First Report of Erannis Defoliaria on Quercus Sp. in North West of Tunisia

First Report of Erannis Defoliaria on Quercus Sp. in North West of Tunisia

Short Communication First Report of Erannis defoliaria on Quercus sp. in North West of Tunisia Yaussra Mannai and Olfa Ezzine, Laboratoire de Gestion et de Valorisation des Ressources Forestières, INRGREF, Université de Carthage, Avenue Hédi Karray, PB 10, 2080 Ariana, Tunisia, Saïd Nouira, Faculté des Sciences de Tunis, Université Tunis El-Manar, Campus Universitaire, 1002 El-Manar II, Tunisia, and Mohamed Lahbib Ben Jamâa, Laboratoire de Gestion et de Valorisation des Ressources Forestières, INRGREF, Université de Carthage, Avenue Hédi Karray, PB 10, 2080, Ariana, Tunisia ABSTRACT Mannai, Y., Ezzine, O., Nouira, S., and Ben Jamâa, M.L. 2015. First report of Erannis defoliaria on Quercus sp. in North West of Tunisia. Tunisian Journal of Plant Protection 10: 75-78. Erannis defoliaria, a spring-feeding moth, caused severe defoliation during springs 2009 and 2010. Larvae were collected from Quercus suber in northwestern forest of Tunisia: Bellif and Ain El Baya. Caterpillars of E. defoliaria were also observed feeding on Q. canariensis, Q. afares and other shrub species such as Pistacia lentiscus, Erica arborea, and E. multiflora. In this paper, we present a first report of this pest in Tunisia. Keywords: Erannis defoliaria, North West of Tunisia, Quercus sp. __________________________________________________________________________ At the beginning of April 2009, suber, from Mzara on Q. canariensis, and severe defoliation of cork oak was from Ain zena on Q. afares was observed in two forests in the North West performed to identify the species. PCR of Tunisia. About 30 ha forest areas were amplification and DNA sequencing were defoliated in Ain El Baya (36°65’N; conducted at the CCDB (Canadian Centre L8°65’E) (Fig. 1) and 23 ha in Bellif for DNA Barcoding, Guelph, Canada) (37°18’N; L9°19’W). Larva of the following standard high-throughput mottled umber moth emerges from April protocols (4) that can be accessed under to May (Fig. 2). DNA analysis of 18 the website (8). PCR amplification with a individuals of Erannis collected from single pair of primers consistently Bellif, Ain El Baya, and El Jouza on Q. recovered a 658 bp region near the 5’ terminus of the mitochondrial Cytochrome c Oxidase I (COI) gene that Corresponding author: Yaussra Mannai included the standard 658 bp barcode Email: [email protected] region for the animal kingdom (3). DNA extracts are stored at the CCDB, with aliquots being deposited in the DNA- Accepted for publication 12 June 2015 Bank facility of the ZSM (9). All sequences are deposited also in GenBank Tunisian Journal of Plant Protection 75 Vol. 10, No. 1, 2015 according to the iBOL (international oak (Q. ilex, Q. robur, Q. petraea, Q. BARCODE OF LIFE) data release lusitanica, and Q. pyrenaica), maple policy. This work is the first record of E. (Acer campestre), blueberry (Vaccinium defoliaria in Tunisia and in North Africa. myrtülus), beech (Fagus sylvatica), hazal E. defoliariais a Lepidoptera that (Corylus avellana), poplar (Populus sp.), belongs to the family of Geometridae, pear, and apple (7). In Tunisia, larvae subfamily of Ennominae (= Boarmiinae), were also observed on Pistacia lentiscus, tribe of Bistonini. Erannis is synonymous Erica arborea and E. multiflora. with Lampetia, Hybernia, and Agriopis E. defoliaria has one generation a (7). year. Adults are active in autumn E. defoliaria was reported to be an (October). After mating, females, which important pest in Northern and Middle are wingless, crawl up the host trees and Europe (7). It is widespread in most of deposit eggs, either singly or in small Europe and Asia such as British Isles, groups in bark crevices, under moss or in North Norway, Sweden, Finland, East of other sheltered places. Females oviposit Russia, Republic of Georgia, Italy, individually or in small groups around the Yugoslavia, Germany, Poland, Spain, buds (5). They can lay 300-400 eggs. Austria, Hungary, and Romania (1, 6). It Eggs are the overwintering stage. The was introduced into North America on the larvae hatch in the spring and feed openly Pacific side many years ago (2). on buds and leaves of host trees. Later, Eighteen barcode sequences were they bind leaves together with silken obtained and were equal to 658 bp. webbing. When the larvae are not actively Nucleotide sequence consists of A (202), feeding, they remain inside this shelter. G (99), C (100) and T (257) as shown in Pupation occurs in the soil (2, 6). Fig. 3 (GWOSP397-11: At present, damage caused by E. http://www.boldsystems.org/index.php/M defoliaria seems to be low because it is AS_Management_RecordList). Compa- limited by the competition of other red to the existing specimens in BOLD Lepidoptera and restricted to Quercus sp. system, 97.86 to 100% of similarity was However, further investigation must be found with 67 specimens. done to detect E. defoliaria in other Larvae of E. defoliaria are regions and other host species. polyphagous. They have many hosts like Fig. 1. Defoliated Quercus suber in Ain El Baya, April 2009. Tunisian Journal of Plant Protection 76 Vol. 10, No. 1, 2015 Fig. 2. Larva of Erranis defoliaria on shrub of Quercus suber forest in Ain El Baya (2009). Fig. 3. Pupa of Erannis defoliaria AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACTTCTTTAAGTTTATT AATTCGAGCAGAATTAGGAAATCCTGGATCTCTAATTGGAGATGATCAAATTTATAACAC TATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGG AGGTTTTGGAAATTGATTAGTACCTTTAATACTGGGTGCCCCTGATATAGCTTTCCCACG AATAAATAATATAAGATTTTGATTATTACCCCCATCTATTACTCTTTTAATTTCAAGAAG AATTGTAGAAAATGGGGCAGGAACTGGTTGAACGGTTTACCCGCCTTTATCCTCTAATAT TGCTCATGGAGGAAGCTCAGTAGATTTAGCTATTTTTTCACTACATTTAGCTGGTATTTC TTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTT ATCATTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTCTTACTATT ATTATCTTTACCAGTTTTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAA TACATCATTTTTCGACCCCGCAGGAGGGGGAGACCCAATTCTTTATCAACACTTATTT Fig. 4. Nucleotide Sequence of Erannis defoliaria Tunisian Journal of Plant Protection 77 Vol. 10, No. 1, 2015 __________________________________________________________________________ RESUME Mannai Y., Ezzine O., Nouira S. et Ben Jamâa M.L. 2015. Premier rapport sur Erannis defoliaria sur Quercus sp. au nord-ouest de la Tunisie. Tunisian Journal of Plant Protection 10: 75-78. Erannis defoliaria a provoqué une défoliation importante au cours des printemps 2009 et 2010. Les larves ont été récoltées sur Quercus suber des forêts de Bellif et Ain El-Baya situées au nord-ouest de la Tunisie. Les chenilles de E. defoliaria ont été également observées se nourrissant sur Q. canariensis, Q. afares et d'autres espèces d'arbustes telles que Pistacia lentiscus, Erica arborea et E. multiflora. Dans cet article, nous présentons le premier rapport sur ce ravageur en Tunisie. Mots clés: Erannis defoliaria, nord-ouest de la Tunisie, Quercus sp. __________________________________________________________________________ ملخص مناعي، يسرى وألفة الزين وسعيد نويرة ومحمد لحبيب بن جامع. 2015. أول تقرير حول Erannis defoliaria على أشجار السنديان في شمال غرب تونس. Tunisian Journal of Plant Protection 10: 75-78. تتغذى يرقات فراشة Erannis defoliation في الربيع وقد تسببت في تآكل شديد لﻷشجار خﻻل ربيع عام 2009 و2010. تم جمع اليرقات من السنديان الفليني في غابات عين البي ّة وبليف بشمال غرب تونس، كما شوھدت اليرقات وھي تتغذى أيضا على سنديان الزان وسنديان اﻷفراس وأنواع أخرى من الشجيرات مثل Erica arborea و Erica multiflora و Pistacia lentiscus . في ھذه المقالة، نقدم أول تقرير حول ھذه اﻵفة في تونس. كلمات مفتاحية: شمال غرب تونس، .Erannis defoliaria ،Quercus sp __________________________________________________________________________ LITERATURE CITED 1. Ciornei, C. and Mihalache, G.1998. Integrated friendly protocol for recovering high-quality control of species of Geometridae in oak forests DNA. Mol. Ecol. Notes 6: 998-1002. of Romania. Pages 222-229. In: Proceedings of 5. Glavendekic, M. 2010. Parasitoids and Population Dynamics, Impacts, and Integrated hyperparasitoids of Erannis defoliaria Cl. Management of Forest Defoliating Insects. (Lepidoptera, Geometridae) in oak forests. USDA Forest Service General Technical, Šumarskilist br. 7-8, CXXXIV, 403-410. Report NE-247, Romania. 6. Luciano, P. and Roversi, P.F. 2001. Erannis 2. Food and Agriculture Organization of the United defoliaria (Clerk) (Lepidoptera Geometridae). Nations (FAO). 2007. Forest Health & Pages 66-67 in Fillofagi delle Querce in Italia, Biosecurity. Working Papers: Overview of Italy, 161 pp. forest pests, Republic of Moldova. Rome, Italy, 7. Soria, S. and Toimil, F.J. 1983. Fuerte ataque de 16 pp. Erannis defoliaria Clerck (Lep. Geometridae) 3. Hebert, P.D.N., Ratnasingham, S., and De Waard, en los Montes de Toledo y ensayos de lucha J.R. 2003. Barcoding animal life: cytochrome c quimica para su combate. Bol. Sev. Plagas. 9: oxidase subunit 1 divergences among closely 61-75. related species. Proc. R. Soc. Lond. B. 270, 8. http://www.dnabarcoding.ca/pa/ge/research/proto Supplement 1: S96-S99. cols 4. Ivanova, N.V., De Waard, J.R., and Hebert, 9. http://www.zsm.mwn.de/dnabank/ P.D.N. 2006. An inexpensive, automation- -------------------------- Tunisian Journal of Plant Protection 78 Vol. 10, No. 1, 2015 .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us