gel

electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular

lysates. J. Vis. Exp. (2010) doi:10.3791/2164.

117. Förster, T. Zwischenmolekulare Energiewanderung und Fluoreszenz. Ann. Phys.

437 , 55–75 (1948).

118. Sekar, R. B. & Periasamy, A. Fluorescence resonance energy transfer (FRET)

microscopy imaging of live cell protein localizations. J. Cell Biol. 160 , 629–33

(2003).

119. Shrestha, D., Jenei, A., Nagy, P., Vereb, G. & Szöllősi, J. Understanding FRET as

a Research Tool for Cellular Studies. Int. J. Mol. Sci. 16 , 6718 (2015).

120. Piston, D. W. & Kremers, G.-J. Fluorescent protein FRET: the good, the bad and

the ugly. Trends Biochem. Sci. 32 , 407–414 (2007).

121. Cottet, M. et al. BRET and Time-resolved FRET strategy to study GPCR

oligomerization: from cell lines toward native tissues. Front. Endocrinol.

(Lausanne). 3, 92 (2012).

122. Bazin, H., Trinquet, E. & Mathis, G. Time resolved amplification of cryptate

emission: a versatile technology to trace biomolecular interactions. Rev. Mol.

Biotechnol. 82 , 233–250 (2002).

123. Walsh, S. M. et al. Single Proteoliposome High-Content Analysis Reveals

Differences in the Homo-Oligomerization of GPCRs. Biophys. J. 115 , 300–312

(2018).

124. Kocan, M. & Pfleger, K. D. G. Study of GPCR-protein interactions by BRET.

Methods Mol. Biol. 746 , 357–371 (2011).

125. Salahpour, A. et al. BRET biosensors to study GPCR biology, pharmacology, and

signal transduction. Front. Endocrinol. (Lausanne). 3, 105 (2012).

126. Vidi, P.-A., Przybyla, J. A., Hu, C.-D. & Watts, V. J. Visualization of G protein-

coupled receptor (GPCR) interactions in living cells using bimolecular

fluorescence complementation (BiFC). Curr. Protoc. Neurosci. Chapter 5 , Unit

5.29 (2010).

127. Berendzen, K. et al. Screening for in planta protein-protein interactions combining

bimolecular fluorescence complementation with flow cytometry. Plant Methods 8,

25 (2012).

128. Kerppola, T. K. Bimolecular Fluorescence Complementation (BiFC) Analysis as a

Probe of Protein Interactions in Living Cells. Annu. Rev. Biophys. 37 , 465–487

(2008).

129. Miller, K. E., Kim, Y., Huh, W.-K. & Park, H.-O. Bimolecular Fluorescence

Complementation (BiFC) Analysis: Advances and Recent Applications for

Genome-Wide Interaction Studies. J. Mol. Biol. 427 , 2039–2055 (2015).

Figure 1: Two-state model of GPCR activation. In the inactive receptor state (Fig. 1A), in the absence of ligand, the receptor remains bound to an intracellular heterotrimeric G protein. The α subunit in the heterotrimeric G protein is bound to GDP and is inactive.

Upon ligand binding (Fig. 1B), the receptor undergoes a conformational change, allowing it to function as a guanine nucleotide exchange factor (GEF), facilitating the association of a GTP molecule with the associated α subunit. This event activates the α subunit and associated βγ subunits, leading to the dissociation of the heterotrimeric G protein from the activated receptor, where they can then signal through a variety of intracellular pathways.

Figure 2: Functional importance of GPCR heterodimerization . In a classical, monomeric receptor model of GPCR function, receptor A and receptor B signal through disparate pathways independent of one another (Fig. 2A). In the case of heterodimerization, ligand binding to receptor B can lead to intracellular signaling through receptor A, a phenomenon referred to as transactivation (Fig. 2B).

Heterodimerization can also lead to transdesensitization (Fig. 2C), where ligand binding to receptor B leads to β-arrestin association and subsequent internalization of the AB receptor complex. This causes desensitization of receptor A in the absence of ligand binding to this receptor.

CHAPTER II: Unexpected role of a conserved domain in extracellular loop 1 in G protein coupled receptor trafficking

Michael J. Rizzo 1, Jack P. Evans 1, Morgan Burt 1, Erik C. Johnson 1,2*

1 Department of Biology, Wake Forest University, Winston-Salem, NC 27109

2 and Center for Molecular Signaling

*Author for Correspondence: [email protected]

Keywords: G protein-coupled receptor (GPCR), membrane trafficking, signaling, membrane transport, mutagenesis

The work contained in this chapter was initially published in the journal Biochemical and

Biophysical Research Communications. M.J. Rizzo, J.P. Evans, M. Burt, C.J. Saunders,

E.C. Johnson, “Unexpected role of a conserved domain in the first extracellular loop in G protein-coupled receptor trafficking”, Biochem. Biophys. Res. Commun. 503 (2018).

Experiments were conceived by MJ Rizzo and EC Johnson. Reagents were generated and experiments were performed by MJ Rizzo, JP Evans, and M Burt. Data were analyzed by

MJ Rizzo and EC Johnson. The manuscript was drafted by MJ Rizzo and edited by EC

Johnson.

ABSTRACT

G protein coupled receptors are the largest superfamily of cell surface receptors in the metazoa and play critical roles in transducing extracellular signals into intracellular responses. This action is mediated through a conformational change in the receptor following ligand binding. A number of conserved motifs play critical roles in GPCR function and stability, but a particular, highly conserved motif in extracellular loop one (EL1) remains under investigated. This WxFG motif is present in ~90% of Class A

GPCRs and is prevalent in 17 of the 19 Class A GPCR subfamilies, yet its function remains incompletely elucidated. Using site-directed mutagenesis, we mutagenized a conserved tryptophan residue in the highly conserved WxFG motif in EL1 in eight receptors from disparate class A GPCR subfamilies. We first targeted the Drosophila leucokinin receptor and found that substitution of any non-aromatic amino acid for the conserved tryptophan ablated receptor function. Additionally, tryptophan to leucine substitutions in the follicle stimulating hormone receptor (FSHR), Galanin receptor

(GALR1), AKH receptor (AKHR), corazonin receptor (CRZR), and muscarinic acetylcholine receptor (mACHR1) lead to a loss of signaling response in each receptor.

We then utilized YFP tagged wild-type and mutant LKR, CRZR, and 5HT 2c R receptors to visualize these receptors in the cell and show that mutant receptor variants exhibited a severe reduction in plasma membrane expression, indicating aberrant trafficking in these receptors. Taken together, these results suggest a novel role for the WxFG motif in GPCR trafficking and overall receptor function.

INTRODUCTION

G protein coupled receptors (GPCRs) are the largest receptor superfamily present throughout the metazoa 1. Approximately 5% of all human genes encode these receptors and these molecules are a target for approximately 50% of all extant drugs 2. GPCRs play a major role in myriad physiologies, including vision, taste, neurotransmission, hormonal communication, and reproduction 3. GPCRs transduce multiple disparate extracellular signals into specific intracellular responses, most commonly increasing or inhibiting intracellular calcium and cAMP and modulating gene expression 4. Specifically, a conformational change induced by ligand binding enables activation of intracellular heterotrimeric G protein complexes, which in turn modulate disparate second messengers.

Given the fundamental importance of GPCRs in a wide variety of behaviors and physiologies, many structural-functional studies have aimed to understand the molecular dynamics of receptor activity . Additionally, the crystal structure of rhodopsin has helped identify a number of highly conserved motifs that have critical roles in wild type GPCR function 5. For example, various motifs have been implicated in activation (e.g., DRY,

CWxP), signal termination and receptor endocytosis (e.g., NPxxY), and endoplasmic

6–8 reticulum to cell surface trafficking (e.g., FX 6LL) . A particular motif that remains relatively unexplored is the WxFG motif in extracellular loop one (EL1). This motif had been initially described in the C5a receptor, wherein mutagenesis of the highly conserved tryptophan residue led to a loss of signaling, presumably through a disruption of receptor signaling downstream of ligand binding 9. Subsequent studies suggested that this tryptophan residue coevolved with proline residues on transmembrane domain 2 (TM2)

58 and/or TM5, presumably to stabilize receptor conformation 10 . In this study, we first investigated the prevalence of the WxFG motif in different receptor subfamilies and in multiple taxa and established that this domain is widespread throughout Class A GPCRs.

We then assessed the functional roles of the tryptophan residue and found a critical role for this residue for normal receptor function. We also found that this mutation ablated constitutive signaling from a modified receptor. Evaluation of receptor distribution using fluorescently tagged receptors revealed aberrant cellular localization, with the majority of the mutant receptors restricted to internal membrane compartments. Structural modeling of these receptor variants suggests this residue is critical for overall receptor topology.

Collectively, our results implicate that the WxFG motif plays a critical role in appropriate

GPCR cell surface trafficking and function.

METHODS

Receptor sequence alignment:

We adopted the receptor subfamily A classification according to the phylogenetic analysis of Joost and Methner to identify human receptors for each receptor subfamily 11 .

For a phylogenetic analysis, we used BLAST to search for homologous receptors to the human subfamily receptors in Mus musculus , Gallus gallus, Xenopus laevis, Danio rerio,

Ciona intestinalis, Drosophila melanogaster, and Caenorhabditis elegans. Only identified and validated receptor types were included in further analysis. Receptor sequences were then entered into TMHMM server to identify sequences corresponding to the first extracellular loop and consensus motifs for receptor subfamilies were generated using the Seq2LOGO webserver.

GPCR cloning and mutagenesis:

All GPCRs were cloned into a pcDNA3 expression vector. The Drosophila receptors originated from amplification from cDNA libraries and mammalian receptors were obtained from Addgene and cdna.org libraries. The human 5HT2c receptor was generously donated by Dr. Katherine Herrick-Davis. Mutagenic primers were designed targeting the tryptophan residue to alter it to a leucine or other amino acid. Site-directed

PCR mutagenesis was performed using both classical PCR mutagenesis or single primer reactions in parallel (SPRINP) 12,13 . The restriction enzyme, DpnI, was utilized to remove template receptor molecules following PCR mutagenesis. All receptor sequences were verified through ABI 3730XL sequencing through Eton Bioscience INC (Research

Triangle Park, NC).

GPCR Signaling Assays:

Galanin, somatostatin, and FSH were purchased from Phoenix Pharmaceticals

(Burlingame, CA). Leukokinin and adipokinetic hormone peptides from Drosophila were synthesized by Multiple Peptide Systems (San Diego, CA). Acetylcholine and corazonin were purchased from Sigma Chemicals (St. Louis, MO). HEK-293T cells were transfected with GPCR recombinant DNA and either a CRE-luciferase or SRE-luciferase reporter DNA at a 5:1 ratio of receptor: reporter construct as previously described 14 . For assessing signaling emanating from Gi coupled receptors, the Gα16 was transfected at a

2:1 ratio to receptor construct 15 . Following transfection, 96 well plates were seeded with cells and incubated with vehicle (MEM) or ligand for four hours (100,000 cells per well,

3 wells per independent transfection, 9 wells per condition). Following incubation, luciferase activity was assessed using the Steadylite plus Reporter Gene Assay System and Victor3 1420 multilabel plate reader. Luminescence was determined through counts per second (CPS) output and receptor activity was normalized to vehicle responses for each condition and reported as % basal activation.

GPCR Receptor trafficking assays:

Wild type and mutagenized receptors were cloned in frame into pcDNA3 CFP or pcDNA3 YFP vectors and transfected into HEK-293T cells. Following transfection,

~100,000 cells were transferred to a glass cover slip and fixed with 2% paraformaldehyde. Plasma membranes were then stained with 5mg/mL Wheat Germ

Agglutinin (WGA-594) and imaged on Zeiss 710 LSM confocal microscope. Receptor localization and trafficking was compared between 5-10 independent cells from three independent transfections expressing YFP tagged wild-type or mutagenized receptors.

Colocalization of the receptor and plasma membrane was determined through Pearson’s coefficient, calculated in FIJI software using the coloc2 plugin as previously described 16 .

Pearson colocalization coefficients of WGA and YFP were obtained for each condition, and values were Fisher transformed prior to statistical analysis.

RAPTORX Receptor Modeling:

Receptor structures were predicted using full length ORF sequences from wild-type and mutant leucokinin receptors modeled using the RAPTORX prediction server 17 .

Prediction quality was assessed through the computed P value for fit (P<.001), using a

NK1R receptor as a template for prediction, a member of the same receptor subfamily as the leucokinin receptor. Structural predictions were visualized using PyMol software suite and the specific tryptophan (WT) or leucine (mutant) was highlighted, as well as N and C termini.

RESULTS

The WxFG domain is present in disparate receptors from multiple taxa:

The initial description of the WxFG receptor motif focused on the functional roles of this domain in the human complement C5a receptor9. We sought to systematically evaluate the prevalence of the WxFG motif among different Class A GPCRs, as the original description of this motif suggested a high degree of conservation. Subsequently, we performed a bioinformatic analysis across all 19 Class A receptor subfamilies focusing on human receptor sequences 11 . We found that the motif is present in multiple members of 17 different receptor subfamilies (Table 1). We did find a substitution in two different peptide receptor subfamilies, A6 and A7, the neuromedin U and cholecystokinin receptor subtypes respectively, in which a phenylalanine (F) residue has replaced the tryptophan (W) position. Notably, this motif is completely absent in subfamilies A13 and

A14. Both of these receptor subfamilies have nucleotide/lipid ligands and suggest a secondary loss of this motif in these related receptor subtypes.

Having established that this motif is present in multiple receptor subtypes, we next evaluated whether this motif was a common feature of each receptor family across a number of different taxa. We extended our analysis focusing on receptor sequences from established vertebrate and invertebrate model organisms: Homo sapiens, Mus musculus,

Gallus gallus, Xenopus laevis, Danio rerio, Ciona intestinalis, Drosophila melanogaster, and Caenorhabditis elegans. We aligned the sequence corresponding to the extracellular loop for all clear members of a receptor family for each of taxa. Notably, in 15 of the 17 receptor subfamilies, the W position exhibited the least identity variance across all

63 sequences as indicated by seq2logo bitscore (Figure 1). As noted previously, the

Cholecystokinin and Neuromedin U receptor subfamilies show a common F substitution.

The W residue is critical for GPCR signaling:

Alteration of the W residue in the WxFG motif causes a loss of receptor signaling in the human complement 5a factor receptor, C5aR 9. Given the widespread prevalence of this motif, we next examined whether the functional aspects of this motif were similar.

We first focused on the effects of different amino acid substitutions on receptor signaling using the leucokinin receptor (LKR) from Drosophila , a receptor with critical roles in meal size discretion and diuresis 18,19 . We made different amino acid substitutions representing changes to non-polar, charged, and aromatic subclasses: W101A, W101L,

W101K, W101E, and W101F. Each of these receptor variants, with the exception of the

W101F, were insensitive to ligand presentation. Specifically, while wild type LKR exhibited dose dependent responses to ligand, the W101L, W101K, W101A, and W101E variants exhibited no significant response to ligand presentation (Figure 2). In contrast, the W101F substitution showed wild-type responses to ligand presentation, indicating that this variant encodes a functional leucokinin receptor. Collectively, these data suggest that amino acid identity at the W position in the WxFG motif is critically important for receptor function.

We next extended our observations to include receptors from several different subfamilies, and that differ in their signaling properties. We targeted six additional receptors representing Class A GPCR subfamilies A4, A5, A6, A10, and A16.

Additionally, these receptors couple to distinct intracellular heterotrimeric G proteins, with the corazonin receptor (CRZR) and follicle-stimulating hormone receptor (FSHR)

64 coupling to Gs 20,21 , the adipokinetic hormone receptor (AKHR), muscarinic acetylcholine receptor (mACHR1), and leucokinin receptor (LKR) coupling to Gq 22–24 , and GALR1 and SSTR2 coupling to Gi 25,26 . The promiscuous Gα16 subunit was included in GALR1 and SSTR2 transfections to promote coupling of these receptors to elevated calcium levels for ease of monitoring. All SSTR2, GALR1, mACHR1, and

FSHR mutant variants exhibited a significant loss of function compared to their wild type counterparts. Additionally, the Drosophila AKH and corazonin receptors (AKHR,

CRZR), exhibited a similar loss of function when mutagenized (Figure 3).

Tryptophan variants impair constitutive signaling:

As previous studies suggested that WxFG domain mutant receptors bind ligand, but lack signaling responses 9, we tested whether the loss of signaling phenotypes could be rescued by simultaneously conferring constitutive activity in a mutagenized receptor background. Many GPCRs exhibit constitutive activity and constitutive activity can be experimentally induced through targeted mutagenesis of the DRY motif 18,19 . To induce constitutive activity, we mutagenized the aspartate residue in the DRY motif of the Drosophila AKHR receptor (D136A), which conferred significantly elevated basal signaling compared to wild type AKHR (Figure 4A), whereas the W105L variant showed no signaling response (Figure 4B). In contrast, a W105L, D136A double mutant receptor showed no signaling activity in response to ligand or in the basal state, indicating a loss of both ligand responsiveness and constitutive activity for that receptor (Figure 4C).

Variants in the W residue impairs receptor trafficking:

Given that substitutions in the WxFG domain cause a reduction in signaling independent of receptor type and ablate constitutive activity, we reasoned that abnormal receptor expression could potentially explain the loss of function phenotypes. To determine the impact of the tryptophan substitution in the WxFG motif on receptor expression, we incorporated a C-terminal fluorescent tag. We targeted three different receptors that differ in their signaling properties and are members of different receptor subfamilies. Specifically, we added a yellow fluorescent protein (YFP) to the Drosophila

CRZR, and LKR and used a previously generated human 5HT 2c -YFP receptor in both wild-type and W ‰L substitution variants. While we observed strong fluorescent signals in both wild-type and mutant receptors, however, the patterns of fluorescence were very different. Specifically, we observed strong YFP signal limited to the plasma membrane in wild-type receptors. In each of the W ‰L receptor variants, we found a dramatic reduction in YFP signal at the plasma membrane, with an increased amount of intracellular YFP expression (Figure 5). These results suggest that the WxFG motif plays a critical role in receptor trafficking and provide a mechanism to explain the loss of function receptor phenotypes.

Structural modeling suggests the W stabilizes receptor architecture:

Based on the confluence of our trafficking and signaling data, we hypothesized that mutagenesis of the conserved W in WxFG must be significantly altering receptor conformation and folding. To assess the impact of these substitutions, we initially modeled the leucokinin receptor and a variant (W101L) using the RAPTORX protein structural modeling program. The models suggest that substitutions of the tryptophan

66 residue result in displacement of the N and C terminal regions of the receptor (Figure 6).

This distortion in overall receptor conformation suggests receptor instability may explain the aberrant trafficking of mutant receptors.

DISCUSSION In this study, we extended a phylogenetic analysis of the presence of the WxFG domain and found that this domain is highly conserved throughout different Class A

GPCRs. Specifically, this domain is present in seventeen of the nineteen Class A subfamilies and is a prominent feature of these receptors independent of taxa. We also evaluated the functional contributions of the largely invariant tryptophan reside and found that an aromatic residue in this position is required for receptor function, independent of receptor type or specific downstream effector. Furthermore, we find that that this domain functions in GPCR trafficking and propose a structural model in which the tryptophan stabilizes overall receptor architecture.

In the initial investigation of WxFG motif in the C5a receptor, Klco et al. noted that a tryptophan was present in the first extracellular loop in 80% of human peptide- binding GPCRs, and that a phenylalanine was present in 10 % of these receptors, indicating high conservation of an aromatic residue at this position 9. Here we performed a comprehensive analysis of the presence of the WxFG motif in each Class A GPCR subfamilies and showed that the motif is largely present in all subfamilies, with the exception of A13 and A14 subfamilies. The loss of this domain in these subfamilies is interesting, as it suggests that A13 and A14 receptor subfamilies may utilize different strategies to adopt stable conformations. This hypothesis is supported by a multidimensional scaling analysis by Pele et al. which suggests that the WxFG motif coevolved with proline residues on TM2 and TM5, presumably stabilizing overall receptor structure 10 . Notably, these proline residues are absent in A13 GPCRs, while the TM5 proline is absent in A14 members, both of which lack the WxFG motif. Additionally, the

68 motif does not appear to be conserved in any other GPCR subfamily, suggesting it arose during the expansion of Class A GPCRs 27 .

Multiple previous studies have investigated the WxFG motif in individual receptors 9,28–30 , and we have furthered these initial descriptions and suggest a novel mechanism for the role of this motif in GPCR function. The initial investigation of the

C5a receptor showed that mutations at the tryptophan residue generated receptors that bind ligand but are unable to transduce a signaling response 9. Our data suggests that modified receptors show an aberrant distribution within the cell, meaning that even if these receptors are able to bind ligand, they are not present at the plasma membrane.

Given that these previous ligand binding studies were performed on isolated membrane preparations, we suspect that modified receptors are localized to intracellular membrane compartments. In support of this, A W99C substitution in the NK2R receptor exhibited no ligand binding when assayed on whole cells 31 . The totality of these studies suggests an aromatic amino acid at the W position is critical for wild type receptor function, and modification of this position causes abnormal GPCR localization.

The aberrant localization of WxFG mutants might stem from defects in receptor folding. Many conserved GPCR motifs play roles in stabilizing the receptor’s active and inactive states, such as the ionic lock/DRY motif 32 and NPxxY motif 33 , or act as microswitches gating receptor activation, such as the CWxP motif 10 . As previous studies have shown that WxFG mutants are able to bind ligand, our data therefore suggest that the WxFG motif plays an unexpected role in appropriate receptor trafficking. It is presently unclear if this motif is involved in trafficking to the plasma membrane, or alternatively, has other unexpected receptor phenotypes that could explain its intracellular

69 distribution, such as constitutive desensitization of the receptor 34 . Many GPCRs require interactions with accessory proteins for appropriate cell surface trafficking, with the

35 Calcitonin receptors requiring interaction with RAMPs , while the β1AR is stabilized at the cell surface by interactions with PSD-95, a PDZ domain containing chaperone 36 . The

5HT2c receptor possesses a C-terminal PDZ-binding domain which plays a critical role in the synaptic localization of this receptor 37 . Disruption of the WxFG motif may interfere with receptor-chaperone interactions, leading to the aberrant receptor localization that we observed. It is possible that the WxFG motif acts as a microswitch, and its modification interferes with the transition between inactive and active receptor conformations. We consider this unlikely, as we would predict that a constitutively active, internalized receptor should still show evidence of increased basal activity.

Alternatively, the c-terminal F(X) 6LL domain is critical for α 2B -AR and AT1R exit from the ER 8, and WxFG may play a similar role in ensuring appropriate receptor localization.

Furthermore, the cysteine residue downstream of WxFG at the top of TM3 forms a disulfide bond with a cysteine residue on EL2 38 , and this disulfide bond is required for appropriate trafficking of M3 receptor to the cell surface. Thus, the WxFG motif may be important for allowing the interactions between these two extracellular loops in establishing the appropriate receptor topology.

This study represents the most comprehensive investigation of the WxFG motif across multiple Class A GPCR subfamilies to date. We have shown that this motif is heavily conserved across Class A GPCRs, and substitution of the W with a nonaromatic amino acid yields a nonfunctional receptor with impaired plasma membrane localization.

We suggest a novel mechanism by which that the WxFG motif plays a critical role in

70 wild type GPCR trafficking to the plasma membrane, and likely functions in concert with other conserved GPCR motifs to stabilize the receptor in an appropriate conformation.

Further investigation is necessary to determine whether these mutant receptors ever reach the cell surface and are retained in the ER-Golgi complex, or that receptor instability causes rapid internalization of the receptor.

ACKNOWLEDGEMENTS

We acknowledge Dr. Glen Marrs for microscopy assistance, Dr. Cecil Saunders and Jon

Nelson for manuscript editing, Dr. T. Michael Anderson for statistical analysis, and Dr.

Katherine Herrick-Davis for reagents. This work was funded by NSF IOS1355097 to

ECJ, and the WFU Center for Molecular Signaling (CMCS).

CONFLICTS OF INTEREST

The authors declare that they have no conflicts of interest with the contents of this manuscript.

AUTHOR CONTRIBUTIONS

MJR and ECJ designed experiments, MJR, JPE, MB performed experiments. MJR and

ECJ analyzed results. MJR and ECJ wrote manuscript, all authors contributed edits.

REFERENCES

1. Whitehead, I. P., Zohn, I. E. & Der, C. J. Rho GTPase-dependent transformation

by G protein-coupled receptors. Oncogene 20 , 1547–1555 (2001).

2. Overington, J. P., Al-Lazikani, B. & Hopkins, A. L. How many drug targets are

there? Nat. Rev. Drug Discov. 5, 993–996 (2006).

3. Lefkowitz, R. J. A Brief History of G-Protein Coupled Receptors (Nobel Lecture).

Angew. Chemie Int. Ed. 52 , 6366–6378 (2013).

4. Hanlon, C. D. & Andrew, D. J. Outside-in signaling – a brief review of GPCR

signaling with a focus on the Drosophila GPCR family. J Cell Sci 128 , 3533–3542

(2015).

5. Palczewski, K. et al. Crystal structure of rhodopsin: A G protein-coupled receptor.

Science (80-. ). 289 , 739–745 (2000).

6. Olivella, M., Caltabiano, G. & Cordomí, A. The role of Cysteine 6.47 in class A

GPCRs. BMC Struct. Biol. 13 , 3 (2013).

7. Chen, W. J., Goldstein, J. L. & Brown, M. S. NPXY, a sequence often found in

cytoplasmic tails, is required for coated pit-mediated internalization of the low

density lipoprotein receptor. J. Biol. Chem. 265 , 3116–3123 (1990).

8. Duvernay, M. T., Zhou, F. & Wu, G. A Conserved Motif for the Transport of G

Protein-coupled Receptors from the Endoplasmic Reticulum to the Cell Surface. J.

Biol. Chem. 279 , 30741–30750 (2004).

9. Klco, J. M., Nikiforovich, G. V & Baranski, T. J. Genetic Analysis of the First and

Third Extracellular Loops of the C5a Receptor Reveals an Essential WXFG Motif

in the First Loop. J. Biol. Chem. 281 , 12010–12019 (2006).

10. Pelé, J., Abdi, H., Moreau, M., Thybert, D. & Chabbert, M. Multidimensional

Scaling Reveals the Main Evolutionary Pathways of Class A G-Protein-Coupled

Receptors. PLoS One 6, e19094 (2011).

11. Joost, P. & Methner, A. Phylogenetic analysis of 277 human G-protein-coupled

receptors as a tool for the prediction of orphan receptor ligands. Genome Biol. 3,

RESEARCH0063 (2002).

12. Weiner, M. P. et al. Site-directed mutagenesis of double-stranded DNA by the

polymerase chain reaction. Gene 151 , 119–123 (1994).

13. Edelheit, O., Hanukoglu, A. & Hanukoglu, I. Simple and efficient site-directed

mutagenesis using two single-primer reactions in parallel to generate mutants for

protein structure-function studies. BMC Biotechnol. 9, 61 (2009).

14. Johnson, E. C. et al. Identification of Drosophila neuropeptide receptors by G

protein-coupled receptors-beta-arrestin2 interactions. J. Biol. Chem. 278 , 52172–8

(2003).

15. Offermanns, S. & Simon, M. I. Gα15 and Gα16 Couple a Wide Variety of

Receptors to Phospholipase C. J. Biol. Chem. 270 , 15175–15180 (1995).

16. Irannejad, R. et al. Functional selectivity of GPCR-directed drug action through

location bias. Nat. Chem. Biol. 13 , 799–806 (2017).

17. Källberg, M. et al. Template-based protein structure modeling using the RaptorX

web server. Nat. Protoc. 7, 1511–1522 (2012).

18. Al-Anzi, B. et al. The leucokinin pathway and its neurons regulate meal size in

Drosophila. Curr. Biol. 20 , 969–978 (2010).

19. Yang, M. Y., Wang, Z., MacPherson, M., Dow, J. A. T. & Kaiser, K. A novel

Drosophila alkaline phosphatase specific to the ellipsoid body of the adult brain

and the lower Malpighian (renal) tubule. Genetics 154 , 285–297 (2000).

20. Sha, K. et al. Regulation of ethanol-related behavior and ethanol metabolism by

the corazonin neurons and corazonin receptor in Drosophila melanogaster. PLoS

One 9, (2014).

21. Costagliola, S. et al. Tyrosine sulfation is required for agonist recognition by

glycoprotein hormone receptors. EMBO J. 21 , 504–513 (2002).

22. Baumbach, J., Xu, Y., Hehlert, P. & Kühnlein, R. P. Gαq, Gγ1 and Plc21C Control

Drosophila Body Fat Storage. J. Genet. Genomics 41 , 283–292 (2014).

23. Biddlecome, G. H., Berstein, G. & Ross, E. M. Regulation of Phospholipase C-1

by G and m1 Muscarinic Cholinergic Receptor. Steady-state balance of receptor-

mediated activation and GTPase-activating protein-promoted deactivation. J. Biol.

Chem. 271bara , 7999–8007 (1996).

24. Terhzaz, S. et al. Isolation and characterization of a leucokinin-like peptide of

Drosophila melanogaster. J. Exp. Biol. 202 , 3667–3676 (1999).

25. Kagimoto, S. et al. Human somatostatin receptor, SSTR2, is coupled to adenylyl

cyclase in the presence of Gi alpha 1 protein. Biochem. Biophys. Res. Commun.

202 , 1188–1195 (1994).

26. Habert-Ortoli, E., Amiranoff, B., Loquet, I., Laburthe, M. & Mayaux, J. F.

Molecular cloning of a functional human galanin receptor. Proc. Natl. Acad. Sci.

U. S. A. 91 , 9780–9783 (1994).

27. Nordström, K. J. V, Sällman Almén, M., Edstam, M. M., Fredriksson, R. &

Schiöth, H. B. Independent HHsearch, Needleman–Wunsch-Based, and Motif

Analyses Reveal the Overall Hierarchy for Most of the G Protein-Coupled

Receptor Families. Mol. Biol. Evol. 28 , 2471–2480 (2011).

28. Peeters, M. C. et al. GPCR structure and activation: an essential role for the first

extracellular loop in activating the adenosine A2B receptor. FASEB J. 25 , 632–643

(2010).

29. Ragnarsson, L., Andersson, Å., Thomas, W. G. & Lewis, R. J. Extracellular

Surface Residues of the α1B-Adrenoceptor Critical for G Protein–Coupled

Receptor Function. Mol. Pharmacol. 87 , 121–129 (2015).

30. Ragnarsson, L. et al. Conopeptide ρ-TIA Defines a New Allosteric Site on the

Extracellular Surface of the α1B-Adrenoceptor. J. Biol. Chem. 288 , 1814–1827

(2013).

31. Labrou, N. E., Bhogal, N., Hurrell, C. R. & Findlay, J. B. C. Interaction of Met297

in the Seventh Transmembrane Segment of the Tachykinin NK2 Receptor with

Neurokinin A. J. Biol. Chem. 276 , 37944–37949 (2001).

32. Audet, M. & Bouvier, M. Restructuring G-Protein- Coupled Receptor Activation.

Cell 151 , 14–23 (2012).

33. Fritze, O. et al. Role of the conserved NPxxY(x)5,6F motif in the rhodopsin

ground state and during activation. Proc. Natl. Acad. Sci. U. S. A. 100 , 2290–2295

(2003).

34. Barak, L. S., Oakley, R. H., Laporte, S. A. & Caron, M. G. Constitutive arrestin-

mediated desensitization of a human vasopressin receptor mutant associated with

nephrogenic diabetes insipidus. Proc. Natl. Acad. Sci. U. S. A. 98 , 93–98 (2001).

35. McLatchie, L. M. et al. RAMPs regulate the transport and ligand specificity of the

calcitonin-receptor-like receptor. Nature 393 , 333–339 (1998).

36. Dunn, H. A. & Ferguson, S. S. G. PDZ Protein Regulation of G Protein–Coupled

Receptor Trafficking and Signaling Pathways. Mol. Pharmacol. 88 , 624–639

(2015).

37. Bécamel, C. et al. Synaptic multiprotein complexes associated with 5‐HT2C

receptors: a proteomic approach. EMBO J. 21 , 2332–2342 (2002).

38. Zeng, F.-Y., Soldner, A., Schöneberg, T. & Wess, J. Conserved Extracellular

Cysteine Pair in the M3 Muscarinic Acetylcholine Receptor Is Essential for Proper

Receptor Cell Surface Localization but Not for G Protein Coupling. J. Neurochem.

72 , 2404–2414 (1999).

Sub- Subfamily Subtype Human ECL 1 sequence UniProt entry family Gene A1 Chemokine CCR1 DYKLKDD WVFGDAMCK P32246[92-107] A2 Chemokine CXCR3 VDAAVQ WVFGSGLCK P49682[111-125] A3 Angiotensin AGTR1 TAMEYR WPFGNYLCK P30556[88-102] Bradykinin B1 NQFN WPFGALLCR P46663[99-111] A4 Somatostatin SSTR1 RH WPFGALLCR P30872[121-131] Opioid OPRD1 MET WPFGELLCK P41143[111-122] A5 Galanin GALR1 QATVYALPT WVLGAFICK P47211[92-109] A6 Cholecystokinin** CCK KD FIFGSAVCK P32238[105-115] Neuropeptide FF NPFFR1 VDNLITG WPFDNATCK Q9GZQ6[102- 117] GnRH GNRHR DGMWNITVQ WYAGELLCK P30968[98-115] Orexin HCRTR1 SLLVDITES WLFGHALC O43613[103-119] A7 Bombesin BRS3 DATHYLAEG WLFGRIGCK P32247[104-121] TRH* TRHR TDSIYGS WVYGYVGCL P34981[84-99] Neuromedin U* NMUR1 YEMWHNYP FLLGVGGCYFRT Q9HB89[119- 138] A8 Formyl peptide receptor fMLPR RKAMGGH WPFGWFLCKF P21462[84-100] Anaphylatoxin C3A HLALQGQ WPYGRFLCK Q16581[81-96] A9 Melatonin MTNR1A LMSIFNNG WNLGYLHCQV P48039[85-102] Tachykinin TAC1R VVNFTYAVHNE WYYGLFYCK P25103[87-106] NPY NPY1R FVYTLMDH WVFGEAMCKLN P25929[98-116] A10 FSH FSHR DIHTKSQYHNYAID WQTGAGCD P23945[422-443] A11 Purinergic P2Y1R YYFNKTD WIFGDAMCKL P47900[110-126] Free Fatty Acid FFAR2 PFKIIEAASNFR WYLPKVVCAL O15552[63-84] A12 P2 purinoreceptor* P2RY13 KILSDSHLAP WQLRAFVCR Q9BPV8[99-117] A13 Cannaboid** CNR2 NFHVFHGVDSKA P34972[93-104] Lysophospatidic acid LPAR1 NTRRLTVSTWLLRQ Q92633[112-125] Syphingophospate* S1PR2 VTLRLTPVQWFARE O95136[96-109] Melanocortin** MC1R ETAVILLLEAGALVARAAVLQQLD Q01726[94-118]

A14 Prostoglandins* PTGER3 VYLSKQRWEHIDPSGRLCT P43115[113-131] A15 Proteases* F2RL1 KIAYHIHGNN WIYGEALCN P55085[131-149] A16 Opsins* OPN4 TSSLYKQ WLFGETGCE Q9UHM6[129- 144] A17 Serotonin HTR2A LTILYGYR WPLPSKLC P28223[133-148] Dopamine DRD1 GF WPFGSFC P21728[88-96] Adrenergic ADRA1A LGY WAFGRVFC P35348[89-99] Trace Amine TAAR1 MVRSAEHC WYFGEVFCKI Q96RJ0[81-98] A18 Histamine HRH1 NILYLLMSK WSLGRPLCL P35367[84-101] Adenosine** ADORA1 NIGPQTYFHTC P30542[70-80] Muscarinic ACh CHRM1 TTYLLMGH WALGTLACD P11229[83-99] A19 Serotonin HTR1A LNK WTLGQVTCD P08908[99-110]

Table 1 : Comparison of representative extracellular loop 1 sequences across Class A

GPCR subfamilies. Human GPCR sequences were obtained from NCBI databases and extracellular loop 1 sequences were predicted using the TMHMM server. The presence of the WxFG motif tryptophan residue is highlighted in red, whereas a phenylalanine residue at this position is highlighted in yellow. A tryptophan is present at the appropriate position in 15 of the 19 subfamilies, and a tryptophan or phenylalanine is present in 17 of the 19 subfamilies, indicating a high level of conservation of this motif amongst class A GPCRs.

Figure 1: Sequence weighting analysis shows that the WxFG motif’s tryptophan residue exhibits high conservation in Class A GPCR receptor subfamilies .

Extracellular loop 1 sequences from Homo sapiens , Drosophila melanogaster , D anio rerio , Mus musculus , Caenorhabditis elegans, Xenopus laevis, and Gallus gallus were obtained using the NCBI database and TMHMM web server, and positional weight scores were generated using the Seq2Logo application. Heavy conservation of the tryptophan residue in the WxFG motif is seen in all but family A6, which exhibits greater conservation of a phenylalanine residue at that position.

Figure 2: Mutagenesis of conserved tryptophan residue in LKR ECL1 ablates receptor signaling . A. W101L substitution in the WXFG motif of the leucokinin receptor ablates receptor function. Site-directed mutagenesis of the conserved tryptophan residue in EL1 yields a receptor which is unresponsive to leucokinin stimulation at all concentrations. The wild type LKR exhibited a maximal response at 10 -6 M ligand application. B. Substitution of the conserved tryptophan residue in EL1 of the leucokinin receptor leads to a loss of function when an aromatic residue is not present at that position. 5 mutagenized variants of LKR were generated and tested using a SRE-luc signaling assay. Receptor responses were quantified as % basal activity following 10 -6 M ligand presentation. Both WT LKR and the W101F variant exhibited significantly elevated activity following ligand addition, while variants W101E, W101A, W101K, and

W101L exhibited no significant increase in signaling from baseline (P<.003). W101F exhibited no significant difference in signaling response when compared to wild type.

Figure 3: Leucine substitution for the conserved tryptophan residue in extracellular loop 1 leads to a loss of function in multiple receptor types . Receptor constructs were obtained from multiple repositories and mutagenized as previously described. These receptor constructs couple to Gs (AKHR, FSHR, white bars), Gq (CRZR, mACHR1, black bars), or Gi (SSTR2, GALR1, black bars), and the promiscuous G α16 subunit was included in transfections of Gi coupled receptors. In each case, leucine substitution at the

W position in the WxFG motif led to a loss of signaling response to 10 -6 M ligand presentation (P<.003), suggesting a conservation of WxFG domain function across taxa.

Specifically, SSTR2, GALR1, FSHR, mACHR1, AKHR, and CRZR wild type receptors

82 exhibited 246.42%, 210.90%, 764.85%, 231.26%, 845.72%, and 290.66% of basal signal at 10-6M ligand application, while their respective mutants exhibited a near complete loss of function (SSTR2 mutant:94.73%, GALR1 mutant:127.29%, FSHR mutant:123.21%, mACHR1 mutant:138.17%, AKHR mutant: 115.75%, and CRZR mutant: 104.40% respectively, P<.003, hatched bars).

Figure 4: Substitution of the conserved tryptophan residue to leucine ablates constitutive activity in a constitutively active AKHR mutant . A. A constitutively active AKHR receptor was generated by mutagenizing the conserved aspartate residue in the DRY motif to alanine (D136A). D136A exhibits significantly greater activity at baseline than the wild-type AKHR receptor, while still remaining responsive to ligand presentation. B. The W105L substitution eliminates AKHR signaling response following

10 -6M ligand presentation. C. The W105L substitution, when incorporated into the

D136A variant, ablated both ligand responsiveness and constitutive activity associated with the receptor.

Figure 5: The WxFG is critical for proper receptor trafficking . YFP tagged leucokinin, corazonin, and 5HT2c receptors were mutagenized as previously described

(W ‰L). Receptor localization was compared between wild type and mutant receptor variants, using the plasma membrane marker WGA-594 colocalization with YFP signal to approximate receptor expression at the cell surface. In each case, receptor localization within the cell was dramatically altered in mutant receptor variants. All wild type receptors exhibited high levels of colocalization with WGA-594, an expected result given their function as cell-surface receptors, while each mutant exhibited no significant colocalization with WGA-594. Taken together, these results suggest impaired receptor trafficking in WxxL mutants, regardless of receptor background. Wild type 5HT2c

(Fig.5 A-C), (R=.66±.08), LKR (Fig.5 G-I), (R=.78±.07), and CRZR (Fig.5 M-O),

(R=.72±.04), and exhibited strong colocalization with the plasma membrane (black bars), while their corresponding mutants, 5HT2c W120L (Fig. 5 E-F), (R= -.02±.05), LKR

W101L (Fig. 5 J-L), (R=.05±.10), and CRZR W191L (Fig. 5 P-R), (R= -.11±.12), and exhibited a dramatic reduction in plasma membrane localization (white bars), with

P<.001 for all wild type – mutant comparisons (Fig. 5 S).

Figure 6: Putative tertiary structures of wild type LKR and mutant W101L are superimposed to identify gross changes in receptor topology . A. Mutant structures are modeled in red, and wild type structures are modeled in blue. The superimposed structures display perfect alignment of the TMs, but a significant distortion of the N- terminus when a leucine residue is added in place of W101 ( B) . Thus, LKR may not be able to tolerate substitutions at W101 due to tryptophan’s stabilization of ECL1 geometry in relation to the N-terminus and adjacent TMs.

CHAPTER III: Homodimerization of Drosophila Class A Neuropeptide GPCRs:

Evidence for conservation of GPCR dimerization throughout metazoan evolution.

Michael J. Rizzo, Erik C. Johnson

The work in this chapter will be submitted to the journal Biochemical and

Biophysical Research Communications. Experiments were conceived by MJ Rizzo and

EC Johnson. Reagents were generated and experiments were performed by MJ Rizzo.

Data were analyzed by MJ Rizzo and EC Johnson. The manuscript was drafted by MJ

Rizzo and edited by EC Johnson. This study was funded by NSF and WFU CMS.

ABSTRACT

While many instances of GPCR dimerization have been reported for vertebrate receptors, GPCR dimerization amongst invertebrates remains poorly investigated, with few invertebrate GPCRs having been shown to assemble as dimers. To date, no

Drosophila GPCRs have been shown to assemble as dimers. Furthermore, dimerization studies are largely confined to vertebrate organisms, and the extent of GPCR dimerization amongst invertebrates remains largely overlooked. To explore the evolutionary conservation of GPCR dimerization, we employed an acceptor- photobleaching FRET methodology to evaluate whether multiple subclasses of

Drosophila GPCRs assembled as homodimers when heterologously expressed in HEK-

293T cells. We C-terminally tagged multiple Drosophila neuropeptide GPCRs that exhibited structural homology with a vertebrate GPCR family member previously shown to assemble as a dimer with CFP and YFP fluorophores and visualized these receptors through confocal microscopy. FRET responses were determined based on the increase in

CFP emission intensity following YFP photobleaching for each receptor pair tested. For each receptor expressed as a homodimer pair, a significant FRET response was seen, while non-significant FRET responses were displayed by both cytosolic CFP and YFP expressed alone, and a heterodimeric pair of receptors from unrelated families, suggesting that receptors exhibiting positive FRET responses assemble as homodimers at the plasma membrane. These results are the first to suggest that Drosophila GPCRs assemble as homodimeric complexes, and suggest that GPCR dimerization arose early in metazoan evolution and likely plays an important and underappreciated role in the cellular signaling of all animals.

INTRODUCTION

G-protein coupled receptors (GPCRs) are the largest superfamily of metazoan cell surface receptors and are responsible for transducing a wide range of extracellular stimuli into cellular responses 1. These receptors possess a characteristic seven-transmembrane architecture, with an extracellular N terminus and intracellular C terminus. GPCRs are essential for a variety of behaviors and physiologies, including vision, taste, homeostatic regulation, and reproduction 2. Given their diverse roles in physiology and behavior, it is unsurprising that GPCRs are the molecular targets of approximately 50% of pharmaceuticals 3. As a consequence of GPCRs importance in a diverse set of physiologies and behaviors and their constituting the pharmacological targets of many drugs, specific determination of their mechanism of actions and signaling pathways are active areas of research and of widespread biological interest. One phenomenon that has engendered significant interest is determination of the exact molecular organization of

GPCRs. The first evidence of higher order GPCR structures stemmed from the identification that functional GABA B receptors consist of two distinct subunits.

Specifically, the GABA BR1 and GABA BR2 subunits are required to construct the functional receptor, as the latter subunit is required for trafficking of the GABA BR1 subunit to the plasma membrane 4. The necessity of dimerization for receptor function is now recognized as a hallmark of Class C GPCRs 5.

Subsequent to the discovery of GABA receptor dimerization, many other unrelated GPCR dimers have been identified, with a diverse array of phenotypes attributable to this molecular organization 6. While there is clear evidence that GPCRs can assemble as dimers, the prevalence of GPCR dimerization as it pertains to phylogeny

91 as well as receptor type remains unresolved. It is clear that GPCR dimerization frequency varies by receptor class. Class C GPCRs, which include GABA B and metabotropic glutamate receptors, function as obligatory dimers as previously discussed 5. However, the question of the whether other GPCR subtypes assemble as dimers is the subject of much debate. Multiple Class A and Class B GPCRs have been shown to assemble as homo- and/or heterodimers. Dimerization is especially common amongst biogenic amine receptors, as all 5HT receptors and multiple dopamine receptors have been experimentally shown to assemble as homo- or heterodimers at the plasma membrane 7–9.

Dimerization has also been demonstrated in a number of peptide receptor family members, including somatostatin receptors, bradykinin receptors, and multiple opioid receptors, among others, further suggesting oligomeric assembly may be a common feature of GPCR biology 10–12 . A difficulty in determining the extent to which Class A and

B form dimers is that these receptors structures may not be as stable as the Class C

GPCRs, and in fact these higher order structures may be transient or dynamically regulated for receptors in these classes, which thus reduces the probability of finding

GPCR oligomers 13 . Thus, the possibility exists that the pool of GPCRs at the cell surface may in fact be a heterogeneous mixture of monomeric, dimeric and higher order oligomeric structures 13–15 .

One example of dimerization imparting differential receptor function are the gonadotropin releasing hormone (GnRH) receptors in Ciona intestinalis , where variance in receptor dimerization influences intracellular cAMP and Ca 2+ signaling 16 . Specifically,

Ciona expresses four specific variants of GnRH receptors, GnRHR1-GnRHR4, which have been shown to form both homo-and heterodimers when these receptors are

92 coexpressed. Intriguingly, GnRHR1 homodimers elicit a ten-fold reduced response compared to the heterodimer, but homodimers of GnRHR1 were able to signal through both cAMP and Ca 2+ . Conversely, the GNRHR1-4 heterodimer signaled through only

Ca 2+ , suggesting that receptor dimerization is responsible for fine tuning cellular responses to GnRH signaling in this species.

Furthermore, a growing body of evidence supports the notion that a dimeric

GPCR functions as the fundamental signaling unit for many receptors 17 . Perhaps the best example of this phenomenon stems from investigations of the human 5HT 2c receptor homodimer. Multiple studies have confirmed that the 5HT 2c receptor assembles as a homodimer, and that this dimerization occurs prior to the mature receptor expression at the plasma membrane, suggesting that dimerization may be necessary for appropriate receptor trafficking to the cell surface 18–20 . To determine whether a homodimer represented the functional receptor molecule for this receptor, Herrick-Davis et al. generated a ligand-binding and signaling deficient mutant 5HT 2c resulting from a single amino acid substitution (S138R) 21 . They then co-expressed these mutant receptors with wild type 5HT 2c receptors in HEK293 cells. Remarkably, the group found that not only did the mutant S138R 5HT 2c variant retain its ability to homodimerize with wild-type

5HT 2c receptors (as resolved by both FRET and Co-IP interactions), but additionally that

5HT signaling through this receptor complex was significantly impaired when these receptors were co-expressed when compared to cells expressing wild type copies of the

5HT 2c receptor alone. These experiments provide perhaps the strongest evidence that, at least for some Class A GPCRs, homodimerization is fundamental to their ability to bind ligands and transduce this event into appropriate cellular responses.

Studies of GPCR dimerization have largely been limited to investigations of vertebrate receptors, notably those from humans, rats, and mice 7. In contrast, there is a dearth of reports on invertebrate GPCR dimerization, and little is known as to the function and frequency of GPCR dimerization amongst invertebrates. The previously discussed study on Ciona intestinalis demonstrated that dimerization amongst Class A

GPCRs (GnRH receptors) not only occurred, but acted as a significant modulator of

GnRH signaling in the ascidian 16 . Still, no further studies on Ciona have indicated any additional species-specific GPCRs in dimerization. Additionally, studies on

Caenorhabditis elegans, despite an estimated 1000 GPCRs present in their genome, have revealed only a single putative GPCR dimer pair – a heterodimer between the receptors

DAF-37 and DAF-38 22 . This dimer also plays a significant functional role in the organism, as it is necessary for proper dauer formation during C. elegans development.

Drosophila melanogaster , another popular invertebrate model organism, has yet to have

GPCR dimerization demonstrated amongst any receptors present in its genome, although it should be noted that Drosophila GABA B receptors, similar to their mammalian counterparts, require co-expression of R 1 and R 2 subunits to confer proper GABA responsiveness 23 . While this finding is consistent with heterodimerization between these two receptors, no FRET, Co-IP, or other dimerization-specific methodology was employed to verify that such an interaction did in fact occur. Overall, the lack of investigation of GPCR dimerization in invertebrates obfuscates our understanding of the function of these receptors in their respective organisms, and also hinders efforts to explore the evolution of GPCR dimerization with appropriate rigor.

As previously noted, to date, no Drosophila GPCR’s have been demonstrated to assemble as dimers. In this study, rather than focus on a singular receptor, as is a common approach in the extant literature, we chose to adopt a systematic approach informed by evolutionary homology to other GPCRs previously shown to dimerize in other taxa in order to identify whether Class A (Rhodopsin-like) Drosophila GPCRs, specifically those involved in neuropeptide signaling, assembled as dimers. We chose to evaluate seven different Drosophila neuropeptide GPCRs that belong to six Class A receptor subfamilies that have been previously been shown to assemble as dimers in other species, to determine whether these Drosophila receptors formed higher order structural ensembles at the plasma membrane. To this aim, we employed a Fluorescence Resonant

Energy Transfer (FRET) based approach, as this is a standard assay to investigate intermolecular interactions. Specifically, FRET assays rely on the transfer of energy from one fluorescent donor to an acceptor molecule and are predicated on short intermolecular distances between the two fluorophores 24 .

In this study, prospective dimeric pairs of both CFP and YFP tagged Drosophila

GPCRs were transiently expressed in HEK-293T cells and assessed for FRET responses.

Significant FRET efficiencies were observed for each receptor homodimer pair when compared to controls, as well as cells expressing donor and acceptor receptors from unrelated receptor families, suggesting that the receptors studied assemble as homodimers at the cell surface. These results are the first evidence for GPCR dimerization amongst Class A Drosophila neuropeptide receptors, and the prevalence of homodimerization across multiple receptor subtypes suggests that GPCR dimerization

95 has been conserved throughout metazoan evolution and is a feature of the receptor superfamily.

METHODS

GPCR cloning and fusion protein generation.

All GPCRs used in this study were previously subcloned into pcDNA3 or pcDNA5 expression vectors (Table 1), with the exception of the 5HT 2c -CFP and 5HT 2c -

YFP pair, which were generously donated by Dr. Katharine Herrick-Davis. PCR primers were designed to add N and C terminal restriction sites to facilitate directional cloning into the pcDNA3 CFP and pcDNA3 YFP expression vectors (Table 2). Likewise, PCR products were designed to eliminate the stop codon and make sure that the resulting receptor reading frame would be continuous with the CFP or YFP reading frames. All resulting plasmids were sequence verified and plasma membrane expression was verified for each receptor prior to FRET analysis.

Cell culture and transfection

HEK-293T cells were grown in a standard growth medium of Dulbecco’s modified Eagle medium (DMEM) supplemented with fetal bovine serum, antibiotic/antimycotic, and 2mM L-glutamine. Prior to transfection, cells were split and seeded into 24 well dishes. Transfections were performed using Lipofectamine 2000 transfection reagent in serum free Opti-MEM media when cell density reached ~0.2*10 6 cells/mL in each well. For all co-expression experiments, receptor cDNAs were transfected at a 1:2 CFP/YFP ratio to bias CFP tagged receptors to dimerize with YFP tagged receptors. Transfected cells were split into glass bottom dishes and allowed to recover for 24 hours in standard growth media following transfection, at which point

97 media was switched to clear, modified Eagle medium (MEM) for imaging analysis. All imaging experiments were performed 48 hours following transfection.

Signaling assays

To assess receptor function in tagged receptor variants, we performed signaling assays on two of the seven modified receptors. YFP tagged variants of the LKR and

CRZR receptors, as well as wild type variants for each receptor for each receptor 25 , were transfected along with the SRE-luciferase reporter construct at a 5:1 ratio into HEK-293T cells using Lipofectamine 2000. Following transfection, cells were split into 96 well plates and given an additional 24 hours to recover in standard growth media. Following recovery, media was replaced with clear MEM containing either 10 -6M ligand or vehicle for each condition and left to incubate for four hours. Luciferase activity was assessed using the SteadyLite Plus Reporter Gene Assay System according to manufacturer’s protocol and luminescence levels were measured using a Victor3 1420 multilabel plate reader.

Microscopy and FRET Imaging analysis

For each condition tested, between 4 and 30 cells were visualized using a Zeiss

710 scanning confocal microscope and images were subsequently analyzed using Zen software. All imaging was performed under identical conditions for quantification purposes and to facilitate statistical analysis across conditions. Initial fluorescent levels were determined to gauge CFP and YFP-tagged receptor expression. These values were used to determine donor and acceptor intensities that were used for subsequent analysis.

Prior to evaluating FRET efficiencies, we imaged cells expressing only cytosolically

98 expressed CFP and YFP to generate a characteristic emission spectrum for each fluorophore to be used for linear unmixing analysis. Following an initial imaging protocol, acceptor photobleaching experiments were performed by defining an area of interest (AOI) around a region of the cell membrane and applying high intensity, 514nm laser pulses to photobleach YFP (Figure 1). Time-lapsed images underwent image analysis to measure the intensity of both CFP and YFP emission both pre and post photobleaching. Any image where CFP or YFP intensities fell below the intensity of the residuals channel following linear unmixing was not analyzed. FRET efficiency was subsequently determined based on the increase of CFP emission intensity following YFP photobleaching using the formula: F E%=(D post -Dpre )/D post . FRET efficiencies were compared across conditions using a one-way ANOVA and a Tukey post-hoc test.

RESULTS

Drosophila receptors were chosen for analysis based on sequence homology to mammalian receptors previously shown to form dimers (Table 1). We chose seven receptors that are members of six different Class A receptor subfamilies and that signal through disparate mechanisms and participate in a diverse set of behaviors and physiologies. Specifically, the Drosophila corazonin receptor (CRZR) is a member of the Gonadotropin Releasing Hormone (GnRH) receptor subfamily and is involved in mediating multiple behaviors in insects, including cardioactivity, gregarious pigmentation, circadian rhythms, and stress 26–28 . GnRH receptors have previously been shown to dimerize in multiple organisms, including rats, wallabies, and the tunicate

Ciona intestinalis 16,29,30 . In mammals, neurokinin receptors fulfill an array of functions ranging from pain perception to vasodilation, and have been show to assemble as dimers, and we chose to examine two Drosophila receptors related to mammalian neurokinin receptors, the leucokinin receptor (LKR) and tachykinin receptor at 86C (TAKR86C) 31,32 .

In mammals, the NPY receptor regulates feeding behaviors, and has been shown to form higher order structures, thus we chose to evaluate the Drosophila NPF receptor (NPFR), which like its mammalian homolog impacts feeding behaviors in the fly, for dimer formation analysis33,34 . The proctolin receptor (ProcR) is a member of the thyrotropin- releasing hormone (TRH) receptor superfamily, whose hormone serves as a master regulator for pituitary hormone release, and was chosen for analysis as human TRH receptors receptor have been previously shown to dimerize in heterologous expression systems 33,35,36 . We also evaluated the Drosophila allatostatin C receptor 2 (AstC-R2), as it is a member of the somatostatin family and, in the rat, somatostatin receptors been

100 shown to form both homo- and heterodimers, with the receptor subclass functioning in multiple physiologies ranging from sleep regulation to regulation of motor activity 11 .

Lastly, we evaluated dimerization in the Drosophila pyrokinin receptor 1 (PK1R), which is a neuromedin U receptor family member, another receptor family shown to assemble as homodimers in humans that also functions in a diverse array of physiological responses, including but not limited to blood pressure regulation, feeding behavior, and immune system function 11,37,38 .

Following fluorophore-tagging these receptors, we sought to determine whether the fluorescent tag interfered with receptor function. We used two parameters to assess receptor function, the first was an evaluation of plasma membrane expression of the tagged receptors. First, we only analyzed receptors that showed high levels of expression at the plasma membrane. Additionally, we evaluated receptor signaling from the LKR-

YFP and CRZR-CFP tagged variants. In both cases, a robust signaling response was observed at 10 -6M ligand concentrations for each tagged receptor that was not significantly different from the signaling responses exhibited by their respective wild type receptors (Figure S1). Collectively, these results indicate that fluorophore addition does not interfere with receptor function for these receptors.

Next, we tested the FRET signatures from cells transfected with both CFP and

YFP tagged receptors. To establish a baseline for non-FRET, we introduced a cytoplasmic CFP and YFP construct and subjected those cells to the acceptor photobleaching protocol (Fig. 1). There were minimal FRET signatures observed and we interpret these as random interactions coincident with localized expression of both fluorophores. We then compared FRET efficiencies between the 5HT 2c receptor and the

101 cytoplasmic introduction of both fluorophores. The 5HT 2c receptor has been shown to dimerize extensively and serves as a hallmark for the phenomena 18–21 . Specifically, cytoplasmic CFP and YFP exhibited a negligible average FRET efficiency of

4.92%±1.28 (Fig. 2 A-F, Fig. 3Q), while the 5HT 2c CFP/YFP pair exhibited a statistically significant higher average FRET efficiency of 15.65%±1.72 (Fig. 2G-L, Fig. 3Q) (P

<0.05 ANOVA). These results indicate that our experimental system is able to accurately identify bona fide receptor dimers.

Next, we tested the seven Drosophila Class A GPCRs previously described under the same experimental conditions. Each receptor tested showed FRET efficiencies significantly different from CFP and YFP alone, but not significantly different from the

5HT 2c positive control (Fig. 3). Specifically, the corazonin receptor (CRZR) exhibited the highest FRET efficiency of all receptors tested at 21.77%±3.07. This was followed by

AstC-R2, which displayed a 21.38%±2.49 FRET efficiency. The NPF receptor, the lone

Gαi-coupled receptor tested in this study, showed a FRET efficiency of 15.77%±0.80.

The two Drosophila tachykinin receptors tested, LKR and TKR86C, showed robust

FRET efficiencies of 10.52%±1.57 and 12.20%±1.85, respectively. Finally, the proctolin and pyrokinin 1 receptors exhibited the lowest FRET responses of all homodimers tested, with FRET efficiencies of 9.96%±1.75 and 7.79%±1.30, respectively, although it is important to note that both receptors FRET responses were significantly higher than cytosolically expressed CFP and YFP (P<.05), and thus represent strong evidence for homodimerization amongst these receptors. In contrast, when we introduced a heterotypic pair of NPFR-CFP and TKR86C-YFP constructs, we observed a FRET response of

5.80%±1.81 that was not significantly different than the CFP/YFP negative control. This

102 finding is significant as it rules out the alternative interpretation that FRET responses are a simply a consequence of coexpression of fluorophore-tagged receptors at the plasma membrane.

103

DISCUSSION

The results of this investigation provide the first experimental evidence that multiple Drosophila Class A GPCRs assemble as homodimers at the plasma membrane.

Rather than focus on a singular receptor, we undertook a systematic approach informed by evolutionary homology to identify seven candidate neuropeptide receptors from six

GPCR families. Notably, for each receptor studied, significant FRET responses consistent with homodimerization were detected. This suggests that GPCR dimerization both occurs in Drosophila and is itself a conserved feature of specific GPCR families and that has been conserved throughout metazoan evolution. Additionally, this investigation adds to the relatively understudied literature regarding invertebrate GPCR dimerization, as dimerization had been previously observed only in tunicates and C. elegans, and has now been demonstrated in dipterans as well.

The receptors examined in this study fulfill diverse physiological roles within the organism. The corazonin receptor, a member of the GnRH receptor subfamily, is critical to Drosophila response to myriad stressors, including starvation and desiccation, while also fulfilling a major role in ethanol metabolism 26,27 . The tachykinin-related receptors,

TKR86C and LKR, have been implicated in a range of functional roles including regulation of meal size, sexual activity and fecundity, and the integration of metabolic state and sleep 39–41 . The somatostatin family member AstC-R2, while named for its inhibitory effects on juvenile hormone secretion from the corpora allata, is a key regulator of multiple physiologies, ranging from circadian rhythm regulation to nociception and innate immunity, while also serving as a cardioinhibitory peptide in the fly 42–44 . The NPF receptor has been shown to mediate physiologies ranging from feeding

104 and foraging behavior to alcohol sensitivity as well as sleep-wake behaviors 45–48 . The proctolin receptor serves as a key regulator of cardioactivity, and has also been shown to regulate both locomotor activity and thermal preference in Drosophila larvae 49,50 . Finally, the pyrokinin-1 receptor, a member of the neuromedin U (NMU) superfamily, has been implicated in both pheromone biosynthesis as well as the suppression of insulin production in Drosophila 51,52 . The diversity of functional roles these receptors fulfill, coupled with the knowledge that these receptors assemble as higher order structures at the plasma membrane, suggest that further investigation of the oligomeric assembly of these receptors within the fly may be critical to dissecting discrete functional roles for each of the receptors studied.

While there was a significant range of FRET efficiencies reported across the receptors tested, it is important to consider that FRET efficiency is dependent on a number of factors beyond whether the two molecules assemble as a dimer, including the length and orientation of each receptor’s C-terminus (which impacts the distance between fluorophores), variations in donor/acceptor ratios, and membrane curvature 24,53 . As such, absolute comparisons of FRET efficiencies across receptors do not necessarily reflect differences in dimerization frequency or the percentage of receptors which assemble as dimers at the cell surface. Still, this only increases our confidence in our results, as our measurements of FRET efficiencies for many of the homodimeric pairs investigated were larger than the 5HT 2c receptor pair, and in all cases were significantly higher than cytosolically expressed CFP and YFP, suggesting that indeed dimerization appears to be a common phenomenon that is widespread throughout both Drosophila GPCRs and likely the GPCR superfamily itself, and is not specific to a particular taxon.

105

We limited our investigation of receptor dimerization only at the plasma membrane. Therefore, we cannot conclude that dimerization is specific to this cellular compartment or whether these receptor interactions are exhibited elsewhere in the cell.

Some studies suggest dimerization occurs co-translationally and can be observed in both

18 the ER and Golgi, as has been shown with the 5HT 2c receptor utilized in this study .

However, other reports suggest that dimerization, especially amongst class A GPCRs, are transient phenomena and therefore may assemble spontaneously at the plasma membrane, leading to a dynamic population of monomeric and higher order oligomeric states 13 . It would be interesting to see if similar FRET efficiencies for each homodimer pair studied could be recorded from CFP and YFP tagged receptors as they move through the ER and

Golgi, which would shed light on the biogenesis of Drosophila GPCR dimers.

One aspect of dimerization that was not tested in this study was the impact of ligand introduction on FRET efficiency between homodimeric receptor pairs. Previous studies have shown that ligand binding can lead to increased, decreased, or unchanged

FRET responses. This, likely, is the result of the conformational changes which take place in the receptor molecule following ligand binding and receptor activation 54–56 .

Future studies should investigate whether ligand introduction alters FRET response through either promoting or inhibiting dimerization in each of the receptors tested.

Taken together, the results of this study suggest that homodimerization of

Drosophila Class A neuropeptide GPCRs may represent a common feature of G protein- coupled receptors. This study represents the first step towards a comprehensive analysis of homodimerization amongst all Drosophila class A GPCRs. It is important to note that these receptors still represent a fraction of the total neuropeptide receptor GPCRs present

106 in the Drosophila genome, which contains 44 Class A and Class B GPCRs from 15 distinct neuropeptide GPCR subfamilies 57,58 . As such, further investigation of these and other potential GPCR dimer pairs in the Drosophila genome is necessary to determine the prevalence of dimerization amongst these receptors. Still, given the findings of this study, along with the wide array of genetic tools available for cell and tissue-specific manipulation of receptor expression, Drosophila represent an attractive model organism to investigate the functional roles that GPCR dimerization impacts in multiple physiologies, and affords the potential to ascribe specific in vivo functional roles to

GPCR oligomeric states and further our understanding of the evolution of GPCR dimerization amongst the receptor superfamily.

107

REFERENCES

1. Whitehead, I. P., Zohn, I. E. & Der, C. J. Rho GTPase-dependent transformation

by G protein-coupled receptors. Oncogene 20 , 1547–1555 (2001).

2. Hanlon, C. D. & Andrew, D. J. Outside-in signaling – a brief review of GPCR

signaling with a focus on the Drosophila GPCR family. J Cell Sci 128 , 3533–3542

(2015).

3. Tautermann, C. S. GPCR structures in drug design, emerging opportunities with

new structures. Bioorg. Med. Chem. Lett. 24 , 4073–4079 (2014).

4. White, J. H. et al. Heterodimerization is required for the formation of a functional

GABA(B) receptor. Nature 396 , 679–682 (1998).

5. Zhang, X. C., Liu, J. & Jiang, D. Why is dimerization essential for class-C GPCR

function? New insights from mGluR1 crystal structure analysis. Protein Cell 5,

492–5 (2014).

6. Terrillon, S. & Bouvier, M. Roles of G-protein-coupled receptor dimerization

From ontogeny to signalling regulation. EMBO Rep. 5, 30–34 (2004).

7. Franco, R., Martínez-Pinilla, E., Lanciego, J. L. & Navarro, G. Basic

pharmacological and structural evidence for class A G-protein-coupled receptor

heteromerization. Frontiers in Pharmacology vol. 7 (2016).

8. Herrick-Davis, K. Functional significance of serotonin receptor dimerization. Exp.

Brain Res. 230 , 375–386 (2013).

9. Tabor, A. et al. Visualization and ligand-induced modulation of dopamine receptor

108

dimerization at the single molecule level. Sci. Rep. 6, (2016).

10. Portoghese, P. S. From models to molecules: Opioid receptor dimers, bivalent

ligands, and selective opioid receptor probes. J. Med. Chem. 44 , 2259–2269

(2001).

11. Pfeiffer, M. et al. Homo- and heterodimerization of somatostatin receptor

subtypes. Inactivation of sst(3) receptor function by heterodimerization with

sst(2A). J. Biol. Chem. 276 , 14027–36 (2001).

12. Michineau, S., Alhenc-Gelas, F. & Rajerison, R. M. Human bradykinin B2

receptor sialylation and N-glycosylation participate with bisulfide bonding in

surface receptor dimerization. Biochemistry 45 , 2699–2707 (2006).

13. Milligan, G., Ward, R. J. & Marsango, S. GPCR homo-oligomerization . Current

Opinion in Cell Biology vol. 57 40–47 (2019).

14. Meral, D. et al. Molecular details of dimerization kinetics reveal negligible

populations of transient µ-opioid receptor homodimers at physiological

concentrations. Sci. Rep. 8, 7705 (2018).

15. Vischer, H. F., Castro, M. & Pin, J.-P. G Protein-Coupled Receptor Multimers: A

Question Still Open Despite the Use of Novel Approaches. Mol. Pharmacol. Mol

Pharmacol 88 , 561–571 (2015).

16. Sakai, T. et al. Evidence for differential regulation of GnRH signaling via

heterodimerization among GnRH receptor paralogs in the protochordate, Ciona

intestinalis. Endocrinology 153, 1841–1849 (2012).

109

17. Ferré, S. et al. G Protein–Coupled Receptor Oligomerization Revisited: Functional

and Pharmacological Perspectives. Pharmacol. Rev. 66 , 413 LP – 434 (2014).

18. Herrick-Davis, K., Weaver, B. A., Grinde, E. & Mazurkiewicz, J. E. Serotonin 5-

HT2C receptor homodimer biogenesis in the endoplasmic reticulum: real-time

visualization with confocal fluorescence resonance energy transfer. J. Biol. Chem.

281 , 27109–16 (2006).

19. Herrick-Davis, K. et al. Native Serotonin 5-HT 2C Receptors Are Expressed as

Homodimers on the Apical Surface of Choroid Plexus Epithelial Cells. Mol.

Pharmacol. Mol Pharmacol 87 , 660–673 (2015).

20. Herrick-Davis, K., Grinde, E. & Mazurkiewicz, J. E. Biochemical and biophysical

characterization of serotonin 5-HT2C receptor homodimers on the plasma

membrane of living cells. Biochemistry 43 , 13963–13971 (2004).

21. Herrick-Davis, K., Grinde, E., Harrigan, T. J. & Mazurkiewicz, J. E. Inhibition of

serotonin 5-hydroxytryptamine2c receptor function through heterodimerization:

receptor dimers bind two molecules of ligand and one G-protein. J. Biol. Chem.

280 , 40144–51 (2005).

22. Park, D. et al. Interaction of structure-specific and promiscuous G-protein-coupled

receptors mediates small-molecule signaling in Caenorhabditis elegans. Proc. Natl.

Acad. Sci. U. S. A. 109 , 9917–9922 (2012).

23. Mezler, M., Müller, T. & Raming, K. Cloning and functional expression of

GABAB receptors from Drosophila. Eur. J. Neurosci. 13 , 477–486 (2001).

110

24. Busnelli, M., Mauri, M., Parenti, M. & Chini, B. Analysis of GPCR Dimerization

Using Acceptor Photobleaching Resonance Energy Transfer Techniques. Methods

Enzymol. 521 , 311–327 (2013).

25. Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. Unexpected

role of a conserved domain in the first extracellular loop in G protein-coupled

receptor trafficking. Biochem. Biophys. Res. Commun. 503 , 1919–1926 (2018).

26. Kubrak, O. I., Lushchak, O. V., Zandawala, M. & Nässel, D. R. Systemic

corazonin signalling modulates stress responses and metabolism in Drosophila.

Open Biol. 6, 160152 (2016).

27. Sha, K. et al. Regulation of ethanol-related behavior and ethanol metabolism by

the corazonin neurons and corazonin receptor in Drosophila melanogaster. PLoS

One 9, (2014).

28. Johnson, E. C. et al. A novel diuretic hormone receptor in Drosophila: evidence

forconservation of CGRP signaling. J. Exp. Biol. 208 , 1239–1246 (2005).

29. Cornea, A. & Michael Conn, P. Measurement of changes in fluorescence

resonance energy transfer between gonadotropin-releasing hormone receptors in

response to agonists. Methods 27 , 333–339 (2002).

30. Cheung, T. C. & Hearn, J. P. Dimerizations of the wallaby gonadotropin-releasing

hormone receptor and its splice variants. Gen. Comp. Endocrinol. 144 , 280–288

(2005).

31. Pfeiffer, M. et al. Heterodimerization of substance P and mu-opioid receptors

111

regulates receptor trafficking and resensitization. J. Biol. Chem. 278 , 51630–7

(2003).

32. Garcia-Recio, S. & Gascón, P. Biological and Pharmacological Aspects of the

NK1-Receptor. BioMed Research International vol. 2015 (2015).

33. Dinger, M. C., Bader, J. E., Kobor, A. D., Kretzschmar, A. K. & Beck-Sickinger,

A. G. Homodimerization of neuropeptide y receptors investigated by fluorescence

resonance energy transfer in living cells. J. Biol. Chem. 278 , 10562–71 (2003).

34. Luquet, S., Perez, F. A., Hnasko, T. S. & Palmiter, R. D. NPY/AgRP neurons are

essentials for feeding in adult mice but can be ablated in neonates. Science (80-. ).

310 , 683–685 (2005).

35. Song, G. J., Jones, B. W. & Hinkle, P. M. Dimerization of the thyrotropin-

releasing hormone receptor potentiates hormone-dependent receptor

phosphorylation. Proc. Natl. Acad. Sci. U. S. A. 104 , 18303–8 (2007).

36. Hanyaloglu, A. C., Seeber, R. M., Kohout, T. A., Lefkowitz, R. J. & Eidne, K. A.

Homo- and hetero-oligomerization of thyrotropin-releasing hormone (TRH)

receptor subtypes: Differential regulation of β-arrestins 1 and 2. J. Biol. Chem.

277 , 50422–50430 (2002).

37. Lin, T.-Y., Huang, W.-L., Lee, W.-Y. & Luo, C.-W. Identifying a Neuromedin U

Receptor 2 Splice Variant and Determining Its Roles in the Regulation of

Signaling and Tumorigenesis In Vitro. PLoS One 10 , e0136836 (2015).

38. Brighton, P. J., Szekeres, P. G. & Willars, G. B. Neuromedin U and its receptors:

112

Structure, function, and physiological roles. Pharmacological Reviews vol. 56

231–248 (2004).

39. Yurgel, M. E. et al. A single pair of leucokinin neurons are modulated by feeding

state and regulate sleep–metabolism interactions. PLoS Biol. 17 , (2019).

40. Al-Anzi, B. et al. The leucokinin pathway and its neurons regulate meal size in

Drosophila. Curr. Biol. 20 , 969–978 (2010).

41. Jiang, H. et al. Natalisin, a tachykinin-like signaling system, regulates sexual

activity and fecundity in insects. (2013) doi:10.1073/pnas.1310676110.

42. Bachtel, N. D., Hovsepian, G. A., Nixon, D. F. & Eleftherianos, I. Allatostatin C

modulates nociception and immunity in Drosophila. Sci. Rep. 8, 7501 (2018).

43. Díaz, M. M., Schlichting, M., Abruzzi, K. C., Long, X. & Rosbash, M.

Allatostatin-C/AstC-R2 Is a Novel Pathway to Modulate the Circadian Activity

Pattern in Drosophila. Curr. Biol. 29 , 13-22.e3 (2019).

44. Price, M. D. et al. Drosophila melanogaster flatline encodes a myotropin

orthologue to Manduca sexta allatostatin. in Peptides vol. 23 787–794 (2002).

45. Brown, M. R. et al. Identification of a Drosophila brain-gut peptide related to the

neuropeptide Y family. Peptides 20 , 1035–1042 (1999).

46. Lee, G., Bahn, J. H. & Park, J. H. Sex- and clock-controlled expression of the

neuropeptide F gene in Drosophila. Proc. Natl. Acad. Sci. 103 , 12580–12585

(2006).

47. Chung, B. Y. et al. Drosophila Neuropeptide F Signaling Independently Regulates

113

Feeding and Sleep-Wake Behavior. Cell Rep. 19 , 2441–2450 (2017).

48. Wen, T., Parrish, C. A., Xu, D., Wu, Q. & Shen, P. Drosophila neuropeptide F and

its receptor, NPFR1, define a signalling pathway that acutely modulates alcohol

sensitivity. Proc. Natl. Acad. Sci. U. S. A. 102 , 2141–2146 (2005).

49. Zornik, E., Paisley, K. & Nichols, R. Neural transmitters and a peptide modulate

Drosophila heart rate. Peptides 20 , 45–51 (1999).

50. Ormerod, K. G. et al. Characterizing the physiological and behavioral roles of

proctolin in Drosophila melanogaster. J. Neurophysiol. 115 , 568 (2016).

51. Stern, P. S. et al. Molecular modeling of the binding of pheromone biosynthesis

activating neuropeptide to its receptor. J. Insect Physiol. 53 , 803–818 (2007).

52. Alfa, R. W. et al. Suppression of Insulin Production and Secretion by a Decretin

Hormone. Cell Metab. 21 , 323–334 (2015).

53. Walsh, S. M. et al. Single Proteoliposome High-Content Analysis Reveals

Differences in the Homo-Oligomerization of GPCRs. Biophys. J. 115 , 300–312

(2018).

54. Pioszak, A. A., Harikumar, K. G., Parker, N. R., Miller, L. J. & Xu, H. E. Dimeric

arrangement of the parathyroid hormone receptor and a structural mechanism for

ligand-induced dissociation. J. Biol. Chem. 285 , 12435–44 (2010).

55. Hiller, C., Kühhorn, J. & Gmeiner, P. Class A G-Protein-Coupled Receptor

(GPCR) Dimers and Bivalent Ligands. J. Med. Chem. 56 , 6542–6559 (2013).

56. Furness, S. G. B. et al. Ligand-Dependent Modulation of G Protein Conformation

114

Alters Drug Efficacy. Cell 167 , 739-749.e11 (2016).

57. Hewes, R. S. & Taghert, P. H. Neuropeptides and neuropeptide receptors in the

Drosophila melanogaster genome. Genome Res. 11 , 1126–42 (2001).

58. Johnson, E. C. et al. Identification of Drosophila neuropeptide receptors by G

protein-coupled receptors-beta-arrestin2 interactions. J. Biol. Chem. 278 , 52172–8

(2003).

59. Cazzamali, G., Saxild, N. P. E. & Grimmelikhuijzen, C. J. P. Molecular cloning

and functional expression of a Drosophila corazonin receptor. Biochem. Biophys.

Res. Commun. 298 , 31–36 (2002).

60. Radford, J. C., Davies, S. A. & Dow, J. A. T. Systematic G-protein-coupled

receptor analysis in Drosophila melanogaster identifies a leucokinin receptor with

novel roles. J. Biol. Chem. 277 , 38810–7 (2002).

61. Park, Y., Kim, Y.-J. & Adams, M. E. Identification of G protein-coupled receptors

for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory

of ligand-receptor coevolution. Proc. Natl. Acad. Sci. 99 , 11423–11428 (2002).

62. Garczynski, S. F., Brown, M. R., Shen, P., Murray, T. F. & Crim, J. W.

Characterization of a functional neuropeptide F receptor from Drosophila

melanogaster. Peptides 23 , 773–780 (2002).

63. Kreienkamp, H.-J. et al. Functional annotation of two orphan G-protein-coupled

receptors, Drostar1 and -2, from Drosophila melanogaster and their ligands by

reverse pharmacology. J. Biol. Chem. 277 , 39937–43 (2002).

115

Figure 1: Demonstration of acceptor-photobleaching FRET assay. GPCRs with C- terminal CFP and YFP fluorophore tags are co-expressed at the plasma membrane of

HEK-293T cells. If the receptors do not form a dimeric complex, the CFP and YFP fluorophores are separated by greater than 100 angstroms, and no FRET response occurs

(Fig. 1A). If the two receptors assemble as a dimer, CFP and YFP should be located within 100 angstroms of one another, and thus a FRET response occurs, with some energy from the excited CFP fluorophore being transferred to the acceptor YFP molecule, resulting in YFP emission at ~527nm (Fig. 1B). Positive results can be confirmed through photobleaching the acceptor YFP molecule (Fig. 1C), which ablates the acceptor

YFP fluorophore and “dequenches” the CFP molecule, resulting in an increase in CFP emission following YFP photobleaching.

116

Figure 2: Verification of experimental system . Empty pcDNA3 CFP and YFP vectors, along with C-terminally CFP and YFP tagged 5HT 2c receptors, were utilized as negative and positive controls, respectively. Negligible FRET was observed following acceptor photobleaching when empty CFP and YFP vectors were coexpressed (4.92%±1.28) (Fig.

117

2A-F), while the 5HT 2c -CFP and 5HT 2c -YFP receptor pair exhibited robust FRET

(15.65%±1.72) (Fig. 2G-L) consistent with previous studies. These results suggest the experimental setup utilized herein accurately differentiates both positive and negative

FRET responses.

118

119

Figure 3: Multiple Drosophila Class A neuropeptide receptors exhibit FRET responses consistent with homodimerization . Seven Drosophila neuropeptide receptors, AstC-R2 (Fig. 3A-B), CRZR (Fig. 3C-D), LKR (Fig. 3E-F), TKR86C (Fig.

3G-H), NPFR (Fig. 3I-J), PK1R (Fig. 3M-N), and ProcR (Fig. 3O-P) were C-terminally tagged with CFP or YFP fluorophores and co-expressed in HEK293T cells to evaluate potential homodimer pairs. Significant increases in CFP intensity following acceptor photobleaching, indicative of FRET, were observed for each homodimer pair tested (Fig.

3Q) Co-expression of NPFR-CFP and TKR86C-YFP as donor and acceptor, respectively,

120 exhibited negligible FRET (Fig. 3K-L), (5.80%±1.81, n=10) that was not significantly different from the CFP-YFP negative control (Fig. 2A-F; P<.05), indicating negligible protein-protein interactions between these two distantly related receptors. These results suggest that the receptors assayed in this study assemble as homodimers when expressed in living cells. Black bars represent data that were significantly different from the CFP-

YFP negative control (P<.05).

121

Receptor Family Accession# Reference

ProcR TRH CG6986 Johnson et al ., 2003 58

Cazzamali et al ., 2002; Johnson et al .,

CrzR GnRH CG10698 2003 58,59

LKR Tachykinin CG10626 Radford et al ., 2002 60

PK1R NMU CG9918 Park et al ., 2002 61

NPFR NPY CG1147 Garczynski et al ., 2002 62

Kreienkamp et al ., 2002; Johnson et

AstC-R2 Somatostatin CG13702 al ., 2003 58,63

TKR86C Tachykinin CG6515 Johnson et al ., 2003 58

Table 1 : Receptors utilized in FRET dimer screen. Each of the above receptors had been previously characterized and cloned into pcDNA3 or pcDNA5 expression vectors.

Family assignments were based on receptor homology to vertebrate GPCRs. Vertebrate homologs of each Drosophila receptor listed have previously been reported to form either homo- or heterodimers when expressed in a heterologous system.

122

Reverse

Forward Restriction

Receptor Forward Primer Reverse Primer Restriction Site Site

LKR GCAAGCTTATGGCAATGGACTTAATCGAGCAG CTCGAGAAGTGGTTGCCACAAGGACTTGCC HindIII XhoI

CRZR GCAAGCTTATGGAGGACGAGTGGGGCTCCTTT CTCGAGCTGCACTGGAAGCACTTGGAGCTC HindIII XhoI

ProcR GCAAGCTTATGACAATGTCCTCGACGTCGACA CTCGAGCGCTATCAGGCGACCCGTATTACG HindIII XhoI

TKR86C GCAAGCTTATGTCGGAGATTGTCGACACCGAG GCGGCCGCAACATCTGCTTGGGACTGAGCT HindIII NotI

PK1R GCAAGCTTATGTCCGCTGGCAATATGAGCCAT CTCGAGGTTGACTTGGACACCGATCATGGC HindIII XhoI

NPFR GCAAGCTTATGATAATCAGCATGAATCAGACG CTCGAGCCGCGGCATCAGCTTGGTGACCTC HindIII XhoI

AstC-R2 GCAAGCTTATGGAAGGTGGATGGTGGCGAGGA CTCGAGTAAGTCCGTGTGGAGCACGGGCGG HindIII XhoI

Table 2: List of primers used for directional cloning of receptor cDNA into pcDNA3

CFP or pcDNA3 YFP expression vectors . For each receptor, stop codons were removed from reverse primers to allow for expression of YFP and CFP C-terminally tagged receptors. Sequences for the restriction sites HindIII and XhoI were added via PCR to facilitate directional cloning into final expression vectors for each receptor used except for TKR86C, where sequences for HindIII and NotI were added due to an internal XhoI recognition sequence present in the cDNA for this receptor.

123

3.5

2.5

1.5

Fold induction over vehicle 1

0.5

0 LKR WT LKR YFP CRZR WT CRZR YFP Receptor

Figure S1: Verification of signaling in fluorophore tagged receptors. YFP tagged receptors for which peptides were readily available (LKR and CRZR) were assayed to determine whether the addition of a C-terminal fluorophore tag impacted receptor signaling. YFP tagged receptors were compared against wild type variants of each receptor. Each receptor variant was challenged with either 10 -6 M ligand or vehicle (n=3) and signaling was measured through luciferase activity generated by the SRE-luc reporter. No significant differences were seen across all receptors tested, with LKR-YFP showing 3.13-fold induction over vehicle and CRZR-YFP showing 2.90-fold induction over vehicle, while their respective wild type receptors exhibited 3.41-fold induction over vehicle (LKR WT) and 3.11-fold induction over vehicle (CRZR WT). These data show that the addition of a C-terminal fluorophore tag to these receptors does not compromise receptor function.

124

CHAPTER IV: Conclusions and future directions The goal of this dissertation was to elucidate specific mechanisms underlying

GPCR signaling and function. Using a combination of approaches, I have uncovered a novel role for a highly conserved amino acid motif in GPCR function, as well as expanded our knowledge of GPCR dimerization by providing the first evidence of such an event occurring in Drosophila. The combination of these findings also extends our knowledge of GPCR evolution, and suggests that many aspects of receptor function arose early in the evolution of the receptor family.

The second chapter of this dissertation specifically explored the prevalence and functional role of an amino acid motif present on the vast majority of Class A GPCRs first extracellular loop, the WxFG motif. While this motif had been previously identified, a full exploration of the conservation of this motif across Class A GPCR subfamilies had not been performed prior to our research. Our bioinformatics analysis showed that this motif is conserved in 17 of the 19 Class A GPCR subfamilies, in addition to being present in ~90% of all Class A GPCRs 1. By generating mutant receptor variants for multiple Class A subfamily members, sourced from a variety of vertebrate and invertebrate taxa, we showed that the presence of an aromatic amino acid at the W position in the WxFG motif is necessary for wild type receptor signaling. Additionally, we suggest an alternative mechanism for the loss of receptor function following mutagenesis of this residue than had been previously put forward. Previous work on this amino acid motif by Klco et al suggested that mutagenesis of the conserved tryptophan residue generated receptor mutants which were able to bind ligand, but unable to appropriately translate ligand binding into specific cellular responses 2. Our findings

125 suggest that, instead, such receptor manipulations lead to defective GPCR trafficking, resulting in these receptors not reaching the cell surface and instead being retained in the

ER-Golgi complex. The findings of previous investigations can be reconciled with our novel mechanism through a comparison of the methods used in the respective studies –

Klco et al performed ligand binding assays on membrane preparations of cells expressing both wild type and mutant receptors. Such preparations would have captured not only receptors present at the plasma membrane, but also receptors retained in the ER-Golgi complex. As such, even though their group found that mutant receptors were able to bind ligand, we suggest that, in the actual environment of the cell, these receptors never reach the cell surface, and are thus unable to interact with their specific ligands, resulting in the lack of signaling responses noted in all studies of this amino acid motif. As such, our findings offer a novel mechanism by which this motif contributes to GPCR function.

The third chapter of this dissertation investigated whether Drosophila GPCRs, specifically those involved in neuropeptide recognition and signaling, assembled as dimers at the plasma membrane. While GPCR dimerization has been widely explored over the past two decades, with a multitude of GPCR homo- and heterodimeric entities identified and described, the vast majority of these studies looked specifically at vertebrate GPCRs, while invertebrate GPCR dimerization remains a neglected field of study 3,4 . Through C-terminal tagging of Drosophila neuropeptide GPCRs with CFP and

YFP fluorophores, we were able to utilize an acceptor-photobleaching FRET methodology to show that multiple Drosophila receptors assemble as homodimers at the plasma membrane. These findings are significant, as they are the first to identify any

GPCR dimerization in Drosophila . Additionally, by focusing on receptors previously

126 shown to assemble as higher order structures in other taxa, our results suggest that receptor dimerization has been conserved throughout the evolution of specific receptor subtypes, rather than being a taxa-specific phenomenon. It is therefore likely that dimerization arose early in the evolution of the receptor superfamily, and is likely critically important for wild-type receptor function in many GPCRs.

Although this work has shed light on mechanisms underlying GPCR function and assembly, there is much left that could be explored. I have clearly shown that the WxFG motif plays a critical role in the appropriate cell surface trafficking of a multitude of

Class A GPCRs. However, as this was explored using a heterologous expression system, the question as to whether similar phenotypes occur in vivo , where other cellular machinery such as chaperone proteins may assist in GPCR trafficking, remains unresolved. As such, a logical next step would be to perform these same mutagenic manipulations via CRISPR or similar methodology in the genome to determine whether a similar trafficking defect occurs. Such an effort would be best focused on the subset of

Drosophila receptors studied, given the genetic tools available in this model organism.

These manipulations could also be used as loss of function alleles to further study the roles of these receptors in a multitude of behaviors and physiologies.

Additionally, my work on dimerization of Drosophila GPCRs suggests that many neuropeptide receptors in the fly are capable of assembling as homodimers, however, this was verified solely using FRET microscopy. To increase confidence in my findings, a logical next step would be to utilize another method to detect GPCR dimers, such as Co-

IP or BiFC, and see if similar results were obtained. Additionally, generating UAS constructs of CFP and YFP tagged receptors used in this study, or simply generating CFP

127 and YFP fusion proteins in the genome through CRISPR, would allow one to assess whether dimerization of these receptors occurs in vivo . Such a finding would add to the dearth of in vivo dimerization studies in the extant literature. Also, my work focused solely on establishing homodimerization of Drosophila GPCRs, it would be interesting to further screen receptors to determine whether disparate GPCRs were capable of assembling as heterodimers, and if so, what impact heterodimerization has on receptor function. These experiments would provide valuable information regarding both the extent and conservation of dimerization across taxa, as well as further elucidating the functional roles of dimerization in receptor signaling in an in vivo setting.

In conclusion, my work has furthered our fundamental understanding of multiple aspects of GPCR function. I have presented evidence supporting a novel mechanism for a highly conserved amino acid motif in receptor trafficking to the cell membrane.

Additionally, I have shown that multiple Drosophila GPCRs from disparate receptor subfamilies are capable of dimeric assembly at the plasma membrane, adding to our limited knowledge of invertebrate GPCR dimerization, while also furthering our understanding of the conservation of dimerization throughout the evolution of the receptor superfamily. Together, these investigations provide valuable insight into multiple aspects of GPCR function, while also offering additional evidence to support the obsolescence of the classical two-state model.

128

REFERENCES

1. Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. Unexpected

role of a conserved domain in the first extracellular loop in G protein-coupled

receptor trafficking. Biochem. Biophys. Res. Commun. 503 , 1919–1926 (2018).

2. Klco, J. M., Nikiforovich, G. V & Baranski, T. J. Genetic Analysis of the First and

Third Extracellular Loops of the C5a Receptor Reveals an Essential WXFG Motif

in the First Loop. J. Biol. Chem. 281 , 12010–12019 (2006).

3. Sakai, T. et al. Evidence for differential regulation of GnRH signaling via

heterodimerization among GnRH receptor paralogs in the protochordate, Ciona

intestinalis. Endocrinology 153 , 1841–1849 (2012).

4. Park, D. et al. Interaction of structure-specific and promiscuous G-protein-coupled

receptors mediates small-molecule signaling in Caenorhabditis elegans. Proc. Natl.

Acad. Sci. U. S. A. 109 , 9917–9922 (2012).

129

Michael J. Rizzo [email protected]

EDUCATION

Wake Forest University, Winston-Salem, NC August 2011 – Present Ph.D. Candidate in Biology; GPA: 3.75

University of Pittsburgh School of Medicine, Pittsburgh, PA July 2009 – June 2010 Ph.D. Student in Biomedical Sciences; GPA: 3.64

University of Virginia, Charlottesville, VA August 2004 – May 2008 B.A. in Biology, Minor in Philosophy; GPA: 3.34 • Phi Eta Sigma National Honor Society (2005) • Dean’s List (2005)

PROFESSIONAL EXPERIENCE High Point University, Department of Biology, High Point, NC August 2018 – Present Instructor of Biology • Taught multiple lecture and laboratory courses. • Helped develop new syllabus and course objectives for non-majors course • Served in multiple department community outreach events

Wake Forest University, Department of Biology, Winston-Salem, NC August 2011 – Present Graduate Research and Teaching Assistant • Taught laboratory courses in a variety of biological subdisciplines. • Undertook research on G-protein coupled receptors (GPCRs) exploring various aspects of their biology, examining receptors from both Drosophila and humans. • Served as Graduate representative to University Honor Council. • Presented posters and talks at multiple institutional meetings, as well as Genetics Society of America and Cold Spring Harbor Laboratories international conferences. • Mentored a variety of undergraduate students in molecular biology and genetic techniques. • Wrote and edited multiple grant applications, secured independent funding for research. • Served as reviewer for multiple publications in scientific journals.

Galax City Public Schools, Galax, VA November 2010 – April 2011 Substitute Teacher • Performed teaching duties as needed for a variety of ages. Classes included science, reading, and special education.

Darden/Curry Partnership for Leaders in Education, Charlottesville, VA October 2010 – April 2011 Lead Editor • Edited collection of case studies for publication, “District Case Studies and Individual Lessons in Leadership,” Dan Duke, Eleanor Smalley.

Cardiovascular Research Center, University of Virginia, Charlottesville, VA October 2007 – June 2009 Research Assistant • Performed an array of laboratory related techniques, including western blots and survival and non- survival surgery on mice.

130

• Actively involved in research pertaining to connexin isoforms found in the vasculature, including editing potential publications and creating presentations on the subject matter. • Performed cell culture work and sterile procedure. • Designed and maintained laboratory website

General Clinical Research Center, UVA Hospital, Charlottesville, VA April 2006 – August 2006 Computer Technician • Performed multiple and complex IT support, including detecting bugs and general compatibility issues. • Implemented state of the art software and hardware applications. • Accountable for general computer maintenance.

SKILLS

Photoshop, Graphpad Prism, Microsoft Office, ImageJ, Carl Zeiss Zen, Tissue Culture, Drosophila and mouse husbandry/dissections, Molecular Cloning, Bioinformatic Sequence Analysis, PCR, RNA and DNA Isolation, Plasmid Prep, Western Blot, DNA Transfection, Phenol-Chloroform Extraction, rudimentary Java

GRANTS AND AWARDS

Center for Molecular and Cell Signaling graduate fellowship – $25,000 2013 – 2014

TEACHING EXPERIENCE

Principles of Cell Biology – BIO1500/BIO1501 2018 – 2019 Biology: A Human Perspective – BIO1100 2018 – 2019 Molecular Biology and Genetics Lab – BIOL213 2014 – 2018 Cell Biology Lab – BIOL214 2012 – 2013 Comparative Physiology Lab – BIOL114 2011 – 2012

UNDERGRADUATE STUDENTS MENTORED

Kandis McNeil 2017 – 2018 Jack Evans; Undergraduate Honors Award 2017 – 2018 Karleigh Smith 2017 – 2018 Harriet Hall 2016 – 2018 Kevin Robinson 2016 Morgan Burt; Undergraduate Honors Award, Carolina Biological Outstanding 2012 – 2015 Undergraduate Research Award Donika Hasanaj 2014 Cole Crowson; Undergraduate Honors Award 2012 – 2014 Rebecca Perry; Undergraduate Honors Award, Carolina Biological Outstanding 2011 – 2013 Undergraduate Research Award, Cocke Outstanding Student Scholar Award. Brian Vega 2012

131

PUBLICATIONS

Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. (2018) Unexpected role of a conserved domain in the first extracellular loop in G protein-coupled receptor trafficking. Biochem. Biophys. Res. Commun. 503, 1919–1926

Miller, M.R., Mandell, J.B., Beatty, K.M., Harvey, S.A.K., Rizzo, M.J., Previte, D.M., Thorne, S.H., and McKenna, K.C. (2014). Splenectomy promotes indirect elimination of intraocular tumors by CD8+ T cells that is associated with IFNγ- and Fas/FasL-dependent activation of intratumoral macrophages. Cancer Immunol Res 2, 1175–1185.

Straub, A.C., Johnstone, S.R., Heberlein, K.R., Rizzo, M.J., Best, A.K., Boitano, S., and Isakson, B.E. (2010). Site-specific connexin phosphorylation is associated with reduced heterocellular communication between smooth muscle and endothelium. J. Vasc. Res. 47 , 277–286.

Johnstone, S.R., Ross, J., Rizzo, M.J., Straub, A.C., Lampe, P.D., Leitinger, N., and Isakson, B.E. (2009). Oxidized phospholipid species promote in vivo differential cx43 phosphorylation and vascular smooth muscle cell proliferation. Am. J. Pathol. 175 , 916–924.

POSTERS AND PRESENTATIONS

Poster: Molecular dissection of Drosophila G protein-coupled receptor oligomerization Michael Rizzo, Erik Johnson Neurobiology of Drosophila , Cold Spring Harbor Laboratories (2015)

Presentation: Molecular dissection of Drosophila G protein-coupled receptor oligomerization Michael Rizzo Wake Forest University Center for Molecular Communication and Signaling (2015)

Poster: Elucidation of Drosophila melanogaster G protein-coupled receptor interactions through heterodimerization and chimeric receptor studies. Michael Rizzo, Erik Johnson Genetics Society of America (2013)

132