DOCSLIB.ORG

WO 2018/175924 Al 27 September 2018 (27.09.2018) W !P O PCT

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2018/175924 Al 27 September 2018 (27.09.2018) W !P O PCT (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/175924 Al 27 September 2018 (27.09.2018) W !P O PCT (51) International Patent Classification: (74) Agent: SCHER, Michael, B.; Johnson, Marcou & Isaacs, C07K 16/26 (2006.01) C07K 14/575 (2006.01) LLC, P.O. Box 691, Hoschton, GA 30548 (US). C07K 16/28 (2006.01) A61K 39/395 (2006.01) (81) Designated States (unless otherwise indicated, for every C07K 14/57 (2006.01) A61P 37/00 (2006.01) kind of national protection available): AE, AG, AL, AM, (21) International Application Number: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, PCT/US20 18/024082 CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (22) International Filing Date: HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, 23 March 2018 (23.03.2018) KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (25) Filing Language: English MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (26) Publication Langi English SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, (30) Priority Data: TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. 62/476,352 24 March 20 17 (24 .03 .20 17) US (84) Designated States (unless otherwise indicated, for every 62/558,298 13 September 2017 (13.09.2017) US kind of regional protection available): ARIPO (BW, GH, (71) Applicants: THE BROAD INSTITUTE, INC. [US/US]; GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, 415 Main Street, Cambridge, MA 02142 (US). UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, MASSACHUSETTS INSTITUTE OF TECHNOLO¬ TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, GY [US/US]; 77 Massachusetts Avenue, Cambridge, MA EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, 02 139 (US). THE BRIGHAM AND WOMEN'S HOSPI¬ MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TAL, INC. [US/US]; 75 Francis Street, Boston, MA 021 15 TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, (US). KM, ML, MR, NE, SN, TD, TG). (72) Inventors; and Published: (71) Applicants: WALLRAPP, Antonia [US/US]; C/o 75 — with international search report (Art. 21(3)) Francis Street, Boston, MA 021 15 (US). RIESENFEILD, — before the expiration of the time limit for amending the Samantha, J. [US/US]; C/o 415 Main Street, Cambridge, claims and to be republished in the event of receipt of MA 02142 (US). BURKETT, Patrick, R. [US/US]; CI amendments (Rule 48.2(h)) o 75 Francis Street, Boston, MA 021 15 (US). KOWAL- — with sequence listing part of description (Rule 5.2(a)) CZYK, Monika, S. [US/US]; C/o 415 Main Street, Cam bridge, MA 02142 (US). REGEV, Aviv [US/US]; C/o 415 Main Street, Cambridge, MA 02142 (US). KUCHROO, Vijay, K. [US/US]; C/o 75 Francis Street, Boston, MA 021 15 (US). (54) Title: METHODS AND COMPOSITIONS FOR REGULATING INNATE LYMPHOID CELL INFLAMMATORY RESPONSES (57) Abstract: Computational and functional analysis identified the neuropep tide receptor Nmurl as selectively expressed on Type 2 innate lymphoid cells (ILC2s). While both IL-33 and IL-25 promote ILC activation in vivo, IL-33 in ■ ILC1 ILC2 duces robust ILC proliferation, whereas ILCs activated with IL-25 do not prolif □ Mixed None erate as robustly and up-regulate Nmurl expression. Treatment with neuromedin : 100 U (NMU), the neuropeptide ligand of Nmurl , had little effect on its own. Co-ad ministration of IL-25 with NMU, however, dramatically amplified allergic lung o 75 inflammation and induced the proliferation and expansion of specific ILC2 sub sets, characterized by a molecular signature unique to pro -inflammatory ILC2s. 50 The results demonstrate that Nmurl signaling strongly modulates IL-25-mediat- ed ILC2 responses, resulting in highly proliferative pro-inflammatory ILCs, and 25 highlights the importance of neuro-immune crosstalk in allergic inflammatory responses at mucosal surfaces. Control iL-25 IL-33 Condition METHODS AND COMPOSITIONS FOR REGULATING INNATE LYMPHOID CELL INFLAMMATORY RESPONSES CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application Nos. 62/476,352, filed March 24, 2017 and 62/558,298, filed September 13, 2017. The entire contents of the above-identified applications are hereby fully incorporated herein by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH [0002] This invention was made with government support under grant numbers AI123516, AI056299 and AI039671 awarded by the National Institutes of Health. The government has certain rights in the invention. TECHNICAL FIELD [0003] The subject matter disclosed herein is generally directed to compositions and methods for modulating Type 2 innate lymphoid cell responses. BACKGROUND [0004] Type 2 innate lymphoid cells (ILC2s) regulate the initiation of allergic tissue inflammation at mucosal surfaces, in large part due to their ability to rapidly produce effector cytokines such as IL-5 and IL-13 14. ILC2s are also vital in maintaining tissue homeostasis by promoting epithelial cell proliferation, survival, and barrier integrity2. Alarmin cytokines, such as IL-25 and IL-33, activate ILC2s to promote tissue homeostasis in the face of epithelial injury, but also play critical roles in initiating allergic inflammatory responses6 9 10 . [0005] The factors that balance homeostatic and pathological ILC responses are unclear, and it remains unknown if unique subsets or functional states of ILCs mediate these homeostatic vs. pro inflammatory effects. Since there are no known markers of such functional states, it is also challenging to distinguish homeostatic from pro-inflammatory ILCs. Single-cell genomics, especially scRNA-seq 11'12, can help identify such diversity, even when changes in cell states are continuous across the cells in a population 13 , or are unique to a very small sub-population 14 15 . Recently, scRNA-seq-based approaches identified transcriptionally distinct sub-populations within intestinal ILC subsets, demonstrating the utility of scRNA-seq in identifying previously unrecognized subpopulations and cell states within this cell type, although the functional roles of these sub-populations remain to be clarified 16 . [0006] Citation or identification of any document in this application is not an admission that such document is available as prior art to the present invention. SUMMARY [0007] Type 2 innate lymphoid cells (ILC2s) are critical for maintaining mucosal barrier functions and tissue homeostasis, and yet are also important drivers of pathologic type 2 immune responses in allergy and asthma 1 5 . Alarmin cytokines produced by damaged and stressed epithelial cells, such as IL-25 and IL-33, have been shown to activate ILC2s, but it remains unclear if these cytokines are unique in switching homeostatic ILC2s into proinflammatory cells that drive tissue inflammation 6 8. [0008] It is an objective of the present invention to identify molecular cues that modulate ILC responses to alarmins. Applicants collected single-cell RNA-sequencing (scRNA-seq) profiles of lung-resident ILCs at steady state and after in vivo stimulation, combining massively-parallel droplet-based scRNA-seq surveys with full-length scRNA-seq for deeper characterization of markers. Computational and functional analysis identified the neuropeptide receptor Nmurl as selectively expressed on ILC2s. While both IL-33 and IL-25 promote ILC activation in vivo, IL-33 induces robust ILC proliferation, whereas ILCs activated with IL-25 do not proliferate as robustly and up-regulate Nmurl expression. [0009] It is another objective of the present invention to modulate ILC2 immune responses and cell states. Treatment of ILC2s with neuromedin U (NMU), the neuropeptide ligand of Nmurl, has little effect on its own in the experimental models used herein. Co administration of IL-25 with NMU, however, dramatically amplifies allergic lung inflammation and induces the proliferation and expansion of specific ILC2 subsets, characterized by a molecular signature unique to pro-inflammatory ILC2s. The results demonstrated for the first time that Nmurl signaling strongly modulates IL-25-mediated ILC2 responses, resulting in highly proliferative pro-inflammatory ILCs, and highlights the importance of neuro-immune crosstalk in allergic inflammatory responses at mucosal surfaces. [0010] In one aspect, the present invention provides for a method of treating a disease requiring reduction of an innate lymphoid cell (ILC) Type 2 inflammatory response comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of inhibiting neuromedin U receptor 1 (Nmurl) or blocking Nmurl interaction with neuromedin U (NMU). In a further aspect, the present invention provides for a method of reducing an innate lymphoid cell (ILC) Type 2 inflammatory response comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of inhibiting neuromedin U receptor 1 (Nmurl) or blocking Nmurl interaction with neuromedin U (NMU). Also provided is an agent capable of inhibiting neuromedin U receptor 1 (Nmurl) or blocking Nmurl interaction with neuromedin U (NMU) for use in a method of treating a disease requiring reduction of an innate lymphoid cell (ILC) Type 2 inflammatory response. Further provided is an agent capable of inhibiting neuromedin U receptor 1 (Nmurl) or blocking Nmurl interaction with neuromedin U (NMU) for use in reducing an innate lymphoid cell (ILC) Type 2 inflammatory response. Further provided is the use of an agent capable of inhibiting neuromedin U receptor 1 (Nmurl) or blocking Nmurl interaction with neuromedin U (NMU) for the manufacture of a medicament for treating a disease requiring reduction of an innate lymphoid cell (ILC) Type 2 inflammatory response.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • TTDN1 (MPLKIP) (NM 138701) Human 3' UTR Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC204348 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: MPLKIP Synonyms: ABHS; C7orf11; ORF20; TTD4 ACCN: NM_138701 Insert Size: 2000 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone – SC204348 Insert Sequence: >SC204348 3’UTR clone of NM_138701 The sequence shown below is from the reference sequence of NM_138701. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC ACAGGCAAAAAAGGAAGATACTTTTGTTAACATTTCTGAAATTCAACTGGAAGCTTCATGTGTCAGGAA CATCTTGGACAAAACTTTAAGTTGTGTTGATATAAATTTACCCAAAGATGATGACTTTGATTGGATAAT TAGTAAGGTCTTTTTGTTATTTTTCATCGTATCAGGTATTGTTGATATTAGAGAAAAAAGTAGGATAAC TTGCAACATTTAGCTCTGGAAGTACCTACCACATTTTAGAGATTTACCGTTTCCATATATTTAACATTC CTGGTTACATAATGGACATTTGTCTTTTAATGTTTTTTCAATGTTTTAAAATAAAACATTTTGTCTTCT AGCTATTGTGGTTTTGTGGTATGATAAAGAAGTAGACTTACTACAGTAATGCTTTGTAGTCACTTAGAG TTCATAGGTAAATGTTTTGCAAATTATTTTTGAAAATGAAATAGGTAAACCATCCTTTGAGCTGTAGAC
    [Show full text]
  • Statistical and Bioinformatic Analysis of Hemimethylation Patterns in Non-Small Cell Lung Cancer
    Statistical and Bioinformatic Analysis of Hemimethylation Patterns in Non-Small Cell Lung Cancer Shuying Sun ( [email protected] ) Texas State University San Marcos https://orcid.org/0000-0003-3974-6996 Austin Zane Texas A&M University College Station Carolyn Fulton Schreiner University Jasmine Philipoom Case Western Reserve University Research article Keywords: Methylation, Hemimethylation, Lung Cancer, Bioinformatics, Epigenetics Posted Date: October 12th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-17794/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on March 12th, 2021. See the published version at https://doi.org/10.1186/s12885-021-07990-7. Page 1/29 Abstract Background: DNA methylation is an epigenetic event involving the addition of a methyl-group to a cytosine-guanine base pair (i.e., CpG site). It is associated with different cancers. Our research focuses on studying non- small cell lung cancer hemimethylation, which refers to methylation occurring on only one of the two DNA strands. Many studies often assume that methylation occurs on both DNA strands at a CpG site. However, recent publications show the existence of hemimethylation and its signicant impact. Therefore, it is important to identify cancer hemimethylation patterns. Methods: In this paper, we use the Wilcoxon signed rank test to identify hemimethylated CpG sites based on publicly available non-small cell lung cancer methylation sequencing data. We then identify two types of hemimethylated CpG clusters, regular and polarity clusters, and genes with large numbers of hemimethylated sites.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Novel Mutation of Type 1 Insulin-Like Growth Factor Receptor (IGF1R) Gene in a Severe Short Stature Pedigree Identified by Targeted Next-Generation Sequencing
    Research Article Novel mutation of type 1 insulin-like growth factor receptor (IGF1R) gene in a severe short stature pedigree identified by targeted next-generation sequencing Running title: Novel mutation of type I insulin-like growth factor receptor Yu Yang1*, Hui Huang2, Ka Chen2, Li Yang1, Li-ling Xie1, Ting Xiong1, and Xian Wu1 1Department of Endocrinology, Metabolism, and Genetics, Jiangxi Provincial Children’s Hospital, Nanchang 330006, Jiangxi, China 2Central laboratory, Jiangxi Provincial Children’s Hospital, Nanchang 330006, Jiangxi, China *Corresponding author: Yu Yang, Department of Endocrinology, Metabolism, and Genetics, Jiangxi Provincial Children’s Hospital, 1 No. 122 Yangming Road Donghu District, Nanchang 330006, Jiangxi, China E-mail: [email protected] Abstract Background: Insulin-like growth factor receptor IGF-1R deficiency is a rare form of short stature, and is difficult to clinically diagnose. Targeted next-generation sequencing (NGS) allows for the rapid and inexpensive assessment of short stature. Case presentation: We identified mutations in the pedigree of a Chinese boy with severe short stature using targeted NGS; we then assessed the clinical characteristics and evaluated the efficacy of growth hormone therapy. NGS analysis revealed a novel heterozygous missense mutation in exon3 (c.926C>T, p.S309L) of the type I IGF-1R gene in the proband, which was inherited from the mother. The proband, mother, and grandfather suffered from severe growth failure. After recombinant human growth hormone therapy, the patient’s growth rate increased. Conclusions: The novel missense mutation in IGF1R (c.926C>T, p.S309L), is associated with severe short stature in Chinese individuals. Targeted NGS may enable efficient diagnosis and genetic consultation of children with short stature.
    [Show full text]
  • Bioinformatics Analysis for the Identification of Differentially Expressed Genes and Related Signaling Pathways in H
    Bioinformatics analysis for the identification of differentially expressed genes and related signaling pathways in H. pylori-CagA transfected gastric cancer cells Dingyu Chen*, Chao Li, Yan Zhao, Jianjiang Zhou, Qinrong Wang and Yuan Xie* Key Laboratory of Endemic and Ethnic Diseases , Ministry of Education, Guizhou Medical University, Guiyang, China * These authors contributed equally to this work. ABSTRACT Aim. Helicobacter pylori cytotoxin-associated protein A (CagA) is an important vir- ulence factor known to induce gastric cancer development. However, the cause and the underlying molecular events of CagA induction remain unclear. Here, we applied integrated bioinformatics to identify the key genes involved in the process of CagA- induced gastric epithelial cell inflammation and can ceration to comprehend the potential molecular mechanisms involved. Materials and Methods. AGS cells were transected with pcDNA3.1 and pcDNA3.1::CagA for 24 h. The transfected cells were subjected to transcriptome sequencing to obtain the expressed genes. Differentially expressed genes (DEG) with adjusted P value < 0.05, | logFC |> 2 were screened, and the R package was applied for gene ontology (GO) enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The differential gene protein–protein interaction (PPI) network was constructed using the STRING Cytoscape application, which conducted visual analysis to create the key function networks and identify the key genes. Next, the Submitted 20 August 2020 Kaplan–Meier plotter survival analysis tool was employed to analyze the survival of the Accepted 11 March 2021 key genes derived from the PPI network. Further analysis of the key gene expressions Published 15 April 2021 in gastric cancer and normal tissues were performed based on The Cancer Genome Corresponding author Atlas (TCGA) database and RT-qPCR verification.
    [Show full text]
  • MPLKIP Gene M-Phase Specific PLK1 Interacting Protein
    MPLKIP gene M-phase specific PLK1 interacting protein Normal Function The MPLKIP gene (formerly known as C7orf11) provides instructions for making a protein called M-phase specific PLK1 interacting protein. The function of this protein is unclear. Based on its interaction with a protein called Plk1, the MPLKIP protein is thought to play a role in cell growth and division. In particular, it may help regulate the cell cycle, which is the cell's way of replicating itself in an organized, step-by-step fashion. Researchers speculate that the MPLKIP protein may also be involved in gene transcription, which is the first step in protein production. Health Conditions Related to Genetic Changes Trichothiodystrophy At least eight mutations in the MPLKIP gene have been identified in people with trichothiodystrophy. These mutations cause some cases of the non-photosensitive form of the disorder, which is not associated with extreme sensitivity to ultraviolet (UV) rays from sunlight. All of the known MPLKIP gene mutations prevent the production of any functional MPLKIP protein. It is unknown how a loss of this protein leads to the characteristic features of trichothiodystrophy, including slow growth, intellectual disability, and brittle hair. Other Names for This Gene • ABHS • C7orf11 • chromosome 7 open reading frame 11 • ORF20 • TTD non-photosensitive 1 protein • TTDN1 • TTDN1_HUMAN Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 A dditional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of MPLKIP
    [Show full text]
  • Using Three-Dimensional Regulatory Chromatin Interactions from Adult
    bioRxiv preprint doi: https://doi.org/10.1101/406330; this version posted January 30, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Using three-dimensional regulatory chromatin interactions from adult and fetal cortex to interpret genetic results for psychiatric disorders and cognitive traits Paola Giusti-Rodríguez 1 †, Leina Lu 2 †, Yuchen Yang 1,3 †, Cheynna A Crowley 3, Xiaoxiao Liu 2, Ivan Juric 4, Joshua S Martin 3, Armen Abnousi 4, S. Colby Allred 1, NaEshia Ancalade 1, Nicholas J Bray 5 , Gerome Breen 6,7 , Julien Bryois 8 , Cynthia M Bulik 8,9 , James J Crowley 1 , Jerry Guintivano 9 , Philip R Jansen 10,11 , George J Jurjus 12,13 , Yan Li 2 , Gouri Mahajan 14 , Sarah Marzi 15,16 , Jonathan Mill 15,16 , Michael C O'Donovan 5 , James C Overholser 17 , Michael J Owen 5 , Antonio F Pardiñas 5 , Sirisha Pochareddy 18 , Danielle Posthuma 11 , Grazyna Rajkowska 14 , Gabriel Santpere 18 , Jeanne E Savage 11 , Nenad Sestan 18 , Yurae Shin 18, Craig A Stockmeier 14, James TR Walters 5, Shuyang Yao 8 , Bipolar Disorder Working Group of the Psychiatric Genomics Consortium, Eating Disorders Working Group of the Psychiatric Genomics Consortium, Gregory E Crawford 19,20 , Fulai Jin 2,21 *, Ming Hu 4 *, Yun Li 1,3 *, Patrick F Sullivan 1,8 * † Equal contributions. * Co-last authors. Correspond with: PF Sullivan ([email protected]), Department of Medical Epidemiology and Biostatistics, Karolinska Institutet (Stockholm, Sweden) and the Departments of Genetics and Psychiatry, University of North Carolina (Chapel Hill, NC, USA).
    [Show full text]
  • Original Article Identification of Differentially Expressed Genes Between Male and Female Patients with Acute Myocardial Infarction Based on Microarray Data
    Int J Clin Exp Med 2019;12(3):2456-2467 www.ijcem.com /ISSN:1940-5901/IJCEM0080626 Original Article Identification of differentially expressed genes between male and female patients with acute myocardial infarction based on microarray data Huaqiang Zhou1,2*, Kaibin Yang2*, Shaowei Gao1, Yuanzhe Zhang2, Xiaoyue Wei2, Zeting Qiu1, Si Li2, Qinchang Chen2, Yiyan Song2, Wulin Tan1#, Zhongxing Wang1# 1Department of Anesthesiology, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou, China; 2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China. *Equal contributors and co-first au- thors. #Equal contributors. Received May 31, 2018; Accepted August 4, 2018; Epub March 15, 2019; Published March 30, 2019 Abstract: Background: Coronary artery disease has been the most common cause of death and the prognosis still needs further improving. Differences in the incidence and prognosis of male and female patients with coronary artery disease have been observed. We constructed this study hoping to understand those differences at the level of gene expression and to help establish gender-specific therapies. Methods: We downloaded the series matrix file of GSE34198 from the Gene Expression Omnibus database and identified differentially expressed genes between male and female patients. Gene ontology, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analy- sis, and GSEA analysis of differentially expressed genes were performed. The protein-protein interaction network was constructed of the differentially expressed genes and the hub genes were identified. Results: A total of 215 up-regulated genes and 353 down-regulated genes were identified. The differentially expressed pathways were mainly related to the function of ribosomes, virus, and related immune response as well as the cell growth and proliferation.
    [Show full text]
  • Molecular Mechanisms and the Conflict Between
    Molecular Ecology (2016) 25, 4368–4376 doi: 10.1111/mec.13766 Molecular mechanisms and the conflict between courtship and aggression in three-spined sticklebacks YIBAYIRI O. SANOGO and ALISON M. BELL School of Integrative Biology, Carl R. Woese Institute for Genomic Biology, University of Illinois at Urbana-Champaign, 505 S. Goodwin Ave., 433 Morrill Hall, Urbana, IL 61801, USA Abstract In nature, animals often face conflicting demands. For example, breeding males must attract a mate but at the same time be ready to defend against rivals. The molecular mechanisms by which the brain resolves behavioural trade-offs are largely unknown. In this study, we compared the brain transcriptional responses of territorial male three-spined sticklebacks to a mating opportunity with a female and to a territorial challenge by a rival male. We focused on the diencephalon and the cerebellum, two regions of the brain implicated in courtship and aggression. There was a set of genes that were differentially expressed in response to both a courtship opportunity and a territorial challenge. Closer inspection of the direction of regulation revealed that genes that were downregulated in response to a courtship opportunity were upregu- lated in response to a territorial challenge and vice versa. Our study reveals some of the potential molecular mechanisms underlying behavioural trade-offs between sex and aggression, along with a possible solution to the conflict via social context- dependent gene regulation. Keywords: behavioural syndrome, Gasterosteus aculeatus, gene expression, limited plasticity, microarray, sociogenomics, territoriality Received 8 April 2015; revision received 28 June 2016; accepted 19 July 2016 the molecular mechanisms by which the brain might Introduction generate and/or resolve such conflicts is in its infancy Many animals in nature are constantly confronted with (O’Connell & Hofmann 2011a).
    [Show full text]
  • Screening of Exosomal Mirnas Derived From
    3314 MOLECULAR MEDICINE REPORTS 18: 3314-3324, 2018 Screening of exosomal miRNAs derived from subcutaneous and visceral adipose tissues: Determination of targets for the treatment of obesity and associated metabolic disorders ZHENG YANG1*, ZHUYING WEI1*, XIA WU2 and HUIDI YANG1 1Basic Medical School, Inner Mongolia Medical University, Hohhot, Inner Mongolia 010110; 2The State Key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, Inner Mongolia University, Hohhot, Inner Mongolia 010070, P.R. China Received November 1, 2017; Accepted June 14, 2018 DOI: 10.3892/mmr.2018.9312 Abstract. Exosomal micro (mi)RNAs have been suggested 58 DE‑miRNAs were identified in VAT between patients with to have important roles in abdominal obesity, and to be obesity and lean patients. miRNA (miR)-4517 was revealed to associated with metabolic alterations via posttranscriptional be a downregulated exosomal miRNA between SAT and VAT, regulation of target genes. However, exosomal miRNA while the other DE-miRNAs were SAT-(e.g. hsa-miR-3156-5p profiles in subcutaneous adipose tissue (SAT) and visceral and hsa-miR-4460) or VAT-(e.g. hsa-miR-582-5p, adipose tissue (VAT) have rarely been investigated. In the hsa‑miR‑566 and miR‑548) specific. Following overlapping present study, microarray data were obtained from the Gene with the target genes of DE-miRNAs, only one DEG [cluster Expression Omnibus database with the following accession of differentiation 86 (CD86)] was identified in SAT samples, numbers: GSE68885 (exosomal miRNAs in SAT obtained whereas 25 DEGs (e.g. fibroblast growth factor 2 (FGF2), from seven patients with obesity and five lean patients), FOS like 2, AP‑1 transcription factor subunit (FOSL2); and GSE50574 (exosomal miRNAs in VAT obtained from seven adenosine monophosphate deaminase 3 (AMPD3)] were iden- patients with obesity and five lean patients) and GSE29718 tified in VAT samples.
    [Show full text]
  • Value Cluster LEFTY1 2.690865644 0.899 0.067 0.00E+00 C1
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut Supplementary Table 3. Marker genes in each malignant epithelial cells cluster Gene Log(Fold-change) Pct.1 Pct.2 Adj p- value Cluster LEFTY1 2.690865644 0.899 0.067 0.00E+00 C1 TFF2 2.186713379 0.855 0.36 0.00E+00 C1 CCT2 1.701377329 0.801 0.283 0.00E+00 C1 SPINK4 1.663911876 0.654 0.128 0.00E+00 C1 TFF3 1.632604627 0.882 0.43 0.00E+00 C1 CXCL17 1.616238928 0.659 0.079 0.00E+00 C1 LDHB 1.407263152 0.711 0.137 0.00E+00 C1 CLDN18 1.398880496 0.825 0.278 0.00E+00 C1 TESC 1.382790712 0.79 0.212 0.00E+00 C1 PDIA6 1.295630983 0.789 0.404 0.00E+00 C1 PSCA 1.263596359 0.922 0.241 0.00E+00 C1 SRD5A3 1.246561606 0.586 0.098 0.00E+00 C1 PDIA4 1.180717046 0.849 0.419 0.00E+00 C1 DPCR1 1.175754587 0.506 0.06 0.00E+00 C1 WBP5 1.163957541 0.734 0.106 0.00E+00 C1 LYZ 1.141614179 0.969 0.727 0.00E+00 C1 RAP1B 1.125989315 0.68 0.255 0.00E+00 C1 S100P 1.055862172 0.962 0.758 0.00E+00 C1 OS9 1.05478066 0.787 0.338 0.00E+00 C1 R3HDM2 1.031695733 0.742 0.167 0.00E+00 C1 B3GNT7 1.031632795 0.549 0.088 0.00E+00 C1 MORF4L1 1.023176967 0.768 0.409 0.00E+00 C1 TMEM165 0.999912261 0.649 0.196 0.00E+00 C1 GALNT3 0.995165397 0.705 0.254 0.00E+00 C1 TFF1 0.962929536 0.96 0.591 0.00E+00 C1 LY6D 0.94328396 0.484 0.007 0.00E+00 C1 MIA 0.895355862 0.623 0.103 0.00E+00 C1 MDM2 0.864864363 0.615 0.089 0.00E+00 C1 YEATS4 0.864197638 0.585 0.128 0.00E+00 C1 CPM 0.831257805
    [Show full text]