Variable Microsatellite Loci for Population Genetics Studies of a Sucking Louse (Pedicinus Badii) Found on Old World Monkeys

Total Page:16

File Type:pdf, Size:1020Kb

Variable Microsatellite Loci for Population Genetics Studies of a Sucking Louse (Pedicinus Badii) Found on Old World Monkeys Variable Microsatellite Loci for Population Genetics Studies of a Sucking Louse (Pedicinus badii) found on Old World Monkeys Katlyn M. Scholl Florida Museum of Natural History Abstract: Sucking lice are permanent, obligate ectoparasites and cannot survive in absence of their host. Pedicinus badii is a type of blood feeding louse that parasitizes an endangered old world primate, the red colobus monkey (Piliocolobus rufomitratus). This paper describes 8 microsatellite markers that can be used for population genetic studies of P.badii. These markers were tested on a sample of 73 lice collected from 26 individual red colobus living in Kibale National Park, Uganda. Preliminary analysis of another 16 louse individuals finds evidence for two species of lice found on this population of red colobus. Introduction: When most people think of lice, they think of elementary school outbreaks of itchy scalps, but the lice that live on human heads are just one of many species in suborder Anoplura, the classification of sucking lice. Humans act as host to three distinct types of lice: the head louse (Pediculus humanus capitis), the clothing louse (Pediculus humanus humanus) and the pubic louse (Pthirus pubis). These lice have been widely studied because of their importance as a disease vector for relapsing fever and epidemic typhus (Buxton 1939). Sucking lice are obligate ectoparasites--they cannot survive if removed from their host. They have adapted to spend the entirety of their life cycle on the host. Female lice lay their eggs, called nits, on the host. The eggs are cemented to the host hair shaft with a very strong adhesive substance of unknown origin (Buxton 1939). When the juvenile lice, called nymphs, emerge from the egg they are able to grip and move along the hair of their host. Their morphology is adapted to life on the host: their claws enable them to hold tightly and travel easily through hair, and their piercing mouthparts enable them to penetrate the skin and feed directly from the blood vessels of their host (Light et al. 2010). Approximately one fifth of all mammalian species are parasitized by these blood-feeding ectoparasites (Light et al. 2010). Some species of lice are found on more than one type of mammal, while others are so host specific in that they can only survive on one host species (Johnson et al. 2002). Because lice are dependent upon their hosts for survival, over long periods of time the host and parasite change together. The coevolution of lice and their hosts means that relationships between different species of lice can be used to understand the relationships between their hosts. It has long been recognized that more closely related species of mammals tend to host more closely related lice (Buxton 1939). Lice can only move between hosts through direct host-to-host contact. Because of this, in humans and other primates, sucking lice have been examined to understand not only long term evolutionary history, but also to answer questions about behavior of host populations (Reed et al. 2007). Pedicinus badii is a sucking louse that parasitizes red colobus monkeys (Piliocolobus rufomitratus), an old world monkey lineage that is found along equatorial Africa in rainforest habitats (Struhsaker 1975). P. badii has not been widely studied, and little is known about how often the parasites move between red colobus hosts. Migration is necessary to have gene flow between different populations and prevent inbreeding, but dangerous because the lice can only live on certain species, and cannot survive in absence of a host. This means that if a louse attempts to move to a new host and is unsuccessful, it will likely not survive. Direct physical contact between host individuals is necessary for lice to move from one monkey to another. It is possible that the lice are transmitted vertically, moving from mother to offspring during nursing. An alternative possibility is that the lice are transferred horizontally, moving between unrelated monkeys who come into contact through social interactions, such as grooming (Clayton & Tompkins 1994). We have developed microsatellites to use for population genetic studies of P. badii. A microsatellite is a stretch of DNA sequence that is comprised of a short sequence, between one and six base pairs, which is repeated a number of times. Microsatellites are useful for population genetics because they are highly polymorphic; individuals within a population vary in the number of repeats they carry (Zane et al. 2002). Using these markers we can distinguish between individuals and look for evidence of gene flow between parasite populations. The lice for this project were collected from two troops of red colobus monkeys that live in Kibale National Park in Uganda. The red colobus monkey is listed as endangered by the International Union for Conservation of Nature (IUCN), and habitat destruction as well as predation by chimpanzees are contributing factors to their continued decline. Kibale National Park is home to thirteen different species of primates, including the largest population of red colobus in the world. Observational and genetic studies of these monkeys has shown that while they behave as two separate groups, individual monkeys are often moving between the troops and breeding. The red colobus monkeys in Kibale represent a single genetic population (Allen et al. in prep). While there have been many studies of lice that parasitize humans and the great apes, those that parasitize old world monkeys have been neglected. Studies of these lice are critical because of their importance as a disease vector, and the potential to learn more about their hosts. Here we present 8 microsatellite loci that are valid for population genetic studies of these lice. Materials and Methods: Initially, we used the program MSAT COMMANDER (Faircloth 2008) to search for tetranucleotide microsatellites within the genome of the human body louse (Pediculus humanus humanus) and used PRIMER3 (Rozen and Skaletsky 2000) to design primers for 96 loci. I amplified each locus using in eight individuals, and used gel electrophoresis to scan for variability. Next the PCR products were cloned and sequenced to verify that the primers were in fact amplifying microsatellites, since the primers were created from a genome of a related species and not Pedicinus badii. We found that these primers designed from the pediculus genome could not be used for cross species amplification with Pedicinus. The next step was to search through the P. badii DNA sequence directly for microsatellites. Sequence data was obtained using 454 sequencing, a type of high- throughput sequencing technology. I searched through the 454 reads for di- and tri- nucleotide microsatellites, identified 72 loci with good flanking regions for designing PCR primers. PCR was then used to amplify each locus in eight individuals; again the products were cloned and sequenced to verify that the primers were amplifying the intended sequence. We found that the primers designed from the 454 sequences were amplifying the microsatellites. These 72 loci were screened for variability in an initial sample of 8 lice; I identified 15 loci that appeared to be polymorphic. Thus far 8 of these 15 have been successfully amplified genotyped in the larger sample. The primer sequences, annealing temperatures and size ranges for these loci are presented in Table 1. Table 1 Primer pairs that amplify microsatellites in P. badii with annealing temperatures and size Ann. T. Size range Locus Forward primers Reverse primers (°C) PbTri1 TGTCAATGGTAATAAAACAGAATCAA CAGGCTCAAGTGCGGAATAC 52 158-170 PbTri2 GCTTTCTTTTTCAAAGCAATTT CGTACTCGACCCGGAGTAAA 55 214-223 PbTri3 AATCGAAGCCGTTAATTTGC TTGGATAAGGTCAATTGATTCG 52 143-170 PbTri4 AGCGTGAAGCCATACAACTTT TGCAATTAATTGATCGATAGGTTG 52 155-167 PbTri5 GGGTGAGAGAGAAAGAAAATGC TCAAGCATAACACCATCACTAACA 50 177-192 PbDi1 AATTCACACTACGGCTCACG TTGGTTTTCCACCTTTCACC 55 347-375 PbDi2 AAATGAAAAACTTTGCCAGGAA GTAACTGGGAAAACGCAAGG 55 ~180 PbDi3 TTTGTGCCACATTGAAAATGA TGCACAATAGTGGTGGGAGATGCACAATAGTGGTGGGAGA 54 ~220 The total sample is comprised of 89 lice collected from 26 individual monkeys across two monkey troops in Kibale. I also included 3 lice collected from a different species of Red Colobus (Procolobus badius) and 1 louse collected from a Black-and-White Colobus (Colobus guereza), all from the Ivory Coast to serve as an outgroup. DNA was extracted from the lice using a QiAmp DNA micro kit (Cat. No 56304). I used two methods to extract DNA from the lice: some of the lice were crushed, while some were cut in half. Following extraction, the two halves of the cut lice remain intact and can be mounted on a microscope slide for future morphological studies. For each louse extract, PCR was used to amplify the mitochondrial gene CO1. The final volume for this reaction was 25 ul, containing 11 ul water, 10 ul HotMasterMix (5PRIME), 1 ul each of forward and reverse primer, and 2 ul of DNA. The steps for the PCR were: denaturation at 94°C for 10 min, followed by 4 cycles of 94°C for 1 min, 48°C for 1 min, 65°C for 2 min, and then 29 cycles of 94°C for 1 min, 52°C for 1 min, 65°C for 2 min, followed by 65°C for 10 min. COI sequences for all of the Kibale and Ivory Coast lice were aligned in the program Seaview, and PAUP* (Version 4.0) was used to create a neighbor-joining gene tree using the default parameters (Fig. 1). The microsatellite loci were amplified by PCR, in a reaction with a total volume of 15 ul containing 7.5 ul of Type-it microsatellite PCR mix (Quiagen), 5.38 ul of water, 0.06 ul of forward primer (5uM), .06 ul of reverse primer (5uM), 1 ul of dye (10uM) and 1 ul of DNA (about 10 uM). The 5’ end of each forward primer was modified to include a M-13 or CAG tag, so that a florescent dye label could be incorporated into the product.
Recommended publications
  • Chewing and Sucking Lice As Parasites of Iviammals and Birds
    c.^,y ^r-^ 1 Ag84te DA Chewing and Sucking United States Lice as Parasites of Department of Agriculture IVIammals and Birds Agricultural Research Service Technical Bulletin Number 1849 July 1997 0 jc: United States Department of Agriculture Chewing and Sucking Agricultural Research Service Lice as Parasites of Technical Bulletin Number IVIammals and Birds 1849 July 1997 Manning A. Price and O.H. Graham U3DA, National Agrioultur«! Libmry NAL BIdg 10301 Baltimore Blvd Beltsvjlle, MD 20705-2351 Price (deceased) was professor of entomoiogy, Department of Ento- moiogy, Texas A&iVI University, College Station. Graham (retired) was research leader, USDA-ARS Screwworm Research Laboratory, Tuxtia Gutiérrez, Chiapas, Mexico. ABSTRACT Price, Manning A., and O.H. Graham. 1996. Chewing This publication reports research involving pesticides. It and Sucking Lice as Parasites of Mammals and Birds. does not recommend their use or imply that the uses U.S. Department of Agriculture, Technical Bulletin No. discussed here have been registered. All uses of pesti- 1849, 309 pp. cides must be registered by appropriate state or Federal agencies or both before they can be recommended. In all stages of their development, about 2,500 species of chewing lice are parasites of mammals or birds. While supplies last, single copies of this publication More than 500 species of blood-sucking lice attack may be obtained at no cost from Dr. O.H. Graham, only mammals. This publication emphasizes the most USDA-ARS, P.O. Box 969, Mission, TX 78572. Copies frequently seen genera and species of these lice, of this publication may be purchased from the National including geographic distribution, life history, habitats, Technical Information Service, 5285 Port Royal Road, ecology, host-parasite relationships, and economic Springfield, VA 22161.
    [Show full text]
  • On Douc Langurs (Pygathrix Spp.)
    Vietnamese Journal of Primatology (2010) 4, 57-68 The Pedicinus species (Insecta, Phthiraptera, Anoplura, Pedicinidae) on douc langurs (Pygathrix spp.) Eberhard Mey Museum of Natural History at the State Museum Heidecksburg, Schloßbezirk 1, D-07407 Rudolstadt, Germany. <[email protected]> Key words: Pygathrix spp., lice, Pedicinus, new species, Vietnam Summary All three species of Southeast-Asian douc langurs (Pygathrix spp.) harbor a host-specific species of Pedicinus (Neopedicinus). Using freshly collected material of known provenance, these were identified as Pedicinus tongkinensis Mey, 1994 ex Pygathrix nemaeus, Pedicinus atratulus nov. spec. ex Pygathrix nigripes, and Pedicinus curtipenitus nov. spec. ex Pygathrix cinerea. The three species described here are closely related to each other and belong to the newly created “ancoratus species group” within the subgenus Neopedicinus. Loài Pedicinus (Insecta, Phthiraptera, Anoplura, Pedicinidae) trên các loài Chà vá (Pygathrix spp.) ở Đông Nam Á Tóm tắt Cả ba loài chà vá (Pygathrix spp.) của Đông Nam Á là nơi trú ngụ của một loài ký sinh Pedicinus (Neopedicinus). Sử dụng vật liệu được thu thập tươi từ nguồn gốc đã biết, các loài này được xác định là Pedicinus tongkinensis Mey, 1994 ex Pygathrix nemaeus, Pedicinus atratulus nov. spec. ex Pygathrix nigripes, và Pedicinus curtipenitus nov. spec. ex Pygathrix cinerea. Ba loài được mô tả ở đây có quan hệ gần gũi với nhau và thuộc về “nhóm loài ancoratus” mới được tạo ra trong giống phụ Neopedicinus. Introduction The colobine genus of the douc langurs Pygathrix E. Geoffroy St.-Hilaire, 1812 is endemic to Indochina. Three monotypic species are distinguished (Roos & Nadler, 2001, Nadler et al., 2003, Nadler, 2007).
    [Show full text]
  • Lice in My Life
    LICE IN MY LIFE K. C. EMERSON 1979 LICE IN MY LIFE by K. C. Emerson, Ph.D. 2704 North Kensington Street Arlington, Virginia 22207 Research Associate U. S. N. M., Smithsonian Institution Research Associate The K. C. Emerson Entomology Museum Oklahoma State University Collaborator United States Department of Agriculture Copyright 1979 by Dr. Kary Cadmus Emerson All Rights Reserved TABLE OF CONTENTS Introduction 1 Why 3 Early history of research on lice 6 The changes begin 12 The new era in lice taxonomy 20 The past twenty years 29 Status of research on lice 44 The Anoplura Collection in the U.S.N.M. 59 The Mallophaga Collection in the U.S.N.M. 64 Medical Entomology and the Armed Forces 71 Ectoparasites in the K. C. Emerson Entomology Museum 77 Acknowledgments 80 Bibliography of entomology papers 86 All men of whatever quality they may be, who have done anything of excellence, or which may properly resemble excellence, ought, if they are persons of truth and honesty, to describe their life with their own hands. Benvenuto Cellini about 500 years ago INTRODUCTION For more than 40 years, working with lice (Mallophaga and Anoplura) has been one of the great pleasures of my life. My research has been interesting. It has been a pleasure to assist others under- stand the taxonomy, ecology and distribution of lice so that they can share my interest and then conduct research on their own. I have been able to provide good collections to The K. C. Emerson Entomology Museum at Oklahoma State University so that students there will not have to spend time in Washington, D.
    [Show full text]
  • Typen Mallophagen
    Insect Types in the ZFMK Collection, Bonn: Phthiraptera Insect Types in the ZFMK Collection, Bonn: Phthiraptera (last update: April 2006) Karl-Heinz Lampe, Dirk Rohwedder & Birgit Rach running title: LAMPE, ROHWEDDER & RACH: Insect Types in ZFMK section Hymenoptera Authors’ addresses: Zoologisches Forschungsinstitut und Museum Alexander Koenig (ZFMK), Adenauerallee 160, 53113 Bonn, Germany, [email protected] Abstract. The type specimens of Phthiraptera housed in the Zoologisches Forschungsinstitut und Museum Alexander Koenig (ZFMK), Bonn, are listed. There are 99 names recorded; of these 6 (6%) are represented by name bearing (i.e., primary) types. Specific and subspecific names are listed alphabetically, followed by the original genus name, bibliographic citation, original label information (in case of primary types), date and place collected, and finally the geographical coordinates (latitude and longitude based on geo-referencing process). Key words. Type specimens, Phthiraptera Introduction This catalogue is generated from the specimen based database BIODAT. Data capture was mainly done within the DIG project (‘Digitization of key Insect groups at ZFMK’). DIG is one of the subprojects of the German GBIF subnode Insecta. It is financially supported by the German Ministry of Science and Education (BMBF) and will run until the end of the year 2005. By adaptation to the ABCD schema (Access to Biological Collection Data) BIODAT became both a BIOCASE- (Biological Collection Access Service for Europe) and GBIF- (Global Biodiversity Information Infrastructure) provider. Therefore full information at the specimen level, and not only of type specimens, for selected ZFMK insect collections (starting with “Homoptera” & Orthoptera) will be sustainably available on the World Wide Web.
    [Show full text]
  • Figures in Italics Indicate the Prime Taxonomic Reference. Figures in Bold Type Indicate the Page on Which There Is a Figure. AB
    INDEX Figures in italics indicate the prime taxonomic reference. Figures in bold type indicate the page on which there is a figure. ABALOOS, 732, 748 Acerentomon, food, 455, 4.59; A. Acrocera, 1006; A. globulus, ABEL, 49I, 493 doderoi, 455 1006 abdomen, Coleoptera, adephagid Acerentulus, 4.59; head, mouth­ Acroceridae, 10o6; larvae par­ type, haplogastrous, hologa­ parts, 456; internal anatomy, asitic, 970; mesopleural sulcus strous, symphiogastrous, 825, 457 straight, 979 826, Diptera, 864; Achanthiptera rohrellijormis Acromantis, 6oi Hymenoptera, number of ex­ ( = inanis) in nests of Vespula, Acronycta, larval ecdyses, I094 posed segments, I I 87 I249 Acrotelsa, 44I ABDULLAH,884,89I,904 Acherontia atropos, I I39; sound­ acrotrophic ovarioles, in ABERNATHY,722,756 production, I I40; larva, alimen­ Coleoptera, 832 Abies excelsa, Physokermes piceae, tary canal, 1095; mandibular Acrydiidae, see Tetrigidae a pest on, 726 gland, 267 Actaletes, 470; tracheae present, ABRAHAMSON,903,904 Acheta domesticus, 546, .5 48; 467 Abraxas grossulariata auditory organ, I33 Actaletidae, 470 (Geometridae) wing-variation, Achilidae, 705 Actinoscytidae, 762 1133 Achilixiidae, 70.5 ACTON,684,688,748,767 Acalyptratae, I 020; larvae oc­ achrestogonimes, in Isoptera, 620 Actora, see Helcomyza casionally parasitic, 970; ner­ ACHTELIG,426,427,794,8I2 Actornithophilus, 665 vous system, 970; preapical Achroia, I 12 I Aculagnathidae, 884 tibial bristle, 967 acid gland, 1189 Aculeata, see Hymenoptera Acanaloniidae, 707 Acidia, see Philophylla Aculeata acanthae, in Mecoptera, 936; in ACKER, 794, 812 aculei, in Lepidoptera, I077 Siphonaptera, 946 Aclerda, 729 Acyrtosiphon, 7I7; A. pisum, Acanthaspis, puncture by, pain­ Aclerdidae, 7 29 photoperiod, temperature and ful, 732 Acleris (Tortricidae) venation, wing-development, 722 Acanthiidae, see Cimicidae or 1708 ACZEL, IOI6, I02J, IOJ7, I046 Saldidae Acletoxenus, I022 ADAIR, 599, 601 Acanthoceridae, 86o Aclypea, 854 Adalia, colour variation, 882; Acanthococcus devoniensis, 728 Acraea, I 126 development oflarva, 883; A.
    [Show full text]
  • For Peer Review Onlyemail: [email protected] 7
    Page 1 of 48 Systematic Biology 1 Robert S. de Moya 2 Department of Entomology 3 University of Illinois Urbana-Champaign 4 505 S. Goodwin Ave. 5 Urbana, IL 61801 6 For Peer Review OnlyEmail: [email protected] 7 8 Phylogenomics of parasitic and non-parasitic lice (Insecta: Psocodea): Combining sequence data 9 and Exploring compositional bias solutions in Next Generation Datasets 10 Robert S. de Moya1,2, Kazunori Yoshizawa3, Kimberly K.O. Walden1, Andrew D. Sweet4, 11 Christopher H. Dietrich2, Kevin P. Johnson2 12 1Department of Entomology, University of Illinois Urbana-Champaign, 505 S. Goodwin Ave., 13 Urbana, IL 61801, USA 14 2Illinois Natural History Survey, Prairie Research Institute, University of Illinois, Champaign, IL 15 61820, USA 16 3Systematic Entomology, School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan 17 4Department of Entomology, Purdue University, 901 W. State St., West Lafayette, IN 47907, 18 USA 19 http://mc.manuscriptcentral.com/systbiol Systematic Biology Page 2 of 48 de Moya et al. 20 Abstract 21 22 The insect order Psocodea is a diverse lineage comprising both parasitic (Phthiraptera) 23 and non-parasitic members (Psocoptera). The extreme age and ecological diversity of the group 24 may be associated with major genomic changes, such as base compositional biases expected to 25 affect phylogeneticFor inference. Peer Divergent morphologyReview between Only parasitic and non-parasitic 26 members has also obscured the origins of parasitism within the order. We conducted a 27 phylogenomic analysis on the order Psocodea utilizing both transcriptome and genome 28 sequencing to obtain a data set of 2,370 orthologous genes.
    [Show full text]
  • Taxonomy, Phylogeny and Host Relationships of the Trichodectidae
    TAXONOMY, PHYLOGENY AND HOST RELATIONSHIPS OF THE TRICHODECTIDAE (PHTHIRAPTERA: ISCHITOCERA) by CHRISTOPHER HENRY GOUTTS LYAL, B.Sc. VOLUME 1 October 1983 A thesis submitted for the degree of Doctor of Philosophy of the University of London and for the Diploma of Imperial College, Department of Pure and Applied Biology, Imperial College, London SN7 and Department of Entomology, British Museum (Natural History), London SM7 2 ABSTRACT The external morphology of the Phthiraptera is discussed with particular reference to the Trichodectidae. Structures of the head, thorax and abdomen are examined and homologised, most attention being given to features of potential use in systematic analysis. The homologies of the component parts of the male and female genitalia, hitherto disputed, are established. The characters used by previous workers for systematic placement of the Trichodectidae, Ischnocera, Amblycera, Rhyncophthirina, Anoplura, Phthiraptera and Psocoptera are examined, and a cladistic analysis of these groups performed. The Psocodea and Phthiraptera are found to be holophyletic but the Psocoptera are paraphyletic. The Trichodectidae, Amblycera, Rhyncophthirina and Anoplura are all holophyletic, the Rhynco- phthirina is the sister-group of the Anoplura and the Amblycera the sister-group of all other lice. The Ischnocera is not demonstrably holophyletic, and the exact placement of the Trichodectidae is not determined. A cladistic analysis of the Trichodectidae is performed and the 351 species and subspecies reclassified on the basis of this. Five subfamilies are used to partition the twenty genera employed, ten of the latter being sub-divided into twenty-seven subgenera. One subfamily, three genera and four subgenera are described as new. Three genera are placed in synonymy, eight genera and subgenera are raised from synonymy, and four genera are reduced to subgenera,.
    [Show full text]
  • Genetic Analysis of Lice Supports Direct Contact Between Modern and Archaic Humans
    Open access, freely available online PLoS BIOLOGY Genetic Analysis of Lice Supports Direct Contact between Modern and Archaic Humans David L. Reed1,3*, Vincent S. Smith2, Shaless L. Hammond3, Alan R. Rogers4, Dale H. Clayton3 1 Florida Museum of Natural History, Dickinson Hall, University of Florida, Gainesville, Florida, United States of America, 2 Graham Kerr Building, DEEB, IBLS, University of Glasgow, Glasgow, Scotland, 3 Department of Biology, University of Utah, Salt Lake City, Utah, United States of America, 4 Department of Anthropology, University of Utah, Salt Lake City, Utah, United States of America Parasites can be used as unique markers to investigate host evolutionary history, independent of host data. Here we show that modern human head lice, Pediculus humanus, are composed of two ancient lineages, whose origin predates modern Homo sapiens by an order of magnitude (ca. 1.18 million years). One of the two louse lineages has a worldwide distribution and appears to have undergone a population bottleneck ca. 100,000 years ago along with its modern H. sapiens host. Phylogenetic and population genetic data suggest that the other lineage, found only in the New World, has remained isolated from the worldwide lineage for the last 1.18 million years. The ancient divergence between these two lice is contemporaneous with splits among early species of Homo, and cospeciation analyses suggest that the two louse lineages codiverged with a now extinct species of Homo and the lineage leading to modern H. sapiens. If these lice indeed codiverged with their hosts ca. 1.18 million years ago, then a recent host switch from an archaic species of Homo to modern H.
    [Show full text]
  • Staatsinstituts Und Zoologischen Museums Hamburg
    Mitt. Hamburg. Zool. Mus. Inst. Band 63 S. 209—264 Hamburg, März 1966 Die Entomologischen Sammlungen des Zoologischen Staatsinstituts und Zoologischen Museums Hamburg VI. Teil *) Insecta III Von Herbert Weidner, Hamburg2) Inhalt Seite 9. Ordnung: Blattariae 210 10. Ordnung: Isoptera 213 11. Ordnung: Notoptera 225 12. Ordnung: Cheleutoptera 226 13. Ordnung: Ensifera 232 14. Ordnung: Caelifera3) 15. Ordnung: Zoraptera 243 16. Ordnung: Corrodentia 243 17. Ordnung: Phthiraptera 246 18. Ordnung: Thysanoptera 264 *) Bisher sind in dieser Zeitschrift Teil I—V im Band 57—61 und TeilX in Band 62 erschienen. *) Anschrift des Verfassers: Professor Dr. Herbert Weidner, 2000 Hamburg 13 Von-Melle-Park 10, Zoologisches Staatsinstitut und Zoologisches Museum. ») Da die Aufstellung dieser umfangreichen Sammlung noch nicht ganz beendet ist, soll über sie später berichtet werden. 210 Herbert Weidner 9. Ordnung: Blattariae Die Sammlung dieser Ordnung wurde von Professor Dr. Max v. Brunn durchgearbeitet und bis auf die Ectobiidae bestimmt und aufgestellt, soweit es ihm bei der vorliegenden Literatur möglich war. Neubeschreibungen hat er nicht gemacht. Historisches Material enthält daher die Sammlung nur in sehr gerin gem Maß. Größere Bedeutung hat sie erst durch die Bearbeitung der Neuein gänge aus der äthiopischen Region durch K. Princis gewonnen. Das bis zur Art bestimmte Material umfaßt 3667 trockene Exemplare in 1320 Nummern, außer dem noch 604 Nummern in Alkohol, von denen jede Nummer meistens mehr als ein Exemplar, in der Regel viele Exemplare enthält. Die 413 Arten verteilen sich auf die von Princis (1960, Eos 36, 427—449) aufgestellten Familien folgen dermaßen: Arten Arten 1. Polyphagidae 11 15. Panesthiidae 13 2. Homoeogamiidae 7 16.
    [Show full text]
  • Curriculum Vitae
    C.A. Chapman 1 Colin A. Chapman Canada Research Chair, Fellow of the Royal Society of Canada, Killam Research Fellow September 2016 Department of Anthropology & McGill School of Environment McGill University, Wildlife Conservation Society 855 Sherbrooke St West, Montreal, Qc, Canada, H3A 2T7 Phone: Cell: 514-378-5596, Fax: 514-398-1643 Email: [email protected] Web: http://chapmanresearch.mcgill.ca/ https://www.orcid.org/0000-0002-8827-8140 https://mcgill.academia.edu/ColinChapman https://www.researchgate.net/profile/Colin_Chapman8 Colin Chapman is a professor in the Department of Anthropology and McGill School of Environment, and an adjunct professor in Biology at McGill University, an Honourary Professor of Zoology at Makerere University, Uganda, and an Associate Scientist with the Wildlife Conservation Society. Since 2005 he has been a Canada Research Chair in Primate Ecology and Conservation, subsequently he was awarded a Killam Fellowship, and became a member of the Royal Society. He has spearheaded a number of conservation projects, primarily in Uganda. For the last 26+ years, Dr. Chapman has conducted research in Kibale National Park, Uganda. ACADEMIC POSITIONS 2012-2014 Killam Research Fellow 2012-present Canadian Research Chair – Primate Ecology and Conservation, McGill University, Montreal 2010-present Fellow of the Royal Society of Canada – McGill University, Montreal 2005-2011 Canadian Research Chair – Primate Ecology and Conservation, McGill University, Montreal 2008-present Associate Member – Redpath Museum, McGill
    [Show full text]
  • Size Correlations Between Sucking Lice and Their Hosts Including a Test of Harrison's Rule
    Georgia Southern University Digital Commons@Georgia Southern Electronic Theses and Dissertations Graduate Studies, Jack N. Averitt College of Spring 2010 Size Correlations between Sucking Lice and Their Hosts Including a Test of Harrison's Rule Sherri M. Cannon Follow this and additional works at: https://digitalcommons.georgiasouthern.edu/etd Recommended Citation Cannon, Sherri M., "Size Correlations between Sucking Lice and Their Hosts Including a Test of Harrison's Rule" (2010). Electronic Theses and Dissertations. 764. https://digitalcommons.georgiasouthern.edu/etd/764 This thesis (open access) is brought to you for free and open access by the Graduate Studies, Jack N. Averitt College of at Digital Commons@Georgia Southern. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons@Georgia Southern. For more information, please contact [email protected]. SIZE CORRELATIONS BETWEEN SUCKING LICE AND THEIR HOSTS INCLUDING A TEST OF HARRISON’S RULE by SHERRI M. CANNON (Under the Direction of Lance A. Durden) ABSTRACT Ectoparasite size can be influenced by many factors; one is host size. Harrison’s rule states that larger hosts typically have larger parasites. In this study, sucking lice (Insecta: Anoplura) were used to test this rule. Sucking lice should provide a good test for this rule because they are generally host-specific and because, as a group, they parasitize hosts of different sizes. Also, sucking lice use their tibio-tarsal claws to grasp host hairs, therefore, correlations between claw size and host hair diameters were also tested. Raw analyses including 206 species of slide-mounted sucking lice from throughout the world, followed by analyses of phylogenetically subtracted data, were used to test the hypotheses that sucking louse body size is correlated with host body size and that sucking louse claw size is correlated with host hair diameters.
    [Show full text]
  • Multiple Origins of Parasitism in Lice Kevin P
    Received 18 March 2004 Accepted 12 May 2004 Published online 27 July 2004 Multiple origins of parasitism in lice à Kevin P. Johnson1 , Kazunori Yoshizawa1,2 and Vincent S. Smith3 1Illinois Natural History Survey, 607 East Peabody Drive, Champaign, IL 61820, USA 2Department of Ecology and Systematics, Hokkaido University, Sapporo 060-8589, Japan 3Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G12 8QQ, UK A major fraction of the diversity of insects is parasitic, as herbivores, parasitoids or vertebrate ectopara- sites. Understanding this diversity requires information on the origin of parasitism in various insect groups. Parasitic lice (Phthiraptera) are the only major group of insects in which all members are permanent para- sites of birds or mammals. Lice are classified into a single order but are thought to be closely related to, or derived from, book lice and bark lice (Psocoptera). Here, we use sequences of the nuclear 18S rDNA gene to investigate the relationships among Phthiraptera and Psocoptera and to identify the origins of parasitism in this group (termed Psocodea). Maximum-likelihood (ML), Bayesian ML and parsimony analyses of these data indicate that lice are embedded within the psocopteran infraorder Nanopsocetae, making the order Psocoptera paraphyletic (i.e. does not contain all descendants of a single common ancestor). Furthermore, one family of Psocoptera, Liposcelididae, is identified as the sister taxon to the louse suborder Amblycera, making parasitic lice (Phthiraptera) a polyphyletic order (i.e. descended from two separate ancestors). We infer from these results that parasitism of vertebrates arose twice independently within Psocodea, once in the common ancestor of Amblycera and once in the common ancestor of all other parasitic lice.
    [Show full text]