Publications

Home , Amboasary Gara, Blaesodactylus sakalava, Brookesia ebenaui, Brown mantella, Golden mantella, Ithycyphus miniatus

DEPARTEMENT DE BIOLOGIE ANIMALE

Latimeria chalumnae

PUBLICATIONS

BORA PARFAIT

A new species of Mantidactylus (subgenus Chonomantis) from Ranomafana National Park, eastern Madagascar (Amphibia, Anura, Mantellidae)

PARFAIT BORA1* , OLGA RAMILIJAONA 1#, NOROMALALA RAMINOSOA1 & MIGUEL VENCES2 1 Université d’Antananarivo, Département de Biologie Animale, Antananarivo 101, Madagascar 2 Division of Evolutionary Biology, Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106 Braunschweig, Germany * Corresponding author: e-mail: [email protected] # deceased 6 January 2010

Abstract

We describe a new frog species of Mantidactylus belonging to the subgenus Chonomantis from Ranomafana National Park, in the Southern Central East region of Madagascar, at mid-elevations (about 950 m above sea level). Specimens of Mantidactylus paidroa sp. nov. were observed during the day in cavities under large rocks next to a stream in rainforest. Their advertisement calls are unique in Chonomantis and consist of a long series of note pairs. The new species shows a high divergence to other Chonomantis species in DNA sequences of the mitochondrial 16S rRNA gene (5.6–10.8%). Man- tidactylus paidroa is so far only known from several streams in Ranomafana National Park but may have been overlooked at other rainforest sites in eastern Madagascar. We propose an IUCN threat status of Data Deficient for this new species.

Key words: Amphibia, Anura, Mantellidae, Mantidactylus paidroa sp. nov., Madagascar

Introduction

Frog species in the family Mantellidae form a highly diversified group that is endemic to Madagascar and the Comoro island of Mayotte (Blommers-Schlösser & Blanc 1991, Glaw & Vences 2003). Within this family, the genus Mantidactylus is one of the most species-rich groups and is further subdivided into various subgenera. One of these, the subgenus Chonomantis, has mainly been defined by tadpole morphology since the larvae of all Chono- mantis species have characteristically derived funnel-shaped mouthparts. Adults of Chonomantis are relatively small, mainly ground-dwelling frogs most of which have a characteristically sharp dorsolateral border between the dark brown lateral and lighter brown dorsal colouration (Vences & Glaw 2004). Many species are furthermore characterized by a frenal stripe, that is, a white stripe running under the eye along the upper lip. Ventrally individuals are usually dark coloured, sometimes with a pattern of white spots or a median white line, especially on the throat. Like all Mantidactylus, males have femoral glands with a medial depression, and the size and distinctness of these appear to be species-specific. Species of Chonomantis are generally diurnal but also show crepuscular and nocturnal activity, and are mostly found in rainforest habitats close to streams. Males are smaller than females and in most species they have a distinctly larger tympanum. At present, the subgenus is composed of eight species: Mantidactylus aerumnalis, M. albofrenatus, M. brevipalmatus, M. charlotteae, M. delormei, M. melanopleura, M. opiparis and M. zipperi (Vences & Glaw 2004, Glaw & Vences 2006, 2007). In this paper we describe a new species of Chonomantis that we discovered during a recent field survey in Ranomafana National Park, in mid-elevation rainforest, in the Southern Central East of Madagascar.

Materials and methods

The new species was first discovered by its typical advertisement calls during a general amphibian survey along a transect at a site locally named Ankerana, within Ranomafana National Park. Calls were recorded with the internal

52 Accepted by J. Padial: 4 Dec. 2010; published: 23 Feb. 2011 microphone of an Edirol R09 digital recorder at a distance of approximately two meters, and photographs were taken at the collecting site. Collected specimens were fixed in 95% ethanol and preserved in 70% ethanol. Tissue samples were taken from each specimen a few months after collection from the femoral muscles and/or the tongue, and preserved in 99% ethanol. Specimens were numbered using field numbers of the Zoological Collection of Miguel Vences (ZCMV) and are stored in the Zoologische Staatssammlung München, Germany (ZSM). Morpho- metric measurements were taken by the first author using a digital caliper (TCM 234 990) to the nearest 0.1 mm: Snout-vent length (SVL); maximum head width (HW); head length; (HL); horizontal tympanum diameter (TD); horizontal eye diameter (ED); distance between anterior edge of eye and nostril (END); distance between nostril and tip of snout (NSD); distance between both nostrils (NND); forelimb length, from limb insertion to tip of longest finger (FORL); hand length, to the tip of the longest finger (HAL); hindlimb length from the cloaca to the tip of the longest toe (HIL); tibia length (TIL); foot length including tarsus (FOTL); foot length (FOL). Webbing formula is given according to Blommers-Schlösser (1979). Call recordings were analyzed using the software Cool Edit Pro 2.0 on a personal computer with Windows XP Professional operating system. Temporal parameters of the calls are reported in milliseconds (ms) as mean ± standard deviation, followed by minimum-maximum values. Environmental or body temperature during call emission were not recorded. From each tissue sample, DNA was extracted and a fragment of the mitochondrial 16S rRNA gene was amplified and resolved on automated sequencers following standard methods (e.g., Vences et al. 2003). Sequences newly obtained for this paper were deposited in Genbank under accession numbers GQ845005–GQ845007. Additional sequences of tadpoles of the new species described herein (from Grosjean et al. in press) have the accession numbers GU808450-GU808467. For comparing genetic distances among closely related species, we used DNA sequences of the mitochondrial 16S rRNA gene produced by Vieites et al. (2009). These previously obtained sequences had the numbers: Mantidactylus aerumnalis, AY848125; M. albofrenatus, AY848267; M. charlotteae, FJ559236; M. delormei, AY848148; M. melanopleura, FJ559239, AY848193, and AY848195; M. opiparis, FJ559240; M. zipperi, FJ559283. For analysis, sequences were aligned using the Clustal algorithm in MEGA (Kumar et al. 2004) and the alignment subsequenctly adjusted manually.

Description of a new species

Mantidactylus paidroa sp. nov. (Fig. 1a–c)

Remarks. This species has been referred to as Mantidactylus sp. 59 by Vieites et al. (2009) and Grosjean et al. (in press). Holotype. ZSM 1777/2008 (field number ZCMV 7108), adult male (Fig. 1), collected by P. Bora, J. Solo and D. Razafindraibe on 24 January 2008 at a site locally named Ankerana, in Ranomafana National Park, Southern Central East of Madagascar (21°15.582’S, 47°25.320’E), approximately 963 m above sea level. Paratypes. ZSM 1778/2008 (field number ZCMV 7109, male) and ZSM 1776/2008 (ZCMV 7107, female), same collecting data as holotype. Diagnosis. Assigned to the genus Mantidactylus based on the presence of an intercalary element between terminal and subterminal phalanges of fingers and toes (verified by external observation), and of a central depression in femoral glands and presence of a rudimentary femoral gland in the female. Within Mantidactylus, assigned to the subgenus Chonomantis based on: (a) a specialized funnel-mouth tadpole, (b) a sharp dorsolateral colour border between dorsal and lateral coloration, (c) presence of a frenal stripe, (d) diurnal calling activity close to streams, (e) intersexual difference in tympanum size, (f) relatively small size (male SVL 22 mm). Mantidactylus paidroa sp. nov is distinguished from all other species in the subgenus Chonomantis by presence of serial double notes in advertisement calls (vs. single notes) and a substantial genetic differentiation (see below). In addition, it is distinguished from Mantidactylus aerumnalis, M. brevipalmatus, M. charlotteae, and M. delormei by a bigger ratio of tympanum/eye diameter in males (1.4–1.5 vs. 0.7–1.3); from M. aerumnalis, M. charlotteae, M. opiparis, M. melanopleura, and M. zipperi by a lower amount of webbing on fifth toe (2 vs. 0.75–1.5 phalanges free of web); from M. brevipalmatus and M. delormei by smaller body size (male SVL 22 vs. 28–35

NEW MANTIDACTYLUS FROM RANOMAFANA NATIONAL PARK Zootaxa 2772 © 2011 Magnolia Press · 53 mm) and by shorter hindlimbs (tibiotarsal articulation reaching anterior eye corner vs. reaching beyond snout tip); from M. opiparis, M. melanopleura and M. charlotteae by presence of distinct and rather large femoral glands in males (vs. small glands), from Mantidactylus aerumnalis by presence of a frenal stripe between forelimb and eye (vs. absence); from M. aerumnalis, M. opiparis, and M. zipperi by a well-delimited narrow extension of the frenal

FIGURE 1. (a), (b) and (c), Photographs of male holotype of Mantidactylus paidroa (ZSM 1777/2008) in life (SVL 22.3 mm), in dorsolateral and ventral views.

54 · Zootaxa 2772 © 2011 Magnolia Press BORA ET AL. stripe (bending upwards) between eye and nostril (vs. absence), and from M. aerumnalis, M. melanopleura and M. opiparis by having the third toe longer than the fifth (vs. fifth toe longer than third). Mantidactylus paidroa is morphologically most similar to M. albofrenatus from which it can be mainly distinguished by the throat colouration, which has a continuous median white line (vs. a row of spots in M. albofrenatus). Tadpoles of M. paidroa differ from those of all other Chonomantis by the presence of very few keratodonts on the upper labium of the oral disk (vs. complete absence; see Grosjean et al. in press). Table 1 includes a comparison of diagnostic characters in Chonomantis species.

TABLE 1. Morphometric ratios and distinctive morphological and bioacoustic characters in Mantidactylus paidroa sp. nov. compared with other species of Chonomantis, based on data published by Vences & Glaw (2004). Abbreviations used: SVL, snout-vent length; TD, tympanum diameter; ED, eye diameter; FOL, foot length; HAL, hand length; RHL, relative hindlimb length; TT, tibiotarsal articulation. Measurement values are mean ± standard deviation, followed by minimum–maximum values in parentheses. Data for M. delormei are based on the female holotype and photos of additional specimens in Glaw & Vences (2007) for colour in life.

M. paidroa M. M. M. M. M. M. M. M. sp. nov. aerumnalis albofrenatus brevipalmatus charlotteae delormei melanopleura opiparis zipperi SVL males 22.0–22.3 22.8–26.6 19.3–23.0 27.6–35.3 22.4–26.2 -- 29.9–39.5 23.8–26.1 21.5–23.4 (mm) SVL 27.0 28.3–31.0 25.3–27.1 34.8–44.9 26.3–32.2 38.9 32.3–40.5 27.0–33.2 29.5 females (mm) TD/ED 1.45 0.77 ± 0.08 1.27 ± 0.10 1.17 ± 0.08 0.92 ± 0.13 -- 1.24 ± 0.16 1.34 ± 0.14 1.24 ± 0.16 ratio males (1.4–1.5) (0.67–0.87) (1.10–1.38) (1.05–1.31) (0.70–1.13) (0.93–1.47) (1.20–1.50) (1.03–1.44) TD/ED 1.04 0.68 ± 0.05 0.73–0.74 0.82 ± 0.07 0.75 ± 0.08 0.66 0.80 ± 0.03 0.81 ± 0.09 0.79 ratio (0.61–0.74) (0.70–091) (0.62–0.84) (0.76–0.85) (0.62–0.91) females FOL/SVL 0.48 0.56 ± 0.03 0.51 ± 0.05 0.66 ± 0.04 0.49 ± 0.03 0.64 0.54 ± 0.06 0.54 ± 0.04 0.52 ± 0.03 ratio (0.46–0.49) (0.51–0.60) (0.46–0.63) (0.60–0.71) (0.45–0.56) (0.51–0.80) (0.49–0.62) (0.47–0.55) HAL/SVL 0.28 0.29 ± 0.01 0.29 ± 0.02 0.30 ± 0.02 0.29 ± 0.01 0.30 0.27 ± 0.01 0.29 ± 0.02 0.30 ± 0.02 ratio (0.26–0.29) (0.27–0.32) (0.27–0.31) (0.27–0.32) (0.27–0.33) (0.25–0.31) (0.25–0.32) (0.27–0.33) RHL of TT reaches TT reaches TT reaches TT reaches TT reaches -- TT reaches TT reaches TT does not most at most snout tip or at most beyond at most beyond snout snout tip or reach snout tip specimens nostril beyond nostril snout tip nostril tip beyond Webbing of 2 0.75–1 1.5–2 2 1.25 -- 1 1 1.5 toe 5 Femoral large, large, large, large, very small to -- small, i small, large, not very glands in prominent prominent prominent prominent large, not ndistinct indistinct prominent males very prominent Frenal present absent present present present present present present present stripe between forelimb and eye Frenal present, absent present, present, usually stops slightly present, fades ante- fades anterior stripe reaches reaches reaches close anterior to fading reaches nostril rior to eye to eye between close to nostril or to nostril the eye anterior or close to it eye and nostril close to it to eye nostril Throat black or black with a grey with light with black, with light black or dark black or light grey– coloration dark brown, distinct large white indistinct, small white brown, with a dark yellowish, with with a white stripe spots weak darker spots which median line or brown, a rather broad median line which is forming a marbling form a row of spots with a light median and spots continued median row median row, median line stripe which onto the ven- sometimes or row of begins as dis- ter fusing to a spots tinct white spot median close to the lip stripe ...... continued

NEW MANTIDACTYLUS FROM RANOMAFANA NATIONAL PARK Zootaxa 2772 © 2011 Magnolia Press · 55 TABLE 1 (continued) M. paidroa M. M. M. M. M. M. M. M. sp. nov. aerumnalis albofrenatus brevipalmatus charlotteae delormei melanopleura opiparis zipperi Duration of 8–14 unknown 56–80 9–21 91–304 unknown 19–54 69–126 21–31 single notes in advertisement calls (ms) Duration of 12–16 unknown absent absent absent unknown absent absent absent double notes in advertisement calls (ms) Relative toe 5<3 5=3 5<3 5>3 5<3 5>3 5>3 5>3 5<3 length

Etymology. The specific name—paidroa—refers to the typical advertisement call of the species, and derives from Malagasy words paika (meaning notes) and roa (double or two) (according to Malagasy grammar, the ending —ka is replaced by —d in the composite word). The name is used as an invariable noun in apposition. Description of the holotype. SVL 22.3 mm. Body relatively slender; head longer than wide, of same width as body; snout rounded in dorsal view, slightly pointed in lateral view; nostrils directed laterally, slightly protuberant, nearer to tip of snout than to eye; canthus rostralis rather indistinct, straight; loreal region concave; tympanum distinct, oval, wider horizontally than vertically, its horizontal diameter 143% of eye diameter; supratympanic fold indistinct; tongue absent, taken for tissue sampling; vomerine teeth distinct, one rounded aggregation on each side of buccal roof, positioned posteromedian to choana; choanae small, rounded. Arms slender, subarticular tubercles distinct, single; inner metacarpal tubercle distinct and ovoid, outer metacarpal tubercle dinstinct but smaller and rounded; fingers without webbing; comparative finger length 1<2<4<3, second finger distinctly shorter than fourth finger; finger disks slightly enlarged; nuptial pads absent. Hindlimbs slender; tibiotarsal articulation reaches the anterior eye corner; lateral metatarsalia not connected; comparative toe length 1<2<5<3<4; third toe slightly longer than fifth toe; inner metatarsal tubercle distinct, outer metatarsal tubercle not recognizable; webbing between toes weakly expressed, formula 1 (1), 2i (>>1), 2e (1), 3i (2.25), 3e (2), 4i (3.5), 4e (3.25), 5 (2). Exact extension of web on 2i cannot be determined more in detail because only one subarticular tubercle is recognizable. Dorsal skin smooth; dorsum with distinct dorsolateral folds; ventral skin smooth, slightly granular in the cloacal region; no distinct tubercles in the cloacal region. Femoral glands large and distinct (length 5.0, width 3.5 mm, distance between internal borders of glands on opposite thighs 0.7 mm (almost in contact in the cloacal region), of type 3 with central depression as defined by Glaw et al. (2000). Colour of the holotype. Colour in life (Fig. 1a–c) is dorsally light brown with irregular black blotches, with a conspicuous dorsolateral bold black border that separates the dorsum from the dark brown flanks, which have a few irregular bronze and white spots. From the insertion of forelimbs there is a white frenal stripe running under the tympanum and the eye, bending upward anterior to the eye and reaching the nostril. In the area between upper lip and nostril there are small bronze to light brown flecks. The iris is light brown in its upper and lower parts, with reddish brown colour in its anterior and posterior parts. The hindlimbs are light brown with dark brown transversal stripes. The ventral side is dark brown on the throat and greyish on the venter, with rounded white spots and a dis- continuous median narrow white stripe running from the snout tip to the venter. The limbs are ventrally blackish with dark grey blotches. After two years in preservative, the colour tones are much less contrasted and especially the white and bronze elements have partly faded to dirty grey. Variation. The male paratype is morphologically similar to the holotype. The female paratype, in contrast, in preservative has a much lighter dorsal and ventral colouration with only indistinct white ventral spots and an indistinct white midventral line. The female has rudimentary femoral glands. Measurements. All given in mm. The first value refers to the holotype, the second and third values (in parentheses, male and female) to the paratypes. SVL 22.3 (22.0; 27.0), HW 7.3 (7.4; 8.0), HL 9.5 (9.0; 10.0), TD 3.3 (3.3; 2.4), ED 2.3 (2.2; 2.3), END 2.4 (2.2; 2.4), NSD 1.7 (1.7; 1.8), NND 3.0 (3.3; 3.3), FORL 14.3 (13.3; 16.0), HAL 6.2 (6.3; 7.0), HIL 35.0 (36.0; 41.5), FOTL 15.5 (16.0; 18.3), FOL 10.7 (10.8; 12.5), TIL 11.1 (11.1; 13.0).

56 · Zootaxa 2772 © 2011 Magnolia Press BORA ET AL. FIGURE 2. Sonagrams and oscillograms of parts of a series of double notes, recorded from the holotype of Mantidactylus paidroa on 24 January 2008; (a) fragment of the call with 8 double notes; (b) enlarged view of two double notes.

NEW MANTIDACTYLUS FROM RANOMAFANA NATIONAL PARK Zootaxa 2772 © 2011 Magnolia Press · 57 Natural History. Calls of Mantidactylus paidroa were heard only at the type locality, Ankerana, in Ranoma- fana National Park, which is also the only locality where adults were collected. Other syntopic anurans at this site included two Chonomantis species (Mantidactylus opiparis, M. melanopleura) as well as Mantidactylus biporus, Gephyromantis asper, G. tschenki, and Stumpffia sp. The type locality is characterized by the presence of various rocks of different size along a small, slow-running stream in rainforest. Specimens were found in humid sites under big rocks. Calls were emitted by the holotype during the day, on 24 January 2008 between 13:30–15:30. The two paratypes were collected close to the holotype. The female was found next to a rock under which the second male was calling, at about 5 m distance from the collecting site of the holotype. The tadpole of M. paidroa is described in detail in Grosjean et al. (in press). It is of the funnel-mouthed type typical for Chonomantis, but as a character state unique in the subgenus, it has rudimentary labial teeth (keratodonts). Advertisement calls. The call of Mantidactylus paidroa consists of a series of pulsatile note pairs (Fig. 2). One completely recorded series had a duration of 47 seconds. At the beginning of the series, five single notes were emitted, followed by 33 note pairs, with a single note emitted in one case in-between two note pairs. Call frequency ranged from 1500–5900 Hz. Temporal call parameters are as follows: note length of single notes 8–14 ms (10.6±10.6 ms; n= 5); note length of first note in note pairs 12–14 ms (12.6±0.8 ms; n=11); note length of second note in note pairs 12–16 ms (13.4±1.1 ms; n=11); interval between single notes 908–1915 ms (1218.5±468.2 ms; n=4); interval between notes in note pairs 100–135 ms (116±8.6 ms; n=11); interval between note pairs 479–1471 ms (980.7±368.7 ms; n=11). For comparison of some call characters with other species in the subgenus see Table 1. Genetic divergence. In the alignment of 458 nucleotides of the 16S rRNA gene (after deleting portions at the beginning and the end of the DNA fragment that were missing in some taxa), the male paratype of Mantidactylus paidroa differed by a single substitution from the holotype and female paratype, which had identical sequences. The new species was strongly differentiated from all other species of Chonomantis (sequences as reported by Vie- ites et al. 2009). We found 24–46 substitutions in pairwise comparisons to all other species, corresponding to 5.6– 10.8% uncorrected pairwise sequence divergence (p-distances). The lowest distances (24–25 substitutions; 5.6– 5.8% divergence) were found to Mantidactylus brevipalmatus. For a preliminary phylogenetic analysis of the 16S sequences that however could not satisfyingly resolve relationships among species of Chonomantis, see supple- mentary information of Vieites et al. (2009) where the species is included as Mantidactylus sp. 59.

Discussion

In general, diversity of Malagasy frogs is concentrated along the eastern rainforest band of the island. The highest species richness is in the latitudinal center of this band (Lees et al. 1999). However, localities in the Southern Cen- tral East and to a lesser degree in the South East, also have a high species diversity, with 116 species of amphibians currently known from Ranomafana National Park and its surroundings (Vieites et al. 2009), at least 57 species known from Andringitra National Park (Raxworthy & Nussbaum 1996), 30 species from Befotaka-Midongy National Park (Bora et al. 2007) and 45 species from Andohahela National Park (Nussbaum et al. 1999). The new species described here highlights the existence of undescribed diversity and possible local endemics in this part of Madagascar’s rainforests. Field identification of species in the subgenus Chonomantis is mostly based on subtle morphological characters. Nonetheless, some qualitative characters or combination of them, as general body shape, presence of a sharp dorsolateral colour border, presence and shape of femoral glands, and frenal stripe, are especially useful to distinguish species belonging to this subgenus. At first glance a confusion is however possible with some species of Blommersia, Gephyromantis, and especially Mantella which can present a superficially similar colour pattern (Glaw & Vences 2007). At the present state of knowledge, however, an upward curved frenal stripe as found in several Chonomantis, including Mantidactylus paidroa, is a unique and diagnostic character state for this subgenus. Ankerana in Ranomafana National Park is to our knowledge the only site where adults of this new species have been collected. In fact, a recent tadpole survey in over 30 streams in this reserve (see Grosjean et al. in press) has led to the discovery of M. paidroa tadpoles in several additional streams (at sites locally named Ambatolahy, Ambodiamontana, Bibiango, Fomponina and Vatoharanana; see Fig. 3). This indicates that M. paidroa is a secretive species of which adults are difficult to observe. It therefore cannot be excluded that this species also occurs

58 · Zootaxa 2772 © 2011 Magnolia Press BORA ET AL. outside Ranomafana National Park and that it has a much wider distribution. Given the general need for a taxonomic revision of species superficially similar to M. charlotteae, M. albofrenatus, and M. paidroa, which include multiple undescribed candidate species (see Vieites et al. 2009) we consider the IUCN conservation status of Man- tidactylus paidroa as Data Deficient.

FIGURE 3. Map of known distribution records of Mantidactylus paidroa in Ranomafana National Park.

We are grateful to Justin Solo and Dominique Razafindraibe who accompanied us in the field, to all the technicians in the laboratory in Braunschweig for the help with DNA sequencing, and to Frank Glaw for comments and discussion. The Ranomafana staff of Madagascar National Parks (MNP), and of the Centre Valbio biological station provided important logistic assistance. This work was carried out in the framework of cooperation accords between the Technical University of Braunschweig and the Département de Biologie Animale, Université d’Antananarivo. Per- mits for collection and export of specimens were kindly issued by the Ministère de l’Environnement et des Forêts de Madagascar. Stephane Grosjean, Roger-Daniel Randrianiaina and Axel Strauß kindly shared information about the tadpole of this new species. This work was supported by a grant of the Volkswagen Stiftung.

References

Blommers-Schlösser, R.M.A. (1979) Biosystematics of the Malagasy frogs. I. Mantellinae (Ranidae). Beaufortia, 29, 1–77. Blommers-Schlösser R.M.A. & Blanc C.P. (1991) Amphibiens (première partie). Faune de Madagascar, 75 (part 1), 1–379. Bora, P., Randriambahiniarime, M.O., Rabemananjara, F.C., Ramilijaona, O.R., Glaw, F. & Vences, M. (2007) A rapid assessment survey of the herpetofauna at Befotaka-Midongy National Park, south-eastern Madagascar. Mitteilungen aus dem Museum für Naturkunde in Berlin, Zoologische Reihe, 83, 170–178. Glaw, F. & Vences, M. (2003) Introduction to amphibians. In: Goodman, S. M. & Benstead, J. P. (Eds): The Natural History of Madagascar. University of Chicago Press, Chicago, pp. 883–898. Glaw, F. & Vences, M. (2006) Phylogeny and genus-level classification of mantellid frogs (Amphibia, Anura). Organisms, Diversity and Evolution, 6, 236–253. Glaw, F. & Vences, M. (2007) A Field Guide to the Amphibians and Reptiles of Madagascar. 3rd edition. Cologne, Vences & Glaw Verlag. Glaw, F., Vences, M. & Gossmann, V. (2000) A new species of Mantidactylus from Madagascar, with a comparative survey of internal femoral gland structure in the genus (Amphibia: Ranidae: Mantellinae). Journal of Natural History, 34, 1135– 1154. Grosjean, S., Strauß, A., Glos, J., Randrianiaina, R.D., Ohler, A. & Vences, M. (in press) Morphological and ecological unifor- mity in the funnel-mouthed tadpoles of Malagasy litter frogs, subgenus Chonomantis. Zoological Journal of the Linnean Society. Kumar, S., Tamura, K. & Nei, M. (2004) MEGA3: integrated software for molecular evolutionary genetic analysis and sequence alignment. Briefings in Bioinformatics, 5, 150–163. Lees, D.C., Kremen, C. & Andriamampianina, L. (1999) A null model for species richness gradients: bounded range overlap of butterflies and other rainforest endemics in Madagascar. Biological Journal of the Linnean Society, 67, 529–584. Nussbaum, R.A., Raxworthy, C.J., Raselimanana, A.P. & Ramanamanjato, J.B. (1999) Amphibians and reptiles of the Réserve Naturelle Integrale d’Andohahela, Madagascar. Fieldiana Zoology (new series), 94, 155–173. Raxworthy, C.J. & Nussbaum R.A. (1996) Amphibians and reptiles of the Réserve Naturelle Intégrale d’Andringitra, Madagas- car: A study of elevational distribution and local endemicity. Fieldiana Zoology (new series), 85, 158–170. Vences, M. & Glaw, F. (2004) Revision of the subgenus Chonomantis (Anura: Mantellidae: Mantidactylus) from Madagascar, with description of two new species. Journal of Natural History, 38, 77–118. Vences, M., Kosuch, J., Glaw, F., Böhme, W. & Veith, M. (2003) Molecular phylogeny of hyperoliid treefrogs: biogeographic origin of Malagasy and Seychellean taxa and re-analysis of familial paraphyly. Journal of Zoological Systematics and Evo- lutionary Research, 41, 205–215. Vieites, D.R., Wollenberg, K.C., Andreone, F., Köhler, J., Glaw, F. & Vences, M. (2009) Vast underestimation of Madagascar's biodiversity evidenced by an integrative amphibian inventory. Proceedings of the National Academy of Sciences of the U.S.A., 106, 8267–8272.

60 · Zootaxa 2772 © 2011 Magnolia Press BORA ET AL. Herpetological Conservation and Biology 5(1):???? Submitted: 14 August 2008; Accepted: 20 July 2009. AMPHIBIANS AND REPTILES OF THE TSINGY DE BEMARAHA PLATEAU, WESTERN MADAGASCAR: CHECKLIST, BIOGEOGRAPHY AND CONSERVATION

1,8 2 2 PARFAIT BORA , J. CHRISTIAN RANDRIANANTOANDRO , ROMA RANDRIANAVELONA , ELISOA 1 3 F. HANTALALAINA , RAPHALI R. ANDRIANTSIMANARILAFY , 1 1 4 DANIEL RAKOTONDRAVONY , OLGA R. RAMILIJAONA , MIGUEL VENCES , 2,5 6 7 RICHARD K. B. JENKINS , FRANK GLAW , AND JÖRN KÖHLER

1Département de Biologie Animale, Université d’Antananarivo, B.P. 906, Antananarivo 101, Madagascar 2Madagasikara Voakajy, B.P. 5181, Antananarivo 101, Madagascar 3Département des Sciences Biologiques, Université de Toliara, Toliara 601, Madagascar 4Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106 Braunschweig, Germany 5School of Biological Sciences, University of Aberdeen, Aberdeen, AB24 2TZ, United Kingdom 6Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München, Germany 7Hessisches Landesmuseum Darmstadt, Department of Natural History - Zoology, Friedensplatz 1, 64283 Darmstadt, Germany 8Corresponding author: e-mail: [email protected]

Abstract.—We surveyed the Tsingy de Bemaraha plateau in central-western Madagascar for amphibians and reptiles. We recorded 19 species of amphibians and 60 species of reptiles by opportunistic searching, bioacoustic identification (frogs), and pitfall trapping. Among the species recorded, 13% were previously unknown to science and a further 15% are of uncertain taxonomic status and possibly represent undescribed species. Of all the species recorded, 28% are endemic to the Bemaraha plateau and 48% appear to be dependent on forest habitat. Phylogenetic relationships of Bemaraha amphibians suggest a biogeographic link to eastern rainforests; whereas, those of reptiles demonstrate a link to the forests of northern Madagascar. We comment on former species records from the area and discuss conservation issues for amphibians and reptiles related to the habitat alteration observed in several parts of the protected area complex.

Key Words.—Amphibia; biogeography; checklist; conservation, endemism; Madagascar; Tsingy de Bemaraha; Reptilia.

Résumé.—Nous avons surveillé les amphibiens et les reptiles dans le plateau du Tsingy de Bemaraha dans le central- ouest de Madagascar. Nous avons recensé 19 espèces d’amphibiens et 60 espèces de reptiles par des recherches opportunistes, identification bioacoustique (amphibiens) et des piégeages par trous pièges. Parmi les espèces recensées, 13% sont auparavant inconnues par la science et plus de 15% ont des statuts taxonomiques incertains et sont possibles des espèces non-décrites. Vingt-huit pourcent de toutes les espèces recensées sont considérées pour représenter les endémicités à Bemaraha et 48% des espèces pourraient être dépendantes de l’habitat forestier. Les relations phylogénétiques des amphibiens de Bemaraha indiquent une continuité biogéographique aux forêts humides de l’Est et celles de reptiles une continuité aux forêts au nord de Madagascar. Nous avons fait des commentaires sur les espèces recensées auparavant dans la région et avons discuté à propos des actions de conservation des amphibiens et des reptiles reliées à l’altération des habitats observée dans certaines parties du complexe aire protégée.

Mots Clés.—Amphibiens; biogéographie; conservation; endémisme; liste; Madagascar; Tsingy de Bemaraha; Reptiles.

INTRODUCTION Conservation 2002). The northern part of the protected area covers 85,370 ha2 and is an Integral The Tsingy de Bemaraha plateau is in the central- Natural Reserve (Réserve Naturelle Intégrale). The western part of Madagascar, in the province of ANGAP (Association Nationale pour la Gestion des Mahajanga, and its protected area complex covers Aires Protégées) managed complex became a 157,710 ha2 (Rasoloarison and Paquier 2003). A UNESCO World Heritage site in 1990 and National limestone massif with steep slopes to the east Cultural Heritage Site in 1991. ANGAP has recently primarily characterizes the protected area complex. been changed to MNP (Madagascar National Parks). The western part of the plateau presents a very ragged For the purpose of this study, we use the term relief, largely covered by dense, dry deciduous forests. ‘Bemaraha’ to refer to habitats on karst formations In its eastern parts, savannahs impinge on the forest within the national park, integral natural reserve, or on habitats. Part of the reserve (72,340 hectares) earned the boundary. It is difficult to access, especially national park status in August 1997 to promote the during the wet season and from the rugged karstic development of ecotourism (Plan de Gestion et de relief, and this affords some protection from human Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar

TABLE 1. Sites of the Bemaraha area, western Madagascar, investigated for this study in 2006.

Altitude Survey Site Coordinates (m a.s.l.) team Survey dates Habitat description S1: Antsalova S18°40’54’’ 103 Team 2 15-17 March and Mango-trees, banana plants and rice E044°37’33’’ 2-4 April fields S2: Andranopasazy S18°42’31’’ 146 Team 1 13-30 January Dry dense deciduous forest with E044°43’02’’ Team 2 17-23 March selective felling trees S3: Andafiabe S18°47’03’’ 177 Team 2 24-25 March and Forest dense sub-humid and boasts E044°46’46’’ 31 March - 1 April vegetation on sand and on tsingy formation along the Beboka River S4: Bendrao S18°47’50’’ 427 Team 1 26 February - 7 Dry dense deciduous forest including E044°51’37’’ March savannah formations with scattered trees Team 2 25-31 March and limestone caves S5: Ankily S18°40’15’’ 286 Team 1 5-14 February Dry and deciduous primary forest with E044°46’86’’ vegetation on tsingy S6: Anjaha S18°39’43’’ 403 Team 1 15-24 February Dry deciduous disturbed forest E044°49’33’’ S7: Ankazomanga S18°44’14’’ 571 Team 1 8-17 March Dry dense deciduous forest on tsingy E044°54’89’’ rocks and highly disturbed outside of the park S8: Ranotsara S19°02’08’’ 65 Team 1 16-26 November Dry deciduous forest on tsingy inside of E044°46’29’’ park S9 : Ankilogoa S19°07’52’’ 57 Team 1 6-15 December Dry deciduous forest, vegetation on E044°48’32’’ tsingy, including savannah trees S10: Andolombazimba S19°08’25’’ 59 Team 1 27 November - 6 Dry deciduous forest, vegetation on E044°49’42’’ December tsingy and wooded savannahs and/or savannah grassland

activities. Nevertheless, there is growing pressure on voucher specimens to allow future verification of the forest from local farming communities for new species' identities. It covers the northern and southern land, grazing areas, and forest products. part of the national park and includes an evaluation of Bemaraha contains a diversity of natural habitats species richness, endemism, biogeographical affinities, that constitute various ecosystems, including and conservation. deciduous dry forest, xerophytic shrublands, sub- humid forest, swamps, and savannah. This area is MATERIALS AND METHODS important for a range of mammal species, including the endemic lemur Avahi cleesei (Goodman and Study sites.—Two different teams of investigators Schütz 2003; Goodman et al. 2005a, b; Thalmann and carried out the field work. We investigated 10 sites Geissmann 2005). Furthermore, a recent analysis of during the rainy seasons of 2006 (Fig. 1; Table 1) multi-taxa distribution (Kremen et al. 2008) identified the eastern parts of Bemaraha as an area of high Survey methods.—Opportunistic searching: conservation priority. Reptiles and amphibians were surveyed along Bemaraha has a rich fauna and the earliest transects or trails, streams and rivers, around ponds, herpetological record known from the area is the within caves, and within the forest during day and spectacular Antsingy Leaf chameleon, Brookesia night using headlamps and hand torches (flashlights perarmata (Angel 1933). More recently, with batteries). Each team used broadly the same herpetological expeditions to the area revealed several search techniques with a day-search typically previously undescribed species, most of which are consisting of 4 diurnal hours and 3–5 hours during the endemic to the plateau (e.g., Schimmenti and Jesu night. 1996; Jesu et al. 1999; Nussbaum et al. 1999; Drift fencing and pitfall trapping: Lines of at least Raselimanana et al. 2000; Vences et al. 2000). In 10 plastic buckets each with a plastic sheeting drift addition, several brief reports on other species are fence approximately 100 m long were used at each site available, but these mainly refer to only a few single (except Antsalova). We oriented lines in parallel and sites within the area (Emanueli and Jesu 1995; approximately 150–300 m apart. We distributed lines Schimmenti and Jesu 1997; Hallmann et al. 1999). among representative habitats within the forest and Very recently, Raselimanana (2008) published a they were usually placed at the apex, on, and at the comprehensive species list of many forests in western base of slopes. Madagascar, including Tsingy de Bemaraha. Despite Bioacoustic identification: We occasionally these considerable efforts, no comprehensive recorded anuran calls and compared these to known assessment of the area’s importance for endemic calls (Vences et al. 2006) to identify frog species herpetofauna exists. present. Although we made an effort to collect This contribution provides the first comprehensive vouchers for all species, we could only identify some species assessment of amphibians and reptiles of the frog species at specific locations by their call. Tsingy de Bemaraha plateau, and provides a list of

2 Herpetological Conservation and Biology

FIGURE 1. Schematic map of the southern portion of the Tsingy de Bemaraha area, western Madagascar, with the names of survey sites: Antsalova (S1); Andranopasazy (S2); Andafiabe (S3); Bendrao Forest (S4); Ankily (S5); Anjaha (S6); Ankazomanga (S7); Ranotsara (S8); Ankilogoa (S9); Andolombazimba (S10).

3 Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar

Voucher specimens.—We euthanized voucher regions, although slightly higher. For example, Glos specimens with chlorobutanol solution, fixed them in (2003) recorded only 15 species from the Kirindy dry 90% ethanol or 4% formalin solution, and we stored forest further south; whereas, Mori et al. (2006) and specimens in 70% ethanol. We deposited vouchers D'Cruze et al. (2007) found only nine species of frogs (Appendix I) in the Université d’Antananarivo, at Parc National d’Ankarafantsika and Montagne des Département de Biologie Animale (UADBA) and the Français, respectively. Raselimanana (2008) recorded Zoologische Staatssammlung München (ZSM). A few 17 anuran species from Bemaraha and 2–14 species reptile species were recorded by photo vouchers only from 16 other western and southern forests. In (Fig. 2), without collected specimens being available. comparison with other western sites, the number of The nomenclature and order of species in tables recorded reptile species from Bemaraha is higher than largely follows Glaw and Vences (2007). in Parc National d'Ankarafantsika (Ramanamanjato and Rabibisoa 2002; Mori et al. 2006; Raselimanana, RESULTS 2008), but lower than reported from the Kirindy dry forest (Bloxam et al. 1996; Appendix II). We recorded 19 amphibian and 60 reptile species for Raselimanana (2008) recorded 54 reptile species from a total herpetofaunal diversity of 79 species (Tables 2– Bemaraha, 58 from Foret de Mikea, and 15–53 from 5; Fig. 2) for the area. The herpetofauna consisted of 15 other western and southern forests. Although his 19 anuran (24%), 43 lizard (54%) and 17 snake surveys revealed slightly fewer amphibian and reptile species (22%). Despite intensive surveys, we were not species than our survey, he recorded several additional able to discover all species of amphibians and reptiles species, indicating that the species richness in previously reported from the area, meaning that our Bemaraha is significantly higher than in any other dry results probably represent a minimum value of species forest site. richness for the area (see also Discussion). Among the species recorded, 10 (13%) were previously unknown Taxonomy and local endemism.—Apart from those to science and a further 12 (15%) are of uncertain relatively widespread anurans occurring in the dry taxonomic status and possibly represent undescribed western parts of Madagascar (e.g., Heterixalus species. In total, approximately 22 species (28%) are luteostriatus, Dyscophus insularis, Aglyptodactylus only known from the Tsingy de Bemaraha protected securifer, Laliostoma labrosum, Boophis doulioti, B. area complex and are therefore considered local occidentalis, Mantella betsileo, Ptychadena endemics. mascareniensis), the records from Bemaraha include some remarkable findings. The Recently described DISCUSSION species Plethodontohyla fonetana and Boophis tampoka are both endemic to the Bemaraha plateau, Species-richness.—With only 19 species, the although their closest relatives are congeners from the amphibian fauna of Bemaraha appears depauparate eastern rainforests (Glaw et al. 2007; Köhler et al. when compared to the rainforests in northern and 2007). eastern Madagascar. Amphibian species richness in Gephyromantis sp. (aff. corvus) represents another Bemaraha is comparable to western and northern dry undescribed, potentially endemic taxon (currently

TABLE 2. List of amphibian species recorded from the different study sites in the Bemaraha area, western Madagascar. The following abbreviations indicate studied sites within the Bemaraha area (+ = confirmed presence of species; – = no record): S1 = Antsalova; S2 = Andranopasazy; S3 = Andafiabe; S4 = Bendrao Forest; S5 = Ankily; S6 = Anjaha; S7 = Ankazomanga; S8 = Ranotsara; S9 = Ankilogoa; S10 = Andolombazimba. *Exact locality for Rhombophryne sp. provided by Andreone and Randrianirina (2008) as Andamozavaky (19°01.86’S, 44°46.80’E, 122 m a.s.l.). Study site Species S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 Ptychadena mascareniensis – + + + – – – – – – Heterixalus carbonei – + – – – – – – – – Heterixalus luteostriatus – + – – – – – – – – Dyscophus insularis – – – + – – + – + – Plethodontohyla fonetana – – – + – – – – – – Rhombophryne sp.* – – – – – – – + – – Scaphiophryne sp. (aff. calcarata) – – – – – + – – + + Scaphiophryne menabensis – + – + – + – – – – Stumpffia sp. (aff. helenae) – + – + – – – + + + Aglyptodactylus securifer – + – + + – – + + – Laliostoma labrosum + + + + – + + – + + Boophis doulioti + + + + – – + + + + Boophis occidentalis – + – – + – – – – – Boophis tampoka – – + + – + – – – – Blommersia sp. (aff. wittei) – + – + – – – – + – Gephyromantis sp. (aff. corvus) – + – + + + – + + – Mantella betsileo – + – – – – – – – – Mantella sp. (aff. expectata) – + – + – – – + – – Mantidactylus sp. (aff. ulcerosus) – + + + – + – – – –

4 Herpetological Conservation and Biology

FIGURE 2. Unvouchered species that we recorded during the survey of Bemaraha National Park, western Madagascar: (A) Trachylepis elegans, (B) Furcifer cf. petteri, (C) Zonosaurus karsteni, (D) Leioheterodon modestus. (Photographed by C. Randrianantoandro). being studied by F. Andreone, Museo Regionale di (Glaw et al. 2009b). Paroedura sp. (aff. tanjaka) Scienze Naturali, Torino, Italy). The status of two superficially resembles small individuals of P. tanjaka, other species requires clarification. Molecular studies but distinctly differentiated genetically (Jackman et al. suggest that the Stumpffia sp. from our study is closely 2008). Phelsuma borai, a new cryptically colored and related to S. helenae from Réserve Spéciale recently described species (Glaw et al. 2009a), occurs d’Ambohitantely but may warrant species status in Bemaraha and apparently also in the Parc National (Wollenberg et al. 2008). Similarly, the species status d'Ankarafantsika (Mori et al. 2006, as P. mutabilis). of Mantella sp. (aff. expectata) requires evaluation, Both, Thamnosophis mavotenda and Paroedura sp. although genetic studies suggest two different syntopic (aff. tanjaka) are potential endemics to Bemaraha. haplotype lineages at Andranopasazy, which include Other candidates for undescribed endemic species are Mantella betsileo and Mantella sp. (aff. expectata; two species of Amphiglossus and two species of Rabemananjara et al. 2007). In contrast, the status of Typhlops, which are also in need of further study. The two other taxa is fairly clear: Blommersia sp. (aff. same might be true for the genus Geckolepis, which is wittei) is an undescribed species distributed in western in urgent need of revision. Although we have possibly Madagascar that will be subject to a forthcoming study collected more than one species in Bemaraha, we and Mantidactylus sp. (aff. ulcerosus) represents a prefer to consider them tentatively all as Geckolepis new species known also from Parc National d’Isalo sp., which is also consistent with preliminary (Glaw and Vences 2007:232), currently being studied molecular data. We collected a single, likely by Aumüller et al. (in prep.). In addition to our undescribed, specimen of Lygodactylus sp., possibly records, Andreone and Randrianirina (2008) reported a related to L. madagascariensis, from the northern species of Rhombophryne from the Bekopaka rainforests. A number of additional species are of commune, a further potential endemic of Bemaraha. uncertain taxonomic status and could include new Summarizing, five amphibian species appear to locally endemic taxa: Uroplatus cf. ebenaui, represent endemics of the Bemaraha plateau. Uroplatus cf. henkeli, Paroedura cf. homalorhina, Among the reptiles, at least three species are new to Madascincus cf. intermedius, Zonosaurus cf. science. The recently described snake Thamnosophis madagascariensis, and Furcifer cf. petteri. mavotenda is morphologically similar to T. martae Clarification of their taxonomic status will be subject from northern Madagascar, but differs in aspects of to future studies. Apart from some taxonomic coloration and in the sequences of mitochondrial genes novelties and some taxonomic uncertainty, the

5 Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar

TABLE 3. List of snake species recorded from the different study sites in the Bemaraha area, western Madagascar. The following abbreviations indicate studied sites within the Bemaraha area (+ = confirmed presence of species; – = no record): S1 = Antsalova; S2 = Andranopasazy; S3 = Andafiabe; S4 = Bendrao Forest; S5 = Ankily; S6 = Anjaha; S7 = Ankazomanga; S8 = Ranotsara; S9 = Ankilogoa; S10 = Andolombazimba. *Photo voucher only. Study sites Species S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 Acrantophis madagascariensis – – – + – – – – – – Sanzinia madagascariensis volontany – + – + – – – – – – Alluaudina bellyi – – – + – – – – – – Dromicodryas bernieri – – – + – – – – – – Heteroliodon lava – + – – – – – – + + Langaha madagascariensis – – – – – – – + – – Leioheterodon madagascariensis * – + + + + + – + – – Leioheterodon modestus – – – – – – – + – – Liophidium torquatum – – – – – – – + + – Madagascarophis colubrinus – + – – – – – – – – Mimophis mahfalensis – + – – – – – – – – Stenophis citrinus – + – – – – – – + – Stenophis pseudogranuliceps – – – + – – + – + – Stenophis cf. variabilis – + – – – – + – + – Thamnosophis mavotenda – – – + – – – – – – Typhlops sp. 1 (aff. arenarius) – – – + – – – + – – Typhlops sp. 2 – – – – – + – – + – following species are considered local endemics of the (Vences et al. 2000), Langaha nasuta is now L. Bemaraha plateau: Lygodactylus klemmeri, madagascariensis (Anonymous 1987), Paroedura Trachylepis volamenaloha, Brookesia exarmata, and bastardi is now P. sp. aff. tanjaka (this study), and B. perarmata. Scaphiophryne marmorata is now S. menabensis (Glos et al. 2005). In other cases, misidentifications are Species recorded by previous surveys.—Previous quite likely (e.g., in the cases of Brookesia bonsi, publications (Hallmann et al. 1999; Blommers- Pelusios subniger, Mantidactylus biporus, M. curtus, Schlösser and Blanc 1991; Emanueli and Jesu 1995; M. granulatus, M. luteus, and M. ulcerosus). All of Schimmenti and Jesu 1997) recorded species that we these species are unlikely to occur in Bemaraha, but no did not find during our surveys. This is partly due to attempt was made to re-identify the corresponding recent taxonomic changes: Aglyptodactylus voucher specimens. Finally, we have been unable to madagascariensis is now A. securifer (Glaw et al. confirm older records for Crocodylus niloticus, 1998), Boophis albilabris is now B. occidentalis Pelomedusa subrufa, Dromicodryas quadrilineatus, (Andreone et al. 2002), Boophis tephraeomystax is Heterixalus tricolor, Phelsuma lineata, Erymnochelys now B. doulioti (Vences and Glaw 2002), Brookesia madagascariensis (being frequently attributed to ebenaui is now B. brygooi (Raxworthy and Nussbaum Bemaraha on many websites), and Zonosaurus 1995), Furcifer verrucosus is now F. nicosiai (Jesu et maramaintso, which was recently described from the al. 1999), Heterixalus betsileo is now H. carbonei "Antsalova region" (Raselimanana et al. 2006). Most

TABLE 4. List of gecko species recorded from the different study sites in the Bemaraha area, western Madagascar. The following abbreviations indicate studied sites within the Bemaraha area (+ = confirmed presence of species; – = no record): S1 = Antsalova; S2 = Andranopasazy; S3 = Andafiabe; S4 = Bendrao Forest; S5 = Ankily; S6 = Anjaha; S7 = Ankazomanga; S8 = Ranotsara; S9 = Ankilogoa; S10 = Andolombazimba. Study sites Species S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 Blaesodactylus sakalava – + – – – – + – – – Geckolepis sp. – + – + – – – + + – Hemidactylus frenatus + – – – – – – – – – Hemidactylus mercatorius – – – – – + – – + – Lygodactylus heterurus – + + + – – – + + – Lygodactylus klemmeri – + – – – – – – + – Lygodactylus tolampyae – + – + + – – + + – Lygodactylus sp. – – – + – – – – – – Paragehyra cf. petiti – – – – – – – + – – Paroedura cf. homalorhina + + – + – – – – – – Paroedura tanjaka – + + – – + – + + + Paroedura sp. (aff. tanjaka) – – + – – – – – – – Phelsuma abbotti chekei – + + – + + – – + – Phelsuma dubia + – – – – – – – – – Phelsuma kochi – + + – – + – + + – Phelsuma mutabilis + – – – – – – – – – Phelsuma borai – – + – – – – – – – Uroplatus cf. ebenaui – – – + – – – – – – Uroplatus guentheri – – – – – – – + + – Uroplatus cf. henkeli – + + + + – – – – –

6 Herpetological Conservation and Biology

TABLE 5. List of lizard species (except gekkonids) recorded from the different study sites in the Bemaraha area, western Madagascar. The following abbreviations indicate studied sites within the Bemaraha area (+ = confirmed presence of species; – = no record): S1 = Antsalova; S2 = Andranopasazy; S3 = Andafiabe; S4 = Bendrao Forest; S5 = Ankily; S6 = Anjaha; S7 = Ankazomanga; S8 = Ranotsara; S9 = Ankilogoa; S10 = Andolombazimba. Study sites Species S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 Amphiglossus reticulatus – + – – – + – – – – Amphiglossus splendidus – – – – – – – + + + Amphiglossus sp.1 – – – – – + – + – – Amphiglossus sp.2 – – – – – + – – – + Madascincus cf. intermedius – – – – – + – + + – Trachylepis cf. dumasi – + – – – – – – + – Trachylepis elegans (photo voucher only) – – – – – – – – – + Trachylepis gravenhorstii – – – – – + – – + – Trachylepis tandrefana + + – – + – – + + – Trachylepis volamenaloha – + + + – + – + + – Brookesia brygooi – + – + + + + + + – Brookesia exarmata – + – + + + + + + – Brookesia perarmata – + – + + + – – – – Furcifer lateralis – – – – – – – – + – Furcifer nicosiai + + – + + + + + + + Furcifer cf. petteri (photo voucher only) – – – + – – – – – – Furcifer oustaleti + + – + – – + – + + Zonosaurus bemaraha – + – – + + – – – – Zonosaurus karsteni (photo voucher only) – – – – – – – – + – Zonosaurus laticaudatus – + – – – – – + + + Zonosaurus cf. madagascariensis – – – + – – – – – – Chalarodon madagascarensis + – – – – – – – – – Oplurus cuvieri + + + – – – – – + + of these species likely occur in Bemaraha but require formerly known only from more northern localities. confirmation. A recent record of an apparently Moreover, Bemaraha is the southernmost confirmed undescribed Rhombophryne species that resembles R. locality of Phelsuma dubia in western Madagascar, the coudreaui from northeastern Madagascar (Andreone north-westernmost locality for Amphiglossus and Randrianirina 2008) highlights the incompleteness splendidus and Boophis occidentalis, and the of our survey and the current knowledge of the westernmost locality for Liophidium torquatum. herpetofauna of Bemaraha. This is even more true for the recent records provided by Raselimanana (2008), Habitat use.—With regards to habitat, 38 species who identified three additional amphibian species (48%) were observed in forest only; whereas, 18 (Heterixalus betsileo, Aglyptodactylus laticeps and species (23 %) were apparently dependent on forest Scaphiophryne brevis). Although the record of H. structures, but also occurred in heavily disturbed betsileo is likely to refer to H. carbonei (see above), forests or at forest edges. We observed 23 species the two other records indicate that at least 21 (29%) that were restricted to open savannah habitat or amphibian species occur at Bemaraha. Raselimanana strongly degraded bushy areas. Some terrestrial (2008) also recorded a number of additional reptile anuran species show a degree of adaptation to the species. Although differences in the use of tsingy limestone habitat by exhibiting well-expanded nomenclature does not allow us to interpret all of these finger discs, which might support climbing ability on records reliably, at least Paroedura stumpffi, rock surfaces (Plethodontohyla fonetana, Stumpffia Paroedura karstophila, Amphiglossus ornaticeps, sp., Gephyromantis sp.). Gephyromantis sp. and Compsophis albiventris, Liopholidophis dolicocercus, Plethodontohyla fonetana were discovered at night Liopholidophis lateralis and Pseudoxyrhopus kely are sitting on tsingy rocks; whereas, Stumpffia sp. seems likely to refer to species not recorded by us and might to occur exclusively in caves and deep clefts within elevate the number of reptile species known from tsingy formations in forest areas. Exclusive Bemaraha to almost 70 species. occurrence in caves was observed for Paroedura cf. homalorhina. Range extensions.—Several species encountered during this study require particular mention as their Biogeography.—As already emphasized by Glaw et occurrence in Bemaraha significantly contributes to al. (2007) and Köhler et al. (2007), the Bemaraha the current information regarding their distribution in plateau is remarkable for its biogeographic Madagascar. Apart from the need to clarify the relationship to eastern Madagascar. Recently taxonomic status of Furcifer cf. petteri, Paroedura cf. described Boophis tampoka and Plethodontohyla homalorhina, Uroplatus cf. ebenaui and U. cf. henkeli, fonetana both have their closest relatives in the humid the Bemaraha populations of these taxa constitute by eastern rainforests. Formerly, only species that were far the southernmost records (see Glaw and Vences not dependent on relatively intact forest habitats 2007). The same is true for Lygodactylus heterurus, demonstrated an east-west relationship of species pairs Amphiglossus reticulatus and Alluaudina bellyi, (e.g., Vences et al. 2000; Vences and Glaw 2002; Glos

7 Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar et al. 2005). By contrast, B. tampoka and P. fonetana Uroplatus cf. henkeli, Paroedura sp. (aff. tanjaka), and their relatives are closely associated with forest Trachylepis volamenaloha, Thamnosophis mavotenda) habitats. Köhler et al. (2007) proposed that remnants may thus be seriously threatened. of gallery forest are important habitats for dispersal Conversely, the occurrence of reproductively active because recurrent expansion of humid forest into Brookesia brygooi, B. exarmata, and B. perarmata in western Madagascar by repeated climate change moderately disturbed forest at Bendrao events probably triggered respective distribution (Randrianantoandro et al. 2007; 2008) leads to many patterns. A similar scenario may explain the species ecological and conservation-relevant questions. The pair Stumpffia helenae (known from Réserve Spéciale Bemaraha plateau contains vast areas of difficult-to- d’Ambohitantely) and Stumpffia sp. (aff. helenae). access habitat, so the disturbance observed at our study The reptile fauna of Bemaraha shows certain sites may not represent the condition of the whole affinities to the Sambirano domain in northern area. Nevertheless, the persistence of a mixture of Madagascar. This affinity is indicated by the presence diversified microhabitats such as the tsingy, caverns, of Alluaudina bellyi, Amphiglossus reticulatus, and caves within dry and sub-humid forests are an Heteroliodon lava, Lygodactylus heterurus, and some essential precondition for the survival of Bemaraha's nominal taxa with populations of uncertain status (e.g., amphibians and reptiles. Furcifer cf. petteri, Lygodactylus sp., Paroedura cf. This survey of the Bemaraha herpetofauna has led homalorhina, Uroplatus cf. ebenaui and U. cf. us to preliminary recommendations for its henkeli). Furthermore, Thamnosophis mavotenda has conservation within this unique area: (1) The forest its closest relative in northernmost Madagascar (Glaw remnants of Anjaha and Ankazomanga (S6 and S7) et al. 2009b). should be included in the protected area complex; (2) Summarizing, the Bemaraha herpetofauna is Further herpetofaunal surveys need to be conducted, characterized by: (1) high local amphibian endemicity especially in the centre of the national park and in the with close relationships to eastern rainforest areas; (2) Réserve Naturelle Intégrale; (3) There should be a reptile fauna with close relationships to the further assessment and monitoring of natural resource- Sambirano region in northern Madagascar; (3) use activities; and (4) Intensified patrols in the existing northern forest reptiles that reach their southernmost protected areas need to occur by ANGAP (MNP) distribution limit in the Bemaraha region; and (4) officials to trace illegal practices (e.g., cattle browsing, widespread amphibian and reptile species from slash-and-burn practice, lemur trapping) and these western Madagascar. The varied topography and activities need to be reduced more efficiently. climate of the Bemaraha plateau enables the existence of forest species during drier periods in western Acknowledgments.—We thank the staff of the Madagascar. The humid microclimate within Tsingy de Bemaraha National Park: Hery Lala limestone caves and deep clefts were probably crucial Ravelomanantsoa, Gaston, Randrianasolo Raymond, for their survival and to some extent characterize the Honoré Bezandry, Solofohery Michel Abdon, Antoine Bemaraha plateau as a refuge during climate change Tsarafindrama, Georges Rakotomalala, Maminirina events. Solondrainy, Kesy Manesiarivo Cadet Olivier, Naory Jovin and Andriamasinanjara Mahafadrahona, Conservation.—With a remarkable number of Razafinarivo Nary of the Association of Bemaraha restricted-range species found only in the forest of Guides (AGB). The Chef de la Circonscription Bemaraha, the protected area complex and Régionale de l’Environnement des Eaux et Forêts surrounding forest habitats must be key sites for d’Antsalova, the Chef de District and the Mayor, as herpetofaunal conservation in western Madagascar. well as the various institutions, all contributed to the Many areas in the Integral Natural Reserve are success of this survey, as did numerous other people difficult to patrol because of security problems, and including guides and porters from the area. For the forests in this area are not well-protected or assistance in the field, Team 2 is indebted to Hildegard surveyed. Further south in the national park, the Enting. Team 1 is grateful to the Ministry of the periphery of the forest and areas near to human Environment, Water, Forests and Tourism for granting settlements or thoroughfares receive sustained permission (# 0154-08/No. 298/07 6 December 2007) degradation because of the demand for new for this study under the project entitled ‘Inventaire et agricultural land, cattle grazing, and wood. The loss conservation des espèces herpétofaunes endémiques of habitat constitutes a major threat to Malagasy incluent dans la liste rouge de l’IUCN et important à amphibians (Andreone et al. 2008) and likely to l’exportation CITES’. Their work took place under a reptiles also. Many of the park’s endemic species protocol of collaboration between the Département de have very specific microhabitat requirements or only Biologie Animale, Université d’Antananarivo, the occur in a small area. This places them at a University of Aberdeen and the Association Nationale disproportionate risk from changes to the forest. pour la Gestion des Aires Protégées. The Darwin Locally endemic forest species (e.g., Boophis Initiative and Calumma Ecological Services funded tampoka, Plethodontohyla fonetana, Stumpffia sp. (aff. the surveys of Team 1. helenae), Brookesia exarmata, B. perarmata,

8 Herpetological Conservation and Biology

LITERATURE CITED Glaw, F., Z.T. Nagy, J. Köhler, M. Franzen, and M. Vences. 2009b. Phylogenetic relationships of a new Andreone, F., A.I. Carpenter, N. Cox, L. du Preez, K. species of pseudoxyrhophiine snake (Reptilia: Freeman, S. Furrer, G. Garcia, F. Glaw, J. Glos, D. Lamprophiidae: Thamnosophis) suggest a Knox, J. Köhler, J.R. Mendelson III, V. Mercurio, biogeographic link between western and northern R.A. Mittermeier, R.D. Moore, N.H.C. Rabibisoa, Madagascar. Organisms Diversity & Evolution H. Randriamahazo, H. Randrianasolo, N. 9:13–22. Raminosoa, O. Ramilijaona, C.J. Raxworthy, D. Glaw, F., and M. Vences. 2007. A Field Guide to the Vallan, M. Vences, D.R. Vieites, and C. Weldon. Amphibians and Reptiles of Madagascar. 3rd 2008. The challenge of conserving amphibian Edition. Vences and Glaw Verlag, Köln, Germany. megadiversity in Madagascar. PLoS Biology Glaw, F., M. Vences, and W. Böhme. 1998. 6:e118.doi: 10.1371/journal.pbio.0060118. Systematic revision of the genus Aglyptodactylus Andreone, F., and J.E. Randrianirina. 2008. An Boulenger, 1919 (Anura: Ranidae) and analysis of unexpected Rhombophryne record at Tsingy de its phylogenetic relationships with other ranid Bemaraha confirms the presence of cophyline frogs genera from Madagascar (Tomopterna, Boophis, in western Madagascar. Zootaxa 1812:46–48. Mantidactylus and Mantella). Journal of Zoological Andreone, F., M. Vences, F.M. Guarino, F. Glaw, and Systematics and Evolutionary Research 36:17–37. J.E. Randrianirina. 2002. Natural history and larval Glos, J. 2003. The amphibian fauna of the Kirindy dry morphology of Boophis occidentalis (Anura: forest in western Madagascar. Salamandra 39:75– Mantellidae: Boophinae) provide new insights into 90. the phylogeny and adaptive radiation of endemic Glos J., F. Glaw, and M. Vences. 2005. A new species Malagasy frogs. Journal of Zoology 257:425–438. of Scaphiophryne from western Madagascar. Copeia Angel, F. 1933. Sur un genre malgache nouveau de la 2005:252–261. famille de Chamaeleontidés. Bulletin Museum Paris, Goodman, S.M., D. Andriafidison, R. T, LVIII, 6:443. Andrianaivoarivelo, S.G. Cardiff, E. Ifticene, Anonymous. 1987. Opinion 1463. De Lacépède, R.K.B. Jenkins, A. Kofoky, T. Mbohoahy, D. 1788–1789, Histoire Naturelle des Serpens and later Rakotondravony, J. Ranivo, F. Ratrimomanarivo, J. editions: rejected as a non-binominal work. Bulletin Razafimanahaka, V. Razakarivony, and P.A. Racey. of Zoological Nomenclature 44 (4):265–267. 2005a. The distribution and conservation of bats in Blommers-Schlösser, R.M.A., and C.P. Blanc. 1991. the dry regions of Madagascar. Animal Amphibiens (première partie). Faune de Madagascar Conservation 8:153–165. 75:1–379. Goodman, S.M., R.K.B. Jenkins, and F.H. Bloxam, Q.M.C., J.L. Behler, E.R. Rakotovao, Ratrimomanarivo. 2005b. A review of the genus H.J.A.R. Randriamahazo, K.T. Hayes, S.J. Tonge, Scotophilus (Chiroptera: Vespertilionidae) on and J.U. Ganzhorn. 1996. Effects of logging on the Madagascar, with the description of a new species. reptile fauna of the Kirindy forest with special Zoosystema 27:867–882. emphasis on the Flat-tailed Tortoise (Pyxis Goodman, S.M., and H. Schütz. 2003. Specimen planicauda). In Ganzhorn, J.U. and J.-P. Sorg evidence of the continued existence of the Malagasy (Eds.). Ecology and economy of a tropical dry forest rodent Nesomys lambertoni (Muridae: Nesomyinae). in Madagascar. Primate Report 46:189–201. Mammalia 67:445–449. D'Cruze, N., J. Sabel, K. Green, J. Dawson, C. Hallmann, G., E. Hoffmann, J. Krüger, P. Gardner, J. Robinson, G. Starkie, M. Vences, and F. Schlagböhmer, and G. Trautmann. 1999. Reptilien Glaw. 2007. The first comprehensive survey of und Amphibien im Naturschutzgebiet "du Tsingy de amphibians and reptiles at Montagne des Français, de Bemaraha" (West-Madagaskar) - Ein Madagascar. Herpetological Conservation and photographischer Steckbrief. Reptilia 4:43–45. Biology 2:87–99. Jackman, T.R., A.M. Bauer, E. Greenbaum, F. Glaw, Emanueli, L., and R. Jesu. 1995. The herpetofauna of and M. Vences. 2008. Molecular phylogenetic the World Heritage site "Tsingy de Bemaraha" relationships among species of the Malagasy- (Western Madagascar). In: Llorente et al., eds., Comoran gecko genus Paroedura (Squamata: Scientia Herpetologica 1995:341–348. Gekkonidae). Molecular Phylogenetics and Glaw, F., J. Köhler, P. Bora, N.H.C. Rabibisoa, O. Evolution 46:74–81. Ramilijaona, and M. Vences. 2007. Discovery of the Jesu, R., F. Mattioli, and G. Schimmenti. 1999. On the genus Plethodontohyla (Anura: Microhylidae) in dry discovery of a new large chameleon inhabiting the western Madagascar: description of a new species limestone outcrops of western Madagascar: Furcifer and biogeographic implications. Zootaxa 1577:61– nicosiai sp. nov. (Reptilia, Chamaeleonidae). 68. Doriana 7:1–14. Glaw, F., J. Köhler, and M. Vences. 2009a. A new Köhler, J., F. Glaw, and M. Vences. 2007. A new species of cryptically coloured day gecko green treefrog, genus Boophis Tschudi 1838 (Anura (Phelsuma) from the Tsingy de Bemaraha National Mantellidae), from arid western Madagascar: Park in western Madagascar. Zootaxa.

9 Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar

phylogenetic relationships and biogeographic Zonosaurus from western Madagascar. Occasional implications. Tropical Zoology 20:215–227. Papers Museum of Zoology, University of Michigan Kremen, C., A. Cameron, A. Moilanen, S.J. Phillips, 739:1–16. C.D. Thomas, H. Beentje, J. Dransfield, B.L. Fisher, Raselimanana, A.P., C.J. Raxworthy, and R.A. F. Glaw, T.C. Good, G.J. Harper, R.J. Hijmans, Nussbaum. 2000. A revision of the dwarf D.C. Lees, E. Louis Jr., R.A. Nussbaum, C.J. Zonosaurus Boulenger (Reptilia: Squamata: Raxworthy, A. Razafimpahanana, G.E. Schatz, M. Cordylidae) from Madagascar, including Vences, D.R. Vieites, P.C. Wright, and M.L. Zjhra. descriptions of three new species. Scientific Papers 2008. Aligning conservation priorities across taxa in of the Natural History Museum, University of Madagascar with high-resolution planning tools. Kansas 18:1–16. Science 320:222–226. Rasoloarison, V., and F. Paquier. 2003. Tsingy de Mori, A., I. Ikeuchi, and M. Hasegawa. 2006. Bemaraha. Pp. 1507–1512 In The Natural History of Herpetofauna of Ampijoroa, Ankarafantsika Strict Madagascar. Goodman, S.M., and J. Benstead Nature Reserve, a dry forest in northwestern (Eds.). University of Chicago Press, Chicago, USA. Madagascar. Herpetological Natural History 10:31– Raxworthy, C.J., and R.A. Nussbaum. 1995. 60. Systematics, speciation and biogeography of the Nussbaum, R.A., C.J. Raxworthy, and J.B. dwarf chameleons (Brookesia; Reptilia, Squamata, Ramanamanjato. 1999. Additional species of Chamaeleontidae) of northern Madagascar. Journal Mabuya Fitzinger (Reptilia: Squamata: Scincidae) of Zoology, London 235:525–558. from western Madagascar. Journal of Herpetology Schimmenti, G., and R. Jesu. 1996. Brookesia 33:264–280. exarmata sp. nov. (Reptilia, Chamaeleonidae): a Plan de Gestion et de Conservation. 2002. Programme new dwarf chameleon from the limestone outcrops Bemaraha, 8/ACP/MAG/037, National Park of western Madagascar. Italian Journal of Zoology Component, internal document, 63 pp. 63:193–197. Rabemananjara, F.C.E., A. Crottini, Y. Chiari, F. Schimmenti, G., and R. Jesu. 1997. Some significant Andreone, F. Glaw, R. Duguet, P. Bora, O. reptile discoveries from the Antsingy Forest Ravoahangimalala Ramilijaona, and M. Vences. ("Tsingy de Bemaraha" massif, western 2007. Molecular systematics of Malagasy poison Madagascar). Pp. 317–329 In Böhme, W., W. frogs in the Mantella betsileo and M. laevigata Bischoff, and T. Ziegler (Eds.). (Proceedings of the species groups. Zootaxa 1501:31–44. eighth ordinary general meeting of the Societas Ramanamanjato, J.B., and N. Rabibisoa. 2002. Herpetologica Europaea), Bonn (SEH), 416 pp. Evaluation rapide de la diversité biologique des Thalmann, U., and T. Geissmann. 2005. New species reptiles et amphibiens de la Réserve Naturelle of wolly lemur Avahi (Primates: Lemuriformes) in Intégrale d'Ankarafantsika. Pp. 98–103 and 135–138 Bemaraha (Central Western Madagascar). American In Une evaluation biologique de la Réserve Journal of Primatology 67:371–376. Naturelle Intégrale d'Ankarafantsika, Madagascar. Vences, M., and F. Glaw. 2002. Molecular Alonso, L.E., T.S. Schulenberg, S. Radilofe, and O. phylogeography of Boophis tephraeomystax: a test Missa (Eds.). Bulletin RAP d'évaluation rapide No. case for east-west vicariance in Malagasy anurans 23, Conservational International, Washington, D.C., (Amphibia, Anura, Mantellidae). Spixiana 25:79– USA. 84. Randrianantoandro, J.C., R. Randrianavelona, R.R. Vences, M., F. Glaw, R. Jesu, and G. Schimmenti. Andriantsimanarilafy, H.E. Fideline, D. 2000. A new species of Heterixalus (Amphibia: Rakotondravony, and R.K.B. Jenkins. 2007. Roost Hyperoliidae) from western Madagascar. African site characteristics of sympatric dwarf chameleons Zoology 35:269–276. (genus Brookesia) from western Madagascar. Vences, M., F. Glaw, and R. Marquez. Eds. 2006. The Amphibia-Reptilia 28:577–581. Calls of the Frogs of Madagascar (3 Audio CD's and Randrianantoandro, J.C., R. Randrianavelona, R.R. booklet, 44 pp.). Alosa, Barcelona (ISBN 84-609- Andriantsimanarilafy, H.E. Fideline, D. 8402-8). Rakotondravony, M. Randrianasolo, H.L. Wollenberg, K.C., D.R. Vieites, A. van der Meijden, Ravelomanantsoa,, and R.K.B. Jenkins. 2008. F. Glaw, D.C. Cannatella, and M. Vences. 2008. Identifying important areas for the conservation of Patterns of endemism and species richness in dwarf chameleons (Brookesia spp.) in Tsingy de Malagasy cophyline frogs support a key role of Bemaraha National Park, western Madagascar. Oryx mountainous areas for speciation. Evolution 42:578–583. 62:1890–1907. Raselimanana, A.P. 2008. Herpétofaune des forets sèches malgaches. Malagasy Nature 1:46–75. Raselimanana, A.P., R.A. Nussbaum, and C.J.

Raxworthy. 2006. Observations and redescription of Zonosaurus boettgeri Steindachner 1891 and description of a second new species of long-tailed

10 Herpetological Conservation and Biology

B A C D E

F G H I J K A) PARFAIT BORA is a PhD student at the University of Antananarivo, Department of Animal Biology. He works on amphibians and reptile conservation in Madagascar and participates in many herpetofaunal surveys on the island. His master thesis was on Mantella and he is developing standard methods for monitoring amphibians at Ranomafana and Andasibe.

B) J. CHRISTIAN RANDRIANANTOANDRO specializes in the ecology and conservation of Malagasy reptiles. He obtained his Diplôme d’Etude Approfondies in 2003 from the University of Antananarivo, in a project funded by the United Kingdom’s Darwin Initiative. This research was on rain forest chameleons. After working as an environmental consultant, he joined Madagasikara Voakajy in 2005 as head of its herpetology program. His recent work focuses on the conservation status of Furcifer chameleons for the IUCN among other herpetological conservation projects. Christian leads the implementation of a Darwin Initiative funded project on chameleon trade and conservation.

C) ROMA RANDRIANAVELONA joined Madagasikara Voakajy in 2006 to work on its Darwin Initiative funded project based in Bemaraha National Park. He developed the organisation’s Mantella conservation program in the Alaotra Mangoro Region. He works on an IUCN funded project to support community-based organizations to conserve and sustainably use natural resources in Mangabe Forest.

D) ELISOA F. HANTALALAINA is preparing her research thesis on the chameleons of Bemaraha National Park for her Diplôme d’Etude Approfondies at the University of Antananarivo. She studied habitat use and roosting ecology of three sympatric species of Brookesia. She works for Madagasikara Voakajy and assists in the preparation of Red List assessments of Malagasy reptiles for the IUCN.

E) RAPHALI R. ANDRIANTSIMANARILAFY obtained his Diplôme d’Etude Approfondies in 2007 from the University of Toliara during a Darwin Initiative funded project to conserve the biodiversity of Malagasy karst habitats. He studied chameleon ecology during his research degree and Madagasikara Voakajy recruited him in 2008 to work on its reptile ecology project. He is preparing Red List assessments of Malagasy reptiles for the IUCN and raising stakeholder support to conserve Furcifer belalandaensis.

F) DANIEL RAKOTONDRAVONY is a Professor and head of the Department of Animal Biology, in the Faculty of Sciences at Antananarivo University, Madagascar. His research specialized on small mammals and conservation biology; he closely collaborates with biologists at Duke University and the Chicago Field Museum, USA.

G) OLGA R. RAMILIJAONA is a Professor at the Department of Animal Biology at the University of Antananarivo, Madagascar. She received her doctoral degree at Institute Pasteur in Paris studying parasitology. She supervises many students working in herpetology at the university. Moreover, she is involved in various joint international projects dealing with Malagasy biodiversity.

H) MIGUEL VENCES is a Professor of Evolutionary Biology at the Technical University of Braunschweig, Germany. He is a systematist, having received his diploma and doctoral degrees at the Zoologisches Forschungsmuseum A. Koenig in Bonn. Since his undergraduate studies 15 years ago, he has studied the taxonomy, biogeography, evolution, and natural history of the amphibians and reptiles of Madagascar. His research, carried out in close collaboration with Frank Glaw and other researchers, has led to the discovery of numerous new species of amphibians and reptiles in Madagascar, and to the elucidation of their molecular phylogenetic relationships.

I) RICHARD K.B. JENKINS is a conservation biologist with a Ph.D. from Cardiff University. He first visited Madagascar in 1992 and made a series of return visits to study rainforest chameleons between 1993 and 1999. Through field studies in the UK and Tanzania, he developed a broad interest in vertebrate ecology and conservation. With his Malagasy colleagues, he founded a national biodiversity conservation organization called ‘Madagasikara Voakajy’ in 2005, which currently has projects focusing on a number of different endemic species, including Mantella aurantiaca, Furcifer belalandaensis, Pteropus rufus and Adansonia grandidieri. He currently works for Bangor University and the University of Kent and coordinates projects on the sustainable use of wild animals in Madagascar.

J) FRANK GLAW is the curator of the herpetology section at the Zoologische Staatssammlung München, Germany. He received his diploma degree at the University of Cologne and the doctoral degree at the Zoologisches Forschungsmuseum A. Koenig in Bonn. Since 1987, he has carried out field work in Madagascar and has specialized on the systematics, bioacoustics and biogeography of the Malagasy herpetofauna.

K) JÖRN KÖHLER is curator for vertebrate zoology at the Hessisches Landesmuseum Darmstadt, Germany. He received his diploma and doctoral degree at the Zoologisches Forschungsmuseum A. Koenig in Bonn and has mainly been working on systematics, natural history, and biogeography of Neotropical and African amphibians and reptiles. Since his undergraduate days,,he has collaborated with Frank Glaw and Miguel Vences.

11 Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar

APPENDIX I sp.: Andafiabe: ZSM 141/2006; Andranopasazy: UADBA 28458, Voucher Specimens 28464, 28472, 28525, 28530, ZSM 49-50/2006; Ankilogoa: UADBA 28058; Bendrao: UADBA 28533, ZSM 81/2006, AMPHIBIANS: Ptychadena mascareniensis: Andafiabe: ZSM 104/2006, 110/2006; Ranotsara: UADBA 28065; Hemidactylus 97/2006, 133/2006; Andranopasazy: UADBA 25667; Bendrao: frenatus: Antsalova: UADBA 28498; Hemidactylus mercatorius: UADBA 25661; Heterixalus carbonei: Andranopasazy: UADBA Anjaha: UADBA 39035; Lygodactylus heterurus: Ankily: UADBA 25619, ZSM 83/2006; Heterixalus luteostriatus: Andranopasazy: 39070; Ranotsara: UADBA 28041; Lygodactylus klemmeri: UADBA 25629; Dyscophus insularis: Bendrao: UADBA 25613, Andranopasazy: UADBA 28488, 28489, ZSM 46-47/2006; Ankily: ZSM 87-88/2006; Tsiandro: UADBA 39051, 39073, 39092; UADBA 39070; Lygodactylus tolampyae: Andranopasazy: UADBA Plethodontohyla fonetana: Bendrao: UADBA 39001, ZSM 39067, 39069, ZSM 5/2006, 26/2006; Ankily: UADBA 39059, 123/2006; Scaphiophryne sp. (aff. calcarata): Anjaha: UADBA 39065; Bendrao: UADBA 39053; Lygodactylus sp.: Bendrao: ZSM 39083, 39085, 39101; Scaphiophryne menabensis: 77/2008; Paragehyra cf. petiti: Ranotsara: UADBA 28038, 28056; Andolombazimba: UADBA 39080, 39086; Andranopasazy: ADBA Paroedura cf. homalorhina: Andolombazimba: UADBA 39030, 39062, 39087, 39090, ZSM 39/2006; Bendrao: UADBA 25611, 39036, ZSM 27/2006; Bendrao: UADBA 39029; Grotte 25612, 25615, 25627, 25630, 39103, ZSM 89-91/2006, 122/2006; d’Anjohimbazimba: UADBA 28529, ZSM 42/2006; Paroedura Anjaha: UADBA 39060; Stumpffia sp. (aff. helenae): Andafiabe: tanjaka: Andafiabe: UADBA 28456, 28499, 28500, 28504, 28531, ZSM 137/2006; Andranopasazy: UADBA 25634, 25660, 25663, ZSM 142-143/2006, 149/2006; Andranopasazy: UADBA 28455, ZSM 21-22/2006; Bendrao: 114/2006; Aglyptodactylus securifer: 28524, 28527, 28528, 39019, 39074, ZSM 18/2006, 43/2006, Andranopasazy: UADBA 25621, 25628, 25646, 25668, 39061, 40/2006, 53/2006; Anjaha: UADBA 39023; Grotte 39098, ZSM 8/2006, 14/2006, 28/2006, 31/2006; 34/2006; Bendrao: d’Anjohimbazimba: ZSM 36/2006; Paroedura sp. (aff. tanjaka): UADBA 25614, 25649, ZSM 111/2006; Laliostoma labrosum: Andafiabe: UADBA 39033, ZSM 128/2006, 163/2006; Phelsuma Andafiabe: 132/2006; Andranopasazy: UADBA 25605, 25608, abbotti chekei: Andafiabe: UADBA 28501; Andranopasazy: 25617, ZSM 16/2006, 33/2006; Ankilogoa: UADBA 39088, 39094; UADBA 39005, ZSM 63/2006; Anjaha: UADBA 39015; Phelsuma Bendrao: UADBA 25607, 39066, 39068; Anjaha: UADBA 39096; dubia: Antsalova: UADBA 28505, ZSM 145/2006; Phelsuma Boophis doulioti: Andranopasazy: UADBA 25604, 25639, 25650, kochi: Andafiabe: UADBA 28526, ZSM 140/2006; Andranopasazy: 28520, 39079, 39089, ZSM 4/2006, 29/2006, 38/2006; Bendrao: UADBA 28521, ZSM 7/2006; Grotte d’Anjohimbazimba: UADBA UADBA 25655, 25669, 39055, 39072, ZSM 92/2006; Boophis 28532; Phelsuma mutabilis: Antsalova: UADBA 28502; Phelsuma occidentalis: Andranopasazy: UADBA 28513, 28515, 28518, ZSM borai: Andafiabe: ZSM 103/2006; Uroplatus cf. ebenaui: Bendrao: 65-66/2006, 69/2006; Ankily: UADBA 39102; Boophis tampoka: UADBA 39009; Uroplatus guentheri: Ankilogoa: UADBA 28031, Andafiabe: UADBA 25616, 25618, 25620, 25622-624, 25654, 28045; Uroplatus cf. henkeli: Andafiabe: UADBA 25603; Ankily: 25664, ZSM 95-100/2006, 101/2006, 139/2006, 144/2006; Anjaha: UADBA 39032; Bendrao: UADBA 25601, 25602, 39017, ZSM UADBA 39097; Blommersia sp. (aff. wittei): Andranopasazy: 112-113/2006, 130-131/2006; Amphiglossus reticulatus: UADBA 39091, 25635, 25637-638, 25640, 25657, 28517, ZSM Andranopasazy: UADBA 39049; Amphiglossus splendidus: 13/2006, 30/2006, 52/2006, 68/2006; Bendrao: UADBA 25641, Ankilogoa: UADBA 28019; Ranotsara: UADBA 28017, 28021, 25662; Gephyromantis sp. (aff. corvus): Anjaha: UADBA 39057, 28080; Amphiglossus sp. 1: Andolombazimba: UADBA 28015; 39100; Ankily: UADBA 39058, 39093; Andranopasazy: UADBA Amphiglossus sp. 2: Andolombazimba: UADBA 28030; Anjaha: 39081, 39082, 39099, ZSM 23/2006, 37/2006; Bendrao: ZSM UADBA 39027, 39038, 39050; Madascincus cf. intermedius: 107/2006; Mantella betsileo: Andranopasazy: ZSM 44/2006 Anjaha: UADBA 39027, 39038, 39040, 39044, 39045, 39047, (=FGZC 759); Mantella sp. (aff. expectata) Andranopasazy: 39050; Trachylepis cf. dumasi: Andafiabe: ZSM 146/2006; UADBA 25632, 25636, 25647, 25653, 25656, 25666, ZSM Andranopasazy: UADBA 39054, 39075; Trachylepis gravenhorstii: 15/2006, 32/2006, 44/2006, 58/2006; Anjohimbazimba: UADBA Anjaha: UADBA 28042, 39026, 39034; Trachylepis tandrefana: 39095; Bendrao: ZSM 73/2006, 120/2006; Mantidactylus sp. (aff. Andranopasazy: UADBA 39037; Ankily: UADBA 39031; ulcerosus): Andafiabe: UADBA 25631, 25670, ZSM 134-136/2006; Trachylepis volamenaloha: Andranopasazy: UADBA 39078; Andranopasazy: UADBA 25610, 25648, ZSM 9-10/2006, 61- Anjaha: UADBA 39071; Brookesia brygooi: Andafiabe: ZSM 62/2006; Bendrao: UADBA 25606, 25609, 25625, 25642, 25651, 138/2006; Andranopasazy: UADBA 28468, 28471, 28491, 28493- 25659, 25671, ZSM 74-75/2006, 78/2006. 497, 39056, ZSM 11-12/2006, 35/2006; Bendrao: UADBA 39077, ZSM 80/2006, 119/2006; Brookesia exarmata: Andafiabe: ZSM REPTILES: Acrantophis madagascariensis: Bendrao: ZSM 147/2006; Andranopasazy: UADBA 28486, 39052, 39063-064, 155/2006; Sanzinia madagascariensis volontany: Andranopasazy: ZSM 72/2006; Brookesia perarmata: Andranopasazy: ZSM UADBA 28539, ZSM 48/2006, 67/2006; Bendrao: UADBA 28540; 17/2006; Bendrao: UADBA 25358, 28482, 28487, 28492, ZSM Alluaudina bellyi: Bendrao: UADBA 28535, 39014, ZSM 93/2006, 118/2006, 125-126; Furcifer lateralis: river near Andafiabe: ZSM 115/2006; Dromicodryas bernieri: Bendrao: UADBA 28541; 79/2006; Furcifer nicosiai: Andranopasazy: UADBA 28440, 28481, Heteroliodon lava: Andranopasazy: UADBA 39021; Ankilogoa: 28485, 39011, 39041, ZSM 2/2006, 20/2006, 51/2006; Ankily: UADBA 28075; Langaha madagascariensis: Ranotsara: UADBA UADBA 39043; Bendrao: ZSM 84/2006; Tsiandro: UADBA 39048; 28006; Liophidium torquatum: Ankilogoa: UADBA 28139; Furcifer oustaleti: Andranopasazy: ZSM 1/2006; Bendrao: UADBA Ranotsara: UADBA 28115, 28135; Madagascarophis colubrinus: 28484, 28490, ZSM 105/2006; Tsiandro: UADBA 39039; Andranopasazy: UADBA 28542; Mimophis mahfalensis: Zonosaurus bemaraha: Anjaha: UADBA 39008, 39013; Andafiabe: ZSM 85/2006; Andranopasazy: UADBA 28536; Andranopasazy: UADBA 39018, ZSM 3/2006; Ankily: UADBA Stenophis citrinus: Andranopasazy: UADBA 28537-538, 39010, 39022; Zonosaurus laticaudatus: Andranopasazy: ZSM 64/2006; ZSM 82/2006; Bendrao: ZSM 117/2006; Stenophis Andolombazimba: UADBA 28036; Zonosaurus cf. pseudogranuliceps: Bendrao: UADBA 39020, ZSM 148/2006; madagascariensis: Andranopasazy: ZSM 25/2006; Bendrao: Tsiandro: UADBA 39016; Stenophis cf. variabilis: Andranopasazy: UADBA 28523; Chalarodon madagascariensis: Antsalova: UADBA 28534; Thamnosophis mavotenda: Bendrao: ZSM UADBA 28507; Oplurus cuvieri: Andranopasazy: UADBA 28503, 127/2006; Typhlops sp. 1: Bendrao: UADBA 39045; Ranotsara: 28506, ZSM 86/2006. UADBA 39045; Typhlops sp. 2: Ankilogoa: UADBA 28077; Blaesodactylus sakalava: Andranopasazy: UADBA 28522; Bendrao: ZSM 106/2006; Tsiandro: UADBA 39004; Geckolepis

12 Herpetological Conservation and Biology

APPENDIX II. Comparative species composition of surveyed sites in western Madagascar: X1, Tsingy de Bemaraha (present study); X2, Ankarana; X3, PN Ankarafantsika; X4, Kirindy (CFPF); X5, PN Mikea; X6, PN Tsimanampetsotsa; X7, Bemaraha (data from X2-X7 unchanged after Raselimanana, 2008).

Study site Species X1 X2 X3 X4 X5 X6 X7 Amphibians Ptychadena mascareniensis + + + + + + + Heterixalus betsileo + Heterixalus carbonei + + + Heterixalus luteostriatus + + + + Heterixalus tricolor + + Hoplobatrachus tigerinus + Cophyla berara Cophyla phyllodactyla + Dyscophus guineti + Dyscophus insularis + + + + + Plethodontohyla fonetana + Rhombophryne sp. + + Scaphiophryne brevis + + + + Scaphiophryne calcarata + + + + Scaphiophryne sp. (aff. calcarata) + Scaphiophryne menabensis + + + Stumpffia gimmeli + Stumpffia aff. pygmaea + Stumpffia sp. (aff. helenae) + + Aglyptodactylus laticeps + + Aglyptodactylus securifer + + + + Laliostoma labrosum + + + + + + + Boophis doulioti + + + + + Boophis madagascariensis + Boophis occidentalis + Boophis tampoka + Boophis aff. occidentalis Boophis xerophilus + Blommersia wittei + + Blommersia sp. (aff. wittei) + Gephyromantis pseudoasper + Gephyromantis sp. (aff. corvus) + Mantella betsileo + + + Mantella ebenaui Mantella sp. (aff. expectata) + Mantella aff. viridis + Mantidactylus bellyi + Mantidactylus aff. corvus + Mantidactylus ulcerosus + Mantidactylus sp. (aff. ulcerosus) + Tsingymantis antitra + Total Amphibians : 19 10 10 15 6 4 17

Study site X1 X2 X3 X4 X5 X6 X7 Reptiles Acrantophis dumerili + + + Acrantophis madagascariensis + + + + Sanzinia madagascariensis volontany + + + + Alluaudina bellyi + + + Alluaudina mocquardi + Compsophis albiventris + Dromicodryas bernieri + + + + + + Dromicodryas quadrilineatus + + Heteroliodon lava + + Heteroliodon occipitalis + + + Ithycyphus miniatus + + Ithycyphus oursi + + Langaha alluaudi + Langaha madagascariensis + + + + + + Leioheterodon geayi + + + Leioheterodon madagascariensis + + + + + + Leioheterodon modestus + + + + + + Liophidium apperti + + Liophidium chabaudi + + Liophidium therezieni + Liophidium torquatum + + + + +

13 Bora et al.—Amphibians and Reptiles of the Tsingy de Bemaraha Plateau, Madagascar

Liophidium trilineatus + Liophidium vaillanti + Liopholidophis dolicocercus + Liopholidophis lateralis + + Madagascarophis citrinus Madagascarophis colubrinus + + + + + + + Madagascarophis meridionalis + + Madagascarophis ocellatus + + Mimophis mahfalensis + + + + + + + Pararhadinea melanogaster + Pseudoxyrhopus kely + Pseudoxyrhopus quinquelineatus + Stenophis pseudogranuliceps + Stenophis cf. variabilis + + Stenophis capuroni + Stenophis citrinus + + + Stenophis inornatus + Stenophis granuliceps + Stenophis pseudogranuliceps + + + + Stenophis tulearensis + + Stenophis n. sp. + Thamnosophis mavotenda + Typhlops arenarius + + + + + Typhlops decorsei + + + Typhlops mucronatus + + Typhlops sp. 1 (aff. arenarius) + Typhlops sp. 2 + Erymnochelys madagascariensis + Pelomedusa subrufa + + Astrochelys radiata + Pyxis arachnoides + + + Pyxis planicauda + Crocodylus niloticus + + + + Blaesodactylus boivini + Blaesodactylus sakalava + + + + + + Ebenavia maintimainty + Geckolepis maculata + + + + Geckolepis typica + + + + Geckolepis sp. + Hemidactylus frenatus + + Hemidactylus mercatorius + + + + + + + Lygodactylus heterurus + + + Lygodactylus klemmeri + + Lygodactylus madagascariensis + Lygodactylus tolampyae + + + + + + Lygodactylus tuberosus + Lygodactylus verticillatus + Lygodactylus sp. + Matoatoa brevipes + + Paragehyra petiti + Paragehyra cf. petiti + Paroedura bastardi + + + + Paroedura homalorhina + + Paroedura cf. homalorhina + Paroedura karstophila + + Paroedura maingoka + Paroedura picta + + + Paroedura stumpffi + + + Paroedura tanjaka + + Paroedura sp. (aff. tanjaka) + Paroedura vahiny + + + Paroedura vazimba + Phelsuma abbotti + + Phelsuma abbotti chekei + Phelsuma breviceps + + Phelsuma bombetokensis + + Phelsuma madagascariensis + + + + Phelsuma dubia + Phelsuma kochi + Phelsuma mutabilis + + + + + + Phelsuma borai + Phelsuma standingi + Uroplatus ebenaui + Uroplatus cf. ebenaui + Uroplatus giganteus + +

14 Herpetological Conservation and Biology

Uroplatus guentheri + + + + Uroplatus henkeli + Uroplatus cf. henkeli + Amphiglossus andranovahensis + + Amphiglossus mandokava Amphiglossus ornaticeps + + + + + Amphiglossus aff. ornaticeps + Amphiglossus reticulatus + + Amphiglossus splendidus + + Amphiglossus stumpffi Amphiglossus n. sp. + Amphiglossus sp.1 + Amphiglossus sp.2 + Androngo trivittatus + Cryptoblepharus boutonii Madascincus igneocaudatus + + Madascincus intermedius + + + + + Madascincus cf. intermedius + Trachylepis aureopunctata + + Trachylepis dumasi + + Trachylepis cf. dumasi + Trachylepis elegans + + + + + + + Trachylepis gravenhorstii + + + + Trachylepis tavaratra + Trachylepis tandrefana + + + Trachylepis vato + Trachylepis volamenaloha + + Pygomeles braconnieri + + Sirenoscincus yamagishii + Voeltzkowia fierinensis + Voeltzkowia lineata + + Voeltzkowia petiti + Voeltzkowia rubrocaudata + + Voeltzkowia n. sp. + Tracheloptychus madagascariensis + Tracheloptychus petersi + Brookesia brygooi + + + Brookesia decaryi + Brookesia ebenaui + Brookesia exarmata + + Brookesia minima Brookesia perarmata + + Brookesia stumpffi + Furcifer angeli Furcifer antimena + Furcifer labordi + + Furcifer lateralis + + + Furcifer nicosiai + + Furcifer petteri + Furcifer cf. petteri + Furcifer oustaleti + + + + + + + Furcifer pardalis + Furcifer rhinoceratus + Furcifer tuzetae Furcifer verrucosus + + Furcifer n. sp. + Zonosaurus bemaraha + + Zonosaurus haraldmeieri + Zonosaurus karsteni + + + + + Zonosaurus laticaudatus + + + + + Zonosaurus quadrilineatus + Zonosaurus rufipes + Zonosaurus trilineatus + Zonosaurus tsingy + Zonosaurus cf. madagascariensis + Chalarodon madagascarensis + + + Oplurus cuvieri + + + + Oplurus cyclurus + + Oplurus quadrimaculatus + Oplurus saxicola + Total Reptiles 60 40 44 42 58 53 54

15 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

High haplotype diversity in a microendemic Malagasy gecko species, Lygodactylus mirabilis (Pasteur, 1962)

YLENIA CHIARI,1,2,6 DAVID R. VIEITES,3 JERRY GUO,1 PARFAIT BORA,4 MIGUEL VENCES5 1 Department of Ecology and Evolutionary Biology and YIBS-Molecular Systematics and Conservation Genetics Lab., Yale University, 21 Sachem St., New Haven, CT, 06520-8106 USA 2 Present address: Institut des Sciences de l'Evolution, CNRS-UMR n° 5554, CC 064, Université Montpellier 2, 2, Place Eugène Bataillon, 34095 MONTPELLIER cedex 5, France 3 Museo Nacional de Ciencias Naturales, CSIC, C/ José Gutierrez Abascal nº2, 28006, Madrid 4 Département de Biologie Animale, Université d’Antananarivo, Antananarivo 101, Madagascar 5 Division of Evolutionary Biology Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106 Braunschweig, Germany 6 Corresponding author: Institut des Sciences de l'Evolution, CNRS-UMR n° 5554, CC 064, Université Montpellier 2, 2, Place Eugène Bataillon, 34095 MONTPELLIER cedex 5, France. E-mail: [email protected]

Abstract

Among Malagasy montane reptiles, the diurnal gecko Lygodactylus mirabilis has one of the most restricted distribution ranges, occurring only on the Tsiafajavona mountain on the Ankaratra massif. Here we report data on the current distribution of this species and its genetic diversity. Mitochondrial data based on samples collected in the only previously known distribution area (the Tsiafajavona peak) showed numerous haplotypes at low frequencies, suggesting a past population expansion and a relatively high within-species genetic diversity in an extremely small distribution area. Our field survey also revealed that the range of the species is larger than previously thought, but still is extremely small and restricted to the Ankaratra massif.

Key words: Madagascar, Lygodactylus, 16S rRNA, Cytochrome b, Mountain microendemism

Introduction

Madagascar has been proposed as a good study system for understanding the patterns and processes of species diversification (Vences et al. 2009). Recent publications (Vences et al. 2009; Vieites et al. 2009) have revealed an astonishingly high number of undescribed species on the island (see Vences et al. 2009 for a list of recent publications on cryptic Malagasy species). Previous studies have shown that tropical montane habitats are especially important to herpetofaunal diversity in Madagascar (e.g., Raxworthy & Nussbaum 1996), because they exhibit a large degree of local endemism, with some species occurring only at high elevation with extremely limited distribution areas (Raxworthy 2003). Out of the about 90 currently described Malagasy gecko species, 22 belong to the genus Lygodactylus (Glaw & Vences 2007; Puente et al. 2009). This genus includes 60 recognized species mostly distributed in Africa and Madagascar, with a few species in South America (Bauer 2003). Lygodactylus are small, diurnal geckos, normally less than 40 mm in snout-vent length (Pasteur 1964). In Madagascar, six Lygodactylus species are known to live above 1500 m altitudes, on a mountain chain that spans the island longitudinally and is otherwise known as the high plateau. Lygodactylus mirabilis (Pasteur 1962), only known to live in the highest elevation area on Tsiafajavona mountain on the Ankaratra massif, seems to be the species with the most adapted morphology to its environment among the montane dwarf geckos of Madagascar, with strongly

Accepted by A. Bauer: 19 Sept. 2009; published: 21 Oct. 2009 43 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. keeled scales, a reduced first finger, and polymorphic coloration. It occurs at high elevations above 2000 m and attains a maximum snout-vent length of 29 mm (Puente et al. 2009; Vences et al. 2002). The Ankaratra massif is characterized by remnants of primary rainforest between 1700-2000 m, while above 2000 m the forest is replaced by grasslands (Goodman et al. 1996; Raxworthy & Nussbaum 1996; Vences et al. 2002). Reproduction of L. mirabilis appears to occur throughout the year, including the warm-wet austral summer and the cold-dry austral winter (Vences et al. 2002). Besides this limited information, little is known about this microendemic species, including the amount of genetic diversity in its population. We here present the first data on the distribution and genetic diversity of this species.

Materials and methods

Sampling and distribution During a three day survey carried out by seven people in February 2006 on the Ankaratra Massif in central Madagascar, geographic coordinates and altitude above sea level (asl) were recorded by GPS instruments for each individual of L. mirabilis encountered as well as for egg deposition sites of this species (non-glued small eggs found under stones, see Vences et al. 2002). Presence/absence along all the surveyed localities was recorded for this animal and its deposited eggs. The surveyed localities extend along the known distribution range of the species on the mountain-top of Tsiafajavona and the surrounding mountain peaks. Geographic coordinates were used to construct distribution maps with ArcView GIS (ver. 3.2.a, Esri® 1992- 2000; ESRI, Redlands, CA). Moreover, 31 samples for DNA analysis were collected through the only currently known distribution area (Fig. 1B and C for range of the sampling). Tissue samples for DNA analysis were not collected for the other surveyed localities. Tissues of the collected samples have been deposited in the Peabody Museum at Yale University and in the collection of M. Vences in the Technical University of Braunschweig.

Molecular protocols Genomic DNA was extracted from tailclip tissues fixed in ethanol 99% using the DNeasy Blood & Tissue Kit from Qiagen. Fragments of the mitochondrial genes cytochrome b and 16S rRNA were amplified via the polymerase chain reaction (PCR). A fragment of 761 base pairs (bp) of the cytochrome b gene was amplified using the primer combination CBL14753 and CB3H (Austin et al. 2004) or the newly designed primer Lygo_cytb (5’ CAAATAGGAAGTATCATTCAG 3’) in combination with CBL14753. A fragment of 490 bp of the 16S rRNA was also amplified using the universal primers 16SA-L and 16SB-H (Palumbi et al. 1991). PCRs and purification of PCR products followed standard protocols. Sequences (in both directions) were resolved on a 3730 DNA Analyzer (Applied Biosystems). Random individual samples were amplified and sequenced again to verify for possible PCR errors. Sequences were deposited in Genbank; accession numbers: GQ910795-GQ910852.

Molecular analyses Sequences were checked and aligned with SEQUENCHER (GeneCodes Corporation, Ann Arbor, MI, USA) using the Clustal algorithm. Alignment was subsequently refined by eye. The number of variable and parsimony-informative sites were calculated using MEGA v.4.0 (Tamura et al. 2007), while nucleotide diversity (π, Nei & Li 1979) and gene diversity (h, Nei & Tajima 1981) were obtained with ARLEQUIN v.3.1 (Excoffier et al. 2005). MEGA was used to calculate the sequence divergence (as uncorrected p-distances) and base frequencies for the complete dataset (both markers analysed together) and for each marker independently, with gaps or missing data deleted in pairwise comparison. R (The R Development Core Team 2008) was used to test for normality of the p-distances of each marker and to run an analysis of variance (ANOVA) F test on the regression between the two used markers.

44 · Zootaxa 2269 © 2009 Magnolia Press CHIARI ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

FIGURE 1. A) Map of Madagascar with indicated the location of the Ankaratra Massif. B) Distribution map of the surveyed area along the mountain peaks of the Ankaratra Massif in Madagascar (see Material and Methods for further explanations). White points indicate where Lygodactylus mirabilis specimens have been found; grey points indicate the locations of the individuals sampled and used for the genetic analysis. C) Altitudinal range of the recorded individuals of L. mirabilis found. Grey areas are proportional to the number of L. mirabilis eggs found at specific altitudes.

GENETIC DIVERSITY IN LYGODACTYLUS MIRABILIS Zootaxa 2269 © 2009 Magnolia Press · 45 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

To compare genetic diversity (as uncorrected p-distances) of the 16S rRNA fragment of L. mirabilis for 409 homologous bp with other Lygodactylus species, 35 sequences belonging to seven species were downloaded from Genbank (for a list of the species and Genbank accession numbers see Table 1). Moreover, to compare the genetic diversity (as uncorrected p-distances) observed at the cytochrome b gene in L. mirabilis with the homologous sequences of other species of geckos, other Gekkonidae cytochrome b sequences were downloaded from Genbank (for a list of species and Genbank accession numbers see Table 2). Only species for which more than six individuals per species were available were used. Sequences of the 16S rRNA and cytochrome b fragments were collapsed (each marker alone and concatenated) into haplotypes using the program DNAcollapser v.1.0, available online. Haplotype sequences of the concatenated dataset were used to construct a haplotype network using TCS (Clement et al. 2000), with the gaps coded as a fifth state. We tested the neutrality of the mutations of the cytochrome b data comparing rates of non-synonymous and synonymous mutations using the online website datamonkey.org. We used two independent codon-biased maximum likelihood methods (FEL and IFEL) to detect codons under selection, using the HKY85 model as estimated to be the best fitting model to the data (best fitting model found using the same website). The IFEL method is an extension of the FEL method, allowing the estimation of the ratio between non-synonymous and synonymous substitution rates separately on internal and terminal branches of the tree built using the data (see Kosakovsky Pond et al. 2006 for additional information). Furthermore, after confirming the lack of recombination using the above mentioned website (datamonkey.org), Fu’s Fs neutrality test (Fu 1997) was run in ARLEQUIN on the concatenated dataset of 27 sequences (for which both gene fragments were available) and on each single gene to detect population growth, using 1000 simulated samples to obtain the Fs statistic. Episodes of population growth generally lead to negative values of Fs. The same software was also used to perform a mismatch distribution analysis on the same dataset to characterize population expansion. A mismatch distribution corresponds to the distribution of the observed number of nucleotide differences between pairs of haplotypes. The distribution may have different shapes depending on the different scenarios (e.g., unimodal shape for a population gone through a recent demographic expansion, Slatkin & Hudson 1991). ARLEQUIN uses the non-linear least-square approach to find the values of the demographic parameters, by minimizing the sum of square deviation (SSD) between the observed and the expected distribution following a stepwise expansion model. The expansion model is rejected if 95% (α=0.1) or more of the simulated mismatch distribution have a lower SSD of the observed under the hypothesis that the estimated parameters are the true ones. The raggedness index (r, Harpending 1994), corresponding to the magnitude of change in the frequencies of the mismatch classes, is also used to understand if the population experienced an expansion. Larger values of r are characteristic of a stationary population with a multimodal distribution, while smaller values indicate unimodal distribution typical of an expanding population. For our mismatch distribution analysis, we used a bootstrap number of 100.

Results

Distribution Fig. 1 shows the distribution and the altitudinal level of occurrence of Lygodactylus mirabilis. Despite the large searching area and effort, animals were found only on two mountain peaks (Fig. 1B) indicating an extremely restricted distribution area. However, the occurrence of the second population on a mountain neighboring the Tsiafajavona peak to the north is a new record (corresponding to the peak of 2607 m asl that bears the same name as the entire massif, Ankaratra). Altitudinal distribution range spans from 2350 to over 2600 m asl, with a higher concentration of individuals observed between 2450 and 2550 m asl (Fig. 1C), where we also found eggs. In the egg deposition sites we observed up to six eggs laid under the same stone (data not shown).

46 · Zootaxa 2269 © 2009 Magnolia Press CHIARI ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Genetic diversity Sequences were obtained from a total of 31 individuals of Lygodactylus mirabilis for the 16S rRNA fragment and from a subset of 27 individuals for the cytochrome b fragment. For the 16S rRNA fragments we needed to add eight gaps to correctly align the sequences. Of the 761 bp of the cytochrome b fragment analysed, 41 sites were variable, 16 were parsimony-informative, and 19 haplotypes were recovered. Out of the 490 bp of the 16S fragments, 13 sites were variable and 11 parsimony-informative and 15 haplotypes were found. Fig. 2 shows the relationship existing between the pairwise p-distances of the cytochrome b and 16S markers for the 27 individuals for which both markers were available. Correlation between the two markers was not linear (R2= 0.25), indicating that they do not evolve in a similar way; however, this could be due to the small sample size used. In fact, the results of the ANOVA indicate that the p-distances of the two markers are not statistically different (degree of freedom=1, F value= 118.67, p= 2.2e-16). All sequences included in this study experienced typical characteristics of mitochondrial DNA. Base composition showed a deficiency of guanine, especially in the cytochrome b gene (values are approximated for excess; cytochrome b: T= 28%, A= 31%, C= 26%, G= 15%; 16S rRNA: T= 20%, A= 30%, C= 28%, G= 22%; concatenated dataset: T= 25%, A= 27%, C= 30%, G= 18%) as already reported for reptiles (Harris 2002), and an open reading frame was maintained for the cytochrome b marker. This, together with the lack of double peaks observed in the sequences suggests that we did not amplify nuclear pseudogenes (numts) instead of the mitochondrial markers. Haplotype and nucleotide diversity values were h=0.912±0.032 and π=0.008±0.005 and h=0.966±0.021 and π=0.007±0.004 for the 16S and cytochrome b respectively and of h=0.986±0.014 and π=0.006±0.003 for the concatenated data set (we considered only the 27 individuals for which data from both markers were obtained). When compared with the other species of Lygodactylus available on Genbank for 409 homologous bp of the 16S rRNA gene, L. tolampyae shows the highest intra-specific p-distance value (Table 1). Table 2 shows the average p-distances for the same homologous fragment of cytochrome b in different species of geckos, indicating that the average p-distances found in L. mirabilis are lower than the ones observed in other species (but probably also sampled on larger geographic areas).

FIGURE 2: Three-dimensional plot of pairwise uncorrected p-distances for the cytochrome b (x-axis) and 16S rRNA (y- axis) markers. The number of observation (z-axis) indicates the number of times that a defined combination of cytochrome b – 16S distances has been observed.

GENETIC DIVERSITY IN LYGODACTYLUS MIRABILIS Zootaxa 2269 © 2009 Magnolia Press · 47 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

FIGURE 3: Haplotype network of L. mirabilis using all the 31 sampled individuals (1251 bp, cytochrome b and 16S rRNA genes). Circle size indicates the frequency of the haplotype, as indicated by the circles on the left side of the figure. Black dots indicate missing haplotypes. Straight lines between two haplotypes indicate that they differ by one mutation.

FIGURE 4: Mismatch distribution graph of the 27 mtDNA sequences (1251 bp, cytochrome b and 16S rRNA genes) in L. mirabilis. The solid line with diamonds represents the observed distribution curve and the diamonds are the relative frequencies of nucleotide differences between pair of individuals. The tick solid line represents the distribution expected from an expanding population. Dashed lines indicate the 95% confidence interval. Additional information can be found in the Materials and Methods.

48 · Zootaxa 2269 © 2009 Magnolia Press CHIARI ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

The analysis of the 1251 bp of both gene fragments concatenated resulted in a total of 25 haplotypes out of 31 individuals. The haplotype network constructed from these 25 haplotypes shows the absence of any high frequency haplotype (Fig. 3). The absolute genetic distance between the different sequences goes from a minimum of 0 to a maximum of 18 substitutions for the concatenated data set of 27 individuals (average absolute distance: 7), between 0 and 16 for the cytochrome b (average absolute distance: 5), and from 0 to 9 for the 16S rRNA (average absolute distance: 2). Average p-distances are 0.7% for the complete dataset of 27 individuals (range 0.0-1.9%) and for cytochrome b (range 0.0-2.1%) and 0.5% for the 16S rRNA gene (range 0.0-0.8%). Numerous missing haplotypes were found. We did not detect selection in our dataset. Only two amino acid sites of the cytochrome b gene (sites 119 and 145) resulted to be under negative selection (dN/dS<0) with significant p-value (0.04 and 0.01 for the sites 119 and 145, respectively). However, the same sites did not appear to be under selection according to the IFEL method, which is more suitable for the analysis of population data. Finally, the Fu’s Fs test indicated episodes of population growth (Fs= -10.62216, p= 0.002 for the concatenated dataset; Fs= -8.87486, p= 0.001 for the cytochrome b gene and Fs= -4.64407, p= 0.03 for the 16S), further confirmed by the mismatch analysis showing a distribution that follows the one expected under an expansion model (Fig. 4). This result is confirmed by both SSD and raggedness index tests (SSD= 0.006 and p (SSD simulated > SSD observed)= 0.51; r=0.015 and p(r simulated> r observed)= 0.31).

TABLE 1. Species, Genbank accession numbers, number of individuals (N), and average p-distances (in %) used for the comparative analysis done on 409 bp of the 16S rRNA gene fragment. Species Accession number N p-distances L. mirabilis GQ910795-GQ910825 31 0.5 L. verticillatus AY653289-91 3 0.0 L. tuberosus AY653283-88 6 0.2 L. tolampyae AY653278-80 3 9.1 L. pictus AY653259 10 1.6 AY653265-72 AY653276 L. miops AY653260-63 4 0.0 L. madagascariensis AY653239 6 4.3 AY653254-58 L. bivittis AY653242-44 3 0.0

Discussion

Boumans et al. (2007) and Münchenberg et al. (2008) found high levels of 16S rRNA variation in a number of widespread lizard species throughout Madagascar. This variation, however, mostly corresponded to differences between geographical clusters of populations whereas specimens from the same site normally shared the same haplotype. In contrast, in L. mirabilis, haplotypes are shared by a maximum of two individuals and only 38% of individuals had shared haplotypes (concatenated 16S rRNA and cytochrome b). The haplotype network presented in this study was built based on concatenated sequences of two genes, 16S and cytochrome b, which increases the chance of finding differences between haplotypes. But even if 16S is analyzed separately, 15 haplotypes are found in 31 individuals. Our molecular data therefore reveal a remarkable level of genetic diversity in L. mirabilis with numerous low frequency haplotypes and no main haplotype occurring in a larger number of specimens. The observed average genetic distance between individuals observed in L. mirabilis is not especially high when compared to the within species average genetic distances found in other gecko species (Table 2). However, our genetic results pertain to a species that

GENETIC DIVERSITY IN LYGODACTYLUS MIRABILIS Zootaxa 2269 © 2009 Magnolia Press · 49 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. occurs in an extremely small range of only a few square km and the lack of population genetic studies on other gecko species with similarly restricted population distribution areas precludes any rigorous comparison of within-population genetic diversity.

TABLE 2. Genus, species, number of individuals (N), and average p-distances (in %) used for the comparative analysis done on a fragment of the cytochrome b gene. Bp indicates the number of homologous base pairs considered for each genus and L. mirabilis. Genus Species Bp N Within species average p-distances Lygodactylus L. mirabilis 302 27 0.4 Hemidactylus H. frenatus 10 8.8 H. bouvieri 15 6.7 H. turcicus 41 1.9 H. angulatus 25 7.9 H. mabouia 32 1.7 Lygodactylus L. mirabilis 713 27 0.7 Phelsuma P. lineata 9 9.0 P. kochi 6 8.3 P. abbotti 7 2.9 Lygodactylus L. mirabilis 306 27 0.4 Coleodactylus C. septentrionalis 33 10.3 C. amazonicus 68 19.8 C. brachystoma 7 18.2 C. meridionalis 47 11.5 Lygodactylus L. mirabilis 732 27 0.7 Gekko G. japonicus 6 0.1 G. wenxianensis 6 0.4 G. gecko 10 5.2 Lygodactylus L. mirabilis 356 27 0.5 Pachydactylus P. weberi 8 2.2 P. montanus 20 9.1 Lygodactylus L. mirabilis 543 27 0.7 Tarentola T. boettgeri 40 8.0

Lygodactylus L. mirabilis 340 27 0.5 Phyllurus P. ossa 32 3.1

One possible explanation for the syntopic occurrence of highly divergent mtDNA haplotypes observed in L. mirabilis could be the presence of cryptic species. However, we did not find two or more well- differentiated and genetically homogeneous clades in our dataset. Thus, not one but several cryptic species would need to be invoked to account for the variation observed. Furthermore, the maximum 16S rRNA and cytochrome b genetic divergence (9 as absolute distance and 0.8% for p-distances and 16 and 2.1% for the 16S rRNA and cytochrome b respectively; see results for average distances) is below the divergence between geographical variants of the same species in geckos (e.g., Boumans et al. 2007; Lamb & Bauer 2000) and lower than the genetic divergence observed among distinct species of geckos (e.g. Rocha et al. 2009 and references therein). Therefore, it would be more conservative and in line with current knowledge of gecko

50 · Zootaxa 2269 © 2009 Magnolia Press CHIARI ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. phylogeography to view all individuals as belonging to L. mirabilis. Discussion should therefore turn to other factors that may have led to the high haplotype mtDNA diversity observed. Our results support a scenario in which L. mirabilis experienced a population growth in which multiple haplotypes were generated with the following extinction of some of these haplotypes. Some authors previously proposed a high mitochondrial substitution rate in geckos (Jesus et al. 2002; Harris 2002; Blair et al. 2009) as estimated by very high divergences in mitochondrial genes along with low divergences in nuclear genes. The pattern found in L. mirabilis could be explained in terms of high mitochondrial substitution rate if this species recently expanded. However, the haplotype network and evidence for a past demographic expansion from Fu’s Fs test suggests a more complex scenario for L. mirabilis, with multiple subgroups of haplotypes. This could be in agreement with a population history characterized by multiple periods of isolation during climate shifts, followed by population growth and consequent genetic diversity among these isolated populations (e.g., on different mountain tops) and secondarily contact with subsequent genetic admixture (in a similar way to what is described for ice age refugia and secondary contacts e.g., in Hewitt 1996). As our results are based on two maternally inherited markers, additional nuclear data and the inclusion of samples from the newly found population would help to better estimate the history of this species. Whether geckos generally have a particularly high mitochondrial mutation rate, or whether our results can be explained by a species-specific pattern of population history and population structure, would have profound consequences for the usage of mitochondrial data in the discovery of species diversity in the Gekkonidae. In fact, divergence thresholds of mitochondrial genes are increasingly used to identify candidate species of organisms (e.g., Vieites et al. 2009) although due to multiple restrictions they need to be applied with caution and only to provide preliminary assessments, never as exclusive argument to actually describe new species (e.g., see Rubinoff et al. 2006 on the risks of using mitochondrial genes for species identification). This might even more be true in geckos if high mitochondrial divergences in these lizards may indeed turn out to reflect a mitochondrial substitution rate higher than in other squamates.

Acknowledgments

We are grateful to Aaron Bauer, Salvador Carranza, Scott Glaberman and Arie van der Meijden for useful comments on this work, to Sara Rocha for technical advices, to Gregory Watkins-Colwell for helping with the import permits and to Adalgisa Caccone for supporting this work. Tokihery Razafindrabe, Dina Malala Ravelonkasina and Edwige Faliarisoa contributed to the field sampling. We are indebted to the University of Antananarivo and ICTE/MICET for logistic assistance and to the Malagasy authorities for research and export permits. Field work was supported by an Ambassadorial Scholarship of the Rotary Foundation to YC. Laboratory work was supported by a grant of the Sigma Xi Grants-in-Aid of Research and Yale Scientific and Engineering Association to JG and YIBS funding to Adalgisa Caccone. This is the publication ISEM 2009- 100 of YC.

References

Austin, J.J., Arnold, E.N. & Jones, C.G. (2004) Reconstructing an island radiation using ancient and recent DNA: the extinct and living day geckos (Phelsuma) of the Mascarene Islands. Molecular Phylogenetics and Evolution, 31, 109–122. Bauer, A.M. (2003) Gekkonidae, geckos. In: Goodman, S. & Benstead, J.P. (Eds.) The Natural History of Madagascar, University of Chicago Press, Chicago, pp. 973–977. Blair, C., Méndez de la Cruz, F. R., Ngo, A., Lindell, J., Lathrop, A. & Murphy, R. W. (2009) Molecular phylogenetics and taxonomy of leaf-toed geckos (Phyllodactylidae: Phyllodactylus) inhabiting the peninsula of Baja California. Zootaxa, 2027, 28–42. Boumans, L., Vieites, D.R., Glaw F. & Vences M. (2007) Geographical patterns of deep mitochondrial differentiation in widespread Malagasy reptiles. Molecular Phylogenetics and Evolution, 45, 822–839.

GENETIC DIVERSITY IN LYGODACTYLUS MIRABILIS Zootaxa 2269 © 2009 Magnolia Press · 51 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Clement, M., Posada, D. & Crandall, K.A. (2000) TCS: a computer program to estimate gene genealogies. Molecular Ecology, 9, 1657–1659. Excoffier, L., Laval, G. & Schneider, S. (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50. Fu, X.Y. (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147, 915–925. Glaw, F. & Vences, M. (2007) A Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Cologne, Vences & Glaw Verlag. Goodman, S.M, Rakotondravony, D., Schatz, G. & Wilmé, L. (1996) Species richness of forest-dwelling birds, rodents and insectivores in a planted forest of native trees: a test case from the Ankaratra, Madagascar. Ecotropica, 2, 109– 120. Harpending, H.C. (1994) Signature of ancient population growth in a low-resolution mitochondrial DNA mismatch distribution. Human Biology, 66, 591–600. Harris, D.J. (2002) Reassessment of comparative genetic distance in reptiles from the mitochondrial cytochrome b gene. Herpetological Journal, 12, 85–86. Hewitt, G.M. (1996) Some genetic consequences of ice ages, and their role in divergence and speciation. Biological Journal of the Linnean Society, 58, 247–276. Jesus, J., Brehm, A. & Harris, D.J. (2002) Relationships of Tarentola (Reptilia: Gekkonidae) from the Cape Verde Islands estimated from DNA sequence data. Amphibia-Reptilia, 23, 47–54. Kosakovsky Pond, S.L., Frost, S.D.W., Grossman, Z., Gravenor, M.B., Richman, D.D. & Brown, A.J.L. (2006) Adaptation to different human populations by HIV-1 revealed by codon-based analyses. PLoS Computational Biology, 2, e62. Lamb, T. & Bauer, A.M. (2000) Relationships of the Pachydactylus rugosus group of geckos (Reptilia: Squamata: Gekkonidae). African Zoology, 35, 55–67. Münchenberg, T., Wollenberg, K.C., Glaw, F. & Vences, M. (2008) Molecular phylogeny and geographic variation of Malagasy iguanas (Oplurus and Chalarodon). Amphibia-Reptilia, 29, 319–327. Nei, M. & Li, W.H. (1979) Mathematical models for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Science USA, 76, 5269–5273. Nei, M. & Tajima, F. (1981) DNA polymorphism detectable by restriction endonucleases. Genetics, 97, 145–163. Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L. & Grabowski, G. (1991) The Simple Fool's Guide to PCR. Version 2.0. Privately published, Univ. Hawaii. Pasteur, G. (1962) Notes préliminaires sur les lygodactyles (Gekkonidés). III. Diagnose de Millotisaurus gen. nov., de Madagascar. Compte Rendu de la Société’ de Science Naturelle et Physique du Maroc, 28, 65–66. Pasteur, G. (1964) Notes préliminares sur les lygodactyles (Gekkonidés). IV Diagnoses de quelques formes africaines et malgaches. Bulletin Musée Natural d’Histoire Natural, 36, 311–314. Puente, M., Glaw, F., Vieites, D.R. & Vences, M. (2009) Review of the systematics, morphology and distribution of Malagasy dwarf geckos, genera Lygodactylus and Microscalabotes. Zootaxa, 2103, 1–76. Raxworthy, C.J. (2003) Introduction to reptiles. In: Goodman, S. & Benstead, J.P. (Eds.) The Natural History of Madagascar, University of Chicago Press, Chicago, pp. 934–949. Raxworthy, C.J. & Nussbaum, R.A. (1996) Montane amphibian and reptile communities in Madagascar. Conservation Biology, 10, 750–756. Rocha, S., Ineich, I. & Harris, D.J. (2009) Cryptic variation and recent bipolar range expansion within the stumped-toed gecko Gephyra mutilata across Indian and Pacific Ocean islands. Contributions to Zoology, 78, 1–8. Rubinoff, D., Cameron, S. & Will, K. (2006) A genomic perspective on the shortcoming of mitochondrial DNA for “barcoding” identification. Journal of Heredity, 97, 581–594. Slatkin, M. & Hudson, R.R (1991) Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics, 129, 555–562. Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24, 1596–1599. The R Development Core Team (2008) R: A Language and Environment for Statistical Computing.Version 2.7.2. Vences, M., Andreone, F., Glaw, F., Raminosoa, N., Randrianirina, J.E. & Vieites, D.R. (2002) Amphibians and reptiles of the Ankaratra massif: reproductive diversity, biogeography and conservation of a montane fauna in Madagascar. Italian Journal of Zoology, 69, 263–284. Vences, M., Wollenberg, K.C., Vieites, D.R. & Lees, D.C. (2009). Madagascar as a model region of species diversification. Trends in Ecology and Evolution, 24, 456–465. Vieites, D.R., Wollenberg, K.C., Andreone, F., Köhler, J., Glaw, F. & Vences, M. (2009) Madagascar biodiversity is vastly underestimated: evidence from amphibians. Proceedings of the National Academy of Science USA, 106, 8267–8272.

Geographical distribution of three species of Malagasy poison frogs of high conservation priority: Mantella aurantiaca, M. crocea and M. milotympanum

Parfait Bora1, Rainer Dolch2, Richard Jenkins3,4, Olga Jovanovic4, Falitiana C. E. Rabemananjara1, Jasmin Randrianirina5, Jeannot Rafanomezantsoa1, Liliane Raharivololoniaina1, Olga Ramilijaona1, Noromalala Raminosoa1, Roma Randrianavelona3, Achille Raselimanana1, Bertrand Razafimahatratra1, Tokihery Razafindraibe1, and Miguel Vences4*

Abstract. The genus Mantella comprises 16 described species of Malagasy poison frogs, several of which are threatened. Despite their importance as flagship species for conservation, remarkably little was known until recently about their geographical distribution. We here provide a revision of the distribution of a complex of three closely related Mantella species from central eastern Madagascar: Mantella aurantiaca (Critically Endangered) M. crocea (Endangered) and M. milotympanum (Critically Endangered). These taxa were thus far known from only a very limited number of sites. Based on own surveys, we could identify 21 new sites to complement the 13 sites known for these frogs. We also provide corrected geographical coordinates for some published sites. Altogether 16 localities are known for M. aurantiaca, nine for M. crocea, five for M. cf milotympanum and four for M. milotympanum. One site of M. crocea is in a Special Reserve (Ambohitantely), a second possibly in the Zahamena National Park, one site of M. aurantiaca (Torotorofotsy) is protected as Ramsar site, and a second site of M. aurantiaca is at the boundary of, and possibly inside, Mantadia National Park, but all other localities do not receive legal protection. All newly recorded sites are along the western edge of the eastern forest band, except Ambohitantely which is a relict forest in central Madagascar. Among the sites reported for M. aurantiaca, only one (Ambakoana) is situated on the western bank of the Mangoro River, indicating that this river is no insurmountable barrier for this species, at least in its upper course.

Keywords: Mantella, Anura, Mantellidae, geographical distribution, Madagascar

Introduction trade (Rabemananjara et al., in press). Nevertheless, Malagasy poison frogs of the genus Mantella are for many species, basic data on distribution and natural known for their bright colouration and the presence history were missing (Vences et al., 1999) and this of alkaloid skin toxins (Daly et al., 1996). Currently has hindered the creation of appropriate conservation there are 16 described species in the genus, and at least measures. This is particularly true for three closely one undescribed species has been identified (Glaw and related species, Mantella aurantiaca, M. crocea and Vences 2007; Rabemananjara et al., 2007). Due to their M. milotympanum, to which we will here refer to as the attractive coloration and diurnal behaviour, Mantella are Mantella aurantiaca complex. These taxa have been prominent representatives of the Malagasy herpetofauna, included in a Mantella aurantiaca group (Vences et al., and they are also exported in large numbers for the pet 1999), but more recent molecular studies have shown that they should be included in the M. madagascariensis group which in addition contains M. madagascariensis

1 Université d’Antananarivo, Département de Biologie Animale, and M. pulchra. Up until 1999, there was no precise Antananarivo (101), Madagascar locality information available for Mantella crocea 2 Association Mitsinjo, Lot 104 A Gare, Andasibe (514), and M. milotympanum, and only one locality, the Madagascar Torotorofotsy marsh, had been identified as containing 3 Madagasikara Voakajy, B.P. 5181 Antananarivo (101), sites with M. aurantiaca. Madagascar Considering the announcement of Madagascar’s 4 School of Biological Sciences, University of Aberdeen, president Ravalomanana, at the Durban Parks Aberdeen, AB24 2TZ, United Kingdom 5 Parc Botanique et Zoologique de Tsimbazaza, B.P 4096, Conference in 2003, to triple the surface of protected Antananarivo (101), Madagascar areas, it is now important to identify unprotected forest 6 Zoological Institute, Technical University of Braunschweig, fragments that harbour significant populations of Spielmannstr 8, 38106 Braunschweig, Germany restricted range species which merit future protection. * Corresponding author: E-mail: [email protected] All three species in the M. aurantiaca complex are 40 Parfait Bora et al. threatened with extinction, with M. aurantiaca and M. for M. aurantiaca, M. crocea, M. milotympanum, and milotympanum listed as Critically Endangered and M. some populations assigned to M. milotympanum in a crocea as Endangered on the IUCN Red List (Andreone preliminary way (as M. cf. milotympanum). For each et al., 2005). This database of threatened species relies species, localities are listed alphabetically. In addition on precise information on the extent of occurrence and we give brief accounts of historical records in the area of occupancy, and periodic reviews when new literature that either are considered to be in error or information becomes available are required. could not be confirmed by recent surveys. The three species in the Mantella aurantiaca complex are characterized by a similar morphology. They can be distinguished by color patterns, but the distinction Localities of Mantella aurantiaca Mocquard, 1900 between M. crocea and M. milotympanum is unclear since many intermediate color morphs exist. Genetically, Historical localities: Mantella aurantiaca has initially these two taxa are not differentiated in mitochondrial been described from a “forest between Beforona and genes, and their species status is doubtful; M. aurantiaca Moramanga”. Later, specimens were often reported appears to be differentiated on the mitochondrial level from “Perinet” or “Perinet district” (e.g., Blommers- but some populations show haplotype sharing with M. Schlösser and Blanc 1991) which refers to a village called crocea. Andasibe, east of Moramanga. Although Zimmermann In the last decade, much information on the distribution and Hetz (1992) mapped the species in grid squares of these species has become available from new close to Andasibe, it is almost certain that the species field surveys. Some of these data, however, are only does not occur here, and that historical records refer available from unpublished reports, while some other to sites at some distance from Andasibe whereas more locality information has been published in molecular recent records may refer to specimens locally introduced phylogenetic studies (Vences et al., 2004; Chiari et al., by commercial collectors (see Vences et al., 1999 for 2004) and is not easily available to conservationists. a more detailed discussion). Most historical records Furthermore, various locality names have partly been refer to the marsh of Torotorofotsy (Zimmermann and used for the same sites, and some of the published Hetz 1992; Zimmermann 1996), including the record coordinates appear to be erroneous. Therefore in this of Blommers-Schlösser (1979) who reported the study our goal is to summarize all available information species from Antaniditra, a village directly bordering on the distribution of these species, to enable its use by the Torotorofotsy marsh. One additional locality in the conservation authorities for establishing management Andasibe area is Ambatodradama (Ambatoharanana) plans for these species. (Methuen and Hewitt 1913) which we could not trace on recent maps and which has not been confirmed since. Behra et al. (1995) further discuss the occurrence Methods of this species in forests near the Ankaratra massif but Field surveys were carried out in Madagascar between 2001 and give no precise locality. No sites in this area have been 2007. Preliminary locality information was in many cases ob- confirmed since. tained from commercial collectors. Geographical coordinates and elevation were assessed using various GPS devices. All available Ambakoana: This previously unknown site was reported literature and unpublished reports, as well as several major museum collections, were checked for precise locality data referring by members of a local NGO (ACCE) and was verified to the three Mantella species discussed here. Coordinates were by us in January 2007. Specimens of yellow-orange and transformed into decimal format and entered into Google Earth to reddish color were observed in a pine forest bordering check for possible mistakes. a fragment of natural rainforest (where no specimens Voucher specimens for some localities are deposited at the Mu- were found). Two males (SVL = 19.6 mm, UADBA seum of the Département de Biologie Animale de l’Université 30073 (RBJ 1051), and UADBA 30102 / RBJ 1049) d’Antananarivo, Madagascar (UADBA), the Zoologische Staats- and one female (SVL = 26.3 mm; UADBA 30103 / RBJ sammlung München, Germany (ZSM), and the Zoological Muse- um Amsterdam, The Netherlands (ZMA). 1045) were collected as vouchers. No individuals were heard calling.

Results and discussion Ambatovy: This site was surveyed by J. Rafanomezantsoa The following accounts list all known localities separately in 1997, very close to the border of Mantadia National Distribution of Mantella aurantica 41

Table 1. List of available locality records of Mantella aurantiaca, M. crocea and M. milotympanum. Sites in italics are not considered as separate sites (either because of erroneous coordinates, or because they are identical to another site). Sources of information are coded as follows: 0, New locality; 1, Chiari et al. (2004); 2, Vences et al. (2004); 3, FADES report (F. Rabemananjara); 4 Randrianirina (2005); 5 Behra et al. (1995); 6 Zimmermann & Hetz (1992) and Zimmermann (1996).

Name of the site Source Observers Remark

Mantella aurantiaca

Ambakoana 1 0 D. Andriafidison, R. Randrianavelona and P. Bora Ambakoana 2 0 D. Andriafidison, R. Randrianavelona and P. Bora Very close to Ambakoana 1 Ambatovy 0 J. Rafanomezantsoa Analabe 0 R. Jenkins, R. Randrianavelona and P. Bora Analamay 1 0 J. Rafanomezantsoa Analamay 2 0 J. Rafanomezantsoa Analamay 3 0 J. Rafanomezantsoa and A. F. Ranjanaharisoa Andranomandry 1 1 M. Vences, E. Edwards, D. R. Vieites, F. Rabemananjara, P. Bora Andranomandry 2 0 F. Rabemananjara Same site as Andranomandry 1 Andranomandry 3 0 F. Rabemananjara Same site as Andranomandry 1 Andranomandry 4 0 J. Randrianirina Same site as Andranomandry 1 Andranomena 1 M. Vences, I. Somorjai, L. Raharivololoniaina, E. Edwards Andranonakoho 0 J. Randrianirina Besariaka forest 0 J. Randrianirina Sahasarotra forest 0 J. Randrianirina Torotorofotsy 1 1,2 M. Vences, L. Raharivololoniaina Published coordinates in error; same locality as Torotorofotsy 3 Torotorofotsy 2 1,2 M. Vences, L. Raharivololoniaina Published coordinates in error; same locality as Torotorofotsy 5 Torotorofotsy 3 - O. Jovanovic Same locality as Torotorofotsy 1 Torotorofotsy 4 0 J. Rafanomezantsoa Torotorofotsy 5 6 Not confirmed Several populations north of Antaniditra; corresponds to Torotorofotsy 2 Torotorofotsy 6 6 Not confirmed Several populations west of Antaniditra

Mantella crocea

Ambodivoasary 0 F. C. Rabemananjara Ambohimanarivo 1 M. Vences, I. Somorjai, L. Raharivololoniaina, E. Edwards Ambohitantely 0 M. Vences, O. Jovanovic and G. Safarek Ampangadimbolana 0 M. Vences, D. R. Vieites, C. Woodhead and E. Edwards Ankosy 0 F. C. Rabemananjara Bakozetra 5 (6) Not confirmed Coordinates estimated from published map Ihofa 1,2 Local collectors instructed by M. Vences and L. Raharivololoniaina Marisiaka 3 F. C. Rabemananjara Zahamena 0 C. J Raxworthy, A. Raselimanana, J. B. No precise coordinates and locality Ramanamanjato, A. Ravoninjatovo, J. information available Rafanomezantsoa, F. Rabemananjara

Mantella milotympanum

Antanifotsy forest 4 J. Randrianirina Bemandotra forest 4 J. Randrianirina Sahalava forest 4 J. Randrianirina Sahamarolambo 1 1 P. Bora, F. Rabemananjara, B. Razafimahatratra, D. R. Vieites, M. Vences Sahamarolambo 2 3 F. C. Rabemananjara Same site as Sahamarolambo 1

Mantella cf. milotympanum

Ambatombolana 0 O. Jovanovic, R. Dolch and H. Kurrer Andriambe 1 P. Bora, B. Razafimahatratra Published as "Andriabe" Andaingo 1 D. R. Vieites, P. Bora Published as "North of Fierenana" Mandrevo Amboa 0 O. Jovanovic, R. Dolch and H. Kurrer Savakoanina 1 P. Bora, B. Razafimahatratra 42 Parfait Bora et al.

Figure 1. Map showing the distribution of Mantella aurantiaca, M. crocea, M. cf. milotympanum and M. milotympanum in the East region in Madagascar. M. aurantiaca sites are marked with circles. M. crocea sites are marked with squares. M. cf. milotympanum and M. milotympanum are marked with triangles. Placement of locality symbols is schematic and adjusted to be able to show all localities. Two sites of M. crocea (Zahamena and Ambohitantely) are outside the range of the map (northeast of Ambatondrazaka and west of Anjozorobe, respectively).

Park, probably located inside the reserve boundaries were captured of which one male with SVL = 21.0 mm; according to available coordinates. Mantella aurantiaca UADBA 30071 (RBJ 1048) and one female with SVL = was found in rainforest next to a small marsh. Ongoing 24.5 mm; UADBA 30072 (RBJ 1047) were collected as degradation and disturbance of the habitat was noted vouchers. An additional voucher specimen was collected during the survey. in a different part of the forest during March 2007.

Analabe: This new site was also discovered first by a Analamay: A first site in Anamalay was visited by J. local NGO (ACCE) and verified by us in January 2007. Rafanomezantsoa. The habitat is a temporary marsh It is a forest fragment of about 400 ha surrounded by a 3 meters from a stream inside primary forest beside pine plantation and agriculture. The species was found a small fragment of secondary forest. A second site is only in a narrow valley alongside small streams. Calling located close to the previous site and was visited by males were hidden among dead leaves of Pandanus J. Rafanomezantsoa in 1997. The habitat was primary plants and in the base of the living plants. Observed forest close to a temporary marsh. individuals were of red color. In total five individuals Distribution of Mantella aurantica 43

Analamay 3: This site was surveyed by J. 1999). Torotorofotsy is a large marsh that currently is Rafanomezantsoa and A. F. Ranjanaharisoa at the end protected as Ramsar Site. At some places around the of November 2004. Mantella aurantiaca was found in marsh there is gallery forest which gets partly flooded degraded primary forest close to a temporary marsh. during the rainy season and which is used by M. Many males were heard calling around the marsh inside aurantiaca for reproduction. Zimmermann and Hetz of the forest during daytime. (1992) and Zimmermann (1996) provided a detailed map of M. aurantiaca populations in this area, but their Andranomandry: This site was visited by M. Vences, D. work also indicated populations in Reserve Speciale R. Vieites, E. Edwards, P. Bora and F. C. Rabemananjara d’Analamazoatra near Andasibe which almost certainly in 2003. Coordinates were published by Chiari et al. were due to individuals introduced by locals at the time, (2004) and Vences et al. (2004). It consists of a valley and these populations have never been confirmed since and a hill with a slope of 20° to 30 ° horizontally. Forest despite intensive research activity in this area. Although is primary but degraded by heavy exploitation of timber. these works contained no coordinates, they confirmed the As well, a marsh is used as a meadow for zebus. This is presence of the species at many sites in the Torotorofotsy also a well-known area for collecting individuals of this area, with three main nuclei. The best studied of these species for pet trade. This locality has also been visited is located at the place where the (abandoned) railroad by other researchers subsequently who all confirmed from Andasibe village arrives at the marsh. This site has the existence of M. aurantiaca at the site with slightly been named Torotorofotsy 1 by Vences et al. (2004) and differing GPS readings (see Table 2). Chiari et al. (2004), but their geographical coordinates were slightly mistaken, probably due to a GPS reading Andranomena: This site is sometimes also called error during the visit in January 2001 (by M. Vences and Beparasy by local collectors because it is close to a L. Raharivololoniaina). The site has further been visited local road leading to this village. In fact, it refers to the by M. Vences, C. Woodhead and E. Randriamitso in same forest fragment as Andranomandry (see above). February 2004, and by O. Jovanovic in January 2007, This site was visited by M. Vences, I. Somorjai, L. and is here thus named Torotorofotsy 3. A further locality Raharivololoniaina and J. Edwards in 2002. The site is at Torotorofotsy was visited by J. Rafanomezantsoa. a fragmented and disturbed forest with some hills and The different GPS readings obtained from sites around some marsh areas in the forest. At the time, we observed Torotorofotsy are reproduced in Table 2. no calling specimens, but a large number of specimens were found in the degraded forest. The coordinates were taken at the bank of the Samarirana River, at some Localities of distance from the actual M. aurantiaca site. Coordinates Mantella crocea Pintak and Böhme, 1990 of this site were published by Vences et al. (2004) and Chiari et al. (2004). Historical localities: Type locality of Mantella crocea is Andasibe, but the species is not found in or near the Andranonakoho: This site was visited by J. Randrianirina village of Andasibe. Instead, the closest populations of in November-December 2005. A population consisting Mantella crocea are north of the Torotorofotsy marsh of red-orange colored individuals was found in a patch (Hetz and Zimmermann, 1992; Zimmermann, 1996), of little disturbed rainforest. in an area called Bakozetra (Behra et al., 1992; see below). Besariaka forest: Another site surveyed by J. Randrianirina in November-December 2005. Ambodivoasary: This site was surveyed by F. Rabemananjara in 2003 and 2004. It is located in the Sahasarotra: A rainforest site surveyed by J. district of Marovoay Gara. The site consists of a marsh Randrianirina in the same period like Andranonakoho, in a clearing with decomposing dead trunks covered but located further south than that locality. with ferns and surrounding by a forest with dense understorey. Torotorofotsy: This site (sometimes also named Antorotorofotsy) was historically the only certain Ambohimanarivo: This site was surveyed by M. Vences, locality of Mantella aurantiaca (see Vences et al., I. Somorjai and E. Edwards in 2002 and is quite close to 44 Parfait Bora et al.

Ambodivoasary and Marisiaka. The name of the site was Ankosy: This site was visited by F. Rabemananjara given after a village along the road from Moramanga to in 2003 and 2004. It comprises parts of rather intact Ambatondranzaka which however is at some distance as well as disturbed forest surrounding a large marsh, from the actual locality. Samples collected at this site and the population consists of yellow-brown coloured have been used in the molecular works of Vences et al. individuals with black lateral band reaching to the (2004) and Chiari et al. (2004). The locality is a medium- flanks, with SVL between 18-22 mm. sized open marsh with rainforest at its edges. Specimens were found in the forest and likely reproduce in flooded Bakozetra: This locality immediately north of areas where the forest borders the marsh. Torotorofotsy marsh has not been confirmed in recent surveys, and no precise GPS reading is available. We Ambohitantely: The Reserve Speciale d’Ambohitantely here provide approximate coordinates based on the consists of fragmented parcels of humid forest in the maps of Zimmermann and Hetz (1992) and Behra et al. central highlands of Madagascar. This site is isolated (1995) (Table 2). from the nest nearest known population of M. crocea by over 100 km. Here, the first records of M. crocea were Ihofa: This M. crocea site has been sampled in 2001 made by A. Raselimanana who observed the species and coordinates were published in Vences et al. (2004) several years ago. New searches in 2005 and 2006 and Chiari et al. (2004). The locality is to the north were unsuccessful, but in 2007, both A. Raselimanana of Torotorofotsy marsh and was surveyed by local and a team consisting of P. Bora, F. Rabemananjara, T. collectors who also took GPS readings themselves Razafindrabe, M. Vences, O. Jovanovic and G. Safarek and reported these to M. Vences, I. Somorjai and L. confirmed the existence of the species in the largest Raharivololoniaina in 2001. No data are therefore forest block remaining at this site. A large number of available on the habitat at this site. individuals were found in February 2007 on a slope, far from water between a major cascade and the Jardin Marisiaka: This site was surveyed by F. Rabemananjara Botanique. The forest here was relatively dry and open, in 2003. This site is comprised of a humid valley of a and characterized by a number of large Pandanus width of approximately 2-3 m, covered with 1 to 10 cm plants. Specimens had a characteristic bright green- leaf litter, in forest with some underwood and without black coloration. a dense canopy. Ground vegetation is formed by tree ferns, Pandanus and Cephalostachyum viguieri. The Ampangadimbolana: This site was identified by M. forest was overexploited for wood but this activity is Vences, D. R. Vieites, C. Woodhead and E. Edwards currently reduced by forest managers elected by the in 2004. Different from most localities for the species local community. (but in agreement with Ambohitantely which is located much further west), this site is situated on the west bank Zahamena: Specimens assigned to M. crocea have been of the river Mangoro. It is the only known site south observed by C. J. Raxworthy, A. Raselimanana, J.-B. of Moramanga. The pace of habitat destruction in this Ramanamanjato, A. Ravoninjatovo, J. Rafanomezantsoa area is extreme, and it is possible that the population and F. Rabemananjara in early February 1994. has in the meantime disappeared. We observed a few Specimens were not encountered in the dense rainforest calling males from an exposed marsh bordered by of Zahamena reserve but at a site outside the major forest remains of rainforest. Calling individuals were all block, and possibly outside of the protected area. The relatively close to the forest border but were calling individuals were found along the trail crossing a block of in the unforested marsh area where fallen logs humid rainforest (Ampangadinatrandraka forest), NW and some large grass tufts were providing shelter. of Manakambahiny Est village. The forest was disturbed Local collectors later in 2004 secured a larger series by cattle grazing and timber exploitation for local needs. of individuals from a site said to be very closely Specimens were collected in open canopy and disturbed nearby (no coordinates taken), indicating that in slope forest at around 10:30 am. Geographic coordinates 2004, some larger populations were still existing in of this locality are not available to us at the time of this area. Specimens were of greenish colour with writing the present paper, but the elevation was about black pigment laterally. 1250 m. The locality has also been used to estimate the Distribution of Mantella aurantica 45

Table 2. Geographical coordinates and altitude above sea level of localities of Mantella aurantiaca, M. crocea and M. milotympanum. Original coordinates refer to the precise format of published data or fieldbook entries. Corrected coordinates refer to coordinates transferred into decimal degrees, and partly replaced by more precise or correct readings (in italics) if a locality was visited more than once. Localities in italics do not represent separate sites but different visits to the same site.

Name of the site Altitude Original Original Corrected decimal Corrected decimal a.s.l. latitude longitude latitude longitude

Mantella aurantiaca

Ambakoana 1 955 18°31’17’’ 48°10’09’’ 18.5214° 48.1692° Ambakoana 2 893 18°31’24’’ 48°10’16’’ 18.5233° 48.1711 Ambatovy unknown 18°51.3 48°21.3 18.855° 48.355° Analabe 940 18°35’36’’ 48°15’06’’ 18.5933° 48.2517° Analamay 1 1006 18°47.957’ 48°20.541 18.79928° 48.34235° Analamay 2 unknown 18°49.7 48°20.0 18.82833° 48.33333° Analamay 3 1039 18°48.736’ 48°20.213’ 18.81227° 48.33688° Andranomandry 1 917 19°02’22’’ 48°10’34’’ 19.0394° 48.1761° Andranomandry 2 918 19°02.373’ 48°10.576’ 19.03955° 48.17627° Andranomandry 3 898 19°02.259’ 48°10.408’ 19.03765° 48.17347° Andranomandry 4 915 19°02’03’’ 48°10’05’’ 19.0342° 48.1681° Andranomena 921 19°01’30’’ 48°10’0’’ 19.025° 48.1761° Andranonakoho 1000 19°08’32’’ 48°09’58’’ 19.1422° 48.1661° Besariaka forest 950 19°02’06’’ 48°09’09’’ 19.035° 48.1525° Sahasarotra forest 1065 19°10’34’’ 48°08’12’’ 19.1761° 48.4403° Torotorofotsy 1 960 18°52’29’’ 48°22’21’’ 18.87622° 48.37072° Torotorofotsy 2 950 18°51’19’’ 48°21’36’’ 18.8454° 48.3741° Torotorofotsy 3 941 18°52.573’ 48°22.243’ 18.87622° 48.37072° Torotorofotsy 4 956 18°52.575' 48°22.265' 18.87625° 48.37108° Torotorofotsy 5 ------18.8454° 48.3741° Torotorofotsy 6 ------18.854° 48.3505°

Mantella crocea

Ambodivoasary 952 18°47.586’ 48°17.492’ 18.7931° 48.29153° Ambohimanarivo 1057 18°48’34’’ 48°16’52’’ 18.8094° 48.2811° Ambohitantely 1572 18°10.695’ 47°17.426’ 18.17825° 47.29043° Ampangadimbolana 890 18°58.425’ 48°04.838’ 18.97375° 48.08063° Ankosy 1025 18°38.559’ 48°16.857’ 18.64265° 48.28095° Bakozetra ------18.8223° 48.3701° Ihofa 1017 18°46’06’’ 48°22’12’’ 18.7683° 48.3717°

Marisiaka 1041 18°48.167’ 48°17.330’ 18.80278° 48.28883° Zahamena ------ca. 17.637 ca. 48.768

Mantella milotympanum

Antanifotsy forest 925 18°34.36 48°26.38 18.57267° 48.43967° Bemandotra forest 915 18°36.56 48°27.74 18.60933° 48.46233° Sahalava forest 964 18°33.44 48°27.56 18.55733° 48.45933° Sahamarolambo 1 948 18°32’36’’ 48°26’56’’ 18.53963° 48.44547° Sahamarolambo 2 889 18°32.378’ 48°26.728’ 18.53963° 48.44547°

Mantella cf. milotympanum

Ambatombolana 938 18°36.422’ 48°22.383’ 18.60703° 48.37305° Andriambe 1047 18°36’46’’ 48°19’34’’ 18.6128° 48.3261° Andaingo 1060 18°16’10’’ 48°29’03’’ 18.2694° 48.4842° Mandrevo Amboa 945 18°35.396’ 48°20.816’ 18.58993° 48.34693° Savakoanina 959 18°34’44’’ 48°24’30’’ 18.6122° 48.4083° distribution range of M. crocea in the Global Amphibian specimens probably attributable to the species have also Assessment based on an information of C. J. Raxworthy more recently been sighted inside Zahamena reserve, in 2003 (see map under www.globalamphibians.org). close to its north-western edge, which may correspond It considerably extends the distribution area of this to the same site reported here. complex of frogs into the north, and more studies on the identity of this population are necessary. According to informations of a Peace Corps volunteer in 2008 to MV, 46 Parfait Bora et al.

Localities of to Randrianirina (2005), the same coloration was also Mantella milotympanum Staniszewski, 1996 observed in the three populations listed above. The further sites listed below as Mantella cf. milotympanum Historical localities: Type locality is the “Fiherenanana have partly an intermediate color or pattern between M. valley in central east Madagascar” which corresponds milotympanum and M. crocea. to the surroundings of Fierenana village. No further information is available from early publications. Localities of Mantella cf. milotympanum:

Antanifotsy forest: This site was surveyed by J. Ambatombolana: This site was identified by O. Randrianirina in 2004 and published by Randrianirina Jovanovic, H. Kurrer and R. Dolch in February 2007. (2005). Encountered specimens were assigned to M. One population of M. crocea consisting of uniformly milotympanum and were red colored. The forest at the yellow-blue coloured individuals was located. The site time of survey was more or less intact without visible comprises of an open swampy valley between hills consequences of human activities. covered with forest. This population is not far from the one from Savakoanina which also harbours green- Bemandotra: This site was visited and surveyed by J. colored individuals. Randrianirina in 2004 and published by Randrianirina (2005). The forest is similar to that in Antanifotsy. Andriambe: This site was visited and surveyed by B. Razafimahatratra and P. Bora in February 2003 and Sahalava forest: Surveyed by J. Randrianirina in 2004 published as sampling site for molecular analysis and published by Randrianirina (2005). The forest is by Chiari et al. (2004). It is close to a village named similar to that in Antanifotsy. Andriambe, and the correct spelling (Andriambe or Andriabe) is uncertain. At this locality, about 80% of Sahamarolambo: This site is located south of the the forest was burned during our visit in 2003, and village of Fierenana and has been visited by numerous Mantella specimens were found in remains of the forest researchers. Mantella milotympanum also occurs at areas devastated by fire were it used holes in fallen other sites between Fierenana and Sahamarolambo as logs as refuges. They were of bright orange-red ground we could verify in January 2002 based on calls heard color and with a variable pattern, some individuals of from small forest fragments, but no individuals were largely uniform colour reminding M. milotympanum, captured from these intermediate sites. Sahamarolambo others with black flanks, remindingM. crocea. A further was visited by M. Vences and E. Edwards in January species occurring at this site is Mantella baroni which 2002, by F. Rabemananjara, D. R. Vieites and M. Vences was here massively collected for the pet trade at the in February 2003, by F. Rabemananjara later in 2003, time of our survey (and was erroneously known among and by J. Randrianirina in 2004. The GPS coordinates collectors as Mantella cowani). used here are those taken by F. Rabemananjara in 2003 which best fit with available satellite pictures. The Andaingo: This site was visited by D. R. Vieites, F. locality has been reported, partly just as “Fierenana”, by Rabemananjara, B. Razafimahatratra and P. Bora Vences et al. (2004), Chiari et al. (2004), Randrianirina in February 2004, and was published as “North of (2005) and Vieites et al. (2005). The site is a small forest Fierenana” by Chiari et al. (2004). We here assign the fragment in-between several large marshes that partly name Andaingo to this site based on a nearby village, have been converted into rice fields. The forest canopy located about 12 km west of the site. The site is located is not very dense. A small stream of 1.5 m width and near a stream flowing through the forest. Forest at 10-50 cm water depth flows through the fragment which this locality is dense but some fragments are cut for at some parts gets flooded. The forest is characterized cultivation. by tree ferns and several large Pandanus plants at the swampy parts. Mandrevo Amboa: This site was identified by O. Sahamarolambo is the best known site with specimens Jovanovic, H. Kurrer and R. Dolch in February 2007. that show the typical color of M. milotympanum, i.e. It is inhabited by red coloured individuals similar to a uniformly red-orange body with a black tympanum M. milotympanum. This site is located near a forest and some black pigment around the nostril. According fragment, in a marshy valley near rice fields. Distribution of Mantella aurantica 47

Savakoanina: This site was visited by B. Razafimahatratra identity of populations further north (at Zahamena), here and P. Bora in February 2003 and published by Chiari assigned to M. crocea, cannot be verified at present. et al. (2004). It consists of primary forest that is All localities of M. aurantiaca are in partly degraded significantly degraded, with a clear stream about 50 cm habitat and many of them are in small forest fragments deep and 2 to 3 m wide. Specimens here are uniformly that suffer from strong anthropogenic pressure. The colored with black tympanum, and with some specimens Torotorofotsy populations are legally protected because tending towards light orange-yellow and others towards this marsh area is a Ramsar site, and one locality may greenish ground color. They were numerous during the occur just within the boundaries of Mantadia National survey. This site is also used for commercial collecting Park, but all other populations live outside of protected by inhabitants of Fierenana village. areas. Mantella crocea is found within the Special Reserve of Ambohitantely, and may also occur within the boundaries of Zahamena reserve. All localities of M. Discussion milotympanum are unprotected. Not considering duplicate entries, our list contains a New conservation efforts should assess how the total of 34 localities which all have been identified after small forest parcels containing the populations of these 1990, most of them after 2000. Of these, 16 localities restricted-range species could be protected. refer to Mantella aurantiaca, nine to M. crocea, four to M. milotympanum and five to M. cf. milotympanum. Acknowledgements. For assistance during our surveys we thank However, this apparent large number of Mantella the Director and all the members of the «Association Culturelle aurantiaca populations is somewhat biased; in fact, Communication et Education » (ACCE) of Moramanga (Associ- seven of the 16 localities are in close proximity to other ation Arongam-panihy), the Head of the Department for Forest Resources in the Moramanga region, the Head of the District, and sites and therefore may not be counted as separate the Mayors of Morarano and Amboasary Gara, as well as other populations (Ambakoana 2, Andranomena which institutions that insure the security in these areas, local guides is close to Andranomandry, Analamay 2 and 3, and and the local population, and all that have contributed to obtain Torotorofotsy 4, 5 and 6). the data summarized here. For field companionship we thank Rai- Of the total of 34 localities, only 13 had been ner Dolch, Hellmut Kurrer, Liliane Raharivololoniaina, Edouard previously reported in publications and 21 new sites are Randriamitso, Tokihery Razafindrabe, Goran Safarek, Ildiko So- listed herein. We are convinced that more unrecorded morjai, David R. Vieites and Cindy Woodhead. Special thanks go to Euan Edwards for his continued support and his help to localities for these species exist. Especially populations obtain informations from local Mantella collectors. The Malaga- assignable to Mantella crocea may occur in the large sy authorities are acknowledged for issuing research permits. We area between Andaingo and Zahamena, and possibly are grateful to Pierre Berner and the environmental department of even north of Zahamena. However, considering the high the Ambatovy Project for logistic support and the permit to use rate of forest destruction along the borders of the main coordinates from their site. eastern rainforest blocks, many of these populations are to be expected in small fragments threatened by logging References and slash-and-burn agriculture. Andreone, F., Cadle, J. E., Cox, N., Glaw, F., Nussbaum, R. A., For M. aurantiaca almost all sites inventoried are found Raxworthy C. J., Stuart S. N., Vallan D., Vences, M. (2005): Species review of amphibian extinction risks in Madagascar: in the south part of the river Mangoro. Only the site conclusions from the Global Amphibian Assessment. Conser- Ambakoana is situated on the western bank of this river, vation Biology 19: 1790-1802. indicating that the river in this area (its upper course) Behra, O., Rabemananjara, F., Rabibisoa, N., Ramilison, O., Ra- does not represent a barrier that small frogs could not voninjatovo, A. (1995): Etude de la repartition et du niveau cross. For M. crocea, the majority of the surveyed de population de deux especes d’Amphibiens de Madagascar sites are found on the band of the east forest with the (Mantella aurantiaca et Mantella crocea, sous-famille Man- exception of Ambohitantely which is situated along tellinae, Laurent, 1946). BIODEV Rapport, 39 pp. Blommers-Schlösser, R. M. A. (1979): Biosystematics of the Ma- the central highland (Ankazobe) in the Antananarivo lagasy frogs. I. Mantellinae (Ranidae). Beaufortia 29 (352): province and also the only protected by laws in force 1-77. (Réserve Spéciale d’Ambohitantely). M. milotympanum Blommers-Schlösser, R. M. A., Blanc, C. P. (1991): Amphibiens (including specimens preliminarily assigned to this (première partie). Faune de Madagascar 75 (1): 1-379. species), occurs in a rather restricted area north of the Convention sur le Commerce International des Espèces de Faune distribution area of typical M. crocea populations. The et de Flore Sauvages Menacées d’Extinction ou CITES. 1973. 48 Parfait Bora et al.

Chiari, Y., Vences, M., Vieites, D. R., Rabemananjara, F., Bora, P., Vallan, D. (2000): Conséquence de la fragmentation de la forêt Ramilijaona, O., Meyer, A. (2004): New evidence for parallel d’Ambohitantely sur les populations d’Amphibiens. In : J. evolution of colour patterns in Malagasy poison frogs (Man- Ratsirarson, and S. M. Goodman (eds.). Monographie de la fo- tella). Molecular Ecology 13: 3763-3774. rêt d’Ambohitantely. Recherche pour le développement, Série Daly, J. W., Andriamaharavo, N. R., Andriantsiferana, M., Myers, Sciences Biologiques 16: 107-130. C. W. (1996): Madagascar poison frogs (Mantella) and their Vences, M., Chiari, Y., Raharivololoniaina, L., Meyer, A. (2004): skin alkaloids. American Museum Novitates : 3177: 1-34. High mitochondrial diversity within and among populations of Glaw, F., Vences, M. (2007): A Field Guide to the Amphibians Malagasy poison frogs. Molecular Phylogenetics and Evolu- and Reptiles of Madagascar. Cologne, 496 pp. tion 30: 295-307. Methuen, P. A., Hewitt, J. (1913): On a collection of Batrachia Vences, M., Carpenter, H. A., Vieites, D. R., Edwards, E. J., Val- from Madagascar made during the year 1911. Annals of the lan, D., Andreone, F., Razafindrabe, T. J., Bora, P., Rabema- Transvaal Museum, Pretoria 4, 2: 49-64 + 2 plates. nanjara, F., Raminosoa, N., Ramilijaona, O. (2007): A survey Rabemananjara, F. C. E., Chiari, Y., Ramilijaona, R.O., Vences, of the trade in Malagasy poison frogs, genus Mantella. Am- M. (2007): Evidence for recent gene flow between north-east- phibian and Reptile Conservation, in press. ern and south-eastern Madagascar from a phylogeography of Vieites, D. R., Rabemananjara, F. E. C., Bora, P., Razafimahat- the Mantella cowani group. Frontiers in Zoology 4: article 1. ratra, B., Ramilijaona Raovahangimalala, O., Vences, M. Rabemananjara, F.C.E., Raminosoa, N.R., Ramilijaona, O.R., (2005): Distribution and population density of the black-eared Andreone, F., Bora, P., Carpenter, A.I., Glaw, F., Razafindrabe, Malagasy poison frog, Mantella milotympanum Staniszewski, T., Vallan, D., Vieites, D.R., Vences, M. (in press): Malagasy 1996 (Amphibia: Mantellidae). 197-204 in: Huber, B. A. & K. poison frogs in the pet trade: a survey of levels of exploitation H. Lampe (eds.): African Biodiversity: Molecules, Organisms, of species in the genus Mantella. In: Andreone F. (ed), A Con- Ecosystems. Proc. 5th Intern. Symp. Trop. Biol., Museum Ko- servation Strategy for the Amphibians of Madagascar, Mono- enig, Bonn. Springer Verlag. grafie, 45. Museo Regionale di Scienze Naturali, Torino. Zimmermann, H., Hetz, S. (1992): Vorläufige Bestandsaufnahme Randrianirina, J. E. (2005): Nouvelles données sur la distribu- und Kartierung des gefährdeten Goldfröschchens Mantella tion d‘une espèce de grenouille menacée dans la foret de aurantiaca, im tropischen Regenwald Ost-Madagaskars. Her- Fierenana, Madagascar, Mantella milotympanum (Amphibia, petofauna 14: 33-34. Mantellidae). Bulletin de la Societé Herpetologique de France Zimmermann, H. (1996): Der Schutz des Regenwaldes und ein 115: 48-54. kleines Fröschchen in Ost-Madagaskar. Stapfia47: 189-218. Vences, M., Glaw, F., Böhme, W. (1999): A review of the genus Mantella (Anura, Ranidae, Mantellinae): taxonomy, distribution and conservation of Malagasy poison frogs. Alytes. 1999:17(1-2): 3-72.

RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 253

A Conservation Strategy for the Monografie del Museo Regionale di Scienze Naturali Amphibians of Madagascar di Torino, XLV (2008): pp. 253-264

Falitiana C.E. RABEMANANJARA1, Parfait BORA1, Tokihery J. RAZAFINDRABE1, Edouard RANDRIAMITSO1, Olga RAVOAHANGIMALALA RAMILIJAONA1, Noromalala RASOAMAMPIONONA RAMINOSOA1, Daniel RAKOTONDRAVONY1, David R. VIEITES2, Miguel VENCES3

Rapid assessments of population sizes in ten species of Malagasy poison frogs, genus Mantella

ABSTRACT

Among the amphibians of Madagascar, the Malagasy poison frogs of the genus Mantella are the group that is most heavily collected for the pet trade. Although the taxonomy and genetic diversity of these frogs has been intensively studied in the past, very few data on their population dynamics are available, although such data are badly needed to evaluate and regulate their commercial collecting and export. Here we summarize available population density data on Malagasy poison frogs and report on own data based on rapid mark-recapture population estimates of ten Mantella species, carried out between 2003-2007. Population sizes usually were around 50-200 individuals, but these data must be seen as preliminary because they refer to specimens at particular reproduction sites (in swamps or along streams), and in some cases are heavily biased towards males since females were more difficult to collect. These partly very high population densities in our and previous studies refer to specimens gathering in very small areas (down to 50 square meters in Mantella viridis where the highest densities were recorded) and therefore can by no means be extrapolated to the whole distribution areas of these species. Long-term studies of the dynamics of particular populations, home ranges and dispersal, and of longevity and recruitment, need to be combined with such short-term density estimates to understand the perspectives of sustainable harvesting of Malagasy poison frogs.

Key words: Amphibians, Conservation, Madagascar, Mantella, Population estimate.

INTRODUCTION

Madagascar, because of its unique biodiversity, can be considered as a real living laboratory for biologists, deserving the highest priority for conservation

1 Université d'Antananarivo. 2 Museum of Vertebrate Zoology and Department of Integrative Biology, University of Carlifornia at Berkeley. 3 Technical University of Braunschweig. RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 254

254

(Myers et al., 2000). All currently described 238 species of non-introduced Malagasy amphibians are fully endemic on this fourth largest island of the world, and are not safe from a variety of threats (Andreone & Luiselli, 2003; Andreone et al., 2005). Despite a high intensity of recent research, Madagascar’s amphibian diversity still has not revealed all its mysteries. Every year, researchers in Madagascar discover numerous undescribed species, and no full species inventory will be available in the next few years (Vences & Glaw, 2003). In addition, taxonomic revisions at the genus level have proven to be necessary after introduction of new methods, such as DNA analyses (Glaw & Vences, 2006). The endemic Malagasy genus Mantella is currently constituted by 17 species (Vences et al., 1999). The systematics of the group is subject to revision using molecular techniques, which revealed that even within one species, considerable color variations can occur: this case was evidenced by mitochondrial DNA sequence analysis of different populations of Mantella crocea (variation of yellow to green), Mantella milotympanum (variation of red to green), and Mantella baroni (variation of extent of yellow dorsal colour), collected in different areas of Madagascar (Chiari et al., 2004, 2005; Rabemananjara et al., 2007a). The existence of different species groups in the genus has been first evidenced by allozyme analyses (Vences & Kniel, 1998), but until now, full taxonomic stability has not been reached. For example the brown species of Mantella in the M. betsileo complex are to be divided into various distinct lineages, at least one of which probably represents an undescribed species (Rabemananjara et al., 2007b). Besides major efforts in molecular systematics, a second line of research has, in the past years, focused on the alkaloid components of the skin of these frogs (Daly et al., 1996, 2002), and the biological origin of these toxins that are uptaken from the frog’s prey (e.g., Daly et al., 1997; Clark et al., 2005). Because of their attractive and variable pattern, almost all Mantella species are exploited for the international wildlife trade, this genus being the one with more exports in terms of Malagasy amphibians present in the pet trade (>230,000 individuals over 10 years 1994–2003) (Rabemananjara et al., in press). All representatives of the genus are actually included in appendix II of the Convention on the International Trade in Endangered Species (CITES) (Nairobi, Kenya, 10-20 April 2000). Madagascar ratified this convention in 1975 (ordinance 75-014 of 5 August 1975) to better protect and control the trade of living animals exported from the island. The Malagasy scientific authority is depending on thorough research results to set up the quotas of Mantella species, especially regarding population densities and species distributions which have remained largely unexplored. Population density studies are difficult to perform in the tropics, because they are resource-intensive (Bailey et al., 2004), especially if carried out in remote areas that are often only reachable after hours of walking. An opportunity for such studies arose as in 2003 when a major project on the biology and alkaloid content of Mantella populations was started by the University of Antananarivo. During the fieldwork related to this study, populations of most Mantella species were visited and several rapid RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 255

255

assessments of population densities obtained. In some cases, these data were already been made available to local authorities in the context of conservation management, but so far most data remained unpublished. The present paper reviews all data available to us, published and unpublished, on density estimates of Mantella species, also adding new surveys that were carried out with similar methodology in the framework of other research projects. Our results refer to ten species of Mantella Boulenger, 1882, including Mantella aurantiaca Mocquard, 1900, M. baroni Boulenger, 1888, M. bernhardi Vences, Glaw, Peyrieras, Böhme & Busse, 1994, M. betsileo (Grandidier, 1872), M. crocea Pintak & Böhme, 1990, M. laevigata Methuen & Hewitt, 1913, M. madagascariensis (Grandidier, 1872), M. milotympanum Staniszewski, 1996, M. pulchra Parker, 1925 and M. viridis Pintak & Böhme, 1988. Four additional species, M. cowani Boulenger, 1882, M. expectata Busse & Böhme, 1992, M. haraldmeieri Busse, 1981 and M. nigricans Guibé, 1978, were also studied, but sample sizes were too low to obtain adequate mark-recapture estimates of population sizes. As we will emphasize again in the conclusions, the data presented here are far from thorough estimate of populations of Mantella, but they give the first and so far most reliable data of the approximate dimension of breeding aggregations of these frogs, across a wide array of species.

MATERIAL AND METHODS

Sites and study periods Data were gathered over three survey periods per population within one reproductive cycle between June 2003 and April 2004. Some other independent studies were carried out between 2004 and 2007 by different researchers and are included in this manuscript (e.g., Vieites et al., 2005). The study periods could roughly be classified according to four seasons: pre-reproduction (between September and November), reproduction (between December and February), post-reproduction (between March and April), and hibernation (between May and August). Most of the mark-recaptures took place during the breeding season (December-February) and in several of them (e.g., M. baroni, especially in the case of Kidonavo) the captured specimens were mostly males. In addition, the selected areas for the estimates were sites with high prevalence of Mantella, species which in general are known to be not continuously distributed but to aggregate at specific places (Daly et al., 1996). Hence, all density estimates for these frogs (previously published and herein) need to be taken with extreme caution as they only refer to particular sites, and the estimates in total numbers must be seen as minimum estimates (rapid assessments) that only refer to the part of the population that was gathering in the mating area at that particular time, and sometimes only to the males. In addition, several species occur along streams, like M. baroni, and specimens were collected along a linear transect following the stream which makes it even more difficult to relate population size estimates to a particular area. RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 256

256

Mark-recapture method Mark-recapture is considered to be an adequate method to estimate population sizes and densities of amphibians (Funk et al., 2003; Bailey et al., 2004). Our surveys were carried out over short periods (2 days minimum and 7 days maximum) with 4 to 7 capture occasions. Considering that no concerted long-distance migrations of Mantella have been reported so far, and considering the periods between recaptures were fairly short (1.5 h to 24 h), we assumed that the studied populations were closed (see White et al., 1982). Toe- clipping of one toe was chosen for marking, considering that this technique allows high survival rates (>98%) (Hott & Scott David, 1999) and insures full mark retention, assumptions needed for mark-recapture methods (White et al., 1982). The capture effort was constant in most estimates, with 4 hour-persons (4 persons searching during one hour) per capture event, and recapture rates were up to 10% of previously marked individuals. The release of animals was carried out by each researcher in the plot section where they had been initially captured, to ensure the animals were spread enough over the whole study area and could mix with the rest of the population in a relatively short period. Due to the limited time available at each site it was not possible to apply individual markings to each specimen, and therefore the use of calculation methods available for open populations (such as the Jolly-Seber method) was not possible. We here apply the calculation method of Schnabel (1938) with 95% confidence intervals.

Population size estimates and summary of literature The population size estimates from our data are summarized in Tab. I and range from 35 to 467 individuals. The original data used to calculate these values are reported in the Appendix. The confidence intervals were not very wide, and minimum and maximum population sizes ranged from 27-683 when confidence intervals were taken into account. From a total of 25 separate population estimates, 12 yielded population sizes below 100 individuals, and 17 yielded values below 200 individuals. Population estimates were highly variable among species, indicating that local conditions exert strong influences on the number of specimens gathering in a particular area for breeding. A slight indication is found that in species of the Mantella betsileo group (i.e., in M. betsileo and M. viridis), population sizes are on average larger than in others species: 4 out of 6 estimates were higher than 200 individuals, and the two highest values, above 400 individuals, corresponded to M. viridis. Since the populations of these two species studied here occur in rather dry, seasonal areas, the results may indicate that in these areas, the specimens aggregate even more strongly in a limited number of moist areas suitable for reproduction. Data available so far, mostly from unpublished reports, always referred to population densities, not absolute numbers of individuals, and were as follows: For Mantella aurantiaca, Behra et al. (1995) observed densities between 14 to 230 individuals per hectare (ind/ha). For M. bernhardi, a density of 100-500 individuals by square km, thus 1 to 5 ind/ha, was mentioned for the RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 257

257

Tab. I. Summary of population size estimates carried out on Mantella populations using mark-recapture methods. The definitive densities were calculated based on population sizes averaged from the Schnabel estimator with 95% confidence interval. The population size of M. milotympanum, here reproduced from Vieites et al. (2005) (with asterisk) was calculated as average of Petersen (1896) estimates. Note the population “densities” calculated in the last column refer only to densities of the specimens at the study plots, and are merely reported to emphasize these frogs can occur in very dense breeding aggregations in very small areas, but these data should in no case be extrapolated to larger areas.

Ambohimanana zone, a site of intensive collecting using capture without release (Ramanamanjato et al., 1994). For M. ebenaui, densities between 100- 253 ind/ha were reported in Zahamena during the reproductive period (Ramanamanjato et al., 1994). For this same species, in 1994, densities of 46 to 440 ind/ha and 100 ind/ha have been estimated respectively in Ankarana and Benavony (Rakotomavo, 2001), and in Lokobe, a density of 133-273 ind/ha in RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 258

258

Fig. 1. Map of study localities as listed in Tab. I. RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 259

259

2000 (Rakotomavo, 2001). The methodology used for the estimates was not mentioned, and most of these estimates were reported under the name M. betsileo (but the north-eastern and north-western populations previously considered under that name are now assigned to M. ebenaui; see Rabemananjara et al., 2007b). For M. cowani, species for which we were unable to obtain population size data, the following density estimates in the Antoetra region in 1996, during the reproduction period, have been mentioned: 1050 ind/ha in the marshy area, 750 ind/ha in savannah, 350 ind/ha in eucalyptus forest, 750 ind/ha in edge and 550 ind/ha in bamboo forest, in Andalasakaviro, 110 ind/ha and 190 ind/ha in Amparihimazava (BIODEV ,1996). The methodology used was the cumulative capture without release. For M. haraldmeieri, a further species where we could not obtain appropriate sample sizes, 760 individuals per hectare were estimated in the low valley of Manantantely and 50 on the flank in January 1996 (BIODEV 1996). For M. milotympanum, earlier studies revealed densities of 1614-3000 ind/ha in March and 500-1652 ind/ha in May 1994 (Ramanamanjato et al., 1994); and 100-500 ind/ha in 2000 during hibernation (Rakotomavo, 2001). For M. viridis, at Montagne des Français, densities of 88-492 were observed in August 1994, and 15-242 ind/ha in February 1996 (BIODEV, 1996; Ramanamanjato et al., 1994). Despite the qualifications applying to the calculation of densities of these frogs per surface area (see Materials and Methods), which clearly is highly dependent on the definition of the study plot, we here calculated “densities” for our populations, in order to be able to compare them with the information available so far in unpublished reports, summarized in the previous paragraph. Except for one estimate of M. milotympanum of 3000 ind/ha (Ramanamanjato et al., 1994), all of the estimates obtained previously were below or around 1000 ind/ha. In contrast, most of our data are clearly higher than 1000 ind/ha, and several were distinctly higher than that. Previous estimates, as far as known, usually applied capture without release or transect counting, and were usually also carried out in favourable areas were Mantella individuals gathered for reproduction. This indicates that mark-recapture will probably give higher and probably more realistic estimates of population sizes of Mantella although long-term methodological comparisons are not available so far.

CONCLUSIONS

According to the data presented herein, it appears that Mantella usually gather in areas suitable for reproduction in populations of about 50-200 individuals at a particular moment. However, the actual populations are much larger, since many individuals will be far from the reproduction area at the particular time of survey, especially females after egg deposition and juveniles which were very rarely found in our surveys. It is remarkable that despite the methodological constraints of our short-term mark-recapture studies, the estimated population sizes are quite similar for all species. The “densities” RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 260

260

show much stronger differences among species, sites and seasons. This can be explained by the fact that sometimes reproductive sites can be small areas where all specimens concentrate (especially in species from dry regions, as M. viridis and M. betsileo), whereas in other cases breeding sites can be more evenly spaced. Under such conditions, defining the study plot area will have enormous effects for any spatial analysis of the population size data. Our data provide important baseline data for conserving Mantella frogs and corroborate further indications (e.g., Vences et al., 2004; Vieites et al., 2005) that, for many species in this genus, population sizes in heavily exploited areas are not necessarily lower than in pristine areas without commercial collecting activity (e.g., Mantella madagascariensis, M. milotympanum, M. aurantiaca). However, without long-term and more detailed studies on population structure and dynamics of these frogs, our data are insufficient to quantitatively assess strategies for sustainable harvesting of these species.

ACKNOWLEDGEMENTS

We are grateful to Marta Andriantsiferana, Rabe Andriamaharavo, Parfait Rasendra, Christian Razafindrabe and Cecchini Harisoa for assistance during field work. We are indebted to the Fonds d’Appui au Développement de 1’Enseignement Supérieur for funding of fieldwork and laboratory expenses to the Département de Biologie Animale, Université d’Antananarivo. The University of Antananarivo and ICTE/ MICET provided logistic assistance. The «Ministère de 1’Environnement, des Eaux et Forêts» kindly issued research authorizations. FR was supported by a WOTRO/NWO DC-fellowship for research in foreign countries. DRV is currently funded by the NSF ATOL Grant EF-1-10135. Fieldwork further received support by grants of the Volkswagen Foundation to MV.

RÉSUMÉ

Estimation rapide de la grandeur taille de population en dix espèces de grenouilles poison de Madagascar, gendre Mantella. De rapides évaluations des dimensions de population de dix espèces de grenouilles poison, le genre Mantella, montrent qu’il s’agit du groupe le plus massivement collecté par le marché des animaux de compagnie. Bien que la taxonomie et la diversité génétique de ces grenouilles ait été intensément étudié dans le passé, très peu de données sur sa dynamique de population sont disponibles, quoique de telles données soient mauvaises pour évaluer et réguler leur collecte commerciale et leur exportation. Ici nous résumons des données disponibles sur la densité de population de grenouilles poison malgaches et référençons chaque donnée estimée à partir de balises sur dix espèces de Mantella, accomplis entre 2003 et 2007. Les dimensions de la population se situaient généralement autour de 50 à 200 individus, mais ces données doivent être seulement prises comme préliminaires car elles se réfèrent à des spécimens pris sur des sites particuliers de reproduction (dans des marais ou le long de cours d’eau), et dans certains cas sont fortement partiales envers les males puisque les femelles sont beaucoup plus difficile à collecter. Une partie de ces densités de populations très élevées dans nos études et celles qui sont prévues se réfère à des RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 261

261

spécimens ramassés dans de très petites aires (inférieures à 50 mètres carrés où les plus hautes densités ont été enregistrées) et ne peut donc pas être extrapolée à l’ensemble des zones de distribution de ces espèces. Des études sur le long terme sur les dynamiques de populations particulières, ainsi que sur la longévité et la collecte, doivent être combinées avec des études sur le court terme d’estimations de densité, pour comprendre les perspectives de la récolte pérenne des grenouilles poison Malgaches.

Mots clés: Amphibiens, Conservation, Madagascar, Mantella, Population éstimée.

Falitiana C.E. RABEMANANJARA * Parfait BORA Tokihery J. RAZAFINDRABE, Edouard RANDRIAMITSO Olga RAVOAHANGIMALALA RAMILIJAONA, Noromalala RASOAMAMPIONONA RAMINOSOA Daniel RAKOTONDRAVONY Département de Biologie Animale Faculté des Sciences, Université d’Antananarivo B.P. 906, 101-Antananarivo, Madagascar

* Current address: Institute for Biodiversity and Ecosystem Dynamics Zoological Museum, University of Amsterdam Mauritskade 61, 1092 AD Amsterdam Email [email protected]

David R. VIEITES Museum of Vertebrate Zoology and Department of Integrative Biology 3101 Valley Life Sciences Bldg. University of California Berkeley, CA 94720-3160. USA Email [email protected]

Miguel VENCES Technical University of Braunschweig, Zoological Institute Spielmannstr. 8, 38106 Braunschweig, Germany Email [email protected]

REFERENCES

ANDREONE F., CADLE J. E., COX N., GLAW F., NUSSBAUM R. A., RAXWORTHY C. J., STUART S. N., VALLAN D. & VENCES M., 2005. Species review of amphibian extinction risks in Madagascar: conclusions from the global amphibian assessment. - Conservation Biology, 19: 1790-1802. RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 262

262

ANDREONE F. & LUISELLI L. M., 2003. Conservation priorities and potential threats influencing the hyper-diverse amphibians of Madagascar. - Italian Journal of Zoology, 70: 53-63. BAILEY L. L., SMITH, THEODORE R. & POLLOK K. H., 2004. Comparing population size estimators for plethodontid salamanders. - Journal of Herpetology 38: 370-380. BEHRA O., RABEMANANJARA F., RABIBISOA N. H., RAMILISON O. & RAVONINJATOVO A., 1995. Etude de la répartition et du niveau de population de deux espèces d’Amphibiens de Madagascar (Mantella aurantiaca et Mantella crocea, sous famille des Mantellinae). - Unpublished report, BIODEV, Antananarivo. BIODEV, 1996. Etude des niveaux de population de Mantella cowani et de Mantella viridis à Madagascar. Unpublished report, BIODEV/CITES International. CHIARI Y., VENCES M., VIEITES D. R., RABEMANANJARA F., BORA P., RAMILIJAONA RAVOAHANGIMALALA O. & MEYER A., 2004. New evidence for parallel evolution of colour patterns in Malagasy poison frogs (Mantella). - Molecular Ecology, 13: 3763-3774. CHIARI Y., ANDREONE F., VENCES M. & MEYER A., 2005. Genetic variation of an endangered Malagasy frog, Mantella cowani, and its phylogeographic relationship to the widespread M. baroni. - Conservation Genetics, 6: 1041-1047. CLARK V. C., RAXWORTHY C. J., RAKOTOMALALA V., SIERWALD P. & FISHER B. L., 2005. Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics. - Proceeding of the National Academy of Sciences of the USA, 102: 11617-11622. DALY J. W., ANDRIAMAHARAVO N. R., ANDRIANTSIFERANA M. & MYERS C. W., 1996. Madagascan poison frogs (Mantella) and their skin alkaloids. - American Museum Novitates, 3177: 1-34. DALY J. W., KANEKO T., WILLIAM J., GARRAFFO H. M., SPANDE T. F., ESPINOSA A. & DONNELLY M. W., 2002. Bioactive alkaloids of frog skin combinatorial prospecting reveals that pumiliotoxins have an arthropod source. - Proceedings of the National Academy of Science of the USA, 99: 13996-14001. DALY J. W., GARRAFFO H. M., HALL G. S. E. & COVER, J. F. Jr., 1997. Absence of skin alkaloids in captive-raised Madagascan mantelline frogs (Mantella) and sequestration of dietary alkaloids. - Toxicon, 35: 1131-1135. FUNK C.W., ALMEIDA-REINOSO D., NOGALES-SORNOSA F. & MARTIN BUSTAMANTE R., 2003. Monitoring population trends of Eleutherodactylus frogs. - Journal of Herpetology 37: 245-256 GLAW F. & VENCES M., 2003. Introduction to Amphibians. In: Goodman S.M. & Benstead J.P. (eds.), The Natural History of Madagascar. - The University of Chicago Press, Chicago and London. GLAW, F. & VENCES M., 2006. Phylogeny and genus-level classification of mantellid frogs. - Organisms Diversity and Evolution, 6: 236-253. HOTT J. A. & SCOTT DAVID E., 1999. Effects of toe-clipping and PIT-lagging on growth and survival in metamorphic Ambystoma opacum. - Journal of Herpetology, 33(2): 344-348. MYERS N., MITTERMEIER R. A., MITTERMEIER C. G., DE FONSECA G. A. B. & KENT J., 2000. Biodiversity hotspots for conservation priorities. - Nature, 403: 853-858. PETERSEN C. G. J., 1896. The yearly immigration of young plaice into Limfjord from the German sea. - Report of the Danish Biological Station 6. Copenhagen, Denmark. RABEMANANJARA F. C. E., CHIARI Y., RAVOAHANGIMALALA RAMILIJAONA O. & VENCES M., 2007a. Evidence for recent gene flow between north-eastern and south-eastern Madagascan poison frogs from a phylogeography of the Mantella cowani group. - Frontiers in Zoology 2007, 4: 1 (http://www.biomedcentral.com/1742-9994/4/1) RABEMANANJARA F. C. E., CROTTINI A., CHIARI Y., ANDREONE F., GLAW F., DUGUET R., BORA P., RAVOAHANGIMALALA RAMILIJAONA O & VENCES M., 2007b. Molecular systematics of Malagasy poison frogs in the Mantella betsileo and M. laevigata species groups. - Zootaxa. RABEMANANJARA F. C. E., RASOAMAMPIONONA RAMINOSOA N., RAVOAHANGIMALALA RAMILIJAONA RABEMANJARA:Layout 1 31-10-2008 15:40 Pagina 263

263

O., ANDREONE F., BORA P., CARPENTER A. I., GLAW F., RAZAFINDRABE T., VALLAN D., VIEITES D. R. & VENCES M., 2008. Malagasy poison frogs in the pet trade: a survey of levels of exploitation of species in the genus Mantella. In: Andreone F. (ed.), A Conservation Strategy for the Amphibians of Madagascar, pp. 253-276. - Monografie 45. Museo Regionale di Scienze Naturali, Torino. RAKOTOMAVO E., 2001. Etude de la filière: Mantella de Madagascar. Unpublished report, O.N.E., Antananarivo. RAMANAMANJATO J. B., RASELIMANANA A. & BEHRA O., 1994. Etude de la répartition et des niveaux de population de certaines espèces animales malagasy couramment collectés pour l’exportation. - Unpublished report, TRADEM IIa, USAID/BIODEV, Antananarivo. SCHNABEL Z. E., 1938. The estimation of the total fish of a lake. American Mathematical Monthly 45: 348-352 VENCES M., CHIARI Y., RAHARIVOLOLONIAINA L. & MEYER A., 2004. High mitochondrial diversity within and among populations of Malagasy poison frogs. - Molecular Phylogenetics and Evolution, 30: 295-307. VENCES M. & GLAW F., 2003. Mantella. In: Goodman S.M. & Benstead J. P. (eds.), The Natural History of Madagascar, pp. 913-916. - The University of Chicago Press, Chicago and London. VENCES M., GLAW F. & BÖHME W., 1999. A review of the genus Mantella (Anura, Ranidae, Mantellinae): taxonomy, distribution and conservation of Malagasy poison frogs. - Alytes 17 (1-2): 3-72. VENCES M. & KNIEL C., 1998. Mikrophage und myrmecophage Ernährungsspezialisierung bei madagassischen Giftfröschen der Gattung Mantella. - Salamandra 34 (3): 245-254. VIEITES D. R., RABEMANANJARA F. E. C., BORA P., RAZAFIMAHATRATRA B., RAMILIJAONA RAVOAHANGIMALALA O. & VENCES M., 2005. Distribution and population density of the black- eared Malagasy poison frog, Mantella milotympanum Staniszewski, 1996 (Amphibia: Mantellidae). In: Huber B. A. & Lampe K. H. (eds.), African Biodiversity: Molecules, Organisms, Ecosystems, pp. 197-204. Proceedings 5th International Symposium - Tropical Biology, Museum Koenig and Springer Verlag, Bonn. WHITE G. C., ANDERSON D. R., BURNHAM K. P. & OTIS D. L., 1982. Capture-recapture and removal methods for sampling closed populations. Los Alamos, New Mexico: Los Alamos National Laboratory. RABEMANJARA:Layout 1 31-10-2008 15:42 Pagina 264

264

APPENDIX: SUMMARY OF THE ORIGINAL MARK-RECAPTURE DATA USED FOR ESTIMATION OF POPULATION SIZES.

Data for each species and localitiy are presented as N/r/m for each capture occasion, where N is the total number of specimens captured on that capture occasion, r is the number of recaptured specimens on that capture occasion, and m is the number of marked specimens in the population before that particular capture occasion. At the end of each mark-recapture series we give the number of total marked specimens in the population at the end of the experiment, which can be seen as the minimum population size. M. aurantiaca - Andranomandry 21-23 Jan 2004: 24/0/0, 20/13/24, 25/8/31, 15/6/48, 21/10/57, 68. M. aurantiaca - Torotorofotsy 20-25 Feb 2004: 26/0/0, 24/15/26, 38/18/35, 45/26/55, 34/33/74, 75. M. aurantiaca - Torotorofotsy 21-22 Jan 2007: 50/0/0, 46/17/50, 59/13/79, 51/30/125, 38/34/146, 150. M. baroni - Fanjavala 15-17 Jan 2004: 18/0/0, 10/2/18, 25/5/26, 36/14/46, 19/14/68, 73. M. baroni - Ampasimpotsy Antoetra 5-7 Dec 2003: 38/0/0, 49/18/38, 52/42/69, 37/33/79, 33/28/83, 88. M. baroni - Kidonavo 21-29 Jan 2004: 8/0/0, 9/3/8, 13/6/14, 9/3/21, 10/3/27, 13/12/34, 5/3/35, 5/4/37, 9/4/38, 43. M. bernhardi - Mangevo, inside Ranomafana National Park 11-12 Dec 2003: 16 0 0, 17 4 16, 10 7 29, 22 19 32, 16 14 35, 37. M. bernhardi - Mangevo, outside Ranomafana National Park 11-12 Dec 2003: 20/0/0, 38/0/20, 104/16/58, 90/47/146, 189. M. bernhardi - Tolongoina 16-19 Dec 2003: 22/0/0, 30/9/22, 22/16/43, 21/10/49, 17/15/60, 62. M. bernhardi - Manombo 1-3 Feb 2004: 5/0/0, 21/2/5, 19/5/24, 27/11/38, 54. M. betsileo - Ankadirano 10-12 Sep 2003: 45/0/0, 67/9/45, 27/12/103, 52/28/118, 55/29/142, 168. M. betsileo - Kirindy 27-29 Nov 2003: 49/0/0, 91/28/49, 80/29/112, 70/60/163, 72/62/173, 183. M. crocea - Ankosy 7-08 Feb 2004: 21/0/0, 23/16/21, 22/16/28, 16/15/34, 35. M. laevigata - Marojejy 20-21 Dec 2003: 12/0/0, 12/0/12, 26/2/24, 25/7/48, 36/14/66, 88. M. laevigata - Marojejy 19-21 Mar 2004: 17/0/0, 13/2/17, 12/2/28, 13/1/39, 13/6/51, 57. M. madagascariensis - Fanjavala 15-17 Jan 2004: 38/0/0, 26/5/38, 13/4/59, 17/5/68, 17/9/80, 88. M. milotympanum - Sahamarolambo (Fierenana) 11-13 Aug 2003: 14/0/0, 17/4/14, 22/8/27, 31/22/41, 50. M. milotympanum - Sahamarolambo (Fierenana) 30 Jan-01 Feb 2004: 57/0/0, 68/18/57, 43/27/107, 31/12/123, 59/38/142, 163. M. milotympanum - Sahamarolambo (Fierenana) 4-6 Apr 2004: 25/0/0, 32/12/25, 38/26/45, 31/19/57, 30/17/69, 82. M. pulchra - An’Ala 09-11 Jan 2004: 20/0/0, 43/13/20, 42/24/50, 42/31/68, 41/24/79, 96. M. viridis - Andranomantsina 30 Aug - 1 Sep 2003: 56/0/0, 78/17/56, 127/40/117, 79/40/204, 193/79/243, 347. M. viridis Andohatany 30 Aug - 1 Sep 2003: 27/0/0, 46/10/27, 37/25/63, 43/33/75, 85. M. viridis Andranomantsina 26-28 Nov 2003: 41/0/0, 36/7/41, 43/5/70, 34/8/108, 29/8/134, 155. M. viridis Andohatany 26-28 Nov 2003: 21/0/0, 10/4/21, 12/4/27, 10/3/35, 4/3/42, 43. Mitt. Mus. Nat.kd. Berl., Zool. Reihe 83 (2007) 2, 170–178 / DOI 10.1002/mmnz.200700007

A rapid assessment survey of the herpetofauna at Befotaka-Midongy National Park, south-eastern Madagascar

Parfait Bora1, Miora Otisitraka Randriambahiniarime1, Falitiana C. E. Rabemananjara1, Olga Ravoahangimalala Ramilijaona1, Frank Glaw2 and Miguel Vences*,3

1 Universite´ d’Antananarivo, De´partement de Biologie Animale, Antananarivo 101, Madagascar 2 Zoologische Staatssammlung, Mu¨ nchhausenstr. 21, 81247 Mu¨ nchen, Germany 3 Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106 Braunschweig, Germany

Received 18 October 2006, accepted 5 April 2007 Published 24 September 2007

With 2 figures

Key words: Herpetology, species survey, Madagascar, Befotaka-Midongy National Park, Rozabe, Kilimagnarivo.

Abstract

We report on the results of a herpetological rapid assessment survey in the Befotaka-Midongy National Park in south-eastern Madagascar, carried out between 25 September and 17 October 2005. The survey yielded a total 46 species (30 amphibians and 16 reptiles). Of the two surveyed sites, both characterized by rainforest habitat and situated at elevations of 600––900 m, Kilimagnar- ivo was richer in species diversity than the second site, Rozabe. Seven species were only recorded from Rozabe whereas 14 species were only recorded from Kilimagnarivo. Among the remarkable discoveries was the frog Gephyromantis spinifer, which constitutes a significant range extension for this species. The same is true for Gephyromantis tschenki which was hitherto only known from the Ranomafana region. One specimen assigned to the arboreal snake Stenophis cf. carleti had a number of ventral and subcaudal scales intermediate between S. gaimardi and S. carleti, indicating that the taxonomic definition of S. carleti is insufficient. The reported herpetofaunal diversity appears low if compared to other sites in the same region (e.g., Ranomafana National Park) but considering the unfavourable period of the survey in the austral winter, and taking into account the results of other teams who also have surveyed sites in the Befotaka-Midongy region, we assume a high species diversity in Midongy National Park.

Resume

Un inventaire rapide a e´te´ effectue´ dans le Parc National de Befotaka-Midongy, dans la partie sud-est de Madagascar, pour but de connaıˆtre la composition herpetologique de la re´serve, du 25 septembre au 17 octobre 2005. Un total de 46 espe`ces est inventorie´ dont 30 amphibiens et 16 reptiles. Cet inventaire a permis de constater que le site de Kilimagnarivo est beaucoup plus riche en espe`ce et plus diversifie´ que celui du site de Rozabe. En effet, 7 espe`ces sont propres de Rozabe tandis que 14 autres ne sont trouveés qu’a` Kilimagnarivo. Entre les dećouvertes remarquables, il faut mentionner la grenouille Gephyromantis spinifer, sa localisation en Midongy constitue un e´largissement important de son aire de re´partition. La meme est vrai pour Gephyromantis tschenki, jusque’a maintenant seulement connue de la region de Ranomafana. Un serpent arbor- icole attribueá` l’espe`ce Stenophis cf. carleti a` un nombre d’ećailles ventrales intermediaire entre S. carleti and S. gaimardi, ceci confirme que S. carleti est insuffisant definie´. La diversite´ herpe´tofaunique trouveé est faible par rapport aux autres sites dans la mem re´gion (par example le Parc National de Ranomafana). Mais, elle est e´leveé si l’on tient compte de la pe´riode d’inventaire qui n’est pas favorable aux animaux en particulier les amphibiens et reptiles et les re´sultats des autres chercheurs qui ont e´galement travaille´ dans la zone de Befotaka-Midongy autres que les sites e´tudie´s dans notre travail.

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Introduction west of Vagaindrano and consisting of of humid mid-altitude rainforest. The area is among the can- Befotaka-Midongy National Park is a reserve in didates for becoming part of a southern cluster of south-eastern Madagascar, located about 110 km natural areas in Madagascar which may become a

* Corresponding author: e-mail: [email protected]

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim Mitt. Mus. Nat.kd. Berl., Zool. Reihe 83 (2007) 2 171

World Heritage site. Although several biotic surveys of this reserve have been carried out in the past by various research teams, no published species inventory exists to date. In 2003, a team of Malagasy students led by A. Raselimanana has carried out intensive research on the herpetofaunal diversity of this region, but their results so far remain unpublished. Considering the need for further data, the Madagascan national agency for the management of protected areas (Association Nationale pour la Gestion des Aires Prote´ge´es; ANGAP) who recently became responsible of managing this area, initiated a number of rapid assessments of sites in this area. In this paper we report on the results of one rapid assessment at two sites within the Befotaka- Midongy National Park, carried out by the first two authors in 2005. Our goal is not to provide a comprehensive species list for the reserve but to contribute an annotated list of species as a starting point for a more complete future inventory. We will highlight a number of remarkable herpetofaunal discoveries and point to future needs of research.

Materials and Methods

Two different sites were surveyed, both within the boundaries of Befotaka-Midongy National Park (BMNP). (1) Ro- zabe, located at 2344011.700 S/4701022.900 E, at elevations between 630––850 m, visited at September 29, 2005 until October 5, 2005. (2) Kilimagnarivo, located at 234705100 S/ 4700034.600 E, at 690––890 m, visited at October 7––13, 2005. Both sites comprised low- to mid-altitude rainforest as well as some more open areas. No rain was recorded during our fieldwork. The location of Befotaka-Midongy National Park, and of other comparative sites mentioned in this paper, is shown in Fig. 1. Three collecting methods were used: (1) opportunistic, non-systematic diurnal and nocturnal searches along transects (paths) in the forest and in open areas, (2) intensive searches in particular microhabitats known to be used by particular Fig. 1. Map of Madgascar, showing the approximate location species of amphibians and reptiles, such as the bark of dead of Befotaka-Midongy du Sud National Park and of other im- trees, logs, and leaf axils of large-leafed plants (Ravenala and portant comparative sites mentioned in the text. Pandanus). (3) Pitfall trapping using 100 m of a 50 cm high plastic barrier interrupted by 11 15-litres buckets. Three pitfall lines at three different settings (valley, flat area, and 16S rRNA gene amplified using the primers 16Sa-L and crest) were used. Voucher specimens were anesthesized and 16Sb-H of Palumbi et al. (1991). After purification (Qiagen killed with ether and fixed in 10% formalin (reptiles) or 95% kits), the fragments were resolved on automated DNA se- ethanol (amphibians), and subsequently stored in 70% etha- quencers (ABI 377 and ABI 3100). Sequences were validated nol. They were deposited in the collections of the Universite´ and aligned with the software Sequence Navigator (Applied d’Antananarivo, De´partement de Biologie Animale (UAD- Biosystems), and deposited in Genbank (accession numbers BA), with a few specimens also deposited at the Zoologische of newly obtained sequences: EF530071-530078). Staatssammlung Mu¨ nchen (ZSM). Four months after capture, tissue samples of the amphibians were taken from the preserved specimens and transferred to vials with 99% ethanol. Morphometric measurements, in particular snout-vent length Results (SVL) were taken from some specimens using calipers. In addition for the snakes we give information about some diagnostic scale counts, in particular number of ventral (V), sub- Altogether in the course of the inventory we have caudal (SC) and dorsal (at midbody; D) scales. Taxonomy of been able to collect 46 species, of which 30 were mantellid amphibians follows Glaw & Vences (2006). amphibians and 16 were reptiles. Although the in- For molecular identification (Vences et al. 2005), muscle ventory was not carried out during the rainy sea- tissue samples were taken from the collected specimens and preserved in 98% ethanol. DNA was extracted using differ- son, there was a relevant reproductive activity of ent standard protocols and a fragment of the mitochondrial many of the frog species, as assessed by male call-

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1http://museum-zool.wiley-vch.de 172 Bora, P. et al.: Herpetofauna of south-eastern Madagascar ing activity. This regards especially the species of Boophis cf. periegetes Cadle, 1995 Boophis that all were observed calling. The recorded amphibians belonged to four families, Hyperoliidae, UADBA 25500 (Rozabe) Ptychadenidae, Microhylidae, and Mantellidae. Rep- tiles included lizards (Chamaeleonidae, Gekkonidae, The status of specimens from south-eastern Mada- Gerrhosauridae, Scincidae) and snakes (Boidae, gascar assigned to Boophis goudoti and B. perie- Colubridae). getes is problematic since the Boophis goudoti po- In the following we provide an annotated list of pulations from this area are morphologically the recorded species, mentioning the respective different from those in central Madagascar, mainly voucher specimens in the UADBA and ZSM col- characterized by a longer snout and a more granu- lections, and reporting some observations on the lar skin in breeding males, both also features specimens when deemed useful. Some of the speci- characterizing B. periegetes. The specific status of mens were collected inbetween the two study sites the specimen collected in this survey requires and their collecting locality is therefore indicated further attention and can only be assessed in the as “Rozabe-Kilimagnarivo”. context of a revision of this group of species.

Amphibians Boophis sibilans Glaw & Thiesmeier, 1993

UADBA 25415, 25419, 25422, 25427 and 25507 (Kilimagnari- Hyperoliidae vo)

Heterixalus cf. alboguttatus (Boulenger, 1882) Five males were collected along a stream, all males of 26––28 mm SVL. Genetically, one specimen UADBA 25510 (Kilimagnarivo) (UADBA 25415) was identified as belonging to Boophis sibilans, with some differentiation from A single juvenile individual was collected along a specimens from the type locality Andasibe in east- river. It is tentatively assigned to Heterixalus albo- ern Madagascar (10 differences in 486 compared guttatus which is known to occur in this area of nucleotides of the 16S rRNA gene). This record is south-eastern Madagascar. a significant range extension to the south.

Mantellidae: Boophinae Mantellidae: Laliostominae

Boophis boehmei Glaw & Vences, 1992 Aglyptodactylus madagascariensis (Dume´ril, 1853)

UADBA 27858, ZSM 178/2006 (Kilimagnarivo) UADBA 25410 (Kilimagnarivo)

A single female specimen collected. Since recent, Boophis luteus (Boulenger, 1882) unpublished genetic evidence indicates that A. madagascariensis is a complex of various species, the UADBA 25405 (Kilimagnarivo) identity of the Midongy population requires further study. A single female of 56 mm SVL was collected at the edge of the forest. Assigned to B. luteus based on the presence of a red outer iris area that was still recognizable five months after preservation. Mantellidae: Mantellinae

Gephyromantis cf. boulengeri Methuen, 1920 Boophis madagascariensis (Peters, 1874) UADBA 25414, 25421, 25469, 25483, 25514 25516 (Kilimag- UADBA 25403, 25406, 25407, 25482 (Kilimagnarivo); 25408, narivo); 25431, 25506, 25512 (Rozabe) 25485 (Rozabe) 5 males and 4 females belonging to the G. boulen- All six specimens collected were males. Although geri complex were collected. Their identity re- the collected specimens were not seen calling, they quires further study since this complex of small were collected from perches on bamboo and Pan- diurnal frogs is known to contain many genetically danus from where typical Boophis madagascarien- differentiated species of only restricted distribu- sis calls were heard. tion.

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim http://museum-zool.wiley-vch.de Mitt. Mus. Nat.kd. Berl., Zool. Reihe 83 (2007) 2 173

Gephyromantis cf. plicifer (Boulenger, 1882) the first reliable record of G. tschenki from outside Ranomafana National Park and makes it likely that UADBA 25399, 25402, 25438, 25463, 25493 and 25504 (Kili- specimens from the Andringitra region deposited magnarivo) in the Paris museum which have initially been identified as G. cornutus (Glaw & Vences 1994) also be- Of the six specimens only one was a male long to G. tschenki. (UADBA 25504). Its large size (46 mm) agrees with the species defined as plicifer by Vences & Glaw (2001). Guibemantis pulcher (Boulenger, 1882)

UADBA 25416, 25429 and 25511 (Rozabe) Gephyromantis spinifer (Blommers-Schlo¨ sser & Blanc, 1991) The three individuals were found in forest between altitude 630––950 m. UADBA 25478 (Kilimagnarivo); 25495 (Rozabe)

The two collected females agree with specimens from the type locality, Chaines Anosyennes, in size Mantella cf. baroni Boulenger, 1888 (37 mm), large number of dorsal tubercles and spines, and distinct black-white ventral patterning. UADBA 27838, 27839, 27844, 27853, 27854, ZSM 172-174/ This species was so far reliably known only from 2006 (Kilimagnarivo) the type locality and from Andohahela National Park at elevations between 440––1250 m (Nuss- This species was collected at Kilimagnarivo at the baum et al. 1999), with a record from the Andringi- forest edge. This species was common along a large tra Massif requiring confirmation (Vences & Glaw, stream between 690 and 750 m. The colouration is 2001), and its presence in BMNP is therefore an dorsally largely green without rostral stripe, and important range extension. It furthermore indicates the venter is black with many small blue spots. Red that this species is relatively widespread in the colour is present on the ventral side of the tibia. In south-eastern rainforests at low and mid-altitudes. a sequence of the 16S rRNA gene, specimens were However, it probably does not reach much further 100% identical to those of Mantella baroni and to the north than BMNP, since it has not been Mantella nigricans (and different from M. harald- found at Andringitra National Park, Ranomafana meieri, the species occurring further south-east), National Park, or the rainforest corridor linking confirming that the complex baroni-nigricans also these two reserves, despite rather intensive surveys comprises the different and more uniform colour in this area (Andreone 1994, Raxworthy & Nuss- morphs of the south-east of Madagascar. baum 1996; Raselimanana 1999; Rakotomalala et al. 2001). Sequences of the 16S rRNA gene differed from Mantidactylus aerumnalis (Peracca, 1893) those of G. asper from Mandraka in central-eastern Madagascar by 33 of 492 nucleotides, correspond- UADBA 25430, 25436, 25460, 25462, 25464, 25465, 25471, ing to a differentiation of almost 7% and confirm- 25492, 25499, ZSM 179/2006 (Kilimagnarivo) ing the separate status of this species. Three males, five females and two juveniles, all found close to a swamp at 630––700 m elevation. Gephyromantis tschenki Glaw & Vences, 2001

UADBA 25457 (Kilimagnarivo); 25396, 25468, 25476, 25489, Mantidactylus argenteus Methuen, 1920 25490 and 25491 (Rozabe) UADBA 25454 (Kilimagnarivo); 25466, 25470, 25479, 25481 Seven individuals were collected, among which and 25502 (Rozabe) there are two males (UADBA 25476 and 25491) of 35––39 mm SVL and two females (UADBA 25489 This species was common along streams at both and 25468) of 45––46 mm. study sites. Of the six collected specimens, only one Molecular data confirmed the assignment of this (UADBA 25470) was a male (SVL 36 mm) while population to G. tschenki; one specimen (UADBA the others were females (SVL 36––38 mm). These 25457) had a highly repeated insert in the specimens appear to be larger and more elongated 16S rRNA gene fragment studied here, which is ty- than in specimens from central eastern Madagas- pical also for most other specimens of the species, car. However, their 16S rDNA sequences (of and also had high sequence similarity to this spe- UADBA 25479 and 25502) were highly similar cies in the remainder of this gene fragment. This is (6––7 mutations in 497 nucleotides; 1.4% diver-

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1http://museum-zool.wiley-vch.de 174 Bora, P. et al.: Herpetofauna of south-eastern Madagascar gence) to those of M. argenteus from other speci- In the male the horizontal tympanum diameter is mens, e.g., Mantadia in central-eastern Madagascar. smaller than the horizontal eye diameter and the upper lip is light coloured.

Mantidactylus cf. betsileanus (Boulenger, 1882) Mantidactylus cf. femoralis (Boulenger, 1882) –– UADBA 25398, 25426, 25508, 25509 (Kilimagnarivo); 25393, 25400, 25417, 25418, 25420, 25423, 25424, 25425, 25428, species B 25437, 25498, 25505, 25513 (Rozabe) UADBA 25461, 25486, 25496 and 25503 (Kilimagnarivo) Five males, six females, and seven juveniles (including one non catalogued specimen) belonging to the Man- Four individuals were collected of which three are tidactylus betsileanus complex were collected but their males (SVL 47––49 mm) and one (UADBA 25503) identity requires further study, considering the poor is a female (SVL 58 mm). In this species the tym- taxonomic resolution in the subgenus Brygoomantis. panum is of similar size as the eye or slightly larger in the males, and a yellow marking is present in the inguinal region as well. The upper lip is darker Mantidactylus cf. biporus (Boulenger, 1889) than in species A.

UADBA 27855 (Kilimagnarivo); 27840, 27847, 27848 (Ro- zabe); ZSM 176-177/2006 Mantidactylus grandidieri Mocquard, 1895 This small species may be related or belong to UADBA 25497 (Kilimagnarivo); 25412, 25458 (Rozabe) Mantidactylus tricinctus, a species that is in need of revision. Of the four UADBA specimens two were This was a common species at the two sites, and males (SVL 18 mm) and two were females (SVL only a few representative specimens were collected. 20––21 mm).

Mantidactylus cf. charlotteae Vences & Glaw, 2004 Mantidactylus lugubris (Dume´ril, 1853)

UADBA 25453 (Kilimagnarivo) UADBA 25459, 25472 (Kilimagnarivo); 25433, 25467, 25494 (Rozabe); ZSM 175/2006 One female (SVL 29 mm) was collected, demonstrat- M. lugubris ing the possible presence of this species in low- to mid- Similar to the previous species, was a elevations of south-eastern Madagascar, which so far common species at both sites and only a limited was only supported by two historical specimens from number of specimens was collected. Andohahela (see Vences & Glaw 2004). However, the identity of these south-eastern populations of this species are in need of revision, because preliminary Mantidactylus majori Boulenger, 1896 genetic data (M. Vences, unpublished) are providing evidence for large genetic differences within M. char- UADBA 25409, 25413, 25474, 25475 (Kilimagnarivo); 25395, lotteae which may in fact be a species complex. 25411 (Rozabe) One male and five females from the two sites. The Mantidactylus cf. femoralis (Boulenger, 1882) –– specimens showed a relativelely strong genetic dif- species A ferentiation from majori specimens from Ranoma- fana which will require further study. UADBA 25488 (Kilimagnarivo); 25397, 25404 (Rozabe)

The subgenus Ochthomantis is, in Mantidactylus, Mantidactylus melanopleura (Mocquard, 1901) one of the groups in major need of revision, with a larger number of undescribed species that partly UADBA 25473, 25477, 25484, 25487 (Kilimagnarivo), 25480 occur in syntopy (Glaw & Vences 2004, Rabibisoa, (Rozabe) pers. comm.). At BMNP we observed individuals belonging to Ochthomantis, morphologically close to Mantidactylus femoralis, which we here classify Spinomantis cf. aglavei (Methuen & Hewitt, 1913) tentatively in two species that we name A and B. Of species A, three specimens were collected, of UADBA 27845 (Rozabe) which one is a male (UADBA 25488) of 44 mm SVL. This species has distinct black horizontal A single subadult specimen was collected which, stripes, bordered by yellow, in the inguinal region. for morphological characters (numerous dermal

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim http://museum-zool.wiley-vch.de Mitt. Mus. Nat.kd. Berl., Zool. Reihe 83 (2007) 2 175 spines laterally on tarsus and foot) can be assigned Madascincus melanopleura (Gu¨ nther, 1877) to this species. UADBA 25541 (Kilimagnarivo); 25540, 25543 (Rozabe)

All three specimens were collected in pitfalls. Microhylidae :Cophylinae Trachylepis gravenhorstii (Dume´ril & Bibron, 1839) Platypelis grandis (Boulenger, 1889) UADBA 25537 (Kilimagnarivo); 25535 (Rozabe) UADBA 25455 (Kilimagnarivo); 25456 (Rozabe) Two specimens captured in pitfalls. One adult female and one juvenile of this species were collected. Chamaeleonidae

Brookesia superciliaris (Kuhl, 1820) Platypelis cf. pollicaris (Boulenger, 1889) UADBA 25519, 25525 (Kilimagnarivo); 25517, 25531 (Rozabe) UADBA 27843 (Kilimagnarivo)

A single male was collected on a bush along a Gerrhosauridae stream at night. Zonosaurus aeneus (Grandidier, 1872)

UADBA 25527 (Kilimagnarivo); 25536 and 25538 (Rozabe) Plethodontohyla cf. bipunctata (Guibe´, 1974) Three specimens captured by hand in open areas. UADBA 25394 (Kilimagnarivo)

A single specimen was collected in a swampy area. Zonosaurus cf. madagascariensis (Gray, 1831)

UADBA 25523 (Kilimagnarivo)

Stumpffia cf. tetradactyla Vences & Glaw, 1991 This species was seen at both sites but only one individual was captured by hand in an open savanna-like UADBA 25434, 25435 (Kilimagnarivo); 25432, 25515 (Ro- area at Kilimagnarivo. Relationships of south-east- zabe) ern specimens assigned to Z. madagascariensis (from BMNP as well as from Ranomafana) to the similar Four specimens were collected in swampy areas. species Z. anelanelany remain to be clarified.

Gekkonidae Ptychadenidae Lygodactylus cf. miops Gu¨ nther, 1891 Ptychadena mascareniensis (Dume´ril & Bibron, 1841) UADBA 25544 (Rozabe) UADBA 25501 (Kilimagnarivo); 25401 (Rozabe)

At both localities specimens were observed along Phelsuma lineata Gray, 1842 rice fields but only single individuals were collected. UADBA 25530, 25533, 25542 (Kilimagnarivo); 25522, 25534, 25545 (Rozabe)

Six specimens were collected on leaves of Panda- Reptiles nus and of agaves.

Scincidae Colubridae

Amphiglossus frontoparietalis (Boulenger, 1889) Compsophis infralineatus (Gu¨ nther, 1882)

UADBA 25539 (Kilimagnarivo) UADBA 25532 (Kilimagnarivo)

A single specimen was collected in a pitfall line po- The single specimen was captured close to a stream sitioned in a valley. while it was swallowing a frog, most probably a

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1http://museum-zool.wiley-vch.de 176 Bora, P. et al.: Herpetofauna of south-eastern Madagascar specimen of Boophis sibilans. The specimen had and subcaudals of carleti (Vences et al. 2004). The 167 V and 61 SC. Midongy specimens lower this gap (263 ventrals and 108 SC in UADBA 25520) and indicate that the taxonomic definition of S. carleti is insufficient. Liopholidophis cf. rhadinaea Cadle, 1996

UADBA 25529 (Rozabe) Boidae

Found on the ground among debris in the forest. Sanzinia madagascariensis (Dume´ril & Bibron, The specimen had 166 ventrals. 1844)

UADBA 25521 (Rozabe) Liophidium torquatum (Boulenger, 1888) One specimen was seen at each of the two sites, UADBA 25524 (Rozabe) but only one juvenile specimen was collected as voucher. Found in similar habitats as L.cf.rhadinaea. Ob- served at both sites but only one individual was captured. Scale counts are: 17 D, 187 V, 63 SC. Discussion

Bibilava infrasignatus (Gu¨ nther, 1882) Altogether 46 species of amphibians and reptiles have been recorded during this inventory, 30 am- UADBA 25546 (Rozabe) phibians and 16 reptiles. Of these, seven were only found at Rozabe and 14 were only found at Kili- Only found at Rozabe within the forest. Meristic magnarivo, validating the decision to select two se- values for the single collected specimen are: 19 D, parate survey sites. Both sites were already suffer- 158 V, 69 SC. ing from some anthropogenic pressure at the time of our survey. Kilimagnarivo had also a much higher amphibian species diversity than Rozabe, namely Liopholidophis cf. sexlineatus (Gu¨ nther, 1882) 26 vs. 19 species at Rozabe, while the recorded reptile species diversity was the same at both sites UADBA 25526, 25528 (Rozabe) (12 species). This might be explained by the higher diversity of microhabitats at Kilimagnarivo, where Found at both sites but only collected at one site. numerous swampy areas and streams, as well as A common species found both within forest and in Pandanus and Ravenala plants, were present. the savanna. Meristic values of UADBA 25528 (fe- Altogether the species diversity recorded from male) are: 17 D, 154 V, 62 SC. both sites together was not particularly high. As points of comparison, at Andohahela in the far south, considering only the results from the rainfor- Madagascarophis colubrinus (Schlegel, 1837) est sites at parcel 1 of this reserve, Nussbaum et al. (1999) found a total of 45 amphibians and 32 rep- This species has been observed during the survey tiles at five surveyed sites, with values of 5––29 am- in the forest of Rozabe, but no voucher specimen phibians and 8––18 reptiles per site. Andreone & was collected. Randriamahazo (1997) found 24 amphibians and 18 reptiles at Andohahela, carrying out surveys at two study periods. At Andringitra, Raxworthy & Stenophis cf. carleti Domergue, 1995 Nussbaum (1996) found a total of 57 amphibians and 35 reptiles at five sites, with values of 5––36 UADBA 25518 and 25520 (Kilimagnarivo) amphibians and 4––17 reptiles per site. At Ranoma- fana National Park, Rakotomalala et al. (2001) One male (25520) and one female (25518) of this found 53 amphibians and 25 reptiles at three sites, arboreal snake were found, one of which at night with 16––31 amphibians and 5––16 reptiles per site. on a rock in an area of low current of a stream. Raselimanana (1999) found 56 amphibians and Meristic data of UADBA 25518 are: 17 D, 253 V, 56 reptiles at Ivohibe Special Reserve and the cor- 100 SC. Meristic data of UADBA 25520 are: 17 D, ridor linking it to Andringitra National Park, after 263 V, 108 SC. surveying five sites, with 10––22 amphibians and The main meristic difference of gaimardi 12––18 reptiles per site. Further north in central- (266––284 V, 105––117 SC) and carleti (252––258 V, eastern Madagascar, in a rapid assessment inven- 97 SC) are apparently the lower counts of ventrals tory of the Zahamena-Mantadia corridor in cen-

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim http://museum-zool.wiley-vch.de Mitt. Mus. Nat.kd. Berl., Zool. Reihe 83 (2007) 2 177 tral-eastern Madagascar, 45 amphibians and 42 rep- number of species of reptiles, but possibly a lower tiles were recorded in only a slightly longer survey number of frog species. Precise data of this survey period (Anonymous, 2001). These data consistently by A. P. Raselimana and colleagues are not yet show higher species diversities in areas from south- available and will likely be published after comple- eastern Madagascar than recorded in our survey. tion of data analysis. We suppose that the relatively low number of Altogether our results indicate links of the her- species recorded from BMNP in our survey is due petofauna of the surveyed sites at BMNP with that to mainly three reasons: (1) The survey was carried found in the extreme south-east (Andohahela). out in the austral winter when accessibility of the This is mainly supported by the record of Gephyro- BMNP area is better. In fact, no rain was recorded mantis spinifer, a species which may not occur during our fieldwork. (2) The survey period was re- much further north since it has not yet been relatively short and (3) only two sites of similar ele- corded in Andringitra National Park or Ranomafa- vation were visited. (4) In Madagascar, the highest na National Park. Gephyromantis plicifer seems to species diversities are recorded in central-eastern be also restricted to south-eastern Madagascar, but Madagascar, probably due to a mid-domain effect is known to occur over a much wider area, includ- of increased overlap of distribution areas (Lees ing Ranomafana. Many other species recorded et al., 1999). BMNP is located relatively far south- from BMNP are widespread and common over east and may therefore harbour a lower species di- much of Madagascar’s rainforests, from at least An- versity than other sites of more central latitude. In dasibe/Mantadia in the center to Andohahela in fact, the comparative values summarized above the south, for example Boophis luteus, B. mada- clearly indicate that species diversity was lowest at gascariensis,orZonosaurus aeneus, and many the southernmost locality Andohahela, while An- others even range into north-eastern Madagascar. dringitra, Ivohibe and Ranomafana had higher spe- Further study is also necessary to assign the Man- cies diversity. BMNP is located further south than tella population of BMNP, although Rabemanan- these three sites and its species diversity may there- jara et al. (2007) have shown that Mantella baroni fore already be lower, approaching the situation at is a genetically very uniform species, with identical Andohahela. haplotypes distributed over much of its distribution The species accumulation curve (Fig. 2) indicates area including specimens from Andringitra that beginning saturation after 6––7 days of survey. show extended yellow-greenish dorsal colouration. However, we suspect that this saturation is artificial In line with several studies indicating that the because in general, activity of amphibians and rep- south-eastern part of Madagascar is undersampled tiles during the survey period is expected to be (Raxworthy et al., 2003) and contains genetically rather low and several seasonal species may be highly divergent phylogeographic lineages (Vieites very difficult to record in this time. The curve and et al., 2006), our study supports the need of more the species recorded may therefore reflect the intensive herpetological survey work in this region, number of species active in the study period rather which should be carried out in concert with taxo- than the number of species actually present at the nomic study of the encountered populations. survey sites. Another survey of BMNP which targeted different sites within the park between 30 October and 14 November 2003 was able to record a higher Acknowledgements

We are grateful to the UNESCO and the Parcs Nationaux de Madagascar/Association Pour la Gestion des Aires Prote´ge´es (BMNP/ANGAP), the “Directeur Inter-Re´gional” of Fianar- antsoa, the director and team of the BMNP for their logistic help to reach the study sites at BMNP. Several local guides and the local population were of help during fieldwork. We are grateful to the Association Nationale pour la Gestion des Aires Protege´es (ANGAP) for funding and for the permission to proceed with the publication of these data.

References

Andreone F. 1994. The amphibians of Ranomafana rain forest, Madagascar –– preliminary community analysis and conservation considerations. –– Oryx 28: 207––214. Andreone, F. & Randriamahazo, H. 1997. Ecological and Fig. 2. Species accumulation curve for amphibians and rep- taxonomic observations on the amphibians and reptiles of tiles as collected during 7 days of survey at each of the two the Andohahela low altitude rainforest, S. Madagascar. –– sites in Befotaka-Midongy National Park. Revue francaise d’Aquariologie 24 (3––4): 95––127.

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1http://museum-zool.wiley-vch.de 178 Bora, P. et al.: Herpetofauna of south-eastern Madagascar

Anonymous 2001. Inventaire bio-ećologique des reptiles et tra. –– Recherches pour le developpement, se´rie Sciences amphibiens dans le corridor Zahamena-Mantadia. RAP., Biologiques 17:1––24. 2001. Rapport pre´liminaire. Collaboration DBAUA et CI. Raselimanana, A. P. 1999. L’Herpetofaune, pp. 81––97. In Unpublished report. Goodman, S. & Rasolonandrasana, B. P. N. (eds.). Inven- Glaw F. & Vences, M. 1994. A fieldguide to the amphibians taire biologique de la re´serve spećiale du pic d’Ivohibe et and reptiles of Madagascar. 2nd edition. ––Ko¨ ln (Vences du couloir forestier qui la relie au Parc national d’Andrin- & Glaw Verlag), 480 pp. gitra. –– Recherches pour le developpement, se´rie –– 2004. A preliminary review of cryptic diversity in frogs of Sciences Biologiques 15:1––181. thesubgenus Ochthomantis based on mtDNA sequences Raxworthy, C. J., Martinez-Meyer, E., Horning, N., Nuss- and morphology (Anura, Mantellidae, Mantidactylus). –– baum, R. A., Schneider, G. E., Ortega-Huerta, M. A. & Spixiana 27:83––91. Townsend Peterson, A. 2003. Predicting distributions of –– 2006. Phylogeny and genus-level classification of mantel- known and unknown reptile species in Madagascar. –– lid frogs (Amphibia, Anura). –– Organisms, Diversity and Nature 426: 837––841. Evolution 6 (3): 236––253, electronic supplement 11, part Raxworthy, C. J. & Nussbaum, R. A. 1996. Amphibians and 1: 1––3, part 2: 1––4. Reptiles of the Re´serve Naturelle Inte´grale d’Andringitra, Lees, D. C., Kremen, C. & Andriamampianina, L. 1999. A Madagascar: A Study of Elevational Distribution and Lo- null model for species richness gradients: bounded range cal Endemicity, pp. 158––170. In Goodman, S. M. (ed.). A overlap of butterflies and other rainforest endemics in Floral and Faunal Inventory of the Eastern Slopes of the Madagascar. –– Biological Journal of the Linnean Society Re´serve Naturelle Inte´grale d’Andringitra, Madagascar: 67: 529––584. With Reference to Elevational Variation. –– Fieldiana Zo- Nussbaum, R. A., Raxworthy, C. J., Raselimanana, A. P. & ology (new series) No 85. Ramanamanjato, J. B. 1999. Amphibians and reptiles of Vences, M. & Glaw, F. 2001. Systematic review and molecular the Re´serve Naturelle Integrale d’Andohahela, Madagas- phylogenetic relationships of the direct developing Mala- car. –– Fieldiana Zoology (new series) No 94: 153––173. gasy anurans of the Mantidactylus asper group (Amphi- Palumbi, S. R., Martin, A., Romano, S., McMillan, W. O., bia, Mantellidae). –– Alytes 19: 107––139. Stice, L. & Grabowski, G. 1991. The Simple Fool’s Guide –– 2004. Revision of the subgenus Chonomantis (Anura: to PCR, Version 2.0. Privately published document com- Mantellidae: Mantidactylus) from Madagascar, with de- piled by S. Palumbi, Dept. Zoology. Honolulu: Univ. scription of two new species. –– Journal of Natural History Rabemananjara, F. C. E., Chiari, Y., Ravoahangimalala 38:77––118. Ramilijaona, O. & Vences, M. 2007. Evidence for recent Vences, M., Glaw, F., Mercurio, V. & Andreone, F. 2004. Re- gene flow between north-eastern and south-eastern view of the Malagasy tree snakes of the genus Stenophis. Madagascan poison frogs from a phylogeography of –– Salamandra 40: 161––179. the Mantella cowani group. –– Frontiers in Zoology 4:ar- Vences, M., Thomas, M., van der Meijden, A., Chiari, Y., & ticle 1. Vieites, D. R. 2005. Comparative performance of the 16S Rakotomalala, D., Raholimavo, E., Talata, P. & Rajeriarison, rRNA gene in DNA barcoding of amphibians. –– Fron- E. 2001. Chapitre 7. Les amphibiens et les reptiles du tiers in Zoology 2: article 5. Parc National de Ranomafana et de la zone forestie`re le Vieites, D. R., Chiari, Y., Vences, M., Andreone, A., Rabe- reliant au Parc National d’Andringitra, pp. 133––164. In mananjara, F., Bora, P., Nieto-Romań, S. & Meyer, A. Goodman, S. M. & Razafindratsita, V. R. (eds.). Inven- 2006. Mitochondrial evidence for distinct phylogeographic taire biologique du Parc National de Ranomafana et du units in the endangered Malagasy poison frog Mantella couloir forestier qui la relie au Parc National d’Andringi- bernhardi.–– Molecular Ecology 15: 1617––1625.

# 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim http://museum-zool.wiley-vch.de Zootaxa 1577: 61–68 (2007) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ ZOOTAXA Copyright © 2007 · Magnolia Press ISSN 1175-5334 (online edition)

Discovery of the genus Plethodontohyla (Anura: Microhylidae) in dry western Madagascar: description of a new species and biogeographic implications

FRANK GLAW1, 5, JÖRN KÖHLER2, PARFAIT BORA3, NIRHY H. C. RABIBISOA3, OLGA RAMILIJAONA3 & MIGUEL VENCES4 1Zoologische Staatssammlung, Münchhausenstr. 21, 81247 München, Germany. E-mail: [email protected] 2Department of Natural History - Zoology, Hessisches Landesmuseum Darmstadt, Friedensplatz 1, 64283 Darmstadt, Germany. E-mail: [email protected] 3Université d’Antananarivo, Département de Biologie Animale, Madagascar. E-mail: [email protected]; [email protected]; [email protected] 4Division of Evolutionary Biology, Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106 Braunschweig, Germany. E-mail: [email protected] 5Corresponding author

Abstract

The cophyline anuran genus Plethodontohyla is considered to be restricted to humid eastern and central Madagascar. Recent surveys of the herpetofauna in the karstic limestone massif "Tsingy de Bemaraha" revealed a distinctive new species which constitutes the first record of this genus in central-western Madagascar. Plethodontohyla fonetana sp. nov. is characterized by large size (snout-vent length up to 65 mm in females), enlarged fingertips, sinuous dorsal folds, and a reticulated dorsal coloration. It is probably closely related to the other Plethodontohyla species with enlarged fingertips. The discovery of the new species suggests the existence of forest corridor between the eastern rainforest stretch and the relatively dry Tsingy de Bemaraha massif during a period of more humid climate. A continuous strip of gallery forest along a river running from the central high plateau to the west might have been sufficient to allow dispersal to the Bema- raha plateau.

Key words: Amphibia, Anura, Microhylidae, Plethodontohyla, new species, Madagascar, biogeography

Introduction

Cophyline microhylids currently comprise seven genera with 43 described species (Andreone et al. 2005b; Glaw & Vences 2007). Next to the endemic Malagasy-Comoroan family Mantellidae with 12 genera and about 165 species (Glaw & Vences 2006; Glaw et al. 2006) they represent the second largest amphibian radiation in Madagascar. Many new cophyline species have already been discovered, but still await their description. Thus far, cophyline frogs are considered to be largely restricted to rainforest environments or moist high- altitude habitats of the east and the central high plateau, whereas they are unknown from the arid western regions of the island (Blommers-Schlösser & Blanc 1991; Glaw & Vences 1994). The only published record of a cophyline species from a deciduous dry forest refers to a small Stumpffia species in the Ankarafantsika reserve (Blommers-Schlösser & Blanc 1991; Ramanamanjato & Rabibisoa 2002). During recent fieldwork in central western Madagascar, we discovered a distinctive new Plethodontohyla in the Tsingy de Bemaraha National Park. In this paper we describe this new species and discuss the biogeographical implications of its discovery.

Accepted by S. Carranza: 26 Jun. 2007; published: 7 Sept. 2007 61 Materials and methods

Specimens were collected by opportunistic searching and pitfall trapping, preserved in 70% ethanol and deposited in the collections of the Université d'Antananarivo, Département de Biologie Animale (UADBA) and of the Zoologische Staatssammlung München (ZSM). ZFMK refers to Zoologisches Forschungsmuseum Alexander Koenig, Bonn. Tissue samples for future DNA studies were preserved separately in 99% ethanol. The description of the new species largely follows the format used by Vences et al. (2003) and Glaw & Vences (2007) to allow for a better comparison to other Plethodontohyla species with enlarged fingertips. SVL is used for snout-vent length. Morphological measurements were taken to the nearest 0.1 mm using calipers.

Results

Plethodontohyla fonetana sp. nov. (Figs. 1–3)

Holotype. ZSM 123/2006 (field number FGZC 917), adult female from Bendrao forest (18°47'50'' S, 44°52'53'' E, 420 m above sea level), Tsingy de Bemaraha National Park, Mahajanga Province, western Mada- gascar; collected on 28 March 2006 by P. Bora, F. Glaw, J. Köhler, and local guides. Paratype. UADBA 39001 (field number NR 853), adult female from Bendrao forest (18°47'54'' S, 44°52'36''E, 470 m a.s.l.), Tsingy de Bemaraha National Park, Mahajanga Province, western Madagascar; collected on 29 March 1998 by N. H. C. Rabibisoa. Diagnosis. A rather large cophyline with expanded finger disks that does not closely resemble any other microhylid from Madagascar. Plethodontohyla fonetana differs from almost all other cophylines with expanded terminal finger disks (of the genera Plethodontohyla, Stumpffia, Anodonthyla, Cophyla and Platype- lis) by larger size (54–65 mm versus 14–42 mm SVL). Only two remaining cophyline species with enlarged fingertips are larger: Platypelis grandis (43–105 mm SVL) and Plethodontohyla inguinalis (SVL 55–100 mm). Platypelis grandis differs by much wider finger disks and granular dorsal skin; for a distinction from Plethodontohyla inguinalis, see below. Plethodontohyla fonetana is also immediately recognizable among all other Madagascan microhylids by its characteristic dorsal coloration (ground color light brown with well delimited blackish reticulation). Plethodontohyla fonetana appears to be most closely related to other conge- neric species with expanded terminal finger disks (P. inguinalis, P. mihanika, P. notosticta and P. guentheri). It differs from these four species by the lack of a distinct dorsolateral border in coloration posterior to the forelimbs, and by two continuous, elevated and sinuous dorsal ridges running from ca. 5 mm behind the eyes to ca. 10 mm in front of the cloaca. Moreover, it differs from P. mihanika, P. notosticta and P. guentheri by much larger size (54–65 mm versus 26–42 mm SVL). Description of the holotype. Adult female with eggs in the body cavity, in relatively good state of preservation, ventrally opened for inspection of gonads and stomach contents. Body stout; head wider than long, not wider than body; snout rounded in dorsal and lateral views; nostrils directed laterally, slightly protuberant, nearer to tip of snout than to eye; canthus rostralis distinct, sharp; loreal region concave; tympanum very indistinct (poorly reconizable on the right side, not recognizable on the left side), 49% of eye diameter; supratympanic fold conspicuous, long, almost straight; tongue ovoid, posteriorly free; maxillary teeth present; vomerine teeth distinct, forming transversal rows posterior to choanae starting close to maxillae; choanae ovoid. Arms slender; single subarticular tubercles, very distinct at the base of the fingers; distinct paired outer metacarpal tubercles; large inner metacarpal tubercle, forming distinct protuberance; fingers without webbing; relative length of fingers 1<2<4<3, fourth finger clearly longer than second; finger disks distinctly enlarged, triangular. Hindlimbs moderately slender; tibiotarsal articulation reaches beyond insertion of arms when hindlimb adpressed along body; lateral metatarsalia connected; distinct inner and indistinct outer meta-

62 · Zootaxa 1577 © 2007 Magnolia Press GLAW ET AL. tarsal tubercles present; only traces of webbing between toes; relative length of toes 1<2<5<3<4; third toe distinctly longer than fifth. Skin on dorsal surface smooth with scarce scattered small granules on middorsum, dorsal surface of snout and flanks, with no dorsolateral fold or color border along the flanks. Two slightly sinuous elevated dorsal ridges running from ca. 5 mm behind the eyes to ca. 10 mm in front of the cloaca. Ventral skin relatively smooth.

FIGURE 1. Plethodontohyla fonetana, holotype (ZSM 123/2006) in dorsolateral view, photographed in life.

Measurements: SVL 54.1 mm; head width 23.4 mm; head length 14.9 mm; eye diameter 5.7 mm; tympanum diameter ca. 2.8 mm (poorly recognizable); eye-nostril distance 4.2 mm; nostril-snout tip distance 3.9 mm; nostril-nostril distance 5.0 mm; hand length 17.5 mm; hindlimb length ca. 70.1 mm; foot length including tarsus 32.2 mm; foot length 23.3 mm; tibia length 22.4 mm; length of inner metatarsal tubercle 3.6 mm; width of inner metatarsal tubercle 2.1 mm. Coloration. In preservative, dorsum brown with a reticulated pattern of distinct black spots of irregular shape and few small white dots. The dark spots are fused to a large, faintly symmetrical, black spot behind the eyes. Towards the flanks the brown ground color changes to light brown, the dark pattern fades to brown, and the whitish dotting becomes more dense. The two dorsal ridges are white and a similar narrow white line is running along the supratympanic fold. Sides of head and tympanic region blackish, sharply bordered by the supratympanic fold. Forelimbs and hindlimbs brown with narrow dark crossbands and white spotting. Highest density of white spots on the posterolateral and anterolateral parts of the shanks. Ventrally, throat dark brown with fine light dots, chest brown with larger white dots and spots, the light color becoming predominant towards the belly. The color in life was similar (Figs. 1–2), perhaps somewhat lighter than in preservative. The iris was greyish with a slightly greenish shade. Variation. The paratype is generally similar to the holotype in morphology and coloration in preservative, although the dorsal ridges are much less recognizable compared to the holotype and not white. As in the holotype, no distinct dorsolateral color border posterior to the forelimbs. Measurements of the paratype (UADBA 39001) are as follows: SVL 65.0 mm; head width 27.9 mm; eye diameter 6.0 mm; tympanum diameter 3.6 mm; eye-nostril distance 4.6 mm; nostril-snout tip distance 4.0 mm; nostril-nostril distance 5.4 mm; hand length 21.3 mm; hindlimb length ca. 81.9 mm; foot length including tarsus 41.0 mm; foot length 28.6 mm; tibia length 27.5 mm; length of inner metatarsal tubercle 5.2 mm; width of inner metatarsal tubercle 2.5 mm, comparative finger length 1<2<4<3; comparative toe length 1<2<5<3<4.

Natural history, distribution and threat status. Very little information is available. The two type specimens are gravid females. The holotype contained more than 100 (more than 50 on each side) yellowish eggs with a black pole, ca. 2.0–2.4 mm in diameter, indicating that the specimen was ready for reproduction at the end of the rainy season. The stomach of the holotype contained a large number of medium-sized insect remains (ants, beetles) and pieces of dead leaves from the forest floor. The holotype was found in a night without rainfall on Tsingy rocks within a moderately moist dry forest. In March 2006, our pitfalls at three other sites in the Tsingy de Bemaraha National Park failed to capture any additional Plethodontohyla specimen. The paratype was captured by a pitfall trap next to Tsingy rocks with dead leaves (soil composition: sand and clay complex). Both type specimens were found in the same forest (Bendrao). Accordingly, the known range of the species is extremely small (Fig. 4). Although the actual range is very likely to comprise a larger area, we assume that the new species is endemic to the Tsingy de Bemaraha massif due to the absence of sufficient humidity outside the karstic habitats. Using the same rationale and IUCN criteria as applied during the Global Amphibian Assessment for Madagascan amphibians (see Andreone et al. 2005a) we classify Plethodontohyla fonetana as "Data Deficient". Etymology. The specific name "fonetana" is the Malagasy word for "stubby" and refers to the general body shape of the new species. It is used as a noun in apposition.

Discussion

According to morphological similarities (mainly the widely expanded fingertips), Plethodontohyla fonetana can be hypothesized to be related to a group of Plethodontohyla that is distributed along the whole of the eastern stretch of Madagascar, from Marojejy in the north-east to Andohahela in the south-east: Plethodontohyla inguinalis, P. guentheri, P. mihanika, and P. notosticta. Molecular data did not provide evidence for the monophyly of this group (Andreone et al. 2005b). Within this assemblage of species, Plethodontohyla fonetana shares a number of characters only with P. inguinalis (stubby body shape, large size, triangle-like coloration on the back). However, novel molecular data, currently being analysed by K. C. Wollenberg and D. C. Canna- tella, indicate that these two species are not closely related, but instead P. fonetana is apparently the closest relative of the recently described P. guentheri from Marojejy in the north-east of Madagascar (Fig. 4), these two species together being closest to P. notosticta. These results, which will be published elsewhere, are well- corroborated by analysis of three different mitochondrial genes, but are surprising because P. fonetana and P. guentheri are morphologically highly divergent. P. gu e n th er i is currently only known from one locality at relatively high elevations, while P. fonetana might be endemic to the low-elevation dry forest of the Tsingy de Bemaraha. However, the future discovery of other localities of P. guentheri in central-eastern Madagascar or its former occurrence in that region cannot be excluded, and P. notosticta — another closely related species — is widespread in the east. In any case, the discovery of P. fonetana highlights a biogeographical link between the Tsingy de Bemaraha and eastern Mada- gascar, suggesting that the ancestor of P. fonetana may have reached the Bemaraha plateau via a humid forest connection from the east (or north-east) through the central high plateau, probably in a period of more humid climate. Such periods of distinctly wetter climate in western and especially southwestern Madagascar are well documented (e. g. Hawkins & Goodmann 2003) and might have distinctly facilitated the dispersal of Plethod- ontohyla to the west and its adaptations to the new environment. Our survey in the Tsingy de Bemaraha revealed two additional undescribed forest frog species, one species of Stumpffia, closely related or even conspecific with S. helenae from Ambohitantely in central Madagas- car, and a green Boophis which is the closest known relative of Boophis luteus from eastern Madagascar (Köhler et al. in press), suggesting that the postulated forest corridor was successfully used by at least three

NEW PLETHODONTOHYLA Zootaxa 1577 © 2007 Magnolia Press · 65 FIGURE 4. Map of Madagascar showing the known distribution of Plethodontohyla fonetana (black square), P. guentheri (black triangle) and remaining members of the genus Plethodontohyla (gray dots), excluding those species now placed in Rhombophryne. The latter records also exclude P. guentherpetersi, as its generic placement is uncertain. different lineages of frogs. Close relationships between the central high plateau and the Tsingy de Bemaraha are not restricted to forest frogs, but are also evident in a species pair of savannah species. Heterixalus carbonei from the Tsingy de Bemaraha is the sister taxon to Heterixalus betsileo from the central highlands based on sequences of the 16S rRNA gene and on bioacoustics (Vences et al. 2000). Sequence divergence between these two taxa is 2.5 %, and thus less than half of that between the two green Boophis species. Although these data are insufficient to allow for any molecular clock approach, they suggest that the ancestor of H. carbonei may have reached the Tsingy de Bemaraha much more recently than the ancestor of the new green Boophis. Further examples of this east-west vicariance pattern are the species pairs Scaphiophryne madagascariensis/S. menabensis (Glos et al. 2005) and Boophis albilabris/B. occidentalis, but these species pairs apparently do not strictly depend on forest habitat. However, in the case of the two Heterixalus, and of Boophis albilabris/B. occidentalis, the situation is complicated by the fact of H. carbonei also occurring in Montagne d'Ambre in northern Madagascar, and of both B. albilabris and B. occidentalis occurring in the Sambirano region in north-western Madagascar, which leaves the possibility of a dispersal via the northern regions of Madagascar

66 · Zootaxa 1577 © 2007 Magnolia Press GLAW ET AL. into the west, rather than crossing the central high plateau. A continuous strip of forest along a river running from the central high plateau to the west might have been sufficient to allow dispersal to the Bemaraha plateau although the potential of this kind of gallery forest as a biogeographical corridor for forest amphibians and reptiles has never been explored. In the case of the new green Boophis, passive drift of the tadpoles after heavy rains could have helped to reach the west, whereas in the case of the two new cophylines which presumably have no tadpoles in large water bodies, drift appears less likely. It is remarkable that despite vast deforestation even today, the central high plateau seems to be partly connected with the west by remains of such gallery forests as recognizable from airplanes. How- ever, the abrupt elevation of the Bemaraha plateau might act as a significant barrier to rivers coming from the east. Only one major river from the east, the Manambolo, crosses the Bemaraha plateau in the south at Beko- paka. This river has its origin east of Tsiroanomandidy, relatively far in the east of Madagascar, and judging from present-day topography, the gallery forest along this river may have had the potential to act as a major corridor, potentially enabling forest species like Stumpffia, Plethodontohyla and Boophis a dispersal to the Bemaraha plateau. About 12% of the world's microhylid species are endemic to Madagascar and include the smallest (Stumpffia tridactyla and S. pygmaea) and the largest species in this family. The largest microhylids are Dys- cophus guineti (and the genetically almost identical Dyscophus antongilii, see Chiari et al. 2006), Platypelis grandis and Plethodontohyla inguinalis, each of them surpassing SVLs of 100 mm, either in the female (Dys- cophus) or in the male (Plethodontohyla and Platypelis). With a SVL of up to 65 mm, P. fonetana represents the fifth largest of the 56 described (and many undescribed) microhylid species from Madagascar. Although it is apparently distinctly smaller than the aforementioned species it should be kept in mind that the known maximum female size is only 63 mm SVL in P. inguinalis (Blommers-Schlösser & Blanc 1991) and 70 mm in P. grandis (pers. obs. in ZFMK 59907), and males are so far unknown in P. fonetana. Male superiority in frog body size is usually correlated with male combats (Shine 1979), which are relatively rare in anurans. How- ever, the two largest cophylines, P. inguinalis and P. grandis, both breed in tree holes and have enlarged fingertips. Future studies might show whether these two features (male superiority in body size and tree hole breeding) also refer to Plethodontohyla fonetana. Many microhylids are microphagous, consuming mainly small insects in large numbers, especially ants and termites (Blommers-Schlösser 1975). Several, especially larger, microhylids from Madagascar are unusual in having well developed maxillary and vomerine teeth which are reduced or absent in other members of the family. These teeth obviously allow to feed on larger prey as is indicated by a few observations of stomach contents (Lourenço et al. 1997). P. fonetana is also relatively large, with well developed maxillary and vomerine teeth, but the stomach of the holotype contained only medium-sized insect remains and no indication for exceptional large prey.

Acknowledgements

For help in the field, we thank Hildegard Enting (HLMD), the ANGAP staff members from Antsalova, our guide 'Nono' who discovered the holotype of the new species, and our cook 'Rasta'. David C. Cannatella (Aus- tin) and Katharina C. Wollenberg (Braunschweig) kindly provided unpublished information on the phylogenetic relationships of Plethodontohyla fonetana. This work was conducted in cooperation with the Département de Biologie Animale, Université d'Antananarivo (UADBA), and the Association Nationale pour la Gestion des Aires Protegées (ANGAP).

Andreone, F., Cadle, J. E., Cox, N., Glaw, F., Nussbaum, R. A., Raxworthy, C. J., Stuart, S., Vallan, D. & Vences, M. (2005a) Species review of amphibian extinction risks in Madagascar: conclusions from the Global Amphibian Assessment. Conservation Biology, 19, 1790–1802. Andreone, F., Vences, M., Vieites, D. R., Glaw, F. & Meyer, A. (2005b) Recurrent ecological adaptations revealed through a molecular analysis of the secretive cophyline frogs of Madagascar. Molecular Phylogenetics and Evolu- tion, 34, 315–322. Blommers-Schlösser, R. M. A. (1975) Observations on the larval development of some Malagasy frogs, with notes on their ecology and biology (Anura: Dyscophinae, Scaphiophryninae and Cophylinae). Beaufortia, 24, 7–26. Blommers-Schlösser, R. M. A. & Blanc, C. P. (1991) Amphibiens (première partie). Faune de Madagascar, 75, 1–379. Chiari, Y., Orozco-terWengel, P., Vences, M., Vieites, D. R, Sarovy, A., Randrianirina, J. E., Meyer, A. & Louis Jr., E. (2006) Genetic identification of units for conservation in tomato frogs, genus Dyscophus. Conservation Genetics, 7, 473–482. Glaw, F., Hoegg, S. & Vences, M. (2006) Discovery of a new basal relict lineage of Madagascan frogs and its implications for mantellid evolution. Zootaxa, 1334, 27–43. Glaw, F. & Vences, M. (1994) A fieldguide to the amphibians and reptiles of Madagascar, 2nd ed. Vences & Glaw Verlag, Köln, 480 pp. Glaw, F. & Vences, M. (2006) Phylogeny and genus-level classification of mantellid frogs (Amphibia, Anura). Organ- isms, Diversity and Evolution, 6, 236–253. Glaw, F. & Vences, M. (2007) Plethodontohyla guentheri, a new montane microhylid frog species from northeastern Madagascar. Mitteilungen des Museums für Naturkunde Berlin, Zoologische Reihe, 83, Supplement, 33–39. Glos, J., Glaw, F. & Vences, M. (2005) A new species of Scaphiophryne from western Madagascar. Copeia, 2005, 252– 261. Hawkins, A. F. A. & Goodman, S.M. (2003) Introduction to the birds, pp. 1019–1044. In: Goodman, S. M. & Benstead, J. P., eds. (2003): The Natural History of Madagascar. The University of Chicago Press, Chicago and London, 1709 pp. Köhler, J., Glaw, F. & Vences, M. (in press) A new green treefrog, genus Boophis Tschudi, 1838 (Anura, Mantellidae), from arid western Madagascar: phylogenetic relationships and biogeographic implications. Tropical Zoology. Lourenço, W. R., Glaw, F., Cloudsley-Thompson, J. L. & Vences, M. (1997) The Madagascan frog Plethodontohyla inguinalis eats scorpions. British Herpetological Society Bulletin, 60, 26–28. Ramanamanjato, J. B. & Rabibisoa, N. (2002) Evaluation rapide de la diversité biologique des reptiles et amphibiens de la Réserve Naturelle Intégrale d'Ankarafantsika, pp. 98–103 and 135–138. In: Alonso, L. E., Schulenberg, T. S., Radilofe, S. & Missa, O. (eds.) Une evaluation biologique de la Réserve Naturelle Intégrale d'Ankarafantsika, Madagascar. Bulletin RAP d'evaluation rapide No. 23, Conservational International, Washington, DC. Shine, R. (1979) Sexual selection and sexual dimorphism in the Amphibia. Copeia, 1979, 297–306. Vences, M., Glaw, F., Jesu, R. & Schimmenti, G. (2000) A new species of Heterixalus (Amphibia: Hyperoliidae) from western Madagascar. African Zoology, 35, 269–276. Vences, M., Raxworthy, C. J., Nussbaum, R. A. & Glaw, F. (2003) New microhylid frog (Plethodontohyla) from Mada- gascar, with semiarboreal habits and possible parental care. Journal of Herpetology, 37, 629–636.

68 · Zootaxa 1577 © 2007 Magnolia Press GLAW ET AL. Zootaxa 1501: 31–44 (2007) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ ZOOTAXA Copyright © 2007 · Magnolia Press ISSN 1175-5334 (online edition)

Molecular systematics of Malagasy poison frogs in the Mantella betsileo and M. laevigata species groups

FALITIANA C.E. RABEMANANJARA1,2, ANGELICA CROTTINI4,5,8, YLENIA CHIARI3, FRANCO ANDREONE5, FRANK GLAW6, REMÍ DUGUET7, PARFAIT BORA2, OLGA RAVOAHANGIMALALA RAMILIJAONA2 & MIGUEL VENCES8 ,9 1Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum University of Amsterdam, Mauritskade 61, 1092 AD Amster- dam, The Netherlands. E-mail: [email protected] 2Département de Biologie Animale, Université d’Antananarivo, BP, 906, 101 Antananarivo, Madagascar 3Department of Ecology and Evolutionary Biology, YIBS-Molecular Systematics and Conservation Genetics Lab., Yale University, 21, Sachem Str., New Haven, CT, 06520-8105 USA E-mail: [email protected] 4Universitá degli Studi di Milano, Dipartimento di Biologia, Sezione di Zoologia e Citologia, Via Celoria 26, 20133 Milano, Italy. 5Museo Regionale di Scienze Naturali, Sezione di Zoologia, Via G. Giolitti, 36, 10123 Torino, Italy. 6Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München 7 Biotope, Agence Océan Indien, 969 ch. cent Gaulettes, 97440 Saint-André, La Réunion 8Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106, Braunschweig, Germany. E-mail: [email protected] 9Corresponding author

Abstract

Malagasy poison frogs of the genus Mantella with its 16 species are currently sub-divided into 5 major groups. Of these, the Mantella betsileo group is traditionally understood as containing four species, Mantella betsileo, M. expectata, M. viridis and M. manery, while the M. laevigata group is considered to be monospecific. A phylogenetic analysis of samples from multiple localities of all species in these two groups, based on sequences of the mitochondrial cytochrome b gene, shows the existence of several well-distinct clades in what is currently considered to be Mantella betsileo: (1) central-western populations from Kirindy, Isalo, and near Antsirabe close to the Betsileo region, to which the name M. betsileo is to be applied, (2) populations of the north-east and north-west, which are closely related to M. viridis and to which the name M. ebenaui is to be applied, and (3) a clade from southernmost Madagascar and from the Tsingy de Bemaraha, which is sister to M. expectata and furthermore includes important intra-clade variation, therefore probably representing one or two undescribed species. Our data also support a large genetic distance of M. manery to all other species and its probable sister-group relationship to the sympatric M. laevigata; M. manery is consequently transferred from the M. betsileo group to the M. laevigata group.

Key words: Anura, Mantellidae, Mantella betsileo, Mantella ebenaui, Mantella expectata, Mantella laevigata, Mantella manery, Mantella viridis, Madagascar

Introduction

Vis-à-vis of the world amphibian decline (Kiesecker et al. 2001; Pounds et al. 2006; Stuart et al. 2004), an increased knowledge on genetic data and their interpretations are needed for conservation purposes (e.g. Moritz & Faith 1998; Frankham et al. 2002; DeSalle & Amato 2004). Mainly due to fast deforestation, the amphibian biodiversity of the fourth largest island of the world, Madagascar, is heavily threatened (Andreone

Accepted by S. Carranza: 23 Apr. 2007; published: 7 Jun. 2007 31 & Luiselli 2003; Andreone et al. 2005; Vallan 2000). As a result of this ongoing process, numerous Malagasy species are actually classified in the Red List of IUCN (Andreone & Luiselli 2003; Andreone et al. 2005; IUCN 2006) as threatened species, and Madagascar is considered to be a hotspot for biodiversity conservation (Myers et al. 2000). The genus Mantella is composed of 16 recognized species, and is probably the most prominent group of Madagascar frogs (Vences et al. 1999; Glaw & Vences 2006). Frogs in the unrelated family Dendrobatidae, which inhabit Central and South America, are among the ecological equivalents of the genus Mantella, and both groups, because of their bright colouration and diurnal habits, have been intensively exploited by the international pet trade (Andreone et al. 2005; Rabemananjara et al. in press). At the same time, the presence of numerous alkaloid compounds in their skin makes these groups of poisonous frogs particularly interesting from a pharmacological point of view, and as in many other animals the presence of these substances goes along with an aposematic colouration that acts as a warning signal for predators (Servedio 2000). The source of these alkaloids is basically determined by the frogs' diet, largely consisting of ants and mites (Daly et al. 1994, 1997, 2002; Jones et al. 1999; Clark et al. 2005). Currently all species in the genus Mantella are included in the Appendix II of the Convention on the International Trade of Endangered Species (CITES). The descriptions and systematics of the Madagascan batrachofauna have been pioneered by the explorer A. Grandidier in the second part of the 19th century (e.g., Grandidier 1869, 1872), and the species of Mantella firstly described were Mantella madagascariensis, and M. betsileo from the Betsileo region (Grandidier 1872). Until now, over 230 amphibians have been described from Madagascar, and the increasing use of molecular biological methods to detect genetic differences and to reconstruct phylogenies, in concert with intensive field explorations, is leading to an accelerated rate of taxonomic revisions and discoveries of new species (Köhler et al. 2005). Recent molecular work on mantellid frogs led to a largely revised classification at the genus and subgenus level (Glaw & Vences 2006; Glaw et al. 2006). For the genus Mantella, the analysis of the full mitochondrial genome has been completed, which will help to speed up phylogenetic and taxonomical studies (Kurabayashi et al. 2006). The subdivision of the genus into five monophyletic groups as well as the evidence of homoplastic evolution of colour pattern of the different species was first demonstrated by Schaefer et al. (2002) and later corroborated by Vences et al. (2004a) and Chiari et al. (2004). Some species of the genus show evidence of hybridization, with shared haplotypes and a weakly expressed phylogeographic structure: e.g., M. aurantiaca, M. crocea and M. milotympanum (Chiari et al. 2004), M. cowani and M. baroni (Chiari et al. 2005), and M. baroni and M. nigricans (Rabemananjara et al. 2007). In contrast, other species such as M. bernhardi show a strong genetic differentiation among geographically close populations (Vieites et al. 2006). In general, however, it is remarkable that the genetic differentiation among and within species of Mantella is relatively small as compared to other species of frogs in Madagascar which often show remarkable intraspecific genetic distances of up to 5% in the 16S rRNA gene and above 10% in the coxI gene (Vences et al. 2005), and even much higher interspecific genetic distances. This indicates that divergences among current species of Man- tella are relatively recent in age, although thorough molecular clock calculations are so far missing. Two species groups in the genus Mantella have so far remained unstudied from a molecular systematic perspective: the Mantella betsileo and Mantella laevigata groups. While the M. laevigata group contains a single species, M. laevigata, the M. betsileo group is usually considered to contain four described species (Vences et al. 1996, 1999): Mantella betsileo, M. manery, M. viridis and M. expectata. Of these, M. expectata and M. viridis are considered as Critically Endangered, M. laevigata as Near Threatened, M. manery as Data Deficient, and M. betsileo as Least Concern, following IUCN categories (Andreone et al. 2005). The "brown" populations, considered to be Mantella betsileo, are widespread throughout much of Madagascar. Preliminary data have indicated that probably more than one species is included in M. betsileo, both from a morphological and a genetic perspective (Vences et al. 1999; Schaefer et al. 2002). Large-sized specimens both from Ankarana in the north-west, and from the west and south-west of Madagascar, were considered to be a differ-

32 · Zootaxa 1501 © 2007 Magnolia Press RABEMANANJARA ET AL. ent species ("Mantella sp. 1") by Vences et al. (1999). Recently, Glaw & Vences (2006) argued that based on the finding of a "brown" Mantella population near Antsirabe, close to the Betsileo region of Madagascar, the western populations of "brown" Mantella are to be seen as the true M. betsileo, and consequently the name Mantella ebenaui, originally described by Boettger (1880), was resurrected for populations from the northern part of the island. Here we provide an analysis of mitochondrial DNA sequences of multiple specimens from populations of all species of the Mantella betsileo and M. laevigata groups. We included samples of "brown" Mantella from all geographic regions of Madagascar and obtained a sample of Mantella manery, a species known from two specimens only and never studied from a genetic perspective thus far. Our results provide evidence for M. manery not being related to the M. betsileo group but instead being sister to the sympatric M. laevigata, while populations of "brown" Mantella belong to several highly divergent genetic lineages that may represent distinct species and need to be considered separately in conservation evaluations.

Methods

Sampling Samples were collected from July 2003 to April 2006 at fifteen localities as summarized in Table 1 and in fig. 1 (Marojejy and Isalo containing two and three separate sampling sites, respectively), with samples of a total of 87 specimens. Tissues of many individuals were obtained by toe clipping and subsequent release of specimens, a method that in frogs is known to allow high survival rates for the released individuals (>98%; Hott et al. 1999). Samples were conserved in 99% ethanol. Representative Mantella individuals from the new localities were collected and preserved as voucher specimens in the collection of the Département de Biologie Animale of the University of Antananarivo (UADBA), in the Zoological Museum of Amsterdam (ZMA), and in the Zoologische Staatssammlung München (ZSM), partly after skinning them for analysis of alkaloids; from these specimens, larger tissue samples of femur muscle were taken. Further identifying acronyms used for tissue samples are FR (lab number of F. Rabemananjara), FGMV, FGZC (field number of F. Glaw), ZCMV (field number of M. Vences), and FA (samples collected by F. Andreone).

DNA extraction and sequencing Total genomic DNA was extracted from the tissue samples using proteinase K digestion followed by a standard salt extraction protocol (Bruford et al. 1992). We used the primers CBJ10933 5’-TATGTTCTAC- CATGAGGACAAATATC-3’ (forward) and Cytb-c 5’-CTACTGGTTGTCCTCCGATTCATGT-3’(reverse) (Bossuyt & Milinkovitch 2000) to amplify one part of the mitochondrial cytochrome b gene of about 600 bp. PCRs were performed in 25.6 µl reactions using 1µl of genomic DNA, 0.8µl of each 10µM primer, 2µl of total dNTP 4mM, 1µl of 25mM MgCl2, 2.5µl 10xNH4 superTaq PCR buffer (HT Biotechnology), 0.25µl of 5u/µl iTaq DNA Polymerase (HT Biotechnology) and 17.25µl of water. PCR conditions were performed with an initial denaturation step at 94°C for 90 seconds; 35 cycles at 94°C for 30 seconds, annealing temperature of 53°C for 45 seconds followed by an extension at 72°C for 30 seconds, final extension of 10 minutes at 72°C. PCR products were loaded on 1% agarose gels, stained with ethidium bromide, and visualised on a "Gel Doc" system (Syngene). Products were purified using QIAquick spin columns (Qiagen) prior to cycle sequencing. Each 10 µl sequencing reaction included 1µl of template, 1.75 µl of 5x sequencing buffer (BigDye Terminator Sequencing buffer, Applied Biosystems), 1 µl of 10 µM primer (Cytb-c or CBJ), 0.5 µl of ABI sequence mix (BigDye Terminator V1.1 Sequencing Standard, Applied Biosystems) and 5.75 µl of water. The sequence reaction was 3 minutes of denaturation at 90°C, 24 cycles of 30 seconds at 96°C, 15 seconds at 50°C and 4 minutes at 60°C, final extension 4 minutes at 60°C. Sequence data collection and visualisation were performed on an ABI 3100 or an ABI 3730 automated sequencer at the sequencing facility of the Medical Center of the University of Amsterdam. Sequences were submitted to Genbank (accession numbers EF179618- EF179704).

MANTELLA BETSILEO GROUP SYSTEMATICS Zootaxa 1501 © 2007 Magnolia Press · 33 FIGURE 1. Localities of the collected samples included in the molecular analyses of the Mantella betsileo and Mantella laevigata groups.

Data analysis Sequences were edited and aligned using Sequence Navigator software (Applied Biosystems). We did not detect stop codons or need to add indels to the alignment. A Neighbor-Joining tree based on uncorrected p- distances was constructed with PAUP*, version 4b10 (Swofford 2002) in order to gain a first overview of differentiation among sequences. Haplotypes were merged using the program Collapse, version 3.1 (Posada 2004). Phylogenetic analyses were performed using the programs PAUP* and MrBayes, version 3.1 (Ronquist & Huelsenbeck 2003). We performed both Bayesian and Maximum-Parsimony (MP) analyses in order to check for consistency in the results using different algorithms based on different assumptions of molecular evolution. MP bootstrap analysis was performed in PAUP* with 250 replicates for the distinct haplotypes. For the Bayesian analysis, we partitioned our data by codon position, as this partitioning strategy is known to often perform better with protein-coding mtDNA (Brandley et al. 2005). Modeltest version 3.06 (Posada & Crandall 1998) was used to choose the appropriate model of sequence evolution for each partition, which were (1) nst = 6, rates = gamma, with gamma distribution shape parameters of, respectively, 0.2314 and 2.1520, for the first and the third position, and (2) nst=1, rates=equal for the second codon position. The Baye- sian analysis was run with four parallel chains for 1 million generations, sampling every tenth tree and dis- carding the first 10,000 trees (thus the first 100,000 generations) as burn-in based on empirical evaluation of the likelihood values. In both analyses we used a homologous sequence of Mantella bernhardi as outgroup (Genbank accession number AB239569), based on previous studies that have shown this species to be the most basal Mantella

34 · Zootaxa 1501 © 2007 Magnolia Press RABEMANANJARA ET AL. (Vences et al. 2004a; Chiari et al. 2004). One sequence of each Mantella madagascariensis and M. cowani were further included as hierarchical outgroups (Genbank accessions AY723691, AY862305).

Results

480 bp of 90 sequences (87 plus three outgroup sequences) were aligned and analysed (Table 1). The analysis of all sequences using Neighbor-Joining, as well as the analysis of the 59 distinct haplotypes (identified by Collapse) using Maximum Parsimony (MP) and Bayesian inference resulted in largely identical topologies. These are resumed here in the MP tree, with bootstrap and posterior probability values, shown in fig. 2.

TABLE 1. Coordinates, species and sample size for each locality.

Locality Coordinates Altitude Species Sample size Montagne des Francais 12°19.09’S, 49°20.51’E 136 m M. viridis 10 Antongombato 12°22.96’S, 49°13.50’E 110 m M. viridis 4 Ankarana 12°58.48’S, 49°07.33’E 45 m M. aff. viridis 9 Nosy-Be 13°25'S, 48°19'E <50 m M. ebenaui 1 Antsirasira 13°56'22'S, 48°33'16''E <100 m M. ebenaui 1 Manongarivo (Antanambao) 13°53'23''S, 48°29'03''E 9 m M. ebenaui 2 Berara 14°18'33''S, 47°54'55''E 170 m M. ebenaui 1 Marojejy 14°26.33’S, 49°46.57’E 411 m M laevigata 9 Marojejy ------M. manery 1 Nosy Mangabe 15°30'S, 49°46'E <100 m M. laevigata 1 Nosy Boraha 16°54.54'S, 49°52.01'E 20 m M. ebenaui 7 Bemaraha 18°42'31''S, 44°43'08''E 146 m M. aff. expectata 11 Kirindy 20°04’35’’S, 44°40’30’’E 55m M. betsileo 13 Isalo Andrehitogna 22°32’19’’S, 45°24’40’’E 756 m M. betsileo 4 Isalo (FA) ------M. betsileo 2 Isalo Oasis 22°37’37’’ E, 45°21’12’’S 776 m M. expectata 4 Ambatondradama 19°38.85’S; 46°02.99’E 922 m M. betsileo 1 South of Tranomaro 24°27.36'S, 46°31.90'E 443 m M. aff. expectata 6

Two main clades were recovered: (1) M. laevigata and M. manery, and (2) the M. betsileo group. The M. betsileo group is further partitioned, by our data, in two main lineages, a northern lineage containing M. viridis and several population of "brown" Mantella, and a southern lineage consisting of M. expectata and the remaining populations of "brown" Mantella. "Brown" specimens, which all had previously (e.g., Blommers-Schlösser & Blanc 1991; Glaw & Vences 1994) been assigned to Mantella betsileo, are now suggested to include: (1) M. betsileo sensu stricto, corresponding to the species occurring at Kirindy, Ambatondradama near Antsirabe, and Isalo, a clade supported by 100% bootstrap and 100% posterior probability (see Discussion for the rationale of assigning the name M. betsileo to these populations); (2) populations from Bemaraha and from Tranomaro which are sister to M. expectata (90% bootstrap and 100% posterior probability) and are here named M. aff expectata; (3) the population from Ankarana which shows haplotype sharing with M. viridis and is here named M. aff. viridis; (4) the populations from Nosy Boraha, Manongarivo, Antsirasira, Berara and Nosy Be, which are paraphyletically arranged basal to a lineage containing M. viridis and M. aff. viridis, and are here named M. ebenaui.

MANTELLA BETSILEO GROUP SYSTEMATICS Zootaxa 1501 © 2007 Magnolia Press · 35 FIGURE 2. Phylogram from a Maximum Parsimony analysis, representing a 50% majority-rule consensus tree of 65700 equally most parsimonious trees. Mantella bernhardi was defined as outgroup. Specimens with identical haplotypes were merged; numbers in brackets after names of taxa give the number of specimens with the same haplotype. Numbers at nodes are bootstrap values in percent from a Maximum Parsimony bootstrap analysis with 250 replicates. Asterisks denote posterior probabilities from a partitioned Bayesian analysis: (*) >90%; * >95%; ** >99%.

36 · Zootaxa 1501 © 2007 Magnolia Press RABEMANANJARA ET AL. Despite very obvious sequence similarities, not all clades were supported by both Bayesian and MP analysis. For example, the clade of M. ebenaui, M. aff. viridis and M. viridis was not supported as monophyletic group by the Bayesian analysis, although all haplotypes in this clade are extremely similar to each other. The same was true for the set of sequences of M. aff. expectata from Bemaraha. A possible explanation is that in data sets of short sequences, with many taxa that are highly similar to each other, likelihood methods in general may perform poorly. However, further speculations or analyses on this problem are far beyond the scope of the present paper. Independent from these analytical problems, most of our main conclusions remain unaf- fected since in no case did an analysis method provide any relevant support for an alternative topology contra- dicting the placements as summarized above. Additionally, unpublished data of K. Wollenberg and M. Vences indicate that sequences from other genes (16S rRNA and cox1) support all of the phylogenetic relationships in the M. betsileo group reported here. Between the species of the M. laevigata and M. betsileo groups, the uncorrected genetic divergence (p- distance, transformed into percent) ranges between 12.9% (M. manery-M. betsileo) and 16.1% (M. laevigata- M. betsileo). M. laevigata as well is differentiated from M. manery by a high distance (10.4%). The two major lineages (northern - southern) of the M. betsileo group are separated by 6.5% to 7.5%. The southern lineage consisting of M. betsileo, M. aff. expectata and M. expectata, is constituted by well separated entities with distances of the order of 3.0% (M. expectata-M. aff. expectata) to 9.2% (M. expectata-M. betsileo). On the con- trary, inside the northern lineage, constituted by M. viridis, M. aff viridis and M. ebenaui a low differentiation was found (1.5% to 2.3% between M. ebenaui and M. aff. viridis-M. viridis). Cases of haplotype sharing were noted between Mantella viridis and M. aff. viridis, which are geographically neighbouring forms, genetically very close to each other. A further possible case was noted among M. aff. expectata specimens from Bemaraha, one of which had a deviant haplotype clustering in the M. betsileo lineage.

Discussion

Taxonomy of the Mantella betsileo group Our data corroborate previous assumptions (Vences et al. 1999) that the Mantella betsileo group is composed of several species, although the encountered pattern of distribution of these species distinctly differs from any previous hypothesis. The "brown" Mantella, previously all subsumed under the name M. betsileo, can in fact be divided into three major genetic lineages: (1) a sublineage of the southern clade (sister to M. expectata and M. aff. expectata), here considered as M. betsileo; (2) a lineage distributed mainly in the north and closely related to M. viridis, here considered as M. ebenaui (and including Mantella attemsi Werner, 1901 as junior synonym, as argued by Glaw & Vences 2006); (3) a lineage sister to M. expectata (here named M. aff. expectata) which further contains relevant genetic differences between the two populations included here. Additional "brown" Mantella population from the north (here represented by Ankarana and named M. aff. viridis) resulted to share haplotypes with Mantella viridis and may be considered to be conspecific with this species. The sympatric occurrence of two representatives of the southern lineage (M. betsileo and M. expectata) in Isalo contradicts an extreme view that would interpret all of these lineages to be colour morphs or geographical variants of the same species. Consequently, our data support the partition of Mantella betsileo sensu lato as anticipated by Glaw & Vences (2006), and in addition indicate the existence of at least one further undescribed species (Mantella aff. expectata). The identity of Mantella betsileo has long remained a mystery. Its original description by Grandidier (1872), as Dendrobates betsileo, was based on specimens collected in the Betsileo region, which refers to an ethnic group in the province of Fianarantsoa. Ten years later, Boettger (1880) described a brown-coloured Mantella from the island of Nosy Be in the north-west as Dendrobates ebenaui. Interestingly, the type locality

MANTELLA BETSILEO GROUP SYSTEMATICS Zootaxa 1501 © 2007 Magnolia Press · 37 of Mantella betsileo has never been confirmed since Vences et al. (1999) and Glaw & Vences (2006) hypothesized that the collecting locality of the types of M. betsileo may have been located along the travel route of Grandidier towards the Betsileo region, but not exactly in the Betsileo region. The discovery by one of us (FA) of a population of "brown" Mantella at Ambatondradama near Antsirabe, which is close to the Betsileo territory, has been anticipated by Glaw & Vences (2006) but is first reported in detail in the present paper (specimens captured on 20 October 2004 by J. E. Randrianirina, in a sort of gallery forest along streams, rich in Ravenala traveller palms). This is the first such record and confirms that it is the species mostly distributed in central-western Madagascar that is to be named Mantella betsileo, whereas the northern populations should be named Mantella ebenaui. The taxonomic status of the populations here named M. aff. expectata requires further study. These frogs occur in western and south-western Madagascar where suitable habitat is scarce and populations are likely to be patchily distributed. Nevertheless, there are further locality records of "brown" Mantella from the southwestern part of Madagascar (Vences et al. 1999), and of M. expectata from the Mikea forest (Thomas & Kid- ney 2005) and possibly from near Morondava (see Vences et al. 1999) which need to be evaluated, before a new species can possibly be described. Most important is to elucidate the relationships between M. aff. expectata and M. expectata. The latter species displays a blue-yellow colour pattern that is unique among Mantella and almost certainly a derived state. M. aff. expectata from Tranomaro, where we collected several adult male and female specimens, does not share with M. expectata this blue-yellow pattern, but there is at least one chromatic character that is in agreement with its placement close to M. expectata: both share a light stripe along the upper lip (frenal stripe) that does not reach the tip of the snout, while it does reach the snout tip in all other taxa in the M. betsileo group. Unfortunately, all specimens of M. aff. expectata that we collected in the Bema- raha massif were juveniles, and therefore their adult colouration remains unknown. However, from available photos taken by other researchers it is clear that at this locality, specimens with a orange-brown dorsal colouration and diamond-shaped markings on the back occur, different from M. expectata which has a yellowish dorsum and no diamond-shaped marking. Furthermore, the juvenile specimens collected by us, in preservative, all have a typical pattern of "brown" Mantella populations, including a frenal stripe that reaches to the tip of the snout (e.g., ZSM 15/2006, 32/2006, 44/2006, 58/2006, 73/2006 and 120/2006).

Rediscovery and relationships of Mantella manery Mantella manery is an enigmatic species known only from two specimens collected in the Marojejy Mas- sif in north-eastern Madagascar, of which only one - the holotype - has been preserved. Despite the lack of data, Vences et al. (1999) felt forced to describe this species because, based on published photos, it had already been given invalid scientific names by various hobbyists, a situation that was leading to nomenclatural confusion. The rediscovery of the holotype later permitted to provide an adequate morphological description of the species (Vences et al. 2004b) but its relationships remained obscure. The species has several similarities with Mantella laevigata, which occurs in north-eastern Madagascar as well, such as the black belly with relatively small bluish dots, and the green-yellowish dorsal color which does not fully cover the posterior part of the dorsum. However, based on several morphological and especially chromatic characters (presence of a horseshoe marking on the throat and of a frenal stripe along the upper lip) M. manery had been placed in the M. betsileo group, while M. laevigata was kept in an own group based on its many derived characters (e.g., tree-hole breeding and enlarged discs of digits) (Glaw & Vences 1994; Vences et al. 1999). Mantella manery remained the only species of Mantella for which no molecular data were available thus far. One of us (RD) could recently (November 2005) find one specimen of the species at the type locality, near a site in Marojejy National Park locally known as "Camp Mantella" (which is at the geographical coordinates 14°26'S, 49°47'E, 481 m above sea level). The precise locality was a small stream flowing into the main river, where after a search of 15 minutes a specimen was found around 10 am on a fallen bamboo trunk, following heavy rains in the previous night. At the same site, FG and MV had unsuccessfully searched for the species in

38 · Zootaxa 1501 © 2007 Magnolia Press RABEMANANJARA ET AL. February of 2005, and FR had been with various colleagues collecting Mantella laevigata in 2004, both in the wet and dry seasons, without finding M. manery. This indicates that the species is probably rare at the type locality, but it may be more common at other, yet unknown sites. The newly collected specimen was a large female, and a molecular sample of it could be taken and analyzed herein. The results corroborate that this species is a genetically very distinct unit, surprisingly not belonging to the M. betsileo group but the sister species of Mantella laevigata. This relationship was not strongly supported in our analysis, but is backed up by analysis of sequences of other genes (K. Wollenberg and M. Vences, unpublished data). Mantella laevigata is a largely arboreal species that can occur at sites with partly open canopy cover, whereas M. manery appears to be living on the floor of dense forest next to streams and rivers (RD, personal observation). Considering these different ecologies and the very high genetic differentiation among these species (more than 10%), it is unlikely that any hybridization takes place despite the close syntopy of both forms. Most adaptations of M. laevigata in its habits (arboreality), morphology (broad tips of fingers and toes) and reproduction (single-egg laying, parental care) are clearly derived and unique among Mantella. If these two species are indeed sister to each other, then it is likely that M. laevigata evolved from a less specialized ancestor which may not have been too different from M. manery. Since both species live in sympatry, and indeed can occur in close syntopy, evolutionary hypotheses that can be drawn at this stage are that (a) speciation may have occurred in sympatry or parapatry by ecological divergence of the ancestor of M. laevigata, and that (b) the very similar colour patterns of the two species may be an ancestral character, although selection through Müllerian mimicry may contribute to maintain this pattern stable over evolutionary time in the two species (Schaefer et al. 2002).

Molecular systematics and biogeography In a recent study, Wilmé et al. (2006) hypothesized that the high faunal richness and local endemism in Madagascar may be explained by the river catchments with sources at relatively low elevations being zones of isolation leading to speciation of locally endemic taxa, whereas those with sources at higher elevations were zones of retreat and dispersion and hence contain proportionately lower levels of microendemism. The existence of geographically restricted lineages in the Mantella betsileo group, especially in western Madagascar, could offer a good opportunity to test this hypothesis but at present the ranges of these lineages are insuffi- ciently known for any such explicit analyses. A further influence of large rivers is that they may play a role as riverine barriers to gene flow (Wallace 1852; Ayres & Clutton-Brock 1992; Bermingham & Moritz 1998). The importance of rivers in western Mada- gascar for species formation and genetic isolation of lemurs has already been emphasized by Pastorini et al. (2003). Especially the Betsiboka river, the longest river of Madagascar which flows in a SE-NW direction, exerts a very important influence in this respect. Our results suggest, at a large geographical scale, the presence of the major phylogenetic subdivision in the Mantella betsileo group separating a clade occurring north of the Betsiboka from a clade occurring south of this river. However, again, without a more comprehensive geographic sampling, especially of populations closer to the river basin itself, we cannot confirm that it is really this river separating the major clades in the M. betsileo group. Mantella betsileo as defined here is, of all species in the clade (and indeed of the whole M. betsileo group), the one occurring over the widest altitudinal range (55–1200 m) and also over a large geographical area encompassing both sides of the Mangoky river which therefore apparently has not played the role of a barrier for this species. The two populations here referred to as M. aff. expectata are sister to each other in one clade, supported by a bootstrap value of 80%. Surprisingly, these two populations come from rather different lowland areas in Madagascar: one from very dry areas in the extreme south of Madagascar, near Tranomaro, the second one from the limestone massif of Bemaraha in the central west. These two areas are separated by a wide geographical gap, in which both Mantella betsileo and Mantella expectata occur. This pattern can at present not be

MANTELLA BETSILEO GROUP SYSTEMATICS Zootaxa 1501 © 2007 Magnolia Press · 39 explained by any simple biogeographic scenario, but further data are necessary to assess whether some other, geographically intermediate populations of "brown" Mantella belong into this clade as well. It needs to be remarked that a similar pattern was found in another vertebrate group: snakes of the genus Acrantophis from the extreme south of Madagascar, usually considered as Acrantophis dumerilii, have haplotypes that form a clade with those of the western/north-western species A. madagascariensis rather than with other A. dumerilii specimens from the south-west (Vences & Glaw 2003). In contrast to the southern clade, the main lineages in the northern clade of the Mantella betsileo group are far less clearly differentiated genetically, although their morphological variability is similar to that of the southern clade. Most populations of M. ebenaui consist of small-sized, brown-coloured frogs, whereas M. aff. viridis is distinctly larger and equally brown-coloured and M. viridis is large and usually uniformly bright green-yellow, but none of these forms turned out to be a clearly monophyletic and genetically divergent lineage. If the poorly supported phylogenetic pattern resulting from our tree is correct, it suggests a relatively recent separation of M. viridis from M. aff. viridis which at its turn probably evolved out of a paraphyletic M. ebenaui. However, since our dataset includes only few specimens from many populations, and no information on differentiation in nuclear genes, we cannot distinguish between possible phenomena of recent and ongoing introgression or incomplete lineage sorting that may apply to some of these populations. Different from the Mantella cowani group, as studied by Rabemananjara et al. (2007), the species in the M. betsileo group show a relatively distinct geographical signature in their haplotypes. In contrast, in the widespread M. baroni and M. nigricans in the M. cowani group, one cytochrome b haplotype was present and most common in all populations, separated by up to 1000 km of geographical distance (Rabemananjara et al. 2007). In the M. betsileo group, haplotype sharing occurs between the closely related M. viridis and M. aff. viridis, but it seems to be less common among genetically more divergent lineages. Despite the sympatric occurrence of Mantella expectata and M. betsileo at Isalo, the specimens studied here did not show haplotype introgression, and although these species may occasionally and in some direct contact zones hybridize, there seems to be no broad genetic admixture, confirming their status as biological species. Among the Bemaraha samples, our data point out one possible case of haplotype introgression, indicated by the presence of a M. betsileo haplotype in what otherwise appears to be a population of M. aff. expectata. However, as said before, all available samples from this site came from juvenile specimens that lacked many of the characteristic colour patterns of adults, and therefore we cannot further interpret this deviant Bemaraha haplotype which might be indicative of (1) haplotype sharing among M. betsileo and M. aff. expectata through introgression or incomplete lineage sorting, or (2) sympatric occurrence of these two species in Bemaraha. Mantella laevigata populations from Marojejy seem to be genetically similar to populations from Nosy Mangabe, indicating that this species is relatively uniform over much of its distribution area.

Conservation units The genus Mantella is one of the most famous groups of Malagasy amphibians and is also prominent in the international commerce (Andreone et al. 2005; Rabemananjara et al. in press). One of the international strategies of Mantella species conservation has been the inclusion of all species of the genus in the Appendix II of the Convention on the International Trade of Endangered Species (CITES), but the lack of knowledge about the precise distribution and status of several Mantella species creates, every year, a very complex discussion about the opportunities and possible strategies for their sustainable exploitation. Actually, habitat loss constitutes the major threat of Madagascan fauna and the inexistence of a clear policy coupling conservation and development represents the major risk of extinction of a lot of species. The genetic data provided herein significantly contribute to a better knowledge of various species of Mantella and, therefore, could help to define more clearly some conservation priorities.

40 · Zootaxa 1501 © 2007 Magnolia Press RABEMANANJARA ET AL. One first step for defining such priorities is to delimit the units to be considered separately for conservation efforts. In the Mantella betsileo and M. laevigata groups, according to our mitochondrial DNA data, there are a number of genetically well defined species which clearly qualify as such units: (1) M. laevigata, (2) M. manery, (3) M. betsileo, and (4) M. expectata. In addition, one undescribed form is genetically distinct and qualifies as unit for conservation, namely (5) M. aff. expectata. This latter form exhibits a clear differentiation between specimens from the two populations studied, but we here refrain from defining these two as independent conservation units until data from the whole range of this form become available and nuclear data will be gathered. Furthermore, there are two other species which are less easy to define based on the mitochondrial sequence data available, in particular M. viridis and the non-monophyletic M. ebenaui. However, in this case, there are distinct morphological and ecological differences such as M. viridis being larger, of a green-yellowish colour and adapted to much drier habitats than M. ebenaui. We suggest that in this case, the Adaptive Evo- lutionary Conservation concept proposed by Fraser & Bernatchez (2001) and evoked also in the studies of Mantella bernhardi (Vieites et al. 2006) and the Mantella cowani group (Chiari et al. 2005; Rabemananjara et al. 2007), is an adequate strategy to define also (6) M. ebenaui and (7) M. viridis as units for conservation. Because M. aff. viridis is morphologically intermediate between M. ebenaui and M. viridis (large body size and predominantly brown colouration) and shares haplotypes with M. viridis, we do not consider it as separate conservation unit but rather as a hybrid zone population. In terms of red listing, M. laevigata is considered as Near Threatened, and its range encompasses several protected areas (Mananara Biosphere Reserve, Marojejy National Park, Masoala National Park, and Nosy Mangabe Special Reserve). Although the species is specialized to low-altitude forest which is under strong pressure, the Near Threatened category for this species appears to be appropriate. The data deficient M. manery (also occurring in Marojejy National Park) deserves more thorough studies to ascertain its status before taking any decision about its conservation strategy, but as with other rare and localized species in northern Madagascar, it is likely that this species deserves being listed in one of the threatened categories. For the M. betsileo group, our surveys confirmed localized occurrences of M. expectata and M. viridis which both are listed as Critically Endangered, and we support these categories. Mantella betsileo is currently listed as Least Concern (Andreone et al. 2005), but this status is based on a wider taxonomic definition of this species. M. betsileo as redefined herein occurs in one protected area (Isalo National Park) and is known from only two additional sites (Kirindy and Ambatondradama). Despite a large extent of occurrence the known area of occupancy for the species is low, and there is no doubt that the distribution will continue to be patchy, even if new populations will be found in future surveys. Furthermore, forests and associated streams in western Madagascar are known to be in decline under heavy anthropogenic pressure which is almost certainly adversely affecting this species for which we therefore suggest a Red List category of Vulnerable. Mantella ebenaui is a widespread and locally common species that tolerates high degrees of habitat disturbance. Populations now assigned to M. ebenaui were previously included in M. betsileo and their common- ness and generalized habitat requirements were the reason for assigning the Least Concern status to that species. We consequently propose to consider Mantella ebenaui as Least Concern. The last species for which we suggest special conservation attention is M. aff. expectata. Although not yet described as distinct species, this lineage occurs in the driest part of Madagascar and in a forested relict habitat in the central west (Tsingy de Bemaraha). There is no doubt that this species qualifies for inclusion in one of the threatened categories of IUCN, and we emphasize that more work is needed to understand the distribution, ecology, taxonomic status and genetic differentiation of this form.

We are grateful to Marta Andriantsiferana, Noromalala Raminosoa, Daniel Rakotondravony, Tokihery Razafindrabe, Rabe Andriamaharavo, Vincenzo Mercurio, Jasmin E. Randrianirina, Parfait Rasendra, Chris- tian Razafindrabe and Cecchini Harisoa for assistance during field work. Katharina C. Wollenberg provided unpublished informations on Mantella phylogeny. We are indebted to the Fonds d'Appui au Développement de l’Enseignement Supérieur (FADES) for funding of fieldwork and laboratory expenses to the Département de Biologie Animale, Université d'Antananarivo. The University of Antananarivo, ICTE/MICET and ANGAP provided logistic assistance. The Ministère des Eaux et Forêts kindly issued research authorizations and export permits. FR was supported by a WOTRO/NWO DC-fellowship for research in foreign countries. Laboratory and field work further received support by grants of the Volkswagen Foundation to MV and by an Ambassadorial Scholarship of the Rotary Foundation to YC.

References

Andreone, F. & Luiselli, L.M. (2003) Conservation priorities and potential threats influencing the hyper-diverse amphibians of Madagascar. Italian Journal of Zoology, 70, 53–63. Andreone, F., Cadle, J.E., Cox, N., Glaw, F., Nussbaum, R.A., Raxworthy, C.J., Stuart, S.N., Vallan, D. & Vences, M. (2005) Species review of amphibian extinction risks in Madagascar: conclusions from the Global Amphibian Assessment. Conservation Biology, 19, 1790–1802. Ayres, J.M. & Clutton-Brock, T. H. (1992) River boundaries and species range size in Amazonian primates. The Ameri- can Naturalist, 140, 531–537. Bermingham, E. & Moritz, C. (1998) Comparative phylogeography: concept and applications. Molecular Ecology, 7, 367–369. Blommers-Schlösser, R. M. A. & Blanc, C. P. (1991) Amphibiens (première partie). Faune de Madagascar 75(1), 1–379. Boettger, O. (1880) Diagnoses reptilium et batrachiorum novorum a Carolo Ebenau in insula Nossi-Bé Madagascariensi lectorum. Zoologischer Anzeiger, Leipzig 3, 279–283. Bossuyt, F. & Milinkovitch, M.C. (2000) Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proceeding of the National Academy of Sciences of the USA, 97, 6585– 6590. Brandley, M.C., Schmitz, A. & Reeder, T.W. (2005) Partitioned Bayesian analyses, partition choice, and the phylogenetic relationships of scincid lizards. Systematic Biology, 54, 373–390. Bruford, M.W., Hanotte, O., Brookfield, J.F.Y. & Burke, T. (1992) Single-locus and multilocus DNA fingerprint. In: Molecular Genetic Analysis of Populations: A Practical Approach (Ed. Hoelzel, A.R.), IRL Press, Oxford pp. 225– 270. Chiari,Y., Vences, M., Vieites, D.R., Rabemananjara, F., Bora, P., Ramilijaona Ravoahangimalala, O. & Meyer, A. (2004) New evidence for parallel evolution of colour patterns in Malagasy poison frogs (Mantella). Molecular Ecol- ogy, 13, 3763–3774. Chiari, Y., Andreone, F., Vences, M. & Meyer, A. (2005) Genetic variation of an endangered Malagasy frog, Mantella cowani, and its phylogeographic relationship to the widespread M. baroni. Conservation Genetics, 6, 1041–1047. Clark, V.C., Raxworthy, C. J., Rakotomalala, V., Sierwald, P. & Fisher, B.L. (2005) Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics. Proceeding of the National Academy of Sciences of the USA, 102, 11617-11622. Daly, J.W., Secunda, S., Garraffo, H.M., Spande, T.F., Wisnieski, A. & Cover, J.F. (1994) An uptake system for dietary alkaloids in poison frogs (Dendrobatidae). Toxicon, 32, 637–663. Daly, J.W., Kaneko, T., William, J., Garraffo, H.M., Spande, T.F., Espinosa, A. & Donnelly, M.W. (2002) Bioactive alkaloids of frog skin combinatorial prospecting reveals that pumiliotoxins have an arthropod source. Proceedings of the National Academy of Science of the USA, 99, 13996–14001. Daly, J.W., Garraffo, H.M., Hall, G.S. & Cover, J.F. Jr. (1997) Absence of skin alkaloids in captive-raised Madagascan mantelline frogs (Mantella) and sequestration of dietary alkaloids. Toxicon, 35, 1131–1135. DeSalle, R. & Amato, G. (2004) The expansion of conservation genetics. Nature Reviews Genetics, 5, 702–712. Frankham, R., Ballou, J.D. & Briscoe, D.A. (2002) Introduction to Conservation Genetics. Cambridge University Press. Fraser, D. J. & Bernatchez, L. (2001) Adaptive evolutionary conservation: Towards a unified concept for defining conservation units. Molecular Ecology, 10, 2741–2752.

42 · Zootaxa 1501 © 2007 Magnolia Press RABEMANANJARA ET AL. Glaw, F. & Vences, M. (1994) A Fieldguide to the Amphibians and Reptiles of Madagascar. Second Edition. Glaw, F., & Vences, M. (2006) Phylogeny and genus-level classification of mantellid frogs (Amphibia, Anura). Organ- isms, Diversity & Evolution, 6, 236–253. Glaw, F., Hoegg, S. & Vences, M. (2006) Discovery of a new basal relict lineage of Madagascan frogs and its implications for mantellid evolution. Zootaxa , 1334, 27–43. Grandidier, A. (1872) Description de quelques reptiles nouveaux découverts à Madagascar en 1870. Annales de Sciences Naturelles, Paris, Zoologie, Sér. 5, 15(20), 6–11. Grandidier, A. (1869) Descriptions de quelques animaux nouveaux découverts, pendant l'année 1869, sur la côte ouest de Madagascar. Revue et Magazine de Zoologie (Paris), Sér. 2, 21, 337–342. Hott, J.A. & Scott, D.E. (1999) Effects of toe-clipping and PIT-lagging on growth and survival in metamorphic Ambystoma opacum. Journal of Herpetology, 33, 344–348. IUCN (2006) 2006 IUCN Red List of Threatened Species. . Accessed on 05 September 2006. Jones, T.H., Gorman, J.S.T., Snelling, R.R., Delabie, J.H.C., Blum, M.S., Garraffo, H.M., Jain, P., Daly, J.W. & Spande, T.F. (1999) Further alkaloids common to ants and frogs: Decahydroquinolines and quinolizidines. Journal of Chem- ical Ecology, 25, 1179–1193. Kiesecker, J. M., Blaustein, A. R. & Belden, L. K. (2001) Complex causes of amphibian population declines. Nature, 410, 681–684. Köhler, J., Vieites, D.R., Bonett, R.M., Hita García, F., Glaw, F., Steinke, D. & Vences, M. (2005) New amphibians and global conservation: a boost in species discoveries in a highly endangered vertebrate group. Bioscience, 55, 693– 696. Kurabayashi, A., Usuki, C., Mikami, N., Fujii, T., Yonekawa, H., Sumida, M. & Hasegawa, M. (2006) Complete nucleotide sequence of the mitochondrial genome of a Malagasy poison frog Mantella madagascariensis: evolutionary implications on mitochondrial genomes of higher anuran groups. Molecular Phylogenetics and Evolution, 39, 223– 236. Myers, N., Mittermeier, R. A. , Mittermeier C. G., de Fonseca, G. A. B. & Kent, J. (2000) Biodiversity hotspots for conservation priorities. Nature, 403, 853–858. Moritz, G. & Faith, D.P. (1998) Comparative phylogeography and the identification of genetically divergent areas for conservation. Molecular Ecology, 7, 419–429. Pastorini, J., Thalmann, U. & Martin, R.D. (2003) A molecular approach to comparative phylogeography of extant Mal- agasy lemurs. Proceedings of the National Academy of Science of the USA, 100, 5879–5884. Posada, D. & Crandall, K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics, 14, 817–818. Posada, D. (2004) Collapse, Version 3.1, Department of Zoology, Brigham Young University, Salt Lake City, UT. Pounds, J. A., Bustamante, M. R., Coloma, L.A. et al. (2006) Widespread amphibian extinctions from epidemic disease driven by global warming. Nature, 439, 161–167. Rabemananjara, F. C. E., Chiari, Y., Ravoahangimalala Ramilijaona, O. & Vences, M. (2007): Evidence for recent gene flow between north-eastern and south-eastern Madagascan poison frogs from a phylogeography of the Mantella cowani group. Frontiers in Zoology, 4, article 1. Rabemananjara, F. C. E., Rasoamampionona Raminosoa, N., Ravoahangimalala Ramilijaona, O., Andreone, F., Bora, P., Carpenter, A. I., Glaw, F., Razafindrabe, T., Vallan, D., Vieites, D. R. & Vences, M. (in press) Malagasy poison frogs in the pet trade: a survey of levels of exploitation of species in the genus Mantella. Amphibian and Reptile Conser- vation. Ronquist, F., & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinfor- matics, 19, 1572–1574. Schaefer, H.C., Vences, M. & Veith, M. (2002) Molecular phylogeny of Malagasy poison frogs, genus Mantella (Anura: Mantellidae): homoplastic evolution of color pattern in aposematic amphibians. Organisms Diversity & Evolution, 2, 97–105. Servedio, S.M. (2000) The effect of predator learning, forgetting and recognition errors on evolution of warning coloration. Evolution, 54, 751–763. Stuart, S.N., Chanson, J.S., Cox N.A. et al. (2004) Status and trends of amphibian declines and extinctions worldwide. Science, 306, 1783–1786. Swofford, D.L. (2002) PAUP* Phylogenetic Analysis using Parsimony (* and other methods), Version 4b10. Sinauer Associates, Sunderland, MA. Thomas, H. & Kidney, D. (2005) Herpetofauna. Pp. 38–46 in: Frontier-Madagascar. 2005. Thomas, H., Kidney, D., Rubio, P. & Fanning, E. (eds.). The Southern Mikea: A Biodiversity Survey. Frontier-Madagascar Environmental Research Report 12. Society for Environmental Exploration, UK and Institut Halieutique et des Sciences Marines, Toliara.

Vallan (2000) Influence of forest fragmentation on amphibian diversity in the nature reserve of Ambohitantely, highland Madagascar. Biological Conservation, 96, 31-43.

MANTELLA BETSILEO GROUP SYSTEMATICS Zootaxa 1501 © 2007 Magnolia Press · 43 Vences, M., Köhler, J., Schmidt, K. & Glaw, F. (1996) Mantella betsileo: Haltung, Nachzucht und Farbvarianten. Die Aquarien- und Terrarien-Zeitschrift, 49, 579–582. Vences, M. & Glaw, F. (2003) Phylogeography, systematics and conservation status of boid snakes from Madagascar (Sanzinia and Acrantophis). Salamandra, 39, 181–206. Vences, M., Glaw, F. & Böhme, W. (1999) A review of the genus Mantella (Anura, Ranidae, Mantellinae): taxonomy, distribution and conservation of Malagasy poison frogs. Alytes, 17, 3–72. Vences, M., Chiari, Y., Raharivololoniaina, L. & Meyer, A. (2004a) High mitochondrial diversity within and among populations of Malagasy poison frogs. Molecular Phylogenetics and Evolution, 30, 295–307. Vences, M., Thomas, M., Bonett, R. M. & Vieites, D. R. (2005) Deciphering amphibian diversity through DNA barcoding: chances and challenges. Philosophical Transactions of the Royal Society London, Ser. B, 360, 1859-1868. Vences, M., Woodhead, C., Bora, P. & Glaw, F. (2004b) Rediscovery and redescription of the holotype of Mantella manery. Alytes, 22, 15–18. Vieites, D.R., Chiari, Y., Vences, M., Andreone, F., Rabemananjara, F., Bora, P., Nieto-Roman, S. & Meyer, A. (2006) Mitochondrial evidence for distinct phylogeographic units in the endangered Malagasy poison frog Mantella bernhardi. Molecular Ecology, 15, 1617–1625. Wallace, A.R. (1852) On the monkeys of the Amazon. Proceedings of the Zoological Society of London, 20, 107–110. Werner, F. (1901) Beschreibung neuer Dendrobatiden. Mit einer Revision dieser Batrachier-Familie. Verhandlungen der zoologisch-botanischen Gesellschaft in Wien, 51, 627–634. Wilmé, L., Goodman, S.M. & Ganzhorn, J.U. (2006) Biogeographic evolution of Madagascar’s microendemic biota. Sci- ence, 312, 1063–1065.

Molecular Ecology (2006) doi: 10.1111/j.1365-294X.2006.02874.x

BlackwellMitochondrial Publishing Ltd evidence for distinct phylogeographic units in the endangered Malagasy poison frog Mantella bernhardi

DAVID R. VIEITES,* YLENIA CHIARI,†‡ MIGUEL VENCES,‡*** FRANCO ANDREONE,§ FALITIANA RABEMANANJARA,¶‡ PARFAIT BORA,¶ SANDRA NIETO-ROMÁN** and AXEL MEYER† *Museum of Vertebrate Zoology and Department of Integrative Biology, 3101 Valley Life Sciences Bldg., University of California, Berkeley, CA 94720-3160, USA, †Lehrstuhl für Zoologie und Evolutionsbiologie, Department of Biology, University of Konstanz, 78457 Konstanz, Germany, ‡Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, University of Amsterdam, PO Box 94766, 1090 GT Amsterdam, The Netherlands, §Museo Regionale di Scienze Naturali, Via G. Giolitti, 36, 10123 Torino, Italy, ¶Département de Biologie Animale, Université d’Antananarivo, Antananarivo 101, Madagascar, **Laboratorio de Anatomía Animal, Departamento de Bioloxía Animal, Universidade de Vigo 36200, Vigo, Galicia, Spain, ***Present address: Zoological Institute, Technical University of Braunschweig, Spielmannstr. 8, 38106 Braunschweig, Germany

Abstract Mantella bernhardi is an endemic species of Malagasy poison frog threatened by loss and fragmentation of its natural habitat and collection for the pet trade. It is classified as threatened according to the International Union for Conservation of Nature and Natural Resources (IUCN) categories and included in Appendix II of the Convention on the International Trade of Endangered Species (CITES). A recent survey has increased the known distributional range of the species from one to eight populations across southeastern Madagascar, but little is known about its biology and genetic diversity. Here we estimate inter- and intrapopulation mitochondrial genetic variation of four populations. Populations from the northern and southern parts of the distributional range showed a high degree of divergence (maximum of 11.35% in cytochrome b) and were recovered as reciprocally monophyletic groups. Nine haplotypes were detected in the northern and 12 in the southern populations. The population from Ranomafana National Park showed the lowest number of haplotypes and nucleotide diversity, and shared its most common haplotype with the second northern population from Tolongoina. All the other detected haplotypes were unique to each of the four populations. This suggests the existence of important barriers to gene flow, pre-dating human colonization of Madagascar at about 2000 years ago, in distinct contrast to other Mantella species that show a high degree of haplotype sharing throughout their range. The continued habitat fragmentation within the distribution range of M. bernhardi prevents any connection between its populations. Our data indicate the existence of at least two different management units for conservation in this species, corresponding to the North and South of its distribution range, and highlight the existence of strong regional endemism in southeastern Madagascar. Keywords: amphibians, conservation, cytochrome b, Madagascar, Mantella bernhardi, phylogeography Received 28 September 2005; revision accepted 8 December 2005

of hypotheses that explain diversification in rainforest Introduction faunas, based on neutral or adaptive processes (reviewed The evolution of species diversity in rainforests has by Moritz et al. 2000). Among these, the riverine model, captured much attention of researchers due to the high with major rivers acting as an isolating barrier driving biodiversity of tropical regions. There have been a number allopatric differentiation, seems to be especially relevant for taxa of low dispersal capacity, and has initially been Correspondence: David R. Vieites, Fax: (510) 6438238; E-mail: applied to explain differentiation patterns of primates [email protected] (Wallace 1852; Ayres & Clutton-Brock 1992). In Sulawesi,

2 D. R. VIEITES ET AL. areas of endemism were defined using phylogeographic rainforests (Rabemananjara et al. 2005). Here we provide patterns of monkeys. These areas show a remarkable data on the mitochondrial genetic structure within and congruence with those defined using similar methods for among four populations of M. bernhardi from the northern toads. This indicates that similar processes may drive and southern parts of its distribution area. The data indi- differentiation in these taxa (Evans et al. 2003). cate a surprisingly strong phylogeographic structuring in Amphibians are a group belonging to the lower end of this low-altitude species, which we discuss in terms of the relative dispersal ability spectrum (e.g. Inger & Voris a possible differentiation due to riverine barriers. Our 2001; Brown & Guttman 2002), although transoceanic findings also have implication for conservation actions, colonizations have been demonstrated for a number of indicating the need of at least two separate managing taxa (Hedges et al. 1992; Kaiser et al. 1994; Vences et al. 2003). units within M. bernhardi for conservation purposes. Molecular studies in amphibians have usually revealed strong phylogeographic structure and limited gene flow Materials and methods among populations (e.g. García-París et al. 2000; Wake & Jockusch 2000; Kraaijeveld-Smit et al. 2005), although sev- Sample collection eral species from the Palearctic and Nearctic have colonized wide ranges after the last glaciation and show very limited Tissue samples were collected in January and February mitochondrial variability in these areas (e.g. Alexandrino 2004 in four of the eight known populations, spanning over et al. 2000; Steinfartz et al. 2000; Babik et al. 2004; Kuchta & most of the distributional range of Mantella bernhardi Tan 2005). Many other amphibian species, however, show (Rabemananjara et al. 2005): Ranomafana National Park high levels of intraspecific mitochondrial divergence (e.g. (21.4°S, 47.5°E), Tolongoina (21.55°S, 47.52°E), Manombo James & Moritz 2000; Vences et al. 2005). Special Reserve (23.0°S, 47.7°E), and Vevembé (22.8°S, Madagascar is an ideal model region to test for general 47.0°E). We collected one toe-clip from each individual, patterns of phylogeographic differentiation in amphi- which was preserved in absolute ethanol, releasing immedi- bians. This island harbours a highly diverse and endemic ately the animals after treating wounds with antiseptic. amphibian fauna, which largely evolved in isolation due to Sample sizes are given for each locality in Table 1. the limited dispersal to and from other landmasses (Glaw & Vences 2003). Moreover, the Madagascan geography is DNA extraction and sequencing of a relatively simple pattern, with a western arid region separated from the eastern rainforests by a central moun- Total genomic DNA was extracted using proteinase K tain chain. The eastern rainforest is interrupted only by (final concentration 1 mg/mL), and isolated by a standard rivers that flow down from the central highlands in a west– salt extraction protocol (Bruford et al. 1992). A fragment east direction into the Indian Ocean. The western dry and of the mitochondrial cytochrome b gene was amplified via spiny forests are separated by rivers flowing in the oppo- polymerase chain reaction (PCR) using the primers Cytb-c site direction into the Mozambique Channel. These rivers and CBJ10933 (Bossuyt & Milinkovitch 2000). PCRs were are known to form significant phylogeographic barriers for performed in 25-µL reactions using 50 ng genomic DNA, lemurs (Pastorini et al. 2003). A mid-domain effect largely 10 pmol of each primer, 15 nmol of each dNTP, 50 nmol influences amphibian diversity, being highest at mid- additional MgCl2 and the REDTaq PCR buffer (10 mm altitudes and in the central-eastern rainforests (Lees Tris-HCl, pH 8.3, 50 mm KCl, 1.1 mm MgCl2 and 0.01% 1996; Lees et al. 1999). So far, phylogeographic studies gelatine) and 1 U of REDTaq DNA polymerase (Sigma). in Madagascan amphibians have mainly focused on PCR conditions were as follows: an initial denaturation Malagasy poison frogs, genus Mantella, and have found a step at 94 °C for 90 s; 35 cycles at 94 °C for 30 s, annealing relatively low degree of phylogeographic structure and temperature of 53 °C for 45 s, extension at 72 °C for 60 s; common haplotype sharing in species from mid-altitude final extension of 10 min at 72 °C. PCR products were rainforest (Chiari et al. 2004, in press; Vences et al. 2004). purified using QIAquick spin columns (QIAGEN) prior Mantella bernhardi is a species of Malagasy poison frog to cycle sequencing. A 10-µL sequencing reaction included endemic to southeastern Madagascar and classified as 1–2 µL of template, 1 µL of sequencing buffer, 2 µL of endangered in the International Union for Conservation of 2 pmol primer, 1.8 µL of ABI sequence mix (BigDye Nature and Natural Resources (IUCN) Red List (Andreone Terminator version 3.1 Sequencing Standard, Applied et al. 2005). It was until recently known from only a single Biosystems) and 3.2–4.2 µL of water. The sequence reaction locality that suffers from habitat destruction and repre- was 33 cycles of 10 s at 96 °C, 10 s at 50 °C and 4 min at sented the only source population for the pet trade 60 °C. Sequence data collection and visualization were (Raxworthy & Nussbaum 2000). Recent fieldwork has performed on an ABI 3100 automated sequencer (Applied considerably extended the known range of this species by Biosystems). Sequences were deposited in GenBank; accession the discovery of seven new populations, all in low-altitude numbers DQ278651–DQ278803.

PHYLOGEOGRAPHIC UNITS IN MANTELLA BERNHARDI 3

Table 1 Summary of mitochondrial DNA diversity for samples of Mantella bernhardi used in this study and other species of Mantella for comparison

Haplotype diversity Nucleotide diversity Species and population Sample size Haplotypes Polymorphic sites (Hd) (Pi) × 100

M. bernhardi Ranomafana — N (1) 25 2 2 0.08 ± 0.07 0.03 ± 0.03 Tolongoina — N (1) 37 8 9 0.47 ± 0.10 0.15 ± 0.04 Manombo — S (1) 66 7 21 0.33 ± 0.07 0.27 ± 0.09 Vevembe — S (1) 25 5 4 0.38 ± 0.12 0.10 ± 0.04 M. milotympanum Fierenana (2) 20 9 14 0.79 ± 0.09 0.65 ± 0.39 M. crocea Ihofa (2) 26 10 11 0.85 ± 0.05 0.50 ± 0.31 Ambohimanarivo (2) 7 2 4 0.57 ± 0.12 0.43 ± 0.31 Savakoanina (2) 15 8 7 0.87 ± 0.07 0.38 ± 0.25 Andriabe (2) 13 7 9 0.73 ± 0.13 0.35 ± 0.24 North of Fierenana (2) 2 2 2 1.00 ± 0.50 0.38 ± 0.46 M. aurantiaca Torotorofotsy 1 (2) 6 2 7 0.62 ± 0.11 0.33 ± 0.22 Torotorofotsy 2 (2) 5 2 2 0.40 ± 0.24 0.15 ± 0.15 Andranomena (2) 10 4 48 0.68 ± 0.12 2.47 ± 1.32 Andranomandry (2) 16 11 36 0.93 ± 0.05 2.00 ± 1.08 M. madagascariensis Marolambo (3) 7 4 6 0.81 ± 0.13 0.32 ± 0.22 M. baroni Farimazava (4) 33 26 42 0.97 ± 0.02 1.24 ± 0.29 Mantady (4) 1 1 — — — Vohidrazana (4) 10 8 12 0.93 ± 0.08 0.49 ± 0.10 Andranomena (4) 2 2 3 1.00 ± 0.50 0.57 ± 0.29 Ranomafana (4) 13 12 20 0.99 ± 0.04 0.70 ± 0.10 Tsinjoarivo (4) 3 2 1 0.67 ± 0.31 0.13 ± 0.06 Andriave (4) 5 3 2 0.80 ± 0.16 0.19 ± 0.05 M. cowani Soamazaka (4) 4 3 4 0.83 ± 0.22 0.38 ± 0.15 Vohisokina (4) 20 8 15 0.77 ± 0.08 0.54 ± 0.10 Vatolampy (4) 6 3 2 0.73 ± 0.16 0.22 ± 0.16 Farimazava (4) 8 5 25 0.79 ± 0,15 1.88 ± 0.71

References are given in parentheses: 1, this study; 2, Chiari et al. (2004); 3, Vences et al. (2004); 4, Chiari et al. (in press). For M. bernhardi, N and S identify northern and southern populations, respectively. Values are given ± standard deviation.

on different assumptions of molecular evolution. MP Data analysis analysis was performed in paup* 4b10 using heuristic Sequences (502 bp) were edited and aligned using searches with tree-bisection–reconnection (TBR) branch sequence navigator software (Applied Biosystems). We swapping, step addition starting tree, and random did not detect stop codons or indels in the alignment. addition sequence with 1000 replicates, using distinct haplo- Haplotypes were merged using the program collapse types. We used two species of mantellids as outgroups: version 1.2 (Posada 1999). Phylogenetic analyses were Mantella baroni and Boophis ankaratra. For the Bayesian performed using the programs paup*, version 4b10 analysis, we partitioned our data by codon position, as this (Swofford 2002), and mrbayes, version 3.1 (Ronquist & partitioning strategy performs better with protein-coding Huelsenbeck 2003). We performed both a Bayesian and mtDNA (Brandley et al. 2005). mrmodeltest version 2.2 maximum-parsimony (MP) analysis in order to check for [Nylander 2004; modified version of modeltest 3.6 (Posada consistency in the results using different algorithms based & Crandall 1998)] was employed to choose the appropriate

© 2006 Blackwell Publishing Ltd, Molecular Ecology, 10.1111/j.1365-294X.2006.02874.x 4 D. R. VIEITES ET AL. model of sequence evolution for each partition. We standardized the initial tree used for calculation of every partition model, by using a neighbour-joining (NJ) tree with Jukes–Cantor substitution model of the whole data set as starting tree, instead of a random NJ tree as is defined in mrmodeltest by default. The models selected were K80 + G, HKY and GTR for the partitions of the first, second and third codon positions, respectively. The analysis consisted of four Markov chains that ran for 10 × 106 generations, sampled every 1000 generations, with a random starting tree, default priors and equal branch lengths for each partition. The burn-in parameter was empirically estimated by plotting –ln L against the generation number, and the trees corresponding to the first million generations discarded. For each population we assessed nucleotide diversity and haplotype diversity using the program dnasp version 4.0 (Rozas et al. 2003). The method of statistical parsimony (Templeton et al. 1992) implemented in the tcs software package (Clement et al. 2000) was employed to depict phylogenetic and geographical relationships among the identified haplotypes. The program first defines the uncorrected distance between haplotypes above which the parsimony criterion is violated with more than 5% of probability, and then establishes connections between the haplotypes until the ‘parsimony’ limit is reached. Ambiguities were solved following the frequency, topological and geographical criteria (Crandall & Templeton 1993; Templeton & Sing 1993; Crandall et al. 1994; Posada & Crandall 2001). Fig. 1 Bayesian phylogram of the observed haplotypes showing the two clades of Mantella bernhardi. Haplotype codes refer to the Results first letter of each population and the number of that haplotype (R, Ranomafana; T, Tolongoina; V, Vevembé; M, Manombo). We obtained sequences for 153 individuals of Mantella Bayesian posterior probabilities and bootstrap values higher than bernhardi, ranging from 25 to 66 individuals per population 85% in the Bayesian and MP analyses, respectively, are shown (Table 1). Of the 502 bp of the cytochrome b gene analysed, (BY/MP). 420 were constant and 64 were parsimony-informative. The M. bernhardi sequences contained 77 variable sites, which defined 23 haplotypes; haplotype and nucleotide diversity These results were congruent also with tcs analysis, values are summarized in Table 1. Haplotype diversity which recovered two haplotype networks corresponding was highest in Tolongoina, and lowest in Ranomafana. to the northern and southern populations, respectively Nucleotide diversity was highest at Manombo, second (Fig. 2). Manombo (with eight haplotypes) and Vevembé highest at Tolongoina, and lowest at Ranomafana. (five haplotypes) had no haplotypes in common, nor did The trees resulting from Bayesian (Fig. 1) and MP either share any haplotype with northern populations. analyses consistently recovered two reciprocally mono- In the two northern populations (Ranomafana and Tolon- phyletic haploclades. MP searches recovered a single goina), one haplotype predominated (R1, Fig. 2), and was most parsimonious tree (consistency index 0.90, retention shared between both. The Ranomafana population showed index 0.97; not shown). The two clades, corresponding very low genetic diversity, with only two haplotypes to the two northern and the two southern populations, detected vs. eight unique haplotypes in Tolongoina. Most respectively, were supported with high (100%) bootstrap of the sampled specimens in the northern populations values. The northern populations constituted a single (96%) shared the same haplotype. We had to force the haploclade, while in the southern clade the Vevembé program to a minimum of 48 steps to connect the two population was supported by high bootstrap values as a networks between the haplotype R2 and M1 (Fig. 2). In different entity. The Bayesian tree agreed in the general the southern haplotype network, Vevembé haplotypes topology with the MP tree, with high support for the two constituted again a separate entity within the southern above-mentioned clades. clade.

Fig. 2 Haplotype network of the four studied populations under the 95% cladogram estimation in tcs. Haplotype codes are the same as in Fig. 1, and alternative nodes are indicated by dashed lines. Only Ranomafana and Tolongoina shared a haplotype; all other haplotypes were unique to single populations. The program had to be forced to connect the two haploclades (see text). Geographic relationships of the sampled populations is shown on the left; light grey and dark grey represent, respectively, low-altitude and mid-altitude natural rainforest.

flow or to a possible lower dispersal capacity of females, Discussion nuclear markers such as microsatellites are necessary. Such a male-biased dispersal pattern has been inferred by Riverine barriers and phylogeography Lampert et al. (2003) in túngara frogs, and observed by Joly Our data suggest the presence of two reciprocally mono- & Grolet (1996) for juvenile Alpine newts, Triturus alpestris, phyletic mitochondrial lineages within Mantella bernhardi, although evidence for female-biased dispersal was found corresponding to the northern and southern popula- in bullfrogs, Rana catesbeiana, by Austin et al. (2000), and tions, respectively. The high mtDNA divergence between in common frogs, Rana temporaria, by Palo et al. (2004). A these haploclades (with a maximum of 57 substitutions further hypothesis that needs to be taken into account is that and 11.35% divergence between haplotypes T1 and V4), phylogeographic discontinuities in nonrecombining units indicates long-term differentiation. This pattern stands in such as mitochondrial genes may arise in continuously dis- remarkable contrast to other species of Mantella from mid- tributed species in the absence of gene flow if individual altitude rainforest areas in Madagascar (Table 1). In one of dispersal distances and population sizes are low (Irwin these species, Mantella baroni, based on the analysis of a 2002). For M. bernhardi, our own unpublished data indicate cytochrome b fragment homologous to the one used here, high local population densities of 170–820 individuals per populations from the northernmost and southernmost hectare, but nothing is known about individual dispersal regions largely shared similar or even identical haplo- distances. However, the fact that very few populations of types (Chiari et al. in press). Of the 17 species of Mantella this species are known and that it had eluded scientific recognized by Vences et al. (1999), six have so far been collection before the 1990s (Rabemananjara et al. 2005) studied from a phylogeographic perspective: M. baroni, indicate that a historically continuous distribution is very Mantella cowani (Chiari et al. in press), Mantella aurantiaca, unlikely. A phylogeographic discontinuity is not only Mantella crocea, and Mantella milotympanum (Chiari et al. present between northern and southern populations of 2004), and Mantella madagascariensis (Vences et al. 2004). this species but also (although much less pronounced) Values of haplotype diversity (= gene diversity) and nucle- between Manombo and Vevembé. The high interpopula- otide diversity for these species are summarized in Table 1. tional divergences and the complete absence of haplotype Haplotype diversity ranged from 0.6 to 0.99 (counting sharing between north and south, and between Manombo populations where more than five individuals were and Vevembé, are therefore best explained by a long genetical sequenced), with most values higher than 0.6. Haplotypes isolation of these populations. Although the habitat of within the M. crocea/milotympanum complex, and within M. bernhardi is currently heavily fragmented, the available M. aurantiaca, had maximum divergences of eight steps. information suggests that most of the forest disappeared Compared with these data, M. bernhardi, by contrast, is recently (Green & Sussman 1990) due to human activities. characterized by relatively lower haplotype diversity within The amount of genetic divergence between the northern populations (Table 1), but a higher among-population and southern haplotype groups are of a level that indicates haplotype differentiation. the presence of barriers to gene flow pre-dating human To reliably ascertain whether this interpopulational dif- colonization of Madagascar which is likely to have occurred ferentiation in M. bernhardi is due to fully disrupted gene less than 2000 years ago (Burney et al. 2003).

Comparisons of phylogeographic patterns for multiple rivers originate in the central highlands and flow east- codistributed species is a powerful tool to detect potential wards into the Indian Ocean. These rivers obviously long-term spatial barriers to gene flow (Bermingham & become larger towards lower altitudes, and therefore Moritz 1998). Based on the Riverine Barrier Model (Wallace may constitute important barriers to species restricted to 1852; Ayres & Clutton-Brock 1992), large rivers facilitate low-altitude habitat. This scenario could still explain why genetic diversification in terrestrial organisms reducing there is distinct interpopulational differentiation in the the gene flow. However, the influence of rivers in this low-altitude specialist M. bernhardi while the mid-altitude respect is controversial. Gascon et al. (2000) found no influ- M. baroni shows no relevant population subdivision (Chiari ence of a river in the Amazon basin on the present-day et al. in press). More intensive sampling of low-altitude pattern of community similarity and species richness of specialists among Madagascan frog species is necessary to frogs and marsupials. Lougheed et al. (1999) found a limited assess the impact of rivers, especially the Manampatrana influence of a riverine barrier on the phylogeographic River, on their genetic differentiation. pattern of a frog species, Epipedobates femoralis, and Lugon-Moulin et al. (1999) found no significance influence Management units for conservation in Mantella of riverine barriers on the gene flow of the common shrew, bernhardi Sorex araneus, in France. On the other hand, rivers are known to provide barriers to gene flow in primates (Peres Madagascar is one region that deserves highest priority for et al. 1996; Eriksson et al. 2004), reptiles (Pellegrino et al. biodiversity conservation (Myers et al. 2000). Amphibians 2005), and even in understorey forest birds (Capparella are a group that is globally affected by important declines 1991). (Stuart et al. 2004), and in Madagascar all amphibian In Madagascar, Pastorini et al. (2003) provided evidence species but one (recently introduced) are endemic (Glaw & for a significant influence of several large rivers in western Vences 2003). For many of them fundamental data are Madagascar on lemur phylogeography, but their data lacking to reliably assess conservation priorities (Andreone were insufficient to analyse the situation in the east. How- & Luiselli 2003; Andreone et al. 2005). Rainforest destruc- ever, several more detailed studies indicated the existence tion has been identified as one of the major causes of the of a genetic barrier between Ranomafana and Manombo/ loss of the Malagasy biodiversity (Green & Sussman 1990; Vevembé. The black and white ruffed lemurs (Varecia Achard et al. 2002). Over-exploitation for the pet trade variegata) are present both in Ranomafana and in Manombo, has also been identified as threat for a few species of showing a high degree of genetic differentiation between Malagasy amphibians, especially of the genera Dyscophus the two sites (Louis et al. 2005). The same pattern of genetic and Mantella (Behra 1993; Andreone & Luiselli 2003). differentiation has been found in brown lemurs (Eulemur Mantella are included on Appendix II of the Convention on fulvus/albocollaris), although in this case a stable hybrid the International Trade of Endangered Species (CITES), zone was recorded in Andringitra National Park (between and the numbers exported from Madagascar amount to Vevembé and Ranomafana) (Sterling & Ramarason 1996). several thousand individuals per year. In this species, a putative barrier was located in the Man- One of the goals of modern conservation biology is not ampatrana River (= Iantara River), which divides northern only to preserve species and habitats, but also their evolu- and southern lemur populations, appearing to serve as an tionary potential in terms of maintaining the genetic diver- important boundary in this hybrid zone (Wyner et al. sity of the extant species. In this context, conservation or 2002). Unfortunately, these studies on lemurs do not use a management units should be clearly defined. There are homologous genetic marker, and a direct comparison of very different criteria for defining these units in practice the depth of the genetic divergences encountered in lemurs (e.g. Ryder 1986; US Fish and Wildlife Service & National and frogs is therefore not possible. However, although Marine Fisheries Service 1996), and some can be contro- there is little phylogeographic information concerning versial (e.g. Ryder 1986; Avise 1994; Moritz 1994; see Malagasy amphibians, and existing works concern species review of Fraser & Bernatchez 2001). We here follow the from other parts of Madagascar (i.e. Chiari et al. 2004, in rather flexible concept of adaptive evolutionary conserva- press; Vences et al. 2004), our data reinforce recent evi- tion (AEC) as proposed by Fraser & Bernatchez 2001). In dence that they might be diverged in response to similar this theoretical framework, an evolutionary significant unit barriers to gene flow as primates (Evans et al. 2003). (ESU) is a lineage demonstrating highly restricted gene As pointed out by Peres et al. (1996), the specific char- flow from other such lineages within the higher organiza- acters of the riverine barriers need to be taken into account tional level of the species, and the best available biological when studying their effect on gene flow. These authors information is used to exercise ESU definitions on a case- found gene flow among adjacent subspecies of saddleback by-case basis. In M. bernhardi, the lack of habitat connection tamarins across Rio Jurua in Amazonia, but restricted to between southern and northern populations as assessed the headwater section of the river. In eastern Madagascar, by Rabemananjara et al. (2005) (see also Fig. 2), and their

© 2006 Blackwell Publishing Ltd, Molecular Ecology, 10.1111/j.1365-294X.2006.02874.x PHYLOGEOGRAPHIC UNITS IN MANTELLA BERNHARDI 7 strong genetic differentiation suggests considering them range size in Amazonian primates. American Naturalist, 140, as ESUs under this concept. The comparatively low haplo- 531–537. type and nucleotide diversity found within populations Babik W, Branicki W, Sandera M et al. (2004) Mitochondrial phylogeography of the moor frog, Rana arvalis. Molecular Eco- of this species (Table 1) indicates that a rather limited logy, 13, 1469–1480. genetic diversity may add to the vulnerability of single Behra O (1993) The export of reptiles and amphibians from populations. Madagascar. TRAFFIC Bulletin, 13, 115–116. Amphibians seem to be less sensitive to reduction of Bermingham E, Moritz C (1998) Comparative phylogeography: habitat size than birds, small mammals or reptiles concept and applications. Molecular Ecology, 7, 367–369. (Goodman & Raherilalao 2003; Vallan 2003). The current Bossuyt F, Milinkovitch MC (2000) Convergent adaptive radi- isolation of M. bernhardi populations therefore probably ations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proceedings of the National does not represent an immediate threat, as long as some Academy of Sciences, USA, 97, 6585–6590. suitable habitat remains. Manombo and Ranomafana are Brandley MC, Schmitz A, Reeder TW (2005) Partitioned Bayesian protected as Special Reserve and National Park, respec- analyses, partition choice, and the phylogenetic relationships of tively, but Vevembé is not. We suspect that the phylogeo- scincid lizards. Systematic Biology, 54 (3), 373–390. graphic pattern observed in M. bernhardi is paralleled by Brown RM, Guttman S (2002) Phylogenetic systematics of the Rana other species. There are several other amphibian species signata complex of Philippine and Bornean stream frogs: recon- that have been found by us at Vevembé but not at the other sideration of Huxley’s modification of Wallace’s Line at the Oriental–Australian faunal zone interface. Biological Journal of sites, and at least one of them (an undescribed species close the Linnean Society, 76 (3), 393–461. to Boophis albilabris) may be a regional endemism. Hence, Bruford MW, Hanotte O, Brookfield JFY, Burke T (1992) Single- our data strongly suggest that this site merits inclusion in locus and multilocus DNA fingerprint. In: Molecular Genetic Madagascar’s network of protected areas. Analysis of Populations: A Practical Approach (ed. Hoelzel AR), pp. 225–270. IRL Press, Oxford. Burney DA, Robinson GS, Burney LP (2003) Sporormiella and the Acknowledgements late Holocene extinctions in Madagascar. Proceedings of the National Academy of Sciences, USA, 19, 10800–10805. We are indebted to J. E. Cadle, E. Rajeriason, E. Randriamitso Capparella A (1991) Neotropical avian diversity and riverine Andrianiaina, F. Glaw, D. R. Wake, C. Woodhead and Julie Barth barriers. Acta XX Congressus Internationalis Ornithologici, 307– for comments, informations or help during field and lab work. 316. D. R. Vieites was supported by a grant of the University of Vigo for Chiari Y, Vences M, Vieites DR et al. (2004) New evidence for research in foreign countries and by NSF AmphibiaTree Grant EF- parallel evolution of colour patterns in Malagasy poison frogs 0334939. Y. Chiari was supported by a grant of the Landesgradui- (Mantella). Molecular Ecology, 13, 3763–3774. ertenförderung Baden-Württemberg and an Ambassadorial Chiari Y, Andreone F, Vences M, Meyer A (in press) Genetic scholarship of the Rotary Foundation. Laboratory and fieldwork variation of an endangered Malagasy frog, Mantella cowani, and received support from grants of the Deutsche Forschungsge- its phylogeographic relationship to the widespread M. baroni. meinschaft to M. Vences and A. Meyer, and of the BIOPAT Foun- Conservation Genetics. dation and the Volkswagen Foundation to M. Vences. Clement M, Posada D, Crandall KA (2000) tcs: a computer program to estimate gene genealogies. Molecular Ecology, 9, References 1657–1659. Crandall K, Templeton AR (1993) Empirical tests of some predic- Achard F, Eva HD, Stibig H-J et al. (2002) Determination of tions from coalescent theory with applications to intraspecific deforestation rates of the world’s humid tropical forests. Science, phylogeny reconstruction. Genetics, 134, 959–969. 297, 999–1002. Crandall KA, Templeton AR, Sing CF (1994) Intraspecific clado- Alexandrino J, Froufe E, Arntzen JW, Ferrand N (2000) Genetic gram estimation: problems and solutions. In: Models in Phylogeny subdivision, glacial refugia and postglacial recolonization in the Reconstruction (eds Scotland RW, Siebert DJ, Williams DM), golden-striped salamander, Chioglossa lusitanica (Amphibia: pp. 273–297. Clarendon Press, Oxford. Urodela). Molecular Ecology, 9, 771–781. Eriksson J, Hohmann G, Boesch C, Vigilant L (2004) Rivers influ- Andreone F, Luiselli LM (2003) Conservation priorities and ence the population genetic structure of bonobos (Pan paniscus) potential threats influencing the hyper-diverse amphibians of Molecular Ecology, 13, 3425–3435. Madagascar. Italian Journal of Zoology, 70, 53–63. Evans BJ, Supriatna J, Andayani N et al. (2003) Monkeys and toads Andreone F, Cadle JE, Cox N et al. (2005) Global amphibian define areas of endemism on Sulawesi. Evolution, 57, 1436– assessment for Madagascar: species diversity, red listing, and 1443. identification of conservation hotspots. Conservation Biology, Fraser DJ, Bernatchez L (2001) Adaptive evolutionary conserva- 19, 1790–1802. tion: towards a unified concept for defining conservation units. Austin JD, Dávila JA, Lougheed SC, Boag PT (2000) Genetic evid- Molecular Ecology, 10, 2741–2752. ence for female-biased dispersal in the bullfrog, Rana catesbeiana García-París M, Good DA, Parra-Olea G, Wake DB (2000) Biodiver- (Ranidae). Molecular Ecology, 12, 3165–3172. sity of Costa Rican salamanders: implications of high levels Avise JC (1994) Molecular Markers, Natural History and Evolution. of genetic differentiation and phylogeographic structure for Chapman & Hall, New York. species formation. Proceedings of the National Academy of Sciences, Ayres JM, Clutton-Brock TH (1992) River boundaries and species USA, 97, 1640–1647.

Gascon C, Malcolm JR, Patton JL et al. (2000) Riverine barriers and variegata, from southeastern Madagascar. Animal Conservation, the geographic distribution of Amazonian species. Proceedings of 8, 105–111. the National Academy of Sciences, USA, 97, 13672–13677. Lugon-Moulin N, Brunner H, Balloux F, Hausser J, Goudet J (1999) Glaw F, Vences M (2003) Introduction to amphibians. In: The Do riverine barriers, history or introgression shape the genetic Natural History of Madagascar (eds Goodman SM, Benstead JP), structuring of a common shrew (Sorex araneus) population? pp. 883–898. University of Chicago Press, Chicago and London. Heredity, 83, 155–161. Goodman SM, Raherilalao MJ (2003) Effects of forest fragmenta- Moritz C (1994) Defining ‘evolutionary significant units’ for con- tion on bird communities. In: The Natural History of Madagascar servation. Trends in Ecology & Evolution, 9, 373–375. (eds Goodman SM, Benstead JP), pp. 1064–1066. University of Moritz C, Patton JL, Schneider CJ, Smith TB (2000) Diversification Chicago Press, Chicago and London. of rainforest faunas. Annual Review of Ecology and Systematics, 31, Green GM, Sussman R (1990) Deforestation history of the eastern 533–563. rainforests of Madagascar from satellite images. Science, 248, Myers N, Mittermeier RA, Mittermeier CG, de Fonseca GAB, 212–215. Kent J (2000) Biodiversity hotspots for conservation priorities. Hedges SB, Hass CA, Maxson LR (1992) Caribbean biogeography: Nature, 403, 853–858. molecular evidence for dispersal in West Indian terrestrial Nylander JAA (2004) mrmodeltest (version 2). Program dis- vertebrates. Proceedings of the National Academy of Sciences, USA, tributed by the author. Evolutionary Biology Centre, Uppsala 89, 1909–1913. University. Inger RF, Voris HK (2001) The biogeographical relations of the Palo JU, Lesbarrres D, Schmeller DS, Primmer CR, Merilä J (2004) frogs and snakes of Sundaland. Journal of Biogeography, 28, 863– Microsatellite marker data suggest sex-biased dispersal in the 891. common frog Rana temporaria. Molecular Ecology, 13, 2865– Irwin DE (2002) Phylogeographic breaks without geographic 2869. barriers to gene flow. Evolution, 56, 2383–2394. Pastorini J, Thalmann U, Martin RD (2003) A molecular approach James CH, Moritz C (2000) Intraspecific phylogeography in the to comparative phylogeography of extant Malagasy lemurs. sedge frog Litoria fallax (Hylidae) indicates pre-Pleistocence Proceedings of the National Academy of Sciences, USA, 100, 5879– vicariance of an open forest species from eastern Australia. 5884. Molecular Ecology, 9, 349–358. Pellegrino KCM, Rodrígues MT, Waite AN, Morando M, Joly P, Grolet O (1996) Colonization dynamics of new ponds, and Yassuda Y, Sites JW (2005) Phylogeography and species the age structure of colonizing Alpine newts, Triturus alpestris. limits in the Gymnodactylus darwinii complex (Gekkonidae, Acta Oecologica, 17, 599–608. Squamata): genetic structure coincides with river systems in the Kaiser H, Sharbel TF, Green DM (1994) Systematics and bio- Brazilian Atlantic Forest. Biological Journal of the Linnean Society, geography of eastern Caribbean Eleutherodactylus (Anura: Lep- 85, 13–26. todactylidae): evidence from allozymes. Amphibia-Reptilia, 15, Peres CA, Patton JL, da Silva MN (1996) Riverine barriers and gene 375–394. flow in Amazonian saddleback tamarins. Folia Primatologica, 67, Kraaijeveld-Smit FJL, Beebee TJC, Griffiths RA, Moore RD, 113–124. Schley L (2005) Low gene flow but high genetic diversity in the Posada D (1999) collapse (version 1.1). Department of Zoology, threatened Mallorcan midwife toad Alytes muletensis. Molecular Brigham Young University, Salt Lake City, UT. Ecology, 14, 3307–3315. Posada D, Crandall KA (1998) modeltest: testing the model of Kuchta SR, Tan AM (2005) Isolation by distance and post-glacial DNA substitution. Bioinformatics, 14, 817–818. range expansion in the rough-skinned newt, Taricha granulosa. Posada D, Crandall KA (2001) Intraspecific gene genealogies: trees Molecular Ecology, 14, 225–244. grafting into networks. Trends in Ecology & Evolution, 16, 37–45. Lampert KP, Rand AS, Mueller UG, Ryan MJ (2003) Fine scale Rabemananjara F, Bora P, Cadle JE et al. (2005) New records, genetic pattern and evidence for sex-biased dispersal in the potential distribution and conservation of Mantella bernhardi, tungara frog, Physalaemus pustulosus. Molecular Ecology, 12, and endangered frog species from south-eastern Madagascar. 3325–3334. Oryx, 39 (3), 335–338. Lees DC (1996) The Perinet effect? Diversity gradients in an adap- Raxworthy CJ, Nussbaum RA (2000) Extinction and extinction tive radiation of Madagascan butterflies (Satyrinae: Mycalesina) vulnerability of amphibians and reptiles in Madagascar. contrasted with other species-rich rainforest taxa. In: Actes du Amphibian and Reptile Conservation, 2, 15–23. Colloque International Biogéographie de Madagascar (ed. Lourenço Ronquist F, Huelsenbeck JP (2003) mrbayes3: Bayesian phylo- WR), pp. 479–490. Mémoires de la Société de Biogeographie, genetic inference under mixed models. Bioinformatics, 19, 1572– Paris. 1574. Lees DC, Kremen C, Andramampiana L (1999) A null model for Rozas J, Sánchez-DeI, Barrio JC, Messeguer X, Rozas R (2003) species richness gradients: bounded range overlap of butterflies dnasp, DNA polymorphism analyses by the coalescent and and other rainforest endemics in Madagascar. Biological Journal other methods. Bioinformatics, 19, 2496–2497. of the Linnean Society, 67, 529–584. Ryder OA (1986) Species conservation and systematics: the Lougheed SC, Gascon C, Jones DA, Bogart JP, Boag PT (1999) dilemma of subspecies. Trends in Ecology & Evolution, 1, 9–10. Ridges and rivers: a test of competing hypotheses of Amazonian Steinfartz S, Veith M, Tautz D (2000) Mitochondrial sequence diversification using a dart-poison frog (Epipedobates femoralis) analysis of Salamandra taxa suggests old splits of major lineages Proceedings of the Royal Society of London. Series B, Biological Sci- and postglacial recolonizations of Central Europe from distinct ences, 266, 1829–1835. source populations of Salamandra salamandra. Molecular Ecology, Louis EE Jr, Ratsimbazafy JH, Razakamaharauo VR et al. (2005) 9, 397–410. Conservation genetics of black and white ruffed lemurs, Varecia Sterling E, Ramarason MG (1996) Rapid assessment of the primate

fauna of the eastern slopes of the Réserve Naturelle Intégrale (2005) Comparative performance of the 16S rRNA gene in DNA d’Andringitra, Madagascar. In: Floral and Faunal Inventory of the barcoding of amphibians. Frontiers in Zoology, 2, article 5. Eastern Slopes of the Réserve Naturelle Intégrale d’Andringitra, Wake DB, Jockusch EL (2000) Detecting species borders using Madagascar: with Reference to Elevational Variation (ed. Goodman diverse data sets. In: The Biology of Plethodontid Salamanders (eds SM). Fieldiana Zoology, 85, 293–305. Bruce RC, Jaeger RG, Houck LD), pp. 95–119. Kluwer Academic/ Stuart SN, Chanson JS, Cox NA et al. (2004) Status and trends of Plenum Publishers, New York. amphibian declines and extinctions worldwide. Science, 306, Wallace AR (1852) On the monkeys of the Amazon. Proceedings of 1783–1786. the Zoological Society of London, 20, 107–110. Swofford DL (2002) PAUP*. Phylogenetic analysis using parsimony (*and Wyner YM, Johnson SE, Stumpf RM, de Salle R (2002) Genetic other methods). Version 4.0. Sinauer, Sunderland, Massachusetts. assessment of a white-collared x red-fronted lemur hybrid zone at Templeton AR, Sing CF (1993) A cladistic analysis of pheno- Andringitra, Madagascar. American Journal of Primatology, 67, 51–66. typic associations with haplotypes inferred from restriction endonuclease mapping. IV. Nested analyses with cladogram uncertainty and recombination. Genetics, 134, 659–669. David R. Vieites is a postdoctoral researcher at the University of Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis California, Berkeley, with a special interest in phylogeo- of phenotypic associations with haplotypes inferred from graphical patterns and conservation of amphibians and reptiles of restriction endonuclease mapping and DNA sequence data. III. Madagascar. This study is part of Ylenia Chiari’s PhD research. Cladogram estimation. Genetics, 132, 619–633. Her research interests focus on the conservation genetics and US Fish and Wildlife Service and National Marine Fisheries phylogeography of endangered Malagasy herpetofauna. The Service (1996) Policy regarding the recognition of distinct research was carried out in the laboratory of Axel Meyer at vertebrate population segments under the Endangered Species the University of Konstanz, Germany. Miguel Vences, previously Act. Federal Register, 61, 4721–4725. at the University of Amsterdam and currently professor for Vallan D (2003) Consequences of rain forest fragmentation for evolutionary biology at the Technical University of Braunschweig, herpetofauna: a case study from Ambohitantely. In: The Natural is a specialist of the biogeography and evolution of the vertebrates History of Madagascar (eds Goodman SM, Benstead JP), pp. 899– of Madagascar, especially amphibians and reptiles, and his research 907. University of Chicago Press, Chicago and London. interests currently focus on understanding the speciation Vences M, Glaw F, Böhme W (1999) A review of the genus Mantella mechanisms that generated Madagascar’s extraordinary biodiversity. (Anura, Ranidae, Mantellinae): taxonomy, distribution and con- Franco Andreone is curator at the Natural History Museum in servation of Malagasy poison frogs. Alytes, 17 (1–2), 3–72. Turin, and is conducting conservation and taxonomic studies on Vences M, Vieites DR, Glaw F et al. (2003) Multiple overseas dis- the Malagasy herpetofauna, being currently chair of the Declining persal in amphibians. Proceedings of the Royal Society of London. Amphibian Population Task Force (DAPTF/IUCN) for Madagascar. Series B, Biological Sciences, 270, 2435–2442. Falitiana Rabemananjara and Parfait Bora are carrying out their Vences M, Chiari Y, Raharivololoniaina L, Meyer A (2004) High PhD and MSc theses, respectively, on the biology of Malagasy mitochondrial diversity within and among populations of poison frogs at the Zoology Department of the University of Malagasy poison frogs. Molecular Phylogenetics and Evolution, 30, Antananarivo. Sandra Nieto-Roman is a PhD student interested in 295–307. biogeography and conservation of amphibians. Vences M, Thomas M, van der Meijden A, Chiari Y, Vieites DR

Short Communication New records, distribution and conservation of Mantella bernhardi, an Endangered frog species from south-eastern Madagascar

Falitiana Rabemananjara, Parfait Bora, John E. Cadle, Franco Andreone, Emile Rajeriarison, Pierre Talata, Frank Glaw, Miguel Vences and David R. Vieites

Abstract We report on seven new localities for Mantella Reserve). An overlap analysis of the potential distribu- bernhardi, a Malagasy poison frog that was previously tion area of the species, based on the extent of remaining known only from a single site. This species has been primary vegetation, indicates that the habitat of M. considered threatened with extinction because of ongo- bernhardi in south-eastern Madagascar is fragmented and ing habitat destruction and collection for the pet trade populations may be relatively small and isolated. We (up to c. 3,000 specimens per year). The new localities support the IUCN Red List category of Endangered for considerably extend the known range of this species, this species and highlight the need for detailed studies of which has now been documented from c. 21.00d to its populations. 24.15dS and 47.00d to 48.00dE, and over 60–629 m altitude. Two of the sites are within protected areas Keywords Amphibia, distribution, Madagascar, (Ranomafana National Park and Manombo Special Mantella bernhardi, Mantellidae, status.

Among the endemic amphibian fauna of Madagascar, (Raxworthy & Nussbaum, 2000). The original description the Malagasy poison frogs of the genus Mantella are (Vences et al., 1994) lacked precise locality data because outstanding for their bright, often aposematic coloration, the specimens upon which the description was based diurnal activity and toxicity (Vences et al., 1999). These were obtained from commercial collectors. frogs, belonging to the endemic Malagasy-Comorian M. bernhardi has been categorized as ‘extremely family Mantellidae, are highly prized in the pet trade vulnerable to extinction’ because the single previously (Behra, 1993; Andreone & Luiselli, 2003). One of the known locality is not in a protected area and is under most recently described species of the genus, Mantella strong pressure from small-scale logging and slash and bernhardi, was known only from a single locality burn agriculture (Raxworthy & Nussbaum, 2000). Here we report the results of recent intensive survey work in south-eastern Madagascar that yielded several new Falitiana Rabemananjara and Parfait Bora Université d’Antananarivo, localities for this species, and summarize the known Département de Biologie Animale, Antananarivo, Madagascar. data on its commercial exploitation and threats. John E. Cadle Department of Herpetology, Chicago Zoological Society, 3300 Voucher specimens were deposited in the collections Golf Road, Brookfield, IL 60513, USA. of the Département de Biologie Animale, Université

Franco Andreone Museo Regionale di Scienze Naturali, Sezione di Zoologia, d’Antananarivo (UADBA), the Field Museum of Natural Via G. Giolitti, 36, 10123 Torino, Italy. History, Chicago (FMNH), the Museo Regionale di

Emile Rajeriarison and Pierre Talata Parc National de Ranomafana, Scienze Naturali, Torino (MRSN), the Museum of BP 2, 312 Ranomafana, Madagascar. Comparative Zoology (Harvard), Cambridge (MCZ),

Frank Glaw Zoologische Staatssammlung, Münchhausenstr. Zoologisches Forschungsinstitut und Museum A. 21, 81247 München, Germany. Koenig, Bonn (ZFMK), and the Zoological Museum, University of Amsterdam (ZMA). Collections were Miguel Vences (Corresponding author) Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, University of Amsterdam, limited to the minimum number of specimens required Mauritskade 61, 1092 AD Amsterdam, The Netherlands. for the integrity of this research (1–5 per site). The exist- E-mail [email protected] ence of such voucher specimens is vital because of the David R. Vieites Museum of Vertebrate Zoology, 3101 Valley Life Sciences taxonomic uncertainty of many Mantella field records Bldg., University of California, Berkeley, CA 94720-3160, USA. (Vences et al., 1999). Received 6 April 2004. Revision requested 25 August 2004. The holotype of M. bernhardi (ZFMK 57164) was part of Accepted 9 November 2004. a larger series of specimens that A. Peyrieras obtained

alive from local collectors in 1994. According to the infor- was found at 629 m altitude, in a degraded area close to a mation available at the time, the specimens originated swamp that had largely been transformed into a ricefield from a site near Tolongoina in south-eastern Madagas- (21.6dS, 47.5dE). The vegetation at this site was made up car. Raxworthy & Nussbaum (2000) reported that the by longoze Rubis mollucanus and Cledemia hirta. The area species had been discovered by R.A. Nussbaum in a is flat, and probably permanently wet. single patch of relict forest near Tolongoina, located at Five other localities are located south of the 21d28.557pS, 47d33.759pE (C. J. Raxworthy, pers. comm., Ranomafana National Park. These populations are all in 2003). small isolated patches of forest at: (1) 23.7dS, 47.5dE, 90 m; The same area, presumably the same spot, was (2–3) 22.8dS, 47.0dE, 550 m; (4) 22.8dS, 47.2dE, 550 m; (5) visited by F. Andreone on 18–21 July 1995 and by P. Bora 23.0dS, 47.7dE, 60 m. The last site is within Manombo on 22–24 August 2003. This small rainforest parcel Special Reserve, although it was previously reported (21d28p42.5qS, 47d33p37.4qE, 577 m altitude) is located next that the species does not occur there (Raxworthy & to Ambohimanana village, Tolongoina Fivondronana, Nussbaum, 2000). At all of these five localities M. Fianarantsoa Province. According to information from bernhardi was found in primary lowland rainforest or local guides this site was the same locality in which the swamp forest on the floodplain of streams. They were collectors of A. Peyrieras had been working. generally associated with areas having much leaf litter on The forest near Ambohimanana was clearly suffering the ground. At locality (4) the forest was a small fragment repeated slash and burn clearance in 1995. Also, traces of and M. bernhardi was found in more open situations and intensive amphibian and reptile collecting activity were not as abundantly as in the other localities. recognizable: the ground was disturbed and many Considering all these records, the species is known d d d d Pandanus screw palms were cut. Local people from a from c. 21.00 to 24.15 S and 47.00 to 48.00 E, and at small settlement next to the site reported that slash and altitudes of 60–629 m. We drew a minimum convex burn agriculture (tavy) had increased considerably in polygon around the available records to obtain an esti- recent years, although until a few years earlier (c. 1992) mate of the area in which M. bernhardi occurs with high probability, using the Animal Movement Analysis Exten- the forest had still been intact and not yet converted to sion for ArcView (Hooge et al., 1999). In this area we iden- rice fields. In 1995 a single specimen of M. bernhardi was tified within a 15p square grid map of Madagascar those found by searching under dead trunks (MRSN A1964, grid squares that overlapped with the area of potential leg. F. Andreone, 20 July 1995). This apparent low density occurrence, by overlap analysis using ArcView 2.0 (ESRI, is explained by the fact that the search was done during Redlands, USA) and using precise coordinates of all the cold dry season, when these frogs are inactive. records, hypsometry (NASA-US Geological Survey, New localities of M. bernhardi were identified during 2005), geology and natural vegetation (Royal Botanic the survey work conducted by ourselves and the staff of Gardens, Kew (2005), and bioclimatology (Missouri the Association Nationale pour la Gestion des Aires Botanical Garden, 2004). The results of this analysis Protégées (ANGAP) of Ranomafana National Park. To (Fig. 1) indicate a relatively fragmented distribution. avoid looting of these new sites by commercial collectors, Within the potential distribution area of M. bernhardi we here give coordinates only with a precision of 0.1d. several grid squares appear not to be covered by suitable The first site is located within the Park boundaries at habitat. M. bernhardi populations appear to be localized d d 21.4 S, 47.5 E and 605 m elevation. Several individuals and often occupy small, isolated and degraded patches of were found in a forest with semi-open canopy next to a forest that are likely to be destroyed by slash and burn 2 river within an area of c. 50 m . This site had previously agriculture in the near future. Such fragmentation is been cleared to form a research expedition campsite, but known to negatively affect many species of Malagasy had been recolonized by native plants common to the amphibians (Vallan, 2000). The high rates of deforesta- eastern forests of Madagascar, such as small bamboos tion (Achard et al., 2002) suggest that the remaining Nastus sp., the longoze Aframomum angustifolium, and a suitable habitat may be even more reduced than the large tree Croton mongue. The surface was flat, allowing potential range estimated here. the formation of a small puddle of stagnant water. M. bernhardi was originally described based on Among other amphibians and reptiles found sympatri- specimens destined for the pet trade, and it has been cally with M. bernhardi at this site was a second species repeatedly exported in small to moderate numbers. Since of Malagasy poison frog Mantella baroni. Voucher speci- 2000 this and all other species of Mantella have been mens were deposited under the catalogue numbers on Appendix II of CITES, and more precise numbers UADBA 20747-20752 and ZMA 19799-19780 (M. of legally exported specimens are therefore available. bernhardi) and UADBA 20753-20754 and ZMA 19803- According to reports of the Malagasy CITES authorities, 19804 (M. baroni). In the same area, just outside the in 2000 a total of 390 specimens of M. bernhardi were boundaries of the Park, a second locality with the species exported to the USA and Canada, and in 2001 a total of

bernhardi. Lower altitude areas within Ranomafana National Park and forested areas within Manombo Special Reserve should be priorities in regional conservation efforts. In addition, other forest blocks at low- to mid-elevations in south-eastern Madagascar, such as Vevembe forest near Vondrozo, should be considered for inclusion in Madagascar’s network of protected areas.

Acknowledgements

The survey work that was the basis of this paper benefited from the help and assistance of many friends and colleagues, in particular G. Aprea, M. Puente, L. Raharivololoniaina and M. Thomas. C. Raxworthy provided information on the geographical coordinates of the presumed type locality. E. Edwards supplied information on the trade in Malagasy amphibians. FA wishes to thanks Emilien ‘Fidi’ Rafidison, who accompanied him to Ambohimanana in 1995, and E. Rakotomavo and H. Randriamahazo for the useful exchange of information. For funding he thanks the National Amphibian Conservation Center, the Wildlife Conservation Society, the Madagascar Fauna Group, J.E. Behler and A. Katz. Financial assistance to MV and FG was provided by the Volkswagen Foundation, to MV by BIOPAT, and to FR and MV by the Netherlands Organization for Scientific Research (WOTRO/NWO). Fieldwork of JEC in Madagascar has been supported over the years by the Douroucouli Foundation, the Chicago Zoological Society Fig. 1 Grid map with known distribution records of M. bernhardi. (SEACON and Chicago Board of Trade funds), and the Grid squares with ascertained distribution are black (an ‘X’ Milton Fund of Harvard University; considerable logistic marking the presumed type locality), squares including areas of potential distribution are grey. The dotted line is the minimum support has been provided by the Madagascar Institut convex polygon around known localities. The rectangle on the pour la Conservation des Environnements Tropicaux. inset indicates the location of the main map in Madagascar. DRV was supported by a grant from the University of Vigo for research in foreign institutions. We are grateful to the ANGAP team of Ranomafana National Park for 955 to the USA and 50 to Japan. Rakotomavo (2000) continuous support, and to the Malagasy authorities for gave numbers for earliers years, viz: 1995, 290 specimens; research and collection permits. 1996, 10 specimens; 1997, 400 specimens; 1998, 2,709 specimens. Based on our data we support the Red List category References of Endangered for M. bernhardi based on criteria Achard, F., Eva, H.D., Stibig, H.J., Mayaux, P., Gallego, J., B2ab(iii,v) (IUCN, 2004) mainly because of its small area Richards, T. & Malingeau, J.P. (2002) Determination of of occupancy, which is probably <500 km2, its severely deforestation rates of the world’s humid tropical forests. fragmented distribution, and the decline of its forest Science, 297, 999–1002. habitat in east-central Madagascar, in agreement with the Andreone, F., Cadle, J.E., Cox, N., Glaw, F., Nussbaum, R.A., Raxworthy, C.J., Stuart, S.N., Vallan, D. & Vences, M. opinion of the Global Amphibian Assessment (Andreone (in press) A species review of amphibian extinction risks in et al., in press). Future research should focus on under- Madagascar: results from the Global Amphibian Assessment. standing densities, habitat requirements, and extent Conservation Biology. of genetic differentiation of and among populations of Andreone, F. & Luiselli, L.M. (2003) Conservation priorities this species. Our data highlight the importance of low- and potential threats influencing the hyper-diverse amphibians of Madagascar. Italian Journal of Zoology, 70, altitude rainforests in south-eastern Madagascar, which 53–63. may harbour a larger species diversity than is currently Behra, O. (1993) The export of reptiles and amphibians from known, including regional endemics such as Mantella Madagascar. Traffic Bulletin, 13, 115–116.

Hooge, P.N., Eichenlaub W. & Solomon, E. (1999) The Animal Vences, M., Glaw, F. & Böhme, W. (1999) A review of the genus Movement Program. USGS, Alaska Biological Science Center, Mantella (Anura, Ranidae, Mantellinae): taxonomy, Gustavus, USA. distribution and conservation of Malagasy poison frogs. IUCN (2004) IUCN Red List of Threatened Species. IUCN, Gland, Alytes, 17, 3–72. Switzerland [http://www.redlist.org, accessed 3 March Vences, M., Glaw, F., Peyrieras, A., Böhme, W. & Busse, K. (1994) Der Mantella madagascariensis-Komplex: 2005]. Wiederentdeckung von Mantella cowani und Beschreibung Missouri Botanical Garden (2004) Http://www.mobot.org von Mantella bernhardi n. sp. Die Aquarien-und Terrarien- [accessed 3 March 2005]. Zeitschrift, 47, 390–393. NASA-US Geological Survey (2005) Land Processes Distributed Active Archive Center. Http://www.edcdaac.usgs.gov [accessed 3 March 2005]. Rakotomavo, E. (2000) Etude de la filière Mantella de Madagascar. Biographical sketches Report for the Ministère des Eaux et Forets, Service Valorisation Economique and the Office National pour F. Rabemananjara and P. Bora are students of the University l’Environnement, Cellule Biodiversité, Antananarivo, of Antananarivo, studying the biology of Malagasy poison Madagascar. frogs. E. Rajeriarison and P. Talata are scientific guides Raxworthy, C.J. & Nussbaum, R.A. (2000) Extinction and at Ranomafana National Park and have carried out exten- extinction vulnerability of amphibians and reptiles in sive zoological surveys in south-eastern Madagascar. F. Madagascar. Amphibian and Reptile Conservation, 2, 15–23. Andreone, J.E. Cadle, F. Glaw and M. Vences have been Royal Botanic Gardens, Kew (2005) involved for over 10 years in intensive work on the Http://www.rbgkew.org.uk [accessed 3 March 2005]. systematics, ecology and evolution of the herpetofauna of Vallan, D. (2000) Influence of forest fragmentation on Madagascar. D.R. Vieites specializes in biogeographical amphibian diversity in the nature reserve of Ambohitantely, analyses. highland Madagascar. Biological Conservation, 96, 31–43.

© 2005 FFI, Oryx, 39(3), 339–342 African Biodiversity: Molecules, Organisms, Ecosystems. Proc. 5th Intern. Symp. Trop. Biol., Museum Koenig, Bonn (BA Huber, BJ Sinclair, K-H Lampe, eds). Springer Verlag. 2005.

DISTRIBUTION AND POPULATION DENSITY OF THE BLACK-EARED MALAGASY POISON FROG, MANTELLA MILOTYMPANUM STANISZEWSKI, 1996 (AMPHIBIA: MANTELLIDAE)

David R. Vieites1*, Falitiana E. C. Rabemananjara2, Parfait Bora2, Bertrand Razafimahatratra2, Olga Ramilijaona Ravoahangimalala2, Miguel Vences1 1 Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, University of Amsterdam, Mauritskade 61, 1092 AD Amsterdam, The Netherlands E-mail: [email protected]; [email protected] 2 Université d'Antananarivo, Département de Biologie Animale, Antananarivo, Madagascar * Present address: Museum of Vertebrate Zoology and Department of Integrative Biology, 3101 Valley Life Sciences Building, University of California, Berkeley, CA 94720-3160, USA

Abstract: We provide first data on the natural history of a poorly known species of frog from Madagascar, the black-eared Malagasy poison frog, Mantella milotympanum. Although this species has been intensively collected for the pet trade, not even one precise locality was published until 2003. We here provide further distribution records north and south of the known locality Fierenana, but the encountered populations showed variable colour and patterns intermediate between M. milotympanum and M. crocea, thus supporting the hypothesis that these are conspecific colour morphs, and that M. milotympanum might be a junior synonym of M. crocea. Intensive fieldwork at one site next to Fierenana, in February 2003, yielded some data on population structure and density. Snout-vent lengths ranged from 16-24 mm, weights from 0.4-1.4 g in adults, with only few subadults and no juveniles found. The population density, estimated by mark-recapture, was about 470 individuals per ha, which is a quite high density, taking into consideration that this population had probably been under commercial exploitation in the past. We propose that some of the forests in the Fierenana area should be included in the planned extension of Madagascar's network of protected 198 David R. Vieites et al.

areas, but a controlled and sustainable exploitation should be allowed in these reserves in order to gain the support of local communities.

Key words: Amphibia; Anura; Mantella milotympanum; Distribution; Conservation; Pet trade; Madagascar

1. INTRODUCTION

The genus Mantella Boulenger, 1882 consists of about 15 species endemic to Madagascar (Vences et al., 1999), named Malagasy poison frogs. All of them are small, colourful and usually diurnal frogs, some resembling the neotropical frogs of the family Dendrobatidae, which also exhibit the presence of alkaloid skin toxins (Daly et al., 1996). Together with the tomato frogs (genus Dyscophus Grandidier, 1872), Malagasy poison frogs are the amphibian species of Madagascar most requested by the international pet trade, mainly due to their attractive colourations (Behra, 1993; Andreone and Luiselli, 2003). Although all Mantella are now included on the Appendix II of the Convention on the International Trade in Endangered Species (CITES), and the numbers exported from Madagascar amount to several thousand individuals per year, almost nothing is known about natural history and distribution and ecology of most species. The black-eared Malagasy poison frog (Mantella milotympanum Staniszewski, 1996) was described by a pet breeder and its status as a separate species is uncertain (see Vences et al., 1999). Although it almost has a uniformly orange-red colour, quite similar to that of the golden Mantella, M. aurantiaca Mocquard, 1900, it appears to be much more closely related to another species, M. crocea Pintak & Böhme, 1990, as evidenced by molecular data (Vences et al., 2004). Because the taxonomy of Mantella species was largely unclarified before the revision of Vences et al. (1999), no reliable trade statistics are available for M. milotympanum which likely was confounded in the exportation lists with M. aurantiaca. From our own observations it is clear that this species is regularly collected by the local pet trade network and exported. The Global Amphibian Assessment (GAA) workshop in Gland, Switzerland, held in September 2003, classified M. milotympanum as Critically Endangered and emphasized the need of further studies on its distribution and natural history (Andreone et al., in press). In this paper we provide new data on the natural distribution of M. milotympanum, in addition to the single locality given in Vences et al. (2004), and report some information on population structure and density of one formerly exploited population. Malagasy Poison Frog Distribution and Population Density 199

2. METHODS

Field expeditions were directed in 2003 to the Fierenana region to locate Mantella populations. In order to find the populations of these patchily distributed frogs, in addition to the one mentioned by Vences et al. (2004), part of the team explored the area south of Fierenana, whereas the area north of Fierenana was separately accessed. The population at a site locally known as Sahamarolambo, close to the village of Fierenana, had been visited in January 2002 by M.Vences; at this site, a campsite was established and more intensive fieldwork carried out from 17-22 February 2003. According to local collectors, this population had been intensively exploited in the past but not any more in the last three years. A parcel of ca. 0.6 ha was then defined in the forest. This parcel bordered on (a) a drift fence line, (b) altered habitat consisting mainly of sun-exposed savanna, (c) a footpath (ca. 2-3 m wide) and our campsite. Although especially the footpath, but also the other limits, certainly are no absolute barriers to Mantella dispersal, we believe that their movements across these structures were very limited during the short period in between our sampling and that this population can therefore be considered as a “closed population” for the purpose of mark-recapture analysis. During one week, five to seven people systematically carried out mark-recapture experiments. Frogs were marked by toe-clipping of one finger and immediately released after treating wounds with antiseptic. Recaptured animals did not show any infection caused by the marking procedure. At each sampling date, the number of marked individuals was recorded and all unmarked individuals in the follow-up sample were marked and released. We used these data to calculate a weighted mean population estimate (Seber, 1973), and its standard error (Begon, 1979).

Table 1. Known localities of Mantella milotympanum and colour morphs intermediate between M. milotympanum and M. crocea

Locality Colour of specimens GPS coordinates Altitude (m) Sahamarolambo next Typical for M.milotympanum; 18°32'36''S 948 to Fierenana orange-red with black spots on 48°26'56''E tympanum and nostril North of Fierenana Greenish, M.crocea-like 18°16'10''S 1060 48°29'03''E Savakoanina Pattern like in typical 18°36'44''S 959 M.milotympanum, but greenish- 48°24'30''E yellow colour Andriabe Some specimens like typical 18°36'46''S 1047 M.milotympanum; others with 48°19'34''E M.crocea-like pattern but red colour 200 David R. Vieites et al.

From all collected individuals we measured snout-vent length (SVL) to the nearest mm using a dial calliper, and weighted them to the nearest 0.01 g using a digital balance. Allometric growth was tested by a regression analysis of SVL (X) and weight (Y), using the formula Y= b Xa , where b is a constant and a is the allometry coefficient (Huxley, 1972). A reliable distinction between sexes was not possible in the field, as in many Malagasy poison frogs, especially outside the breeding season.

3. RESULTS

3.1 Distribution and habitat

The first known populations of Mantella milotympanum had been located in the Fierenana region, between Moramanga and Ambatondrazaka, Central- Eastern Madagascar. We discovered three additional Mantella populations in the area between 18º16'S and 18º36'S, and 48º19'E and 48º29'E (Table 1). All were in humid tropical areas between 900 and 1100 m a.s.l., in swamp Pandanus forests. Whereas the population of Andriabe contained specimens with the typical colour and pattern of M. milotympanum, and others of M. crocea-like pattern but an orange-red colour, the populations north of Fierenana and at Savakoanina consisted of yellow-green and green coloured specimens.

Figure 1. Snout to vent length (mm) distribution of 99 Mantella milotympanum specimens captured in February 2003 in Fierenana population. No recaptures were considered. Malagasy Poison Frog Distribution and Population Density 201

Specimens were distributed in the forest, being locally more abundant in accumulations of leaf litter under Pandanus screw palms and places with dense litter cover close to the swamps. No nocturnal activity was observed.

3.2 Natural history

Calling males were abundant in Sahamarolambo and many other places between Sahamarolambo and Fierenana in January 2002, but not in February 2003, indicating a possible strong seasonality of the reproductive season in this species. Distribution of size classes (Fig. 1) shows that the studied sample consisted mainly on adults. Only three animals of less than 15 mm were found which we here consider as probable subadults. No juveniles were located in the study area despite intensive searches in potential suitable areas like swamps and their immediate surroundings. Adult mean SVL (± standard deviation, minimum and maximum in parentheses) was 19.3 ± 2.2 mm (16.3- 24.3mm, n = 99). Adult mean weight was 0.7 ± 0.2g (0.4-1.4g, n = 99). No external character allowed us to distinguish between males and females in the field. Positive allometric growth was observed between SVL and weight (y=0.0005X2.4501, r2= 0.82, P< 0.001, Fig. 2).

Figure 2. Scatterplot of the relation between body weight (g) and snout-vent length (mm) in the animals captured.

202 David R. Vieites et al.

Table 2. Estimate of population size of adult Mantella milotympanum in the Sahamarolambo population. (1) Simple Petersen estimate (Petersen, 1896); (2) weighted mean estimate (Seber, 1973), ± standard error (see Begon, 1979) based on the data of the last two sampling days

18 Feb. 19 Feb. 20 Feb. 21 Feb. 22 Feb. Marked in population (a) 0 43 91 105 119 Captured (b) 43 48 19 28 30 Marked in captured sample (c) 0 3 5 14 8 (1) Population a (b+1)/(c+1) -- 527 303 203 410 (2) Population a (b+1)/ (c+1) 283±62

3.3 Population estimate

Using the weighted mean estimate (Seber, 1973), the number of frogs in the study parcel was 283±62 (Table 2), with a confidence interval of 222-345 individuals. In relation to the sampled area (0.6ha) this estimate gives a rough density of about 470 specimens per ha.

4. DISCUSSION

Our data support the hypothesis that “typical” M. milotympanum occur only next to Fierenana, and the variable and intermediate populations identified corroborate the close relationships, and possible conspecificity, of M. milotympanum and M. crocea. Populations of the Mantella milotympanum /M. crocea complex inhabit a wider area than previously known, including populations north of Fierenana. Surveys in the Zahamena Reserve, further north, revealed that populations of this complex also are present in that area (F. Rabemananjara, per. obs.), although their specific identity still needs to be verified. However, the colour morph typical for M. milotympanum appears to be more restricted to the Fierenana area itself. Our preliminary data suggests that the typical habitat of all these populations is constituted by forested edges of large inland swamps at mid-altitudes (900- 1100 m a.s.l.), or by swamps inside primary or degraded rainforest areas. According to our observations, the reproduction of M. milotympanum takes place at the beginning of the rainy season (December - January), and after that, the adults spend some weeks active, probably gaining fat reserves for aestivation. After this, their activity is probably less intensive. This coincides with data from exporters who confirmed that it is not possible to obtain this species from local collectors during a long period in the dry season. Malagasy Poison Frog Distribution and Population Density 203

The Sahamarolambo population of M. milotympanum has been exploited for several years, but not during the three previous years prior to our fieldwork. Our estimate of the adult population during this period gave a relatively high number of specimens per hectare. We consider the information on regular past collecting as relatively reliable since it was confirmed by various professional collectors and locals. Almost certainly these frogs are characterized by a high yearly reproductive output and rate of recruitment, although no precise data are available so far. We therefore speculate that even heavy collecting does not necessarily lead to serious threats for Mantella milotympanum, although more data on the population dynamics of this and other species are needed for definitive statements. The original habitat around Fierenana is being destroyed at very high rates by small-scale slash- and burn-agriculture, and this truly constitutes a high threat to Mantella populations. Although the black-eared poison frog may not constitute a species distinct from M. crocea (Vences et al., 2004), its distinct colour convergence with M. aurantiaca provides a very interesting model for studies on the evolution of aposematism, emphasizing the interest in conserving this locally restricted form. Considering recent efforts of increasing the network of Madagascar's protected areas, the area around Fierenana certainly qualifies for an improved level of protection of natural habitat. However, the fact that populations of M. milotympanum apparently are able to withstand strong collection activities and to survive in slightly degraded habitat (as M. aurantiaca; see Vences et al., 2004) indicates that a certain degree of controlled exploitation of natural resources in this area could be sustainable and not in contradiction with the proposed conservation efforts.

ACKNOWLEDGEMENTS

We are grateful to Marta Puente, Meike Thomas, and Wouter zum Vörde Sieve Vörding for their help in the field. Euan Edwards provided invaluable logistic assistance and companionship. The work in Madagascar was made possible by a cooperation accord of the Institute for Biodiversity and Eco- system Dynamics, University of Amsterdam, Netherlands, the Département de Biologie Animale, Université d'Antananarivo, and the Association Nationale pour la Gestion des Aires Protegées, Madagascar. We acknowledge financial support by grants of the University of Vigo to DRV, and of the Volkswagen Foundation. We are especially grateful to the BIOPAT foundation that supported the expeditions to Fierenana.

204 David R. Vieites et al.

REFERENCES

Andreone, F., Cadle, J. E., Cox, N., Glaw, F., Nussbaum, R. A., Raxworthy, C. J., Stuart, S. N., Vallan, D., and Vences, M., in press, A complete species review of amphibian extinction risks in Madagascar: results from the Global Amphibian Assessment, Conserv. Biol. Andreone, F., and Luiselli, L. M., 2003, Conservation priorities and potential threats influencing the hyper-diverse amphibians of Madagascar, Ital. J. Zool. 70:53-63. Begon, M., 1979, Investigating Animal Abundance. Capture-recapture for Biologists, Arnold, London. Behra, O., 1993, The export of reptiles and amphibians from Madagascar, Traffic Bull. 13(3):115-116. Daly, J. W., Andriamaharavo, N.R., Andriantsiferana, M., and Myers, C.W., 1996, Madagascan Poison Frogs (Mantella) and Their Skin Alkaloids, Am. Mus. Novit. 3177:1- 34. Huxley, J. S., 1972, Problems of Relative Growth, Dover, New York. Petersen, C.G.J., 1896, The yearly immigration of young plaice into Limfjord from the German sea, Report of the Danish Biological Station 6. Copenhagen, Denmark. Seber, G.A.F., 1973, The Estimation of Animal Abundance, Griffin, London. Vences, M., Glaw, F., and Böhme, W., 1999, A review of the genus Mantella (Anura, Ranidae, Mantellinae): taxonomy, distribution and conservation of Malagasy poison frogs, Alytes 17(1-2):3-72. Vences, M., Chiari, Y., Raharivololoniaina, L., and Meyer, A., 2004. High mitochondrial diversity within and among populations of Malgasy poison frogs, Mol. Phylogenet. Evol. 30:295-307.

Molecular Ecology (2004) 13, 3763–3774 doi: 10.1111/j.1365-294X.2004.02367.x

BlackwellNew Publishing, Ltd. evidence for parallel evolution of colour patterns in Malagasy poison frogs (Mantella)

Y. CHIARI,* M. VENCES,† D. R. VIEITES,†§ F. RABEMANANJARA,‡ P. BORA,‡ O. RAMILIJAONA RAVOAHANGIMALALA‡ and A. MEYER* *Department of Biology (Evolutionary Biology), University of Konstanz, D−78457 Konstanz, Germany; †Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, University of Amsterdam, PO Box 94766, NL−1090 GT Amsterdam, the Netherlands; ‡Département de Biologie Animale, Université d’Antananarivo, Antananarivo 101, Madagascar

Abstract Malagasy poison frogs of the genus Mantella are diurnal and toxic amphibians of highly variable and largely aposematic coloration. Previous studies provided evidence for several instances of homoplastic colour evolution in this genus but were unable to sufficiently resolve relationships among major species groups or to clarify the phylogenetic position of several crucial taxa. Here, we provide cytochrome b data for 143 individuals of three species in the Mantella madagascariensis group, including four newly discovered populations. Three of these new populations are characterized by highly variable coloration and patterns but showed no conspicuous increase of haplotype diversity which would be expected under a scenario of secondary hybridization or admixture of chromatically uniform populations. Several populations of these variable forms and of M. crocea were geographically interspersed between the distribution areas of Mantella aurantiaca and Mantella milotympanum. This provides further support for the hypothesis that the largely similar uniformly orange colour of the last two species evolved in parallel. Phylogenies based on over 2000 bp of two nuclear genes (Rag-1 and Rag-2) identified reliably a clade of the Mantella betsileo and Mantella laevigata groups as sister lineage to the M. madagascariensis group, but did not support species within the latter group as monophyletic. The evolutionary history of these frogs might have been characterized by fast and recurrent evolution of colour patterns, possibly triggered by strong selection pressures and mimicry effects, being too complex to be represented by simple bifurcating models of phylogenetic reconstruction. Keywords: Amphibia, cytochrome b, Mantella madagascariensis group, Mantellidae, Rag-1, Rag-2 Received 28 April 2004; revision received 26 July 2004; accepted 2 September 2004

Diurnal frogs are a good example of this latter associ- Introduction ation. Warning coloration usually involves red, orange and Coloration plays an important role in the life history yellow; the ‘bull’s-eye’ black and white ventral patterns and evolution of animals. Different colour patterns have of some frogs are also considered aposematic (Duellman & been associated with mate choice, defence or mimicry, Trueb 1986). e.g. in fishes, birds and frogs (Seehausen et al. 1997, 1999; In the South-American family of poison frogs, Dendro- Summers et al. 1999; Uy & Borgia 2000). Brightness batidae, a relationship between coloration and visual can be an indicator of health and absence of parasites in mate choice has been observed (Summers et al. 1999) birds (Hamilton & Zuk 1982). Bright coloration is also often and the possibility of a correlation between intensity of associated with toxicity of the organisms and acts as an coloration and toxicity is debated (Summers & Clough aposematic warning signal for predators (Servedio 2000). 2001; Daly et al. 2002; Santos et al. 2003). In addition, Hagman & Forsman (2003) showed a positive association between conspicuous coloration and body size in this Correspondence: Axel Meyer, Fax: +49 753 1883018; E-mail: [email protected]. §Present address: Museum of family. Vertebrate Zoology, 3101 Valley Life Sciences Building, University Like dendrobatids, Malagasy poison frogs (genus of California, Berkeley, CA 94720-3160, USA. Mantella, family Mantellidae) are a monophyletic group

3764 Y. CHIARI ET AL. of diurnal, terrestrial frogs with bright coloration (Schaefer uniform orange, differing by a black spot in the tympanic et al. 2002). Their behaviour, feeding and mating mech- and nostril region in the latter species, whereas M. crocea anisms are considered to be a case of convergence with has a more cryptic yellow-green and black pattern. the Dendrobatidae. Similar to these, they feed primarily Previous studies using allozyme (Vences et al. 1998b) and on ants and other small arthropods from which they derive mitochondrial markers (Schaefer et al. 2002; Vences et al. their toxic skin alkaloids (Vences et al. 1998a). Daly et al. (1996) 2004) have produced conflicting hypotheses of phylogeny recognized the general alkaloid composition of the skin of within the M. madagascariensis group. This especially concerns Mantella species to be similar to that of Dendrobatidae. the position of M. madagascariensis, which was grouped either Dendrobatid and mantellid frogs bred in captivity do with the chromatically similar M. pulchra (allozymes) or not have any detectable alkaloids (Daly et al. 1994, 1997). with M. aurantiaca (mtDNA), but the individuals studied Considering the toxicity of wild individuals, an aposematic originated from different populations. The locality maps function is the most probable explanation for the con- produced by Vences et al. (2004) furthermore provided spicuous colour patterns of Mantella. However, mate indications that the derived uniform orange colour of M. choice based on coloration cannot be totally excluded. aurantiaca and M. milotympanum might be homoplastic, For example, Staniszewski (2001) noted that the flanks since geographically interspersed populations (M. crocea) of excited males of Mantella pulchra may shift from dark were genetically closer to M. milotympanum and showed a to iridescent blue or green and in Mantella expectata the different pattern. The relationships of the M. madagascariensis colour might be more vivid in breeding specimens than group within Mantella, crucial to understand the evolution in aestivating individuals (M. Vences, personal observation of their colour and pattern, are also unclarified since different in captive specimens). mitochondrial genes provided contradictory hypotheses Many species of Mantella are highly valued in the pet trade (Vences et al. 2004). for their bright coloration. For the same reason they have The goal of our study is to contribute to the clarification been considered as flagship-species to promote conservation of these controversies by providing further mitochondrial of specific areas in Madagascar (Zimmermann 1996). All and nuclear DNA data on Malagasy poison frogs, with Mantella species are placed on Appendix II of Convention particular focus on the Mantella madagascariensis group. We on International Trade in Endangered Species of Wild determined cytochrome b sequences of 143 specimens, Fauna and Flora (CITES), and some, such as Mantella including additional individuals from known populations cowani and Mantella aurantiaca, have been assigned high and samples from four newly discovered populations of conservation priorities (Vences et al. 1999; Raxworthy & M. aurantiaca, M. crocea and M. milotympanum. In addition, Nussbaum 2000; Andreone & Randrianirina 2003). we used sequences of two nuclear genes (Rag-1 and Rag-2) Schaefer et al. (2002) subdivided Mantella into five major in order to understand the phylogenetic relationships monophyletic species groups based on an analysis of within the group and to identify their closest relatives. mitochondrial sequences of the 16S rRNA gene and found evidence for homoplastic evolution of colour pattern in Materials and methods these frogs. Studies of Vences et al. (2004) have shown a high mitochondrial diversity within and among populations Sampling of Mantella. Among species of the Mantella madagascariensis group they found evidence for a sharing of relatively divergent Tissue samples from 13 species comprising five species haplotypes as a result of secondary introgression or, less groups used in this study were available from previous likely, incomplete lineage sorting. This group consists of five studies (Vences et al. 1998c; Schaefer et al. 2002; Vences species that display a high diversity in colour phenotypes: et al. 2004) or collected during fieldwork in Madagascar. M. aurantiaca, M. crocea, M. madagascariensis, M. milotympanum These five groups (Schaefer et al. 2002; Vences et al. 2004) and M. pulchra. Of these, M. madagascariensis and M. pulchra include the Mantella betsileo group (M. betsileo, M. expectata have a relatively wide, complementary distribution in and M. viridis), the M. cowani group (M. baroni, M. cowani, the eastern rainforest belt. They show a black dorsal colour M. haraldmeieri and M. nigricans), the M. madagascariensis with yellow to green flank blotches that is highly similar to group (M. aurantiaca, M. crocea, M. milotympanum, M. that of the often sympatric M. baroni and M. nigricans madagascariensis and M. pulchra), the M. bernhardi group which belong to another species group (Vences et al. (M. bernhardi) and the M. laevigata group (M. laevigata). 1999; Schaefer et al. 2002). The remaining three species Fieldwork was carried out in December 2001 and are more specialized to the forests that border larger inland February 2003. Ten populations were sampled and geograph- swamps and occupy a very restricted range in central ical coordinates and altitude above sea level recorded by GPS eastern Madagascar (Vences et al. 2004). They have a instruments (Table 1). These localities extend along a north– patchy distribution with only a few precisely known local- south transect of c. 110 km in central eastern Madagascar ities. M. aurantiaca and M. milotympanum are bright (Fig. 1) that encompass the complete known ranges of all

COLOUR EVOLUTION IN MANTELLA 3765

Table 1 Coordinates, altitude and Mantella species for each locality

Locality Locality number Coordinates Altitude (m) Species

North of Fierenana 1 18°16′10′′ S, 48°29′03′′ E 1060 M. cf. milotympanum Fierenana (Sahamarolambo) 2 48°26′56′′ S, 18°32′36′′ E 948 M. milotympanum Andriabe 3 18°36′46′′ S, 48°19′34′′ E 1047 M. cf. milotympanum Savakoanina 4 18°36′44′′ S, 48°24′30′′ E 959 M. cf. milotympanum Ambohimanarivo 5 18°48′34′′ S, 48°16′52′′ E 1057 M. crocea Ihofa 6 18°46′06′′ S, 48°22′18′′ E 1017 M. crocea Torotorofotsy 1 7 18°52′29′′ S, 48°22′21′′ E 960 M. aurantiaca Torotorofotsy 2 8 18°51′19′′ S, 48°21′36′′ E 950 M. aurantiaca Andranomandry 9 19°02′22′′ S, 48°10′34′′ E 917 M. aurantiaca Andranomena 10 19°01′30′′ S, 48°10′0′′ E 921 M. aurantiaca

Locality numbers are the same as those in Fig. 1.

Fig. 1 Map of localities of Mantella aurantiaca, Mantella crocea and Mantella milotympanum: black squares, Mantella crocea; white squares, Mantella aurantiaca; Black diamond, Mantella milotympanum; black triangle, uncertain assignation, variable or intermediate colour and pattern. The photographs show individuals found in the populations indicated by arrows (or identical to the typical patterns found in the populations). Populations 2 and 7–10, and some individuals from population 3, are uniformly orange (uniform orange individuals included in boxes) whereas the others show a pattern of at least partly black flanks or a green-yellow colour. Localities are as follows: 1, North of Fierenana; 2, Fierenana; 3, Andriabe; 4, Savakoanina; 5, Ambohimanarivo; 6, Ihofa; 7–8, Torotorofotsy; 9, Andranomandry; 10, Andranomena.

© 2004 Blackwell Publishing Ltd, Molecular Ecology, 13, 3763–3774 3766 Y. CHIARI ET AL. three species. No other reliable locality records for these Table 2 Names and sequences of primers used for amplification species have been published to date. of cytochrome b, Rag-1 and Rag-2 gene fragments

We here follow two approaches with different sampling. On one hand we study differentiation of three species in Locus Primer Primer sequence the M. madagascariensis group (M. aurantiaca, M. crocea and Cyt b Cytb-c 5′-CTACTGGTTGTCCTCCGATTCATGT-3′ M. milotympanum) at the population level, using partial CBJ 10933 5′-TATGTTCTACCATGAGGACAAATATC-3′ sequences of the mitochondrial cytochrome b gene. On Rag-1 Amp F2 5′-ACNGGNMGICARATCTTYCARCC-3′ the other hand we determined Rag-1 and Rag-2 sequences Amp F1 5′-ACAGGATATGATGARAAGCTTGT-3′ from a less extensive number of individuals in a broader Amp R2 5′-GGTGYTTYAACACATCTTCCATYTCRTA-3′ ′ ′ taxonomic sampling. This included (1) representatives AmpRI 5 -AACTACGCTGCATTKCCAATRTCACA-3 ′ AGCTGGAGYCARTAYCAYAARATG ′ of each of the species groups recognized in the genus Mart FL1 5 - -3 Mart R6 5′-GTGTAGAGCCARTGRTGYTT-3′ (Schaefer et al. 2002) and (2) individuals from crucial Rag-2 Lung.35F 5′-GGCCAAAGAGRTCYTGTCCIACTGG-3′ populations of all five species of the M. madagascariensis Lung.320R 5′-AYCACCCATATYRCTACCAAACC-3′ group. From this latter group we chose two specimens Lung.460R 5′-GCATYGRGCATGGACCCARTGICC-3′ of M. madagascariensis that in previous studies were placed 31 FN. Venk 5′-TTYGGICARAARGGITGGCC-3′ at different phylogenetic positions and three M. aurantiaca specimens that clustered in the two separate mitochondrial haplotype networks. A species of the mantellid genus tion step at 94 °C for 5 min, followed by 10 cycles at 94 °C Mantidactylus, M. wittei, was used as outgroup in phylogenetic for 30 s, annealing temperatures increasing by 0.5 °C per analyses. Representative voucher specimens were preserved cycle from 54 °C to 57 °C for 40 s and extension for 3 min in the collection of the Zoologische Staats-sammlung at 68 °C. An additional 25 PCR cycles were performed at Munich, Germany, and the Zoological Museum, Amsterdam, 94 °C for 30 s, 57 °C for 40 s and 68 °C for 3 min. Final The Netherlands. extension was at 68 °C for 5 min. Cycle conditions for Rag- 2 were an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, annealing temperature of Laboratory techniques 50 °C for 40 s and an extension step of 68 °C for 3 min; final Genomic DNA was extracted from toeclips or muscle extension was at 68 °C for 5 min. tissues fixed in 99% ethanol using a Proteinase K digestion The PCR products were loaded on 1.2% agarose gels, (final concentration 1 mg/mL). DNA was isolated by a stained with ethidium bromide, and visualized on a Gel standard salt extraction protocol (Brufford et al. 1992). Doc system (Bio-Rad). If results were satisfactory, products Fragments of cytochrome b and two nuclear genes were purified using QIAquick spin columns (Qiagen) prior (Rag-1 and Rag-2) were amplified via polymerase chain to cycle sequencing. A 10 µL sequencing reaction included reaction (PCR). For the population genetic part of our 1–2 µL of template, 1 µL of sequencing buffer, 2 µL of study, a fragment of 528 bp of the cytochrome b gene was pmol/µL primer, 1.8 µL of ABI sequence mix (Applied amplified using the primers Cytb-c and CBJ10933 from Biosystems) and 3.2–4.2 µL of water. The sequence reaction Bossuyt & Milinkovitch (2000). For the phylogenetic part was 30 cycles of 10 s at 96 °C, 10 s at 50 °C and 4 min at of our work a fragment of 1367 bp of Rag-1 and 666 bp of 60 °C. Sequence data collection and visualization were Rag-2 were amplified using a combination of degenerate performed on an ABI 3100 automated sequencer. primers (Hoegg et al. 2004) (Table 2). We obtained cytochrome b sequences of 5–26 specimens To obtain the Rag-1 and Rag-2 fragments, PCRs were from each population of the M. madagascariensis group performed in 25 µL reactions containing 0.5–1.0 units of sampled (except for only two specimens from North of REDTaq DNA Polymerase (Sigma), 0.01 units of Pwo DNA Fierenana, see Table 1). Sequences were deposited in polymerase (Roche), 50 ng genomic DNA, 10 pmol of each GenBank; accession numbers AY723515–AY723696. primer, 15 nmol of each dNTP, 50 nmol additional MgCl2 and the REDTaq PCR reaction buffer (10 mm Tris-HCl, Phylogeography and population genetics pH 8.3, 50 mm KCl, 1.1 mm MgCl2 and 0.01% gelatine). To amplify the cytochrome b fragment, the same reaction was This part of our study was based on cytochrome b sequences performed using 1.0 unit of REDTaq DNA Polymerase from 143 individuals from the M. madagascariensis group. A without Pwo DNA polymerase, using the following condi- 528 bp segment of this gene was available from all specimens tions: an initial denaturation at 94 °C for 90 s, 35 cycles at and contained no indels. A minimum spanning network 94 °C for 30 s, annealing temperature of 53 °C for 45 s, was constructed using the tcs software package (Clement extension at 72 °C for 90 s, and final extension for 10 min at et al. 2000), which employs the method of Templeton et al. 72 °C. Cycle conditions for Rag-1 were adapted from a long (1992). It calculates the number of mutational steps by which range PCR protocol (Barnes 1994), with an initial denatura- pairwise haplotypes differ and computes the probability of

© 2004 Blackwell Publishing Ltd, Molecular Ecology, 13, 3763–3774 COLOUR EVOLUTION IN MANTELLA 3767 parsimony (Templeton et al. 1992) for pairwise differences one of the haplotype aur2 from the M. aurantiaca network until the probability exceeds 0.95. The number of mutational to aur21, cro2 or mil8 of the M. milotympanum/M. crocea differences associated with the probability just before the network in pairwise comparisons). Of these two main groups 0.95 cut-off is then the maximum number of mutational one includes only M. aurantiaca individuals, while the other connections between pairs of sequences justified by the contains mainly M. crocea and M. milotympanum. A newly ‘parsimony’ criterion, and these justified connections are sampled population (Andranomandry) confirms the applied in a haplotype network (Clement et al. 2000). In data obtained from Vences et al. (2004), showing haplo- addition we performed a maximum likelihood phylogenetic type sharing between the M. aurantiaca and the M. crocea/ analysis of all identified haplotypes using methods described M.milotympanum networks. The first network contains eight below. The topology inferred using this method was then M. aurantiaca individuals from two populations (Andrano- used to choose among various unresolved connections in mandry and Andranomena) and all M. crocea and M. the haplotype network. Values of nucleotide diversity and milotympanum. The second haplotype network contains 53 gene diversity were obtained with the software arlequin M. aurantiaca individuals from four populations divided in version 2.0 (Schneider et al. 2000). 17 haplotypes, with a maximum divergence of eight steps. The number of pairwise substitutions is 17–34 between the two networks. Within populations we found 2–11 haplotypes, Phylogenetic analyses with nucleotide diversities of 0.15–2.4% and haplotype Sequences were checked and aligned with the sequence diversities of 40–100% (Table 3). navigator (Applied Biosystems) software. Sequence alignment was done by eye since there was no length variation. Phylogenetic analyses We calculated phylogenetic trees using each marker separately. Maximum parsimony (MP) and maximum likelihood In an effort to construct a robust phylogeny of Mantella (ML) analyses were carried out using paup* (Swofford 2002), we amplified fragments of 528 bp of cytochrome b, 1367 using the heuristic search option with tree-bisection- bp of Rag-1 and 666 bp of Rag-2 from 17 individuals of 13 reconnection (TBR) branch swapping and 10 random Mantella species. A total of 333 positions of the cytochrome addition sequence replicates, following substitution model b were invariant, 45 were parsimony-uninformative but parameter estimation with modeltest version 3.06 (Posada variable, and 150 were parsimony-informative characters. & Crandall 1998). Of those 150 parsimony-informative characters 85% were Two-thousand bootstrap replicates were calculated under third position substitutions and 13% and 2%, respectively, the MP optimality criterion, and 500 replicates under the ML referred to substitutions at first and second codon posi- criterion. All bootstrapping was carried out using heuristic tions. Of the 1367 total characters of Rag-1, 1279 were constant searches with 10 random addition sequence replicates and 57 variable characters were parsimony-uninformative. and TBR branch swapping. Bayesian posterior probabilities Of the 31 parsimony-informative characters, 74% were at were calculated using mrbayes version 2.01 (Huelsenbeck third codon positions and 16% and 10% at first and second & Ronquist 2001) under a GTR substitution model with positions, respectively. In Rag-2, 605 of the total of 666 parameters estimated from the data. A total of 300 000 characters were constant, and of the variable characters, 41 generations were run, every 10th tree collected, and the were parsimony-uninformative and 20 were parsimony- number of initial generations needed before convergence informative; 65% were at third codon positions and 20% on stable likelihood values was empirically estimated at and 15% at first and second positions, respectively. 15 000; the ‘burn in’ parameter was consequently set at 5%. In Rag-1, one to four amino acid substitutions among Competing phylogenetic hypotheses were tested using Mantella species groups were identified. No amino acid SH-tests (Shimodaira & Hasegawa 1999) as implemented substitutions were found within groups, except for the in paup*. We performed maximum likelihood searches under M. cowani group, which has up to three amino acid sub- various constraints and compared the obtained trees simul- stitutions between species. Rag-2 sequences differ for one taneously with the best tree from the unconstrained search. amino acid substitution of the M. betsileo and M. bernhardi groups relative to other Mantella. Within-group variation is limited to one amino acid substitution each in the M. cowani Results and in the M. madagascariensis groups. Cytochrome b is more variable, with two to six amino acid substitutions between Population genetic analysis groups, and some within each of the groups (up to six The TCS analysis of cytochrome b of 143 specimens from 10 within the M. madagascariensis group). populations produced two main haplotype networks (Fig. 2). modeltest suggested a TrN + I + G substitution model We had to force the tcs program to employ a minimum of (Tamura & Nei 1993) with a gamma distribution shape 17 steps to connect them (this minimum distance is the parameter of 1.78 as best fitting the cytochrome b data

Fig. 2 Haplotype network of populations assigned to Mantella aurantiaca, Mantella crocea and Mantella milotympanum. The inset figures indicate which species and populations are uniformly orange and which show a pattern of at least partly black flanks. set. The best model for Rag-1 was the HKY + I + G model The cytochrome b, Rag-1 and Rag-2 ML trees (Fig. 3) (Hasegawa et al. 1985) with gamma distribution shape para- supported five main groups as indicated in Schaefer et al. meters of 0.9873. The optimal model for Rag-2 was HKY + (2002). The two nuclear markers are incongruent for the G model (Hasegawa et al. 1985) with gamma distribution position of M. laevigata. This species is basal to the M. mada- shape parameters of 0.1301. gascariensis group based on Rag-1, but it clustered with

Table 3 Summary of colour and gene/nucleotide diversity in the Mantella madagascariensis group populations examined

Colour Locality variability Nucleotide Population number Colour variability description score (0–4) Gene diversity diversity

Fierenana 2 Totally uniform pattern, slight variation in colour 0 0.7895 ± 0.0859 0.6465 ± 0.003851 (Sahamarolambo) Torotorofotsy 1 7 Totally uniform pattern, slight variation in colour 0 0.6166 ± 0.1068 0.3252 ± 0.002193 Torotorofotsy 2 8 Totally uniform pattern, slight variation in colour 0 0.4 ± 0.2373 0.1509 ± 0.001503 Andranomandry 9 Totally uniform pattern, slight variation in colour 0 0.9333 ± 0.0477 2.0047 ± 0.010799 Andranomena 10 Totally uniform pattern, slight variation in colour 0 0.6750 ± 0.1174 2.4701 ± 0.013152 Ambohimanarivo 5 Slightly variable dorsal pattern, moderately 2 0.5714 ± 0.1195 0.4313 ± 0.003070 variable ventral pattern, uniform colour Ihofa 6 Slightly variable dorsal pattern, moderately 2 0.8492 ± 0.0460 0.005039 ± 0.003089 variable ventral pattern, uniform colour Andriabe 3 Moderately variable dorsal pattern, strongly 3 0.7308 ± 0.1332 0.003532 ± 0.002425 variable ventral pattern, uniform colour North Fierenana 1 Strongly variable dorsal pattern, variable ventral 3 1 ± 0.5 0.003774 ± 0.004622 pattern, uniform colour Savakoanina 4 Moderately variable dorsal and ventral pattern, 4 0.8667 ± 0.0673 0.003810 ± 0.002544 strongly variable colour

Populations are sorted according to the colour variability score, a subjective measure extending from no variability (0) to a maximum variability (4) as explained in the descriptions. Gene diversity is defined as the probability that two randomly chosen haplotypes are different in the sample. Nucleotide diversity is the equivalent to gene diversity at the nucleotide level (Nei 1987). Locality numbers refer to those in Fig. 1.

M. viridis in the Rag-2 analysis (Fig. 3b,c). Nuclear and madagascariensis was rejected as well as the monophyly of mitochondrial markers differed mainly for the basal posi- haplotypes of M. baroni + M. madagascariensis and of all tion in the trees. Cytochrome b indicated M. laevigata as orange individuals (P < 0.05). most basal, where the nuclear markers placed M. bernhardi. The phylogenetic position of M. madagascariensis remained Discussion uncertain. In the cytochrome b and Rag-2 ML analyses, the sample of M. madagascariensis from Ranomafana was The M. madagascariensis group is sister to the basal to the rest of M. madagascariensis group. The other M. M. betsileo and M. laevigata groups madagascariensis sample had a haplotype almost identical to M. pulchra in the cytochrome b analysis and an unresolved Phylogenetic analyses based on morphology (Vences position within the M. madagascariensis group for Rag-2 et al. 1998c), allozymes (Vences et al. 1998b) and mtDNA (Fig. 3a,c). In the Rag-1 ML analysis the sample from (Schaefer et al. 2002) placed the M. betsileo group (M. betsileo, Ranomafana clustered with M. pulchra and the other M. expectata and M. viridis) and the M. laevigata group (M. sample clustered with one of the M. aurantiaca samples laevigata) as most basal representatives of the genus Mantella, (Fig. 3b). although the molecular analyses did not provide any sig- SH-tests were carried out separately for the Rag-1, Rag-2 nificant bootstrap support for this placement. Vences et al. and Cytochrome b data sets. The two nuclear genes yielded (1998c) identified two osteological character states in which similar results. Trees calculated under the constraints of these two species groups had plesiomorphic states, thereby (1) monophyly of individuals of Mantella aurantiaca, (2) mono- defining a monophylenic group containing the M. bernhardi, phyly of uniformly orange individuals belonging to M. M. cowani and M. madagascariensis groups. This basal aurantiaca and M. milotympanum, and (3) monophyly of position of the M. betsileo and M. laevigata groups was individuals of M. madagascariensis were not significantly in apparent agreement with their partly less derived different from the most likely trees obtained from the colour pattern (for example that of M. betsileo which is unconstrained searches and aredepicted in Fig. 3. In con- rather cryptic with a brown dorsum and black flanks). trast, a monophyletic group containing (4) individuals of A combined analysis of 2840 bp of three mitochondrial M. madagascariensis and M. baroni was significantly rejected and one nuclear gene (Vences et al. 2004) differed from the in both cases (P < 0.001). In the cytochrome b dataset, all previous hypotheses and identified a lineage containing four comparisons yielded significant results, i.e. mono- M. laevigata and the M. betsileo group as the sister clade of phyly of the respective haplotypes of M. aurantiaca and M. the M. madagascariensis group, and M. bernhardi as the most

Fig. 3 Maximum Likelihood cladograms of 13 species of Mantella, based on 528 bp of cytochrome b (a), 1367 bp of Rag-1 (b) and 666 bp of Rag-2 (c). The tree was obtained by heuristic searches in paup*. Numbers indicate maximum parsimony (MP) and maximum likelihood (ML) bootstrap values in per cent (2000 and 500 bootstrap replicates, respectively). Asterisks indicate Bayesian posterior probabilities of 98% or higher. AZ, specimens used in the allozyme study of Vences et al. (1999); grey boxes, the Mantella madagascariensis group. The inset figures show individuals of similar colour and pattern: specimens of M. madagascariensis and M. baroni, which have a similar complex black-yellow-orange pattern, and M. aurantiaca that is invariably and uniformly orange. Mantidactylus wittei was used as the outgroup and is not shown in the figure.

basal Mantella. However, this hypothesis also received 2004) that was also recovered here. In addition, both nuclear only low bootstrap support (59–67%). genes provide moderate bootstrap support (63–78%) for The nuclear gene data presented here (Fig. 3b,c) are in the placement of M. bernhardi as most basal species, sister agreement with the topology presented in Vences et al. (2004). to all other Mantella species groups, and good support So far, the only relevant support for any intergroup rela- (89–97%) for the placement of the M. betsileo/M. laevigata tionship within Mantella was the placement of M. laevigata groups sister to the M. madagascariensis group. These results with the M. betsileo group (Schaefer et al. 2002; Vences et al. strongly suggest that the evolution of colour patterns in this

© 2004 Blackwell Publishing Ltd, Molecular Ecology, 13, 3763–3774 COLOUR EVOLUTION IN MANTELLA 3771 genus is homoplastic and, more interestingly, in parallel. colour spreading into other populations. The third hypo- This fact is most extreme in the two species M. baroni and thesis is parallel or convergent evolution triggered by M. madagascariensis that have very precisely the same pattern directional selection towards uniform orange colour. and often occur in syntopy (Schaefer et al. 2002). It also As set out by Schaefer et al. (2002), in the case of Mantella implies that the cryptic coloration of M. betsileo, and the baroni and M. madagascariensis, the similarity in colour pattern lack of any flank blotches in the M. betsileo and M. laevigata is most likely to have evolved through parallel evolution. groups (present in all other Mantella) are most probably These two taxa are consistently grouped into different cases of reversal. species groups by all available data sets, and this distant placement was significantly confirmed by the SH-tests. A reconstruction of putative ancestral character states indi- The uniform colour of M. aurantiaca and cated different colour patterns in the most recent common M. milotympanum is likely homoplastic ancestor of these two species. Even under the different Mantella aurantiaca and M. milotympanum show a very phylogenetic scenario as proposed by Vences et al. (2004) similar orange-red coloration, and M. milotympanum has a and corroborated herein (Fig. 3b,c), it is obvious that assum- black spot in the nostril region and on the eardrum. M. ing a retention of ancestral colour pattern implies a higher milotympanum was considered as a variant of M. aurantiaca number of character state transformations than the assump- (Glaw & Vences 1994) until genetic data suggested its tion of convergent or parallel evolution, and therefore is closer relationships to M. crocea (Vences et al. 1998b). less parsimonious. The cytochrome b data presented here (Fig. 3a) corroborate The situation is different in the case of M. aurantiaca and that the haplotype lineages of M. crocea and M. milotympanum M. milotympanum as described herein. These two taxa are are distinct from most M. aurantiaca, but they also confirm closely related, as demonstrated by all available characters. the existence of M. aurantiaca with haplotypes clustering They show mitochondrial haplotype sharing indicative of in the milotympanum/crocea clade. In the DNA fragment possible introgressive hybridization. However, the puta- analysed here, there was even one haplotype shared by tively introgressive haplotypes found in M. aurantiaca are M. aurantiaca and M. crocea (haplotype cro1). However, not identical to those observed in M. milotympanum (Fig. 2). this applies to only a few M. aurantiaca individuals from The fact that the uniformly orange M. milotympanum is Andranomena and Andranomandry (localities 9 and 10; geographically fully encircled by differently coloured Fig. 1). Geographically, these two populations are most populations makes an introgressive hybridization scenario distant from the M. milotympanum distribution area further unlikely. In contrast, the hypothesis of ancestral (Fierenana; locality 2 in Fig. 1), and the known sites of polymorphism is more difficult to rule out. The populations M. crocea are known to be geographically intermediate in geographical proximity to M. milotympanum are charac- (Vences et al. 2004). terized by colour polymorphism. One argument against Two newly discovered populations, Savakoanina and such a hypothesis is that M. aurantiaca have a translucent Andriabe (localities 3 and 4 in Fig. 1), further fill the gap shade which is lacking in M. milotympanum. This could between the areas of M. milotympanum and M. aurantiaca. indicate that the orange colour in these two taxa originated Specimens from these sites were intermediate in colour and through different mechanisms of colour formation. We pattern between M. crocea and M. milotympanum (Table 3), favour the hypothesis that the similar colour of M. milotym- confirming that these two taxa are probably conspecific. To panum and M. aurantiaca evolved convergently, but a more the north of Fierenana (locality 1 in Fig. 1) we further dis- thorough testing of this assumption is required. covered a population of Mantella with a pattern similar to The presence of the same coloration as a warning pattern M. crocea. Individuals with M. crocea-like pattern are also in unpalatable species can be interpreted as a Müllerian known from the Zahamena reserve that is further to the mimicry. In this case, a toxic species will obtain a selective north (F. Rabemananjara, personal observation). advantage by sharing the similar warning coloration (Müller These observations and the low incidence of haplotype 1879). The Müllerian mimicry theory would require the sharing between M. aurantiaca and M. milotympanum species presenting the same warning coloration to live in suggest that one of three alternative explanations need to sympatry, in a way that each species can benefit from the be invoked to explain their highly derived uniform orange learning capacity of the predator. Müllerian mimicry colour. The first of these possible scenarios is retention of evidence is well supported when different populations ancestral colour polymorphism in various populations, living in sympatry with different model species mimic their followed by local elimination of this polymorphism by distinct colour pattern. In frogs, Müllerian mimicry has been genetic drift or selection, with only the orange phenotype postulated for a Peruvian poison frog, Dendrobates imitator, remaining in populations today considered as M. milotym- that may mimic sympatric species in different geographical panum and M. aurantiaca. The second explanation is intro- regions (Symula et al. 2001), and for the sympatric M. mada- gressive hybridization, with alleles for a uniform orange gascariensis and M. baroni (Schaefer et al. 2002). Because

Table 4 Summary of sample sizes, number Locality Sample Polymorphic haplotypes and number of polymorphic Population number size Haplotypes sites sites in the cytochrome b fragments studied in populations of Mantella aurantiaca, North of Fierenana 1 2 2 2 Mantella crocea and Mantella milotympanum Fierenana (Sahamarolambo) 2 20 9 14 Andriabe 3 13 7 9 Savakoanina 4 15 8 7 Ambohimanarivo 5 7 2 4 Torotorofotsy 1 7 23 7 9 Torotorofotsy 2 8 5 2 2 Ihofa 6 26 10 11 Andranomandry 9 16 11 36 Andranomena 10 16 6 33

Locality numbers are the same as those in Fig. 1.

of their strictly allopatric distribution (Fig. 1) it is unlikely (Fig. 3a) also indicates that M. madagascariensis is not a that such effects also explain the pattern similarity of genetically homogeneous species: one individual clustered M. aurantiaca and M. milotympanum, although the identifi- with high support in a clade with M. pulchra, coinciding cation of predators and their home range would be needed with allozyme results (Vences et al. 1998b) and karyolo- to exclude this hypothesis. gical data (Odierna et al. 2001), whereas the individual from Ranomafana clustered as the most basal representative of the M. madagascariensis group. This separate clustering Mantella madagascariensis may not be a genetically was confirmed by the SH tests that significantly rejected homogeneous species the alternative hypothesis of monophyly of the two M. Because of its relatively fast mutation rate (Brown et al. madagascariensis haplotypes. This phylogeny would sug- 1979), mitochondrial DNA is often used to reconstruct gest that the colour pattern of M. madagascariensis evolved relationships among closely related species. Even if the twice, possibly as a cause of independent events of taxa under study are well differentiated species, a limited Müllerian mimicry with the chromatically similar M. baroni amount of gene flow between their populations may occur (Schaefer et al. 2002). However, in the nuclear gene phylo- in some cases. Because mtDNA is maternally inherited and genies, no consistent pattern was apparent. Neither the two no recombination takes place, incomplete lineage sorting M. madagascariensis nor the three M. aurantiaca individuals or introgression of divergent haplotypes after speciation were placed in a monophyletic group, but their monophyly can lead to equivocal phylogenetic reconstructions. A was not significantly excluded by the SH tests. surprisingly large number of species have been found Analysis of more variable nuclear markers such as to be paraphyletic using mitochondrial gene trees (Funk & amplified fragment length polymorphisms (AFLPs) might Omland 2003). In such cases, nuclear-encoded markers could be necessary to understand whether this is caused by a too provide better means to estimate the true phylogenetic low number of informative substitutions among these relationships among taxa and populations (Albertson et al. closely related taxa, an incomplete lineage sorting, or by a 1999). Conversely, the fourfold lower effective population complex evolutionary history of repeated hybridization size of mitochondrial DNA (Moore 1995) causes mtDNA and admixture of populations. haplotypes to coalesce and become monophyletic more quickly compared with nuclear markers, making these less Haplotype diversity is not strongly correlated with reliable to estimate relationships among closely related colour diversity and incipient species (Wiens & Penkrot 2002). However, independent of these considerations, simple bifurcating It is striking that some of the Mantella populations sampled phylogenies may poorly represent the evolutionary history in this study show a pronounced intrapopulational variation of species that have been exchanging genes (Machado et al. in colour pattern (Table 3). For example, at Savakoanina, 2002; Machado & Hey 2003). some individuals were orange-red and others yellow- In Mantella, haplotype sharing with M. crocea/milotympa- greenish, whereas at Andriabe different extension of black num was found in the Andranomena population of M. lateral pattern was observed. This contradicts classical aurantiaca and confirmed herein a second nearby popula- theory of aposematism, which would predict stability of tion of this species, Andranomandry (populations 9 and 10 colour and pattern within a population (Guilford & in Fig. 1). In M. madagascariensis, the cytochrome b tree Dawkins 1993). Our observations could be explained by

© 2004 Blackwell Publishing Ltd, Molecular Ecology, 13, 3763–3774 COLOUR EVOLUTION IN MANTELLA 3773 secondary admixture of chromatically uniform populations, Brown WM, George M Jr, Wilson AC (1979) Rapid evolution of e.g. having the colour and pattern typical for either M. animal mitochondrial DNA. Proceedings of the National Academy crocea and M. milotympanum; it is known that Mantella of Sciences of the USA, 76, 1967–1971. Brufford MW, Hanotte O, Brookfield JFY, Burke T (1992) Single- hybrids show intermediate as well as new patterns (Glaw locus and multilocus DNA fingerprint. In: The South American et al. 2000). If this hypothesis were true, populations with Herpetofauna: its Origin, Evolution, and Dispersal. Molecular Genetic high colour variability would be expected to have a high Analysis in Conservation (ed. Hoelzel AR), pp. 225–270. IRL heterozygosity and increased haplotype diversity. Cyto- Press, Oxford. chrome b diversity patterns (Table 4) do not seem to support Clement X, Posada D, Crandall K (2000) tcs: a computer program this hypothesis (Spearman correlation of genetic diversity to estimate gene genealogies. Molecular Ecology, 9, 1657–1659. values with subjective scores of colour pattern diversity, Daly JW, Secunda S, Garraffo HM, Spande TF, Wisnieski A, Cover JF Jr (1994) An uptake system for dietary alkaloids in P > 0.2). Alternatively, the variation in pattern and colour poison frogs (Dendrobatidae). Toxicon, 32, 657–663. could also be an indication of disruptive or fluctuating Daly JW, Andriamaharavo NR, Andriantsiferana M, Myers CW selection, e.g. through heterogeneous or unstable populations (1996) Madagascan poison frogs (Mantella) and their skin of predators. To choose among these hypotheses, it will be alkaloids. American Museum Novitates, 3177, 1–34. necessary to screen more populations and to employ codo- Daly JW, Garraffo HM, Hall GS, Cover JF Jr (1997) Absence of skin minant and highly variable nuclear data (i.e. microsatellites) alkaloids in captive-raised Madagascan mantelline frogs that also will provide data on levels of heterozygosity in (Mantella) and sequestration of dietary alkaloids. Toxicon, 35, 1131–51135. chromatically uniform vs. variable populations. It will be Daly JW, Kaneko T, Wilham J, Garraffo HM, Spande TF, Espinosa A, crucial to perform field studies to identify which animals Donnelly MW (2002) Bioactive alkaloids of frog skin: combina- prey on Mantella, to assess the intensity of predation, and torial bioprospecting reveals that pumiliotoxins have an arthropod to study experimentally the selective prey choice and source. Proceedings of the National Academy of Sciences of the USA, learning capacity of these predators. 99, 13996–14001. Duellman WE, Trueb L (1986) Biology of Amphibians. McGraw-Hill, New York, NY. Acknowledgements Funk DJ, Omland KE (2003) Species-level paraphyly and polyphyly: frequency, causes and consequences, with insights We are grateful to Arie van der Meijden for comments on this paper from animal mitochondrial DNA. Annual Review of Ecology and and to Simone Hoegg and Marta Barluenga for, respectively, assist- Systematics, 34, 397–423. ance in the phylogenetic and population genetic analyses. Euan Glaw F, Vences M (1994) A Fieldguide to the Amphibians and Reptiles Edwards, Marta Puente, Meike Thomas and Bertrand Razafima- of Madagascar, 2nd edn. Vences & Glaw, Cologne. hatratra helped during field work. We are indebted to the Univer- Glaw F, Vences M, Schmidt K (2000) Nachzucht, Juvenilfärbung sity of Antananarivo and ICTE/MICET for logistic assistance. The und Oophagie von Mantella laevigata im Vergleich zu anderen Ministere des Eaux et Forets kindly issued research authorizations Arten der Gattung (Amphibia: Ranidae). Salamandra, 36, 1–24. and export permits (036N-EA02/MG03, 038N-EA02/MG03, 074C- Guilford T, Dawkins MS (1993) Are warning colors handicaps? EA02/MG04). Y.C. was supported by a grant of the Landesgra- Evolution, 47, 400–416. duiertenförderung Baden-Württemberg, D. R. V. by a grant of the Hagman M, Forsman A (2003) Correlated evolution of conspicu- University of Vigo for research in foreign countries, and F.R. by a ous coloration and body size in poison frogs (Dendrobatidae). WOTRO/NWO DC-fellowship. Laboratory and field work Evolution, 57, 2904–2910. received support by grants of the Deutsche Forschungsgemein- Hamilton WD, Zuk M (1982) Heritable true fitness and bright schaft to M.V. and A.M. (VE247/1–1 and VE247/1–2). birds: a role for parasites? Science, 218, 384–387. Hasegawa M, Kishino K, Yano T (1985) Dating the human–ape References splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution, 22, 160–174. Albertson RC, Markert JA, Danley PD, Kocher TD (1999) Phylogeny Hoegg S, Vences M, Brinkmann H, Meyer A (2004) Phylogeny and of a rapidly evolving clade: the cichlid fishes of Lake Malawi, comparative substitution rates of frogs inferred from sequences East Africa. Proceedings of the National Academy of Sciences of the of three nuclear genes. Molecular Biology and Evolution, 21, 1188– USA, 96, 5107–5110. 1200. Andreone F, Randrianirina JE (2003) It’s not carnival for the Huelsenbeck JP, Ronquist F (2001) mrbayes: Bayesian inference of harlequin mantella! Urgent actions needed to conserve Mantella phylogenetic trees. Bioinformatics, 17, 754–755. cowani, an endangered frog from the high plateau of Madagascar. Machado CA, Hey J (2003) The causes of phylogenetic conflict in Froglog, 59, 1–2. a classic Drosophila species group. Proceedings of the Royal Society Barnes WM (1994) PCR amplification of up to 35-kb DNA with of London Series B: Biological Sciences, 270, 1193–1202. high fidelity and high yield from bacteriophage templates. Machado CA, Kliman RM, Markert JA, Hey J (2002) Inferring the Proceedings of the National Academy of Science of the USA, 91, history of speciation from multilocus DNA sequence data: the 2216–2220. case of Drosophila pseudoobscura and close relatives. Molecular Bossuyt F, Milinkovitch MC (2000) Convergent adaptive radi- Biology and Evolution, 19, 472–488. ations in Madagascan and Asian ranid frogs reveal covariation Moore WS (1995) Inferring phylogenies from mtDNA variation: between larval and adult traits. Proceedings of the National Academy mitochondrial trees versus nuclear-gene trees. Evolution, 49, of Sciences of the USA, 97, 6585–6590. 718–726.

Müller F (1879) Ituna and Thyridia: a remarkable case of mimicry Tamura K, Nei M (1993) Estimation of the number of nucleotide in butterflies. Proceedings of the Entomological Society of London, sub-stitutions in the control region of mitochondrial DNA in 1879, 20–29. humans and chimpanzees. Molecular Biology and Evolution, 10, Nei M (1987) Molecular Evolutionary Genetics. Columbia University 512–526. Press, New York, NY. Templeton AR, Crandall KA, Sing CF (1992) A cladistic analysis of Odierna G, Vences M, Aprea G, Lötters S, Andreone F (2001) phenotypic associations with haplotypes inferred from restriction Chromosome data for Malagasy poison frogs (Amphibia: endonuclease mapping and DNA sequence data. III. Cladogram Ranidae: Mantella) and their bearing on taxonomy and phylogeny. estimation. Genetics, 132, 619–633. Zoological Science, 18, 505–514. Uy JAC, Borgia G (2000) Sexual selection drives rapid divergence Posada D, Crandall KA (1998) Modeltest: testing the model of in bowerbird display traits. Evolution, 54, 273–278. DNA substitution. Bioinformatics, 14, 817–818. Vences M, Glaw F, Böhme W (1998a) Evolutionary correlates of Raxworthy CJ, Nussbaum RA (2000) Extinction and extinc- microphagy in alkaloid-containing frogs (Amphibia: Anura). tion vulnerability of amphibians and reptiles in Madagascar. Zoologischer Anzeiger, 236, 217–230. Amphibian and Reptile Conservation, 2, 15–23. Vences M, Glaw F, Mausfeld P, Böhme W (1998b) Comparative Santos JC, Coloma LA, Cannatella D (2003) Multiple, recurring osteology of Malagasy poison frogs of the genus Mantella origins of aposematism and diet specialization in poison frogs. (Amphibia: Ranidae: Mantellinae). Bonner Zoologische Beiträge, Proceedings of the National Academy of Sciences of the USA, 22, 48, 205–215. 12792–12797. Vences M, Hille A, Glaw F (1998c) Allozyme differentiation in the Schaefer HC, Vences M, Veith M (2002) Molecular phylogeny genus Mantella (Amphibia: Anura: Mantellinae). Folia Zoologica, of Malagasy poison frogs, genus Mantella (Anura: Mantellidae): 47, 261–274. homoplastic evolution of color pattern in aposematic amphibians. Vences M, Glaw F, Böhme W (1999) A review of the genus Mantella Organisms Diversity and Evolution, 2, 97–105. (Anura, Ranidae, Mantellinae): taxonomy, distribution and con- Schneider S, Roessli D, Excoffier L (2000) ARLEQUIN Version 2.000; servation of Malagasy poison frogs. Alytes, 17, 3–72. A Software for Population Genetic Data Analysis. Genetics and Vences M, Chiari Y, Raharivololoniaina L, Meyer A (2004) High Biometry Laboratory, University of Geneva, Geneva. mitochondrial diversity within and among populations of Seehausen O, van Halpen JJM, Witte F (1997) Cichlid fish diversity Malgasy poison frogs. Molecular Phylogenetics and Evolution, 30, threatened by eutrophication that curbs sexual selection. 295–307. Science, 277, 1808–1811. Wiens JJ, Penkrot TA (2002) Delimiting species using DNA and Seehausen O, van Halpen JJM, Lande R (1999) Color poly- morphological variation and discordant species limits in spiny morphism and sex ration distortion in a cichlid fish as an lizards (Sceloporus). Systematic Biology, 51, 69–91. incipient stage in a sympatric speciation by sexual selection. Zimmermann H (1996) Der Schutz des tropischen Regenwaldes Ecology Letters, 2, 376–378. und ein kleines Fröschchen in Ost-Madagaskar. Stapfia, 47, Servedio MR (2000) The effect of predator learning, forgetting, 189–218. and recognition errors on the evolution of warning coloration. Evolution, 54, 751–763. Shimodaira H, Hasegawa M (1999) Multiple comparison of This study is part of Ylenia Chiari’s PhD research project. Her research log-likelihoods with applications to phylogenetic inference. interests focus on the conservation genetics and phylogeography Molecular Biology and Evolution, 16, 1114–1116. of endangered Malagasy herpetofauna. The research was carried Staniszewski M (2001) Mantellas, 1st edn. Chimaira, Frankfurt am out in the laboratory of Axel Meyer at the University of Konstanz, Main. Germany. Miguel Vences, Assistant Professor at the University of Summers K, Clough ME (2001) The evolution of coloration and Amsterdam, is a specialist of the biogeography and evolution of toxicity in the poison frog family (Dendrobatidae). Proceedings of the vertebrates of Madagascar, especially amphibians and reptiles, the National Academy of Sciences of the USA, 98, 6227–6232. and his research interests currently focus on understanding the Summers K, Symula R, Clough M, Cronin T (1999) Visual mate speciation mechanisms that generated Madagascar’s extra- choice in poison frogs. Proceedings of the Royal Society of London ordinary biodiversity. David R. Vieites is a postdoctoral researcher Series B: Biological Sciences, 266, 2141–2145. with a special interest in biogeographical patterns and popula- Swofford DL (2002) PAUP*. Phylogenetic analysis using parsimony tion genetics of threatened species. Falitiana Rabemananjara (* and other methods), v.4 beta10. Sunderland, MA: Sinauer. and Parfait Bora are carrying out their PhD and MSc theses, Symula R, Schulte R, Summers K (2001) Molecular phylogenetic respectively, on the biology of Malagasy poison frogs, this being evidence for a mimetic radiation in Peruvian poison frogs supervised by Olga Ramilijaona Ravoahangimalala, Professor at supports a Müllerian mimicry hypothesis. Proceedings of the the Zoology Department of the University of Antananarivo. Royal Society of London Series B: Biological Sciences, 268, 2415–2421.

Rediscovery and redescription of the holotype of Mantella manery

Miguel Vences*, Cindy Woodhead**, Parfait Bora*** & Frank Glaw****

* Zoological Museum, University of Amsterdam, Mauritskade 61, 1092 AD Amsterdam, The Netherlands ** Durrell Institution of Conservation and Ecology, Department of Anthropology, Eliot College, The University of Canterbury, Canterbury, CT2 7NS, United Kingdom *** Université d’Antananarivo, Département de Biologie Animale, Antananarivo 101, Madagascar **** Zoologische Staatssammlung, Münchhausenstr. 21, 81247 München, Germany

The Malagasy poison frog Mantella manery Vences, Glaw & Böhme, 1999 was described on the basis of color slides of a specimen deposited in the collection of the Département de Biologie Animale, Université d’Anta- nanarivo, which is the only voucher of this species known to date. The holotype of this species was not available for morphological examination at the time of the description but has been rediscovered by us in 2004. Its catalogue number is UADBA 7273 and its snout-vent length is 22.7 mm. We here provide an updated description of Mantella manery, based on morphological examination of the holotype.

Introduction

The genus Mantella Boulenger, 1882 is composed of 15 species currently recognized (Glaw &Vences, 2003). These colorful diurnal animals are usually named Malagasy poison frogs (Daly et al., 1996) and are important for the pet trade, ecotourism, and as flagship species for conservation (Behra, 1993; Zimmermann, 1996; Vences et al., 2004). After Glaw &Vences (1994) first mentioned and figured an unnamed species of Mantella from the Marojejy Massif in north-eastern Madagascar, hobbyists have used various invalid (condi- tional) names to refer to this species, such as ‘‘Mantella marojezyi’’ or ‘‘Mantella marojezy’’. To avoid an accidental description similar to the case of Mantella milotympanum Stanis- zewski, 1996, the species was described as Mantella manery by Vences et al. (1999), based on photographs and field data only.The holotype was said to be ‘‘a single specimen of this species (...) in the herpetological collection of the Zoological Institute of the Antananarivo Univer- sity, Madagascar’’. Because this specimen was not found in the Antananarivo collection, the original description of Mantella manery was based ‘‘on color slides of this specimen’’ alone (Vences et al., 1999). In a recent effort of contributing to the inventory of the herpetological collection in the Département de Biologie Animale, Université d’Antananarivo, Madagascar (UADBA), we 16 ALYTES 22 (1-2) rediscovered the holotype of Mantella manery in February 2004. In the following we provide a redescription of this species and focus on the previously unavailable morphological features of the holotype. Terminology follows Vences et al. (1999).

Mantella manery Vences, Glaw & Böhme, 1999

Mantella manery Vences, Glaw & Böhme, 1999. ¢ Name-bearing type: holotype by original designation (Vences et al. 1999: 15), its catalogue number here ﬁrst reported as UADBA 7273. Usage of the name subsequent to the original description: Mantella manery:Vences et al., 1999; Glaw &Vences, 2000, 2003; Schaefer et al., 2002; Vences &Glaw, 2003. Mantella manery n. sp. (1999): Staniszewski, 2001.

Morphology of holotype. ¢ Adult specimen in moderate state of preservation. Several cuts through ventral skin for gonad examination. Some tissue removed from left femur for DNA extraction. Probably a male, but gonads not sufficiently recognizable due to poor preservation and dark color of inner organs. Body relatively stout for a Mantella; head clearly longer than wide, slighly narrower than body; snout rounded in dorsal and lateral views; nostrils directed laterally, very slightly protuberant; canthus rostralis distinct, concave; loreal region slightly concave; tympanum distinct, rounded, its diameter 57 % of eye diameter; supratympanic fold distinct, slightly curved; tongue narrow and longish-ovoid, very slightly notched posteriorly; vomerine and maxillary teeth absent. Forelimbs slender; subarticular tubercles single; inner and outer metacarpal tubercles distinct; fingers without webbing; comparative finger length 1 <2≤ 4 < 3; finger discs moderately enlarged; nuptial pads absent. Hindlimbs slender; when hindlimbs are adpressed along body, the tibiotarsal articulation reaches the posterior eye corner; lateral (outer) metatarsalia strongly connected; a large inner and a distinct outer metatarsal tubercles; webbing between toes absent; comparative toe length1<2<5<3<4, third toe clearly longer than fifth toe. Skin on dorsal surface, throat and chest smooth; slightly granular on venter; shanks ventrally granular, possibly marking an area of indistinct and not sharply delimited femoral glands. Measurements of holotype. ¢ All in mm. Snout-vent length, 22.7 (estimated as 25 mm by Vences et al. 1999); maximum head-width, 7.7; head length from tip of snout to maxillary articulation, 9.0; horizontal eye diameter, 2.8; horizontal tympanum diameter, 1.6; distance from anterior edge of eye to center of nostril, 1.9; distance from center of nostril to snout tip, 1.1; distance between centers of nostrils, 2.6; hand length, 6.0; forelimb length, 14.4; hindlimb length, 33.8; foot length including tarsus, 14.9; foot length, 9.6; tibia length, 10.4. Color of holotype in life. ¢ See Vences et al. (1999). Figure 320 in Glaw &Vences (1994) shows the ventral side of the holotype but is mirrored horizontally. Color of holotype in preservative. ¢ After almost 10 years, the pattern of the holotype is still fully recognizable (fig. 1). The greenish dorsal and blue ventral color has partly faded and is much less vivid than in life. Vences et al. 17

Fig. 1. ¢ Holotype of Mantella manery (UADBA 7273) in ventral and dorsal view, as photographed in February 2004, before the application of ventral cuts for gonad examination and tissue removal from shank muscle. The scale bar represents 10 mm.

Acknowledgements

PB acknowledges the support by the Volkswagen Foundation through a grant to curate the amphibian collection of the University of Antananarivo. We are grateful to O. Ramilijaona who granted access to this collection, and to the Malagasy authorities for research permits.

Literature cited

Behra, O., 1993. ¢ The export of reptiles and amphibians from Madagascar. Traffic Bull., 13 (3): 115-116. Daly, J. W., Andriamaharavo, N. R., Andriantsiferana, M. &Myers, C. W., 1996. ¢ Madagascan poison frogs (Mantella) and their skin alkaloids. Am. Mus. Novit., 3177: 1-34. Glaw, F. &Vences, M., 1994. ¢ A ﬁeldguide to the amphibians and reptiles of Madagascar.2nd edition. Köln, Vences & Glaw Verlag: 1-480, 48 pl. ----- 2000. ¢ Mantella manery, M. nigricans und M. milotympanum. Aquarien- & Terrarien-Z., 5 (7): 36-39. ----- 2003. ¢ Introduction to Amphibians. In:S. M. Goodman &J. P. Benstead (ed.), The Natural History of Madagascar, Chicago & London, The University of Chicago Press: 883-898. Schaefer, H.-C., Vences, M. &Veith, M., 2002. ¢ Molecular phylogeny of Malagasy poison frogs, genus Mantella (Anura: Mantellidae): homoplastic evolution of colour pattern in aposematic amphibians. Org. Divers. Evol., 2: 97-105. Staniszewski, M. S., 2001. ¢ Mantellas. Frankfurt, Edition Chimaira, 1-229. 18 ALYTES 22 (1-2)

Vences, M., Chiari, Y., Raharivololoniaina, L. &Meyer, A., 2004. ¢ High mitochondrial diversity within and among populations of Malagasy poison frogs. Mol. Phylogenet. Evol., 30: 295-307. Vences, M. &Glaw, F., 2003. ¢ Mantella. In: S. M. Goodman &J. P. Benstead (ed.), The Natural History of Madagascar, Chicago & London, The University of Chicago Press: 913-916. Vences, M., Glaw, F. &Böhme, W., 1999. ¢ A review of the genus Mantella (Anura, Ranidae, Mantellinae): taxonomy, distribution and conservation of Malagasy poison frogs. Alytes, 17: 3-72. Zimmermann, H., 1996. ¢ Der Schutz des tropischen Regenwaldes und ein kleines Fröschchen in Ost-Madagaskar. Stapﬁa, 47: 189-218.

Corresponding editor: Alain Dubois.