DOCSLIB.ORG

First Report of Erannis Defoliaria on Quercus Sp. in North West of Tunisia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
First Report of Erannis Defoliaria on Quercus Sp. in North West of Tunisia Short Communication First Report of Erannis defoliaria on Quercus sp. in North West of Tunisia Yaussra Mannai and Olfa Ezzine, Laboratoire de Gestion et de Valorisation des Ressources Forestières, INRGREF, Université de Carthage, Avenue Hédi Karray, PB 10, 2080 Ariana, Tunisia, Saïd Nouira, Faculté des Sciences de Tunis, Université Tunis El-Manar, Campus Universitaire, 1002 El-Manar II, Tunisia, and Mohamed Lahbib Ben Jamâa, Laboratoire de Gestion et de Valorisation des Ressources Forestières, INRGREF, Université de Carthage, Avenue Hédi Karray, PB 10, 2080, Ariana, Tunisia ABSTRACT Mannai, Y., Ezzine, O., Nouira, S., and Ben Jamâa, M.L. 2015. First report of Erannis defoliaria on Quercus sp. in North West of Tunisia. Tunisian Journal of Plant Protection 10: 75-78. Erannis defoliaria, a spring-feeding moth, caused severe defoliation during springs 2009 and 2010. Larvae were collected from Quercus suber in northwestern forest of Tunisia: Bellif and Ain El Baya. Caterpillars of E. defoliaria were also observed feeding on Q. canariensis, Q. afares and other shrub species such as Pistacia lentiscus, Erica arborea, and E. multiflora. In this paper, we present a first report of this pest in Tunisia. Keywords: Erannis defoliaria, North West of Tunisia, Quercus sp. __________________________________________________________________________ At the beginning of April 2009, suber, from Mzara on Q. canariensis, and severe defoliation of cork oak was from Ain zena on Q. afares was observed in two forests in the North West performed to identify the species. PCR of Tunisia. About 30 ha forest areas were amplification and DNA sequencing were defoliated in Ain El Baya (36°65’N; conducted at the CCDB (Canadian Centre L8°65’E) (Fig. 1) and 23 ha in Bellif for DNA Barcoding, Guelph, Canada) (37°18’N; L9°19’W). Larva of the following standard high-throughput mottled umber moth emerges from April protocols (4) that can be accessed under to May (Fig. 2). DNA analysis of 18 the website (8). PCR amplification with a individuals of Erannis collected from single pair of primers consistently Bellif, Ain El Baya, and El Jouza on Q. recovered a 658 bp region near the 5’ terminus of the mitochondrial Cytochrome c Oxidase I (COI) gene that Corresponding author: Yaussra Mannai included the standard 658 bp barcode Email: [email protected] region for the animal kingdom (3). DNA extracts are stored at the CCDB, with aliquots being deposited in the DNA- Accepted for publication 12 June 2015 Bank facility of the ZSM (9). All sequences are deposited also in GenBank Tunisian Journal of Plant Protection 75 Vol. 10, No. 1, 2015 according to the iBOL (international oak (Q. ilex, Q. robur, Q. petraea, Q. BARCODE OF LIFE) data release lusitanica, and Q. pyrenaica), maple policy. This work is the first record of E. (Acer campestre), blueberry (Vaccinium defoliaria in Tunisia and in North Africa. myrtülus), beech (Fagus sylvatica), hazal E. defoliariais a Lepidoptera that (Corylus avellana), poplar (Populus sp.), belongs to the family of Geometridae, pear, and apple (7). In Tunisia, larvae subfamily of Ennominae (= Boarmiinae), were also observed on Pistacia lentiscus, tribe of Bistonini. Erannis is synonymous Erica arborea and E. multiflora. with Lampetia, Hybernia, and Agriopis E. defoliaria has one generation a (7). year. Adults are active in autumn E. defoliaria was reported to be an (October). After mating, females, which important pest in Northern and Middle are wingless, crawl up the host trees and Europe (7). It is widespread in most of deposit eggs, either singly or in small Europe and Asia such as British Isles, groups in bark crevices, under moss or in North Norway, Sweden, Finland, East of other sheltered places. Females oviposit Russia, Republic of Georgia, Italy, individually or in small groups around the Yugoslavia, Germany, Poland, Spain, buds (5). They can lay 300-400 eggs. Austria, Hungary, and Romania (1, 6). It Eggs are the overwintering stage. The was introduced into North America on the larvae hatch in the spring and feed openly Pacific side many years ago (2). on buds and leaves of host trees. Later, Eighteen barcode sequences were they bind leaves together with silken obtained and were equal to 658 bp. webbing. When the larvae are not actively Nucleotide sequence consists of A (202), feeding, they remain inside this shelter. G (99), C (100) and T (257) as shown in Pupation occurs in the soil (2, 6). Fig. 3 (GWOSP397-11: At present, damage caused by E. http://www.boldsystems.org/index.php/M defoliaria seems to be low because it is AS_Management_RecordList). Compa- limited by the competition of other red to the existing specimens in BOLD Lepidoptera and restricted to Quercus sp. system, 97.86 to 100% of similarity was However, further investigation must be found with 67 specimens. done to detect E. defoliaria in other Larvae of E. defoliaria are regions and other host species. polyphagous. They have many hosts like Fig. 1. Defoliated Quercus suber in Ain El Baya, April 2009. Tunisian Journal of Plant Protection 76 Vol. 10, No. 1, 2015 Fig. 2. Larva of Erranis defoliaria on shrub of Quercus suber forest in Ain El Baya (2009). Fig. 3. Pupa of Erannis defoliaria AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACTTCTTTAAGTTTATT AATTCGAGCAGAATTAGGAAATCCTGGATCTCTAATTGGAGATGATCAAATTTATAACAC TATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGG AGGTTTTGGAAATTGATTAGTACCTTTAATACTGGGTGCCCCTGATATAGCTTTCCCACG AATAAATAATATAAGATTTTGATTATTACCCCCATCTATTACTCTTTTAATTTCAAGAAG AATTGTAGAAAATGGGGCAGGAACTGGTTGAACGGTTTACCCGCCTTTATCCTCTAATAT TGCTCATGGAGGAAGCTCAGTAGATTTAGCTATTTTTTCACTACATTTAGCTGGTATTTC TTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTT ATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTCTTACTATT ATTATCTTTACCAGTTTTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAA TACATCATTTTTCGACCCCGCAGGAGGGGGAGACCCAATTCTTTATCAACACTTATTT Fig. 4. Nucleotide Sequence of Erannis defoliaria Tunisian Journal of Plant Protection 77 Vol. 10, No. 1, 2015 __________________________________________________________________________ RESUME Mannai Y., Ezzine O., Nouira S. et Ben Jamâa M.L. 2015. Premier rapport sur Erannis defoliaria sur Quercus sp. au nord-ouest de la Tunisie. Tunisian Journal of Plant Protection 10: 75-78. Erannis defoliaria a provoqué une défoliation importante au cours des printemps 2009 et 2010. Les larves ont été récoltées sur Quercus suber des forêts de Bellif et Ain El-Baya situées au nord-ouest de la Tunisie. Les chenilles de E. defoliaria ont été également observées se nourrissant sur Q. canariensis, Q. afares et d'autres espèces d'arbustes telles que Pistacia lentiscus, Erica arborea et E. multiflora. Dans cet article, nous présentons le premier rapport sur ce ravageur en Tunisie. Mots clés: Erannis defoliaria, nord-ouest de la Tunisie, Quercus sp. __________________________________________________________________________ ملخص مناعي، يسرى وألفة الزين وسعيد نويرة ومحمد لحبيب بن جامع. 2015. أول تقرير حول Erannis defoliaria على أشجار السنديان في شمال غرب تونس. Tunisian Journal of Plant Protection 10: 75-78. تتغذى يرقات فراشة Erannis defoliation في الربيع وقد تسببت في تآكل شديد لﻷشجار خﻻل ربيع عام 2009 و2010. تم جمع اليرقات من السنديان الفليني في غابات عين البي ّة وبليف بشمال غرب تونس، كما شوھدت اليرقات وھي تتغذى أيضا على سنديان الزان وسنديان اﻷفراس وأنواع أخرى من الشجيرات مثل Erica arborea و Erica multiflora و Pistacia lentiscus . في ھذه المقالة، نقدم أول تقرير حول ھذه اﻵفة في تونس. كلمات مفتاحية: شمال غرب تونس، .Erannis defoliaria ،Quercus sp __________________________________________________________________________ LITERATURE CITED 1. Ciornei, C. and Mihalache, G.1998. Integrated friendly protocol for recovering high-quality control of species of Geometridae in oak forests DNA. Mol. Ecol. Notes 6: 998-1002. of Romania. Pages 222-229. In: Proceedings of 5. Glavendekic, M. 2010. Parasitoids and Population Dynamics, Impacts, and Integrated hyperparasitoids of Erannis defoliaria Cl. Management of Forest Defoliating Insects. (Lepidoptera, Geometridae) in oak forests. USDA Forest Service General Technical, Šumarskilist br. 7-8, CXXXIV, 403-410. Report NE-247, Romania. 6. Luciano, P. and Roversi, P.F. 2001. Erannis 2. Food and Agriculture Organization of the United defoliaria (Clerk) (Lepidoptera Geometridae). Nations (FAO). 2007. Forest Health & Pages 66-67 in Fillofagi delle Querce in Italia, Biosecurity. Working Papers: Overview of Italy, 161 pp. forest pests, Republic of Moldova. Rome, Italy, 7. Soria, S. and Toimil, F.J. 1983. Fuerte ataque de 16 pp. Erannis defoliaria Clerck (Lep. Geometridae) 3. Hebert, P.D.N., Ratnasingham, S., and De Waard, en los Montes de Toledo y ensayos de lucha J.R. 2003. Barcoding animal life: cytochrome c quimica para su combate. Bol. Sev. Plagas. 9: oxidase subunit 1 divergences among closely 61-75. related species. Proc. R. Soc. Lond. B. 270, 8. http://www.dnabarcoding.ca/pa/ge/research/proto Supplement 1: S96-S99. cols 4. Ivanova, N.V., De Waard, J.R., and Hebert, 9. http://www.zsm.mwn.de/dnabank/ P.D.N. 2006. An inexpensive, automation- -------------------------- Tunisian Journal of Plant Protection 78 Vol. 10, No. 1, 2015 .
Load more

Recommended publications
  • Page 1 of 7 Moth Species List Froyle Records
    Moth species list Froyle Records extracted 9th December 2012 from the moth databases held by the Hampshire & Isle of Wight Branch of Butterfly Conservation. Contains Lepidoptera records in the Froyle Parish, Hampshire. Taxon Vernacular Abrostola tripartita Spectacle Acasis viretata Yellow-barred Brindle Acleris forsskaleana Acleris variegana Garden Rose Tortrix Adaina microdactyla Adela rufimitrella Agapeta hamana Agonopterix arenella Agonopterix heracliana Agriopis leucophaearia Spring Usher Agriopis marginaria Dotted Border Agriphila straminella Agrochola lota Red-line Quaker Agrochola macilenta Yellow-line Quaker Agrotis exclamationis Heart and Dart Agrotis puta Shuttle-shaped Dart Alcis repandata Mottled Beauty Allophyes oxyacanthae Green-brindled Crescent Alucita hexadactyla Twenty-plume Moth Amblyptilia acanthadactyla Amphipyra pyramidea Copper Underwing Amphipyra pyramidea agg. Copper Underwing agg. Anthophila fabriciana Anticlea badiata Shoulder Stripe Anticlea derivata Streamer Apamea crenata Clouded-bordered Brindle Apamea epomidion Clouded Brindle Apamea monoglypha Dark Arches Apamea sordens Rustic Shoulder-knot Apeira syringaria Lilac Beauty Aphomia sociella Bee Moth Aplocera efformata Lesser Treble-bar Archips podana Large Fruit-tree Tortrix Asteroscopus sphinx Sprawler Autographa gamma Silver Y Autographa pulchrina Beautiful Golden Y Axylia putris Flame Batia unitella Biston betularia Peppered Moth Biston strataria Oak Beauty Blastobasis adustella Page 1 of 7 Blastobasis lacticolella Cabera exanthemata Common Wave Cabera
    [Show full text]
  • 2020 Forest Action Plan
    Alabama’s Forest Road Map 2020 The Forest Action Plan of the Alabama Forestry Commission Est. 1924 Welcome from the state forester Rick Oates, State Forester t is interesting how time modifies your perspective. Ten years ago, while working for the Alabama Forestry Association, I was asked to provide feedback in the development of the 2010 Alabama Forest Action Plan, Forests at the Crossroads. At the time I did not fully understand the importance of the Forest Action Plan to our state’s forest resources. IFast forward ten years and I am now the State Forester of Alabama, with a much better understanding of what this doc- ument means to the state. I now have the responsibility of updating this important plan. As such, it is with pride that I offer the 2020 Alabama Forest Action Plan, Alabama’s Forest Roadmap as a guide for all forestry stakeholders to reference over the next decade. This guide will serve as a tool to help our state better understand and manage this amazing resource. Alabama is blessed with abundant forest resources – 23.1 million acres - which cover more than two-thirds of the state. These forests improve water and air quality, provide wildlife habitat, support a growing forest industry and help provide jobs across the state. Without these forests Alabama would be a very different place. As such, we want to see forests remain as working forests in order to continue to accrue these important benefits. That is not to say there are not challenges associ- ated with our forest resource, but the assessment and strategies discussed in this document will be instrumental in raising awareness, implementing solutions and taking a step towards achieving this goal.
    [Show full text]
  • Bosco Palazzi
    SHILAP Revista de Lepidopterología ISSN: 0300-5267 ISSN: 2340-4078 [email protected] Sociedad Hispano-Luso-Americana de Lepidopterología España Bella, S; Parenzan, P.; Russo, P. Diversity of the Macrolepidoptera from a “Bosco Palazzi” area in a woodland of Quercus trojana Webb., in southeastern Murgia (Apulia region, Italy) (Insecta: Lepidoptera) SHILAP Revista de Lepidopterología, vol. 46, no. 182, 2018, April-June, pp. 315-345 Sociedad Hispano-Luso-Americana de Lepidopterología España Available in: https://www.redalyc.org/articulo.oa?id=45559600012 How to cite Complete issue Scientific Information System Redalyc More information about this article Network of Scientific Journals from Latin America and the Caribbean, Spain and Journal's webpage in redalyc.org Portugal Project academic non-profit, developed under the open access initiative SHILAP Revta. lepid., 46 (182) junio 2018: 315-345 eISSN: 2340-4078 ISSN: 0300-5267 Diversity of the Macrolepidoptera from a “Bosco Palazzi” area in a woodland of Quercus trojana Webb., in southeastern Murgia (Apulia region, Italy) (Insecta: Lepidoptera) S. Bella, P. Parenzan & P. Russo Abstract This study summarises the known records of the Macrolepidoptera species of the “Bosco Palazzi” area near the municipality of Putignano (Apulia region) in the Murgia mountains in southern Italy. The list of species is based on historical bibliographic data along with new material collected by other entomologists in the last few decades. A total of 207 species belonging to the families Cossidae (3 species), Drepanidae (4 species), Lasiocampidae (7 species), Limacodidae (1 species), Saturniidae (2 species), Sphingidae (5 species), Brahmaeidae (1 species), Geometridae (55 species), Notodontidae (5 species), Nolidae (3 species), Euteliidae (1 species), Noctuidae (96 species), and Erebidae (24 species) were identified.
    [Show full text]
  • Predicting Forest Insect Disturbance Under Climate Change
    PREDICTING FOREST INSECT DISTURBANCE UNDER CLIMATE CHANGE Allan L. Carroll University of British Columbia Department of Forest Sciences 2424 Main Mall, Vancouver, BC Canada V6T 1Z4 Tel: 1-604-822-3360 Fax: 1-604-822-9102 Email: [email protected] 1 ABSTRACT This paper comprises a review of literature regarding climate change impacts to forest insect disturbances. Its primary objectives were three-fold. First, commonalities were sought among systems regarding the effects associated with altered temperature and/or precipitation patterns on forest insect herbivores, the proximate and ultimate form of the response by the insects, and the outcome in terms of forest disturbance. Second, a general framework within which to assess future disturbances to temperate and boreal forests by insect herbivores was constructed. Finally, uncertainty regarding predictions of the extent/severity of forest insect disturbances under climate change into the future was discussed. 2 INTRODUCTION There is now ample evidence that recent climatic changes have affected a broad range of organisms in a manner consistent with expectations from a warming environment (reviewed by Walther et al. 2002, Parmesan and Yohe 2003, Root et al. 2003, Hickling et al. 2006, Post et al. 2009, Robinet and Roques 2010, Wolken et al. 2011). In fact, evidence has accumulated indicating direct effects of anthropogenic climate change on every continent, in every ocean and in most major taxonomic groups (Parmesan 2006). Among the major taxonomic groups in which impacts of global warming have been most frequently documented are the insects. Terrestrial insects are sensitive indicators of changes to the condition of abiotic and biotic systems (McGeoch 1998).
    [Show full text]
  • Modelling the Population Fluctuation of Winter Moth and Mottled Umber Moth in Central and Northern Germany Anika Hittenbeck* , Ronald Bialozyt and Matthias Schmidt
    Hittenbeck et al. Forest Ecosystems (2019) 6:4 https://doi.org/10.1186/s40663-019-0162-6 RESEARCH Open Access Modelling the population fluctuation of winter moth and mottled umber moth in central and northern Germany Anika Hittenbeck* , Ronald Bialozyt and Matthias Schmidt Abstract Background: Winter moth (Operophtera brumata) and mottled umber moth (Erannis defoliaria) are forest Lepidoptera species characterized by periodic high abundance in a 7–11 year cycle. During outbreak years they cause severe defoliation in many forest stands in Europe. In order to better understand the spatio-temporal dynamics and elucidate possible influences of weather, stand and site conditions, a generalized additive mixed model was developed. The investigated data base was derived from glue band catch monitoring stands of both species in Central and North Germany. From the glue bands only female moth individuals are counted and a hazard code is calculated. The model can be employed to predict the exceedance of a warning threshold of this hazard code which indicates a potential severe defoliation of oak stands by winter moth and mottled umber in the coming spring. Results: The developed model accounts for specific temporal structured effects for three large ecoregions and random effects at stand level. During variable selection the negative model effect of pest control and the positive model effects of mean daily minimum temperature in adult stage and precipitation in early pupal stage were identified. Conclusion: The developed model can be used for short-term predictions of potential defoliation risk in Central and North Germany. These predictions are sensitive to weather conditions and the population dynamics.
    [Show full text]
  • CHECKLIST of WISCONSIN MOTHS (Superfamilies Mimallonoidea, Drepanoidea, Lasiocampoidea, Bombycoidea, Geometroidea, and Noctuoidea)
    WISCONSIN ENTOMOLOGICAL SOCIETY SPECIAL PUBLICATION No. 6 JUNE 2018 CHECKLIST OF WISCONSIN MOTHS (Superfamilies Mimallonoidea, Drepanoidea, Lasiocampoidea, Bombycoidea, Geometroidea, and Noctuoidea) Leslie A. Ferge,1 George J. Balogh2 and Kyle E. Johnson3 ABSTRACT A total of 1284 species representing the thirteen families comprising the present checklist have been documented in Wisconsin, including 293 species of Geometridae, 252 species of Erebidae and 584 species of Noctuidae. Distributions are summarized using the six major natural divisions of Wisconsin; adult flight periods and statuses within the state are also reported. Examples of Wisconsin’s diverse native habitat types in each of the natural divisions have been systematically inventoried, and species associated with specialized habitats such as peatland, prairie, barrens and dunes are listed. INTRODUCTION This list is an updated version of the Wisconsin moth checklist by Ferge & Balogh (2000). A considerable amount of new information from has been accumulated in the 18 years since that initial publication. Over sixty species have been added, bringing the total to 1284 in the thirteen families comprising this checklist. These families are estimated to comprise approximately one-half of the state’s total moth fauna. Historical records of Wisconsin moths are relatively meager. Checklists including Wisconsin moths were compiled by Hoy (1883), Rauterberg (1900), Fernekes (1906) and Muttkowski (1907). Hoy's list was restricted to Racine County, the others to Milwaukee County. Records from these publications are of historical interest, but unfortunately few verifiable voucher specimens exist. Unverifiable identifications and minimal label data associated with older museum specimens limit the usefulness of this information. Covell (1970) compiled records of 222 Geometridae species, based on his examination of specimens representing at least 30 counties.
    [Show full text]
  • Exposure of Noctuid and Geometrid Development Stages in Oak Forests
    Glavendekić & Mihajlović: Exposure of noctuid and geometrid development stages in oak forests EXPOSURE OF NOCTUID AND GEOMETRID DEVELOPMENT STAGES IN OAK FORESTS Milka M. Glavendekić, Ljubodrag S. Mihajlović Faculty of Forestry University of Belgrade, Kneza Višeslava 1, 11030 Belgrade, Serbia (e-mail: [email protected]) Abstract The research was carried out in the period 1985-2005 in oak forests in Serbia. During the research of winter moths in oak forests of Serbia we recorded 9 outbreaking winter moth species: Colotois pennaria L., Agriopis aurantiaria Hbn., Erannis defoliaria Cl., Alsophila aescularia D.& Sch., A. aceraria D.& Sch., Operophtera brumata L., Apocheima pilosaria D.& Sch., Agriopis leucophaearia D.& Sch., A. marginaria F. The most significant noctuids are Orthosia spp. There are 38 parasitoids of the winter moths recorded and they fall into the families Braconidae, Ichneumonidae, Eulophidae, Torymidae, Trichogrammatidae, Scelionidae and Tachinidae. Egg parasitoids were recorded at 3 localities: Brankovac, Mala Moštanica and wide area of National Park Djerdap. Hyperparasitoids of winter moths in Serbia have also been studied. We recorded altogether 12 species of winter moth hyperparasitoids. The method of exposure was applied in egg and larva stages. While total parasitism in the natural population varies between 12.50-28.57 %, in the exposed conditions there were between 27.31-43.75 % parasitized caterpillars were recorded. The method of host exposure could be suitable for the local increase of abundance of parasitoids of winter moth eggs, larvae and pupae. Keywords: Defoliators, oak, Geometridae, Noctuidae 1. Introduction In Serbia forests cover about 2,313,000 ha, or 26.2 % of the whole territory.
    [Show full text]
  • Second Generation Sequencing and Morphological Faecal Analysis
    Hope et al. Frontiers in Zoology 2014, 11:39 http://www.frontiersinzoology.com/content/11/1/39 RESEARCH Open Access Second generation sequencing and morphological faecal analysis reveal unexpected foraging behaviour by Myotis nattereri (Chiroptera, Vespertilionidae) in winter Paul R Hope1,2*†, Kristine Bohmann1,3†, M Thomas P Gilbert3, Marie Lisandra Zepeda-Mendoza3, Orly Razgour1 and Gareth Jones1 Abstract Background: Temperate winters produce extreme energetic challenges for small insectivorous mammals. Some bat species inhabiting locations with mild temperate winters forage during brief inter-torpor normothermic periods of activity. However, the winter diet of bats in mild temperate locations is studied infrequently. Although microscopic analyses of faeces have traditionally been used to characterise bat diet, recently the coupling of PCR with second generation sequencing has offered the potential to further advance our understanding of animal dietary composition and foraging behaviour by allowing identification of a much greater proportion of prey items often with increased taxonomic resolution. We used morphological analysis and Illumina-based second generation sequencing to study the winter diet of Natterer’sbat(Myotis nattereri) and compared the results obtained from these two approaches. For the first time, we demonstrate the applicability of the Illumina MiSeq platform as a data generation source for bat dietary analyses. Results: Faecal pellets collected from a hibernation site in southern England during two winters (December-March 2009–10 and 2010–11), indicated that M. nattereri forages throughout winter at least in a location with a mild winter climate. Through morphological analysis, arthropod fragments from seven taxonomic orders were identified. A high proportion of these was non-volant (67.9% of faecal pellets) and unexpectedly included many lepidopteran larvae.
    [Show full text]
  • Aerial Signatures of Forest Damage in Colorado and Adjoining States
    Aerial Signatures of Forest Damage in Colorado and Adjoining States William M. Ciesla, S. Sky Stephens, Brian E. Howell and Justin C. Backsen Aerial Signatures of Forest Damage in Colorado and Adjoining States William M. Ciesla, S. Sky Stephens, Brian E. Howell and Justin C. Backsen April 2015 For additional copies of this publication, contact: Colorado State Forest Service Colorado State University 5060 Campus Delivery Fort Collins, CO 80523 970.491.6303 i Authors William M. Ciesla is owner of Forest Health Management International (FHMI), Fort Collins, Colo., and has been involved with aerial forest health surveys since 1959. He has conducted these surveys under contract to the Colorado State Forest Service since 2004. S. Sky Stephens was forest entomologist with the Colorado State Forest Service from 2009-2013, and is presently forest entomologist with the USDA Forest Service, Forest Health Protection, Rocky Mountain Region, Lakewood, Colo. She conducts aerial survey missions in the Region. Brian E. Howell is aerial survey program manager for the USDA Forest Service, Forest Health Protection in the Rocky Mountain Region, and has been conducting aerial survey missions in the Region since 2004. Justin C. Backsen is a forestry technician with the USDA Forest Service, Forest Health Protection in the Rocky Mountain Region, and conducts aerial survey missions throughout the Region. Aerial Signatures of Forest Damage in Colorado and Adjoining States ii Preface “Aerial Signatures of Forest Damage in Colorado and Adjoining States” is a revision and update of the USDA Forest Service, Forest Health Technology Enterprise Team (FHTET), publication FHTET-01-06 “Aerial Signatures of Forest Insect and Disease Damage in the Western United States” (Ciesla 2006).
    [Show full text]
  • Oak Symposium: Sustaining Oak Forests in the 21St Century Through Science-Based Management
    IMPACTS OF OAK DECLINE, GYPSY MOTH, AND NATIVE SPRING DEFOLIATORS ON THE OAK RESOURCE IN VIRGINIA Christopher Asaro and Lori A. Chamberlin Abstract—The oak-hickory and oak-pine forest types dominate much of the southern landscape. In the Blue- Ridge and Appalachian Mountains of western Virginia, oak as a percentage of total forest volume can be as high as 60 percent. Much of this forest type is represented by older aged cohorts with little potential for oak regeneration to replace declining codominants. Oak decline is a prevalent natural phenomenon across the landscape, brought about by aging cohorts growing on poor sites, and exacerbated by inciting factors such as recurring drought and insect defoliation events. In Virginia, the gypsy moth (Lymantria dispar L.) has been the primary spring defoliator of oaks since the mid-1980s, although outbreak populations have been moderated since the mid-1990s by the gypsy moth fungus, Entomophaga maimaiga. In addition, several native defoliators have produced periodic outbreaks since the 1950s, particularly the fall cankerworm. The fall cankerworm (Alsophila pometaria) is the most common native defoliator of Virginia’s oaks, producing outbreaks somewhere in the State about every 5 years for the last 65 years or so. According to detailed historical records, these outbreaks seem to be getting worse in terms of acres impacted by defoliation. Other native defoliators have also had periodic outbreaks over this time period, albeit less frequently than the fall cankerworm. These include the forest tent caterpillar (Malacasoma disstria), variable oakleaf caterpillar (Lochmaeus manteo), linden looper (Erannis tiliaria), oak leaf tier (Croesia semipurpurana), and half-winged geometer (Phigalia titea).
    [Show full text]
  • Beginner S Guide to Moths of the Midwest Geometers
    0LGZHVW5HJLRQ86$ %HJLQQHU V*XLGHWR0RWKVRIWKH0LGZHVW*HRPHWHUV $QJHOOD0RRUHKRXVH ,OOLQRLV1DWXUH3UHVHUYH&RPPLVVLRQ Photos: Angella Moorehouse ([email protected]). Produced by: Angella Moorehouse with the assistance of Alicia Diaz, Field Museum. Identification assistance provided by: multiple sources (inaturalist.org; bugguide.net) )LHOG0XVHXP &&%<1&/LFHQVHGZRUNVDUHIUHHWRXVHVKDUHUHPL[ZLWKDWWULEXWLRQEXWFRPPHUFLDOXVHRIWKHRULJLQDOZRUN LVQRWSHUPLWWHG >ILHOGJXLGHVILHOGPXVHXPRUJ@>@YHUVLRQ $ERXWWKH%(*,11(5¶6027+62)7+(0,':(67*8,'(6 Most photos were taken in west-central and central Illinois; a fewDUH from eastern Iowa and north-central Wisconsin. Nearly all were posted to identification websites: BugGuide.netDQG iNaturalist.org. Identification help was provided by Aaron Hunt, Steve Nanz, John and Jane Balaban, Chris Grinter, Frank Hitchell, Jason Dombroskie, William H. Taft, Jim Wiker,DQGTerry Harrison as well as others contributing to the websites. Attempts were made to obtain expert verifications for all photos to the field identification level, however, there will be errors. Please contact the author with all corrections Additional assistance was provided by longtime Lepidoptera survey partner, Susan Hargrove. The intention of these guides is to provide the means to compare photographs of living specimens of related moths from the Midwest to aid the citizen scientists with identification in the field for Bio Blitz, Moth-ers Day, and other night lighting events. A taxonomic list to all the species featured is provided at the end along with some field identification tips. :(%6,7(63529,',1*,'(17,),&$7,21,1)250$7,21 BugGuide.net LNaturalist.org Mothphotographersgroup.msstate.edu Insectsofiowa.org centralillinoisinsects.org/weblog/resources/ :+,&+027+*8,'(7286( The moths were split into 6 groups for the purposes of creating smaller guides focusing on similar features of 1 or more superfamilies.
    [Show full text]
  • Bat Aggregational Response to Pest Caterpillar Emergence Ján Blažek*, Adam Konečný & Tomáš Bartonička
    www.nature.com/scientificreports OPEN Bat aggregational response to pest caterpillar emergence Ján Blažek*, Adam Konečný & Tomáš Bartonička Moths (Lepidoptera) are major agricultural and forest pests in many parts of the world, including Europe, with many causing great economic damage to crops, horticultural plants, stored items, and wool products. Here, we focus on two ecologically similar inchworms, Operophtera brumata and Erannis defoliaria, known for their high foliage consumption during the spring emergence of caterpillars. We hypothesise that bats could play a role in reducing pests such as caterpillars by switching to this abundant emerging prey. At two infested and one control forest sites, caterpillars were sampled during spring to determine levels of infestation. At the same time, bat fight activity was monitored during the peak in caterpillar abundance. During the spring caterpillar outbreak, we collected faecal samples of forest-dwelling bats capable of using gleaning. The majority of samples were positive for our focus species, being 51.85% for O. brumata and 29.63% for E. defoliaria faecal samples. The foraging activity of two gleaning bats, Myotis nattereri and Myotis bechsteinii, increased at both infested sites, but not at the control site, during caterpillar emergence, as did foraging of Plecotus auritus/austriacus, which used both gleaning and aerial hawking. We conclude that both specialists and occasional gleaners, which prefer diferent prey but are able to switch their foraging strategies, aggregate at sites during pest emergence and, as such, our results confrm the high potential of bats to reduce numbers of pest species such as caterpillars. A predator’s efect on prey populations is generally studied using numerical responses 1,2 driven by two mecha- nisms, migration of predators to sites with high prey concentrations (aggregational response) and predator reproduction, which results in a delayed increase in the density of predators3.
    [Show full text]