Variable Microsatellite Loci for Population Genetics Studies of a Sucking Louse (Pedicinus Badii) Found on Old World Monkeys
Total Page：16
File Type：pdf, Size：1020Kb
Variable Microsatellite Loci for Population Genetics Studies of a Sucking Louse (Pedicinus badii) found on Old World Monkeys Katlyn M. Scholl Florida Museum of Natural History Abstract: Sucking lice are permanent, obligate ectoparasites and cannot survive in absence of their host. Pedicinus badii is a type of blood feeding louse that parasitizes an endangered old world primate, the red colobus monkey (Piliocolobus rufomitratus). This paper describes 8 microsatellite markers that can be used for population genetic studies of P.badii. These markers were tested on a sample of 73 lice collected from 26 individual red colobus living in Kibale National Park, Uganda. Preliminary analysis of another 16 louse individuals finds evidence for two species of lice found on this population of red colobus. Introduction: When most people think of lice, they think of elementary school outbreaks of itchy scalps, but the lice that live on human heads are just one of many species in suborder Anoplura, the classification of sucking lice. Humans act as host to three distinct types of lice: the head louse (Pediculus humanus capitis), the clothing louse (Pediculus humanus humanus) and the pubic louse (Pthirus pubis). These lice have been widely studied because of their importance as a disease vector for relapsing fever and epidemic typhus (Buxton 1939). Sucking lice are obligate ectoparasites--they cannot survive if removed from their host. They have adapted to spend the entirety of their life cycle on the host. Female lice lay their eggs, called nits, on the host. The eggs are cemented to the host hair shaft with a very strong adhesive substance of unknown origin (Buxton 1939). When the juvenile lice, called nymphs, emerge from the egg they are able to grip and move along the hair of their host. Their morphology is adapted to life on the host: their claws enable them to hold tightly and travel easily through hair, and their piercing mouthparts enable them to penetrate the skin and feed directly from the blood vessels of their host (Light et al. 2010). Approximately one fifth of all mammalian species are parasitized by these blood-feeding ectoparasites (Light et al. 2010). Some species of lice are found on more than one type of mammal, while others are so host specific in that they can only survive on one host species (Johnson et al. 2002). Because lice are dependent upon their hosts for survival, over long periods of time the host and parasite change together. The coevolution of lice and their hosts means that relationships between different species of lice can be used to understand the relationships between their hosts. It has long been recognized that more closely related species of mammals tend to host more closely related lice (Buxton 1939). Lice can only move between hosts through direct host-to-host contact. Because of this, in humans and other primates, sucking lice have been examined to understand not only long term evolutionary history, but also to answer questions about behavior of host populations (Reed et al. 2007). Pedicinus badii is a sucking louse that parasitizes red colobus monkeys (Piliocolobus rufomitratus), an old world monkey lineage that is found along equatorial Africa in rainforest habitats (Struhsaker 1975). P. badii has not been widely studied, and little is known about how often the parasites move between red colobus hosts. Migration is necessary to have gene flow between different populations and prevent inbreeding, but dangerous because the lice can only live on certain species, and cannot survive in absence of a host. This means that if a louse attempts to move to a new host and is unsuccessful, it will likely not survive. Direct physical contact between host individuals is necessary for lice to move from one monkey to another. It is possible that the lice are transmitted vertically, moving from mother to offspring during nursing. An alternative possibility is that the lice are transferred horizontally, moving between unrelated monkeys who come into contact through social interactions, such as grooming (Clayton & Tompkins 1994). We have developed microsatellites to use for population genetic studies of P. badii. A microsatellite is a stretch of DNA sequence that is comprised of a short sequence, between one and six base pairs, which is repeated a number of times. Microsatellites are useful for population genetics because they are highly polymorphic; individuals within a population vary in the number of repeats they carry (Zane et al. 2002). Using these markers we can distinguish between individuals and look for evidence of gene flow between parasite populations. The lice for this project were collected from two troops of red colobus monkeys that live in Kibale National Park in Uganda. The red colobus monkey is listed as endangered by the International Union for Conservation of Nature (IUCN), and habitat destruction as well as predation by chimpanzees are contributing factors to their continued decline. Kibale National Park is home to thirteen different species of primates, including the largest population of red colobus in the world. Observational and genetic studies of these monkeys has shown that while they behave as two separate groups, individual monkeys are often moving between the troops and breeding. The red colobus monkeys in Kibale represent a single genetic population (Allen et al. in prep). While there have been many studies of lice that parasitize humans and the great apes, those that parasitize old world monkeys have been neglected. Studies of these lice are critical because of their importance as a disease vector, and the potential to learn more about their hosts. Here we present 8 microsatellite loci that are valid for population genetic studies of these lice. Materials and Methods: Initially, we used the program MSAT COMMANDER (Faircloth 2008) to search for tetranucleotide microsatellites within the genome of the human body louse (Pediculus humanus humanus) and used PRIMER3 (Rozen and Skaletsky 2000) to design primers for 96 loci. I amplified each locus using in eight individuals, and used gel electrophoresis to scan for variability. Next the PCR products were cloned and sequenced to verify that the primers were in fact amplifying microsatellites, since the primers were created from a genome of a related species and not Pedicinus badii. We found that these primers designed from the pediculus genome could not be used for cross species amplification with Pedicinus. The next step was to search through the P. badii DNA sequence directly for microsatellites. Sequence data was obtained using 454 sequencing, a type of high- throughput sequencing technology. I searched through the 454 reads for di- and tri- nucleotide microsatellites, identified 72 loci with good flanking regions for designing PCR primers. PCR was then used to amplify each locus in eight individuals; again the products were cloned and sequenced to verify that the primers were amplifying the intended sequence. We found that the primers designed from the 454 sequences were amplifying the microsatellites. These 72 loci were screened for variability in an initial sample of 8 lice; I identified 15 loci that appeared to be polymorphic. Thus far 8 of these 15 have been successfully amplified genotyped in the larger sample. The primer sequences, annealing temperatures and size ranges for these loci are presented in Table 1. Table 1 Primer pairs that amplify microsatellites in P. badii with annealing temperatures and size Ann. T. Size range Locus Forward primers Reverse primers (°C) PbTri1 TGTCAATGGTAATAAAACAGAATCAA CAGGCTCAAGTGCGGAATAC 52 158-170 PbTri2 GCTTTCTTTTTCAAAGCAATTT CGTACTCGACCCGGAGTAAA 55 214-223 PbTri3 AATCGAAGCCGTTAATTTGC TTGGATAAGGTCAATTGATTCG 52 143-170 PbTri4 AGCGTGAAGCCATACAACTTT TGCAATTAATTGATCGATAGGTTG 52 155-167 PbTri5 GGGTGAGAGAGAAAGAAAATGC TCAAGCATAACACCATCACTAACA 50 177-192 PbDi1 AATTCACACTACGGCTCACG TTGGTTTTCCACCTTTCACC 55 347-375 PbDi2 AAATGAAAAACTTTGCCAGGAA GTAACTGGGAAAACGCAAGG 55 ~180 PbDi3 TTTGTGCCACATTGAAAATGA TGCACAATAGTGGTGGGAGATGCACAATAGTGGTGGGAGA 54 ~220 The total sample is comprised of 89 lice collected from 26 individual monkeys across two monkey troops in Kibale. I also included 3 lice collected from a different species of Red Colobus (Procolobus badius) and 1 louse collected from a Black-and-White Colobus (Colobus guereza), all from the Ivory Coast to serve as an outgroup. DNA was extracted from the lice using a QiAmp DNA micro kit (Cat. No 56304). I used two methods to extract DNA from the lice: some of the lice were crushed, while some were cut in half. Following extraction, the two halves of the cut lice remain intact and can be mounted on a microscope slide for future morphological studies. For each louse extract, PCR was used to amplify the mitochondrial gene CO1. The final volume for this reaction was 25 ul, containing 11 ul water, 10 ul HotMasterMix (5PRIME), 1 ul each of forward and reverse primer, and 2 ul of DNA. The steps for the PCR were: denaturation at 94°C for 10 min, followed by 4 cycles of 94°C for 1 min, 48°C for 1 min, 65°C for 2 min, and then 29 cycles of 94°C for 1 min, 52°C for 1 min, 65°C for 2 min, followed by 65°C for 10 min. COI sequences for all of the Kibale and Ivory Coast lice were aligned in the program Seaview, and PAUP* (Version 4.0) was used to create a neighbor-joining gene tree using the default parameters (Fig. 1). The microsatellite loci were amplified by PCR, in a reaction with a total volume of 15 ul containing 7.5 ul of Type-it microsatellite PCR mix (Quiagen), 5.38 ul of water, 0.06 ul of forward primer (5uM), .06 ul of reverse primer (5uM), 1 ul of dye (10uM) and 1 ul of DNA (about 10 uM). The 5’ end of each forward primer was modified to include a M-13 or CAG tag, so that a florescent dye label could be incorporated into the product.