(HBV) Infection of the Liver Ahmed Mohamed Abdel-B Diab Purdue University

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Purdue University Purdue e-Pubs Open Access Dissertations Theses and Dissertations January 2016 The oler of PLK1 in Hepatitis B Virus (HBV) infection of the liver Ahmed Mohamed Abdel-B Diab Purdue University Follow this and additional works at: https://docs.lib.purdue.edu/open_access_dissertations Recommended Citation Diab, Ahmed Mohamed Abdel-B, "The or le of PLK1 in Hepatitis B Virus (HBV) infection of the liver" (2016). Open Access Dissertations. 1214. https://docs.lib.purdue.edu/open_access_dissertations/1214 This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School Form 30 Updated 12/26/2015 PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance This is to certify that the thesis/dissertation prepared By Ahmed Mohamed Abdel-B Diab Entitled The role of PLK1 in Hepatitis B Virus (HBV) Infection of the Liver For the degree of Doctor of Philosophy Is approved by the final examining committee: Ourania Andrisani Andy W. Tao Co-chair Fabien Zoulim Co-chair Robert Geahlen Xiaoqi Liu To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy of Integrity in Research” and the use of copyright material. Approved by Major Professor(s): Ourania Andrisani Laurie Jaeger 10/6/2016 Approved by: Head of the Departmental Graduate Program Date i THE ROLE OF PLK1 IN HEPATITIS B VIRUS (HBV) INFECTION OF THE LIVER A Dissertation Submitted to the Faculty of Purdue University by Ahmed M Diab In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy December 2016 Purdue University West Lafayette, Indiana ii ACKNOWLEDGEMENTS I would like to begin by extending my gratitude to my committee members Robert Geahlen, Andy W. Tao and Xiaoqi Liu as well as committee co-chairs Ourania Andrisani and Fabien Zoulim for accepting to read, evaluate and thoughtfully critique my work. I also thank them for their confidence, continuous support and mentorship throughout my stay at Purdue. I would like to express my sincerest gratitude to my mentor and adviser Ourania Andrisani for her exceptional mentorship and the tremendous support she provided throughout the years. Her dedication to her work was inspiration, attention to detail and perseverance was inspirational. I appreciate her relentless encouragement, being readily available for scientific, intellectual and emotional support as well as her honest and constructive advice. I would like also to thank Fabien Zoulim and David Durantel for cordially granting me the opportunity to work with them and for their continuous professional and scientific support. My stay at INSERM Lyon was extremely beneficial for my scientific and personal development and it would have not been possible without their support. I will be utterly grateful for the expertise and experience I gained under their mentorship. iii I owe very special thanks to Ronald Hullinger for his outstanding mentorship, continuous support and the intellectual encounters. His wittiness, hospitability and exceptional culinary skills made my stay at Purdue memorable. I would like also thank my colleagues at the Andrisani lab, Saravana Kumar Mani, Hao Zhang, Huitao Fan, Zhibin Cui, Dante Johnson, Ellen Weigel, Zuo Ding and Li Ma. I would like to thank Adrien Foca, Nathalie Isorce, Dulce Alfaiate, Pascal Jalaguier, Suzanne Faure-Dupuy, Maëlle Locatelli, Valentina D’Arienzo and Olivier Hantz at INSERM Lyon. I would like to particularly thanks Adrien Foca for his tremendous help to complete my work on the PLK1 project in Lyon. It has been a pleasure to work with him. I am also obligated to thank my colleagues at Purdue Wen-Hung Want, I-Hsuan (Blair) Chen, Meng-Ju Wu, Anton Iliuk, Mariya Krisenko, Lama Alabdi and Cindy Xing for their help. I particularly thank I-Hsuan chen for her help with the mass spectrometry work. I thank François-Loïc Cosset and Floriane Fusil for the work on the humanized-liver mice and their help extending my findings to in vivo models. Finally, I would like to thank my friends at Purdue who made Lafayette a second home and my family for their belief in me and their continuous encouragement. iv TABLE OF CONTENTS Page LIST OF TABLES .................................................................................................................... ix LIST OF FIGURES ................................................................................................................... x LIST OF ABBREVIATIONS .................................................................................................... xii CHAPTER 1. INTRODUCTION ......................................................................................... 1 1.1 Hepatitis B......................................................................................................... 1 1.1.1 Pathogenesis ................................................................................................. 1 1.1.2 Carcinogenesis .............................................................................................. 2 1.1.3 Treatment and prevention............................................................................ 3 1.2 Hepatitis B virus ................................................................................................ 3 1.2.1 Genome organization and structure ............................................................. 3 1.2.2 HBV Life cycle ................................................................................................ 4 1.3 References: ....................................................................................................... 5 1.4 Figures: ............................................................................................................. 7 CHAPTER 2. HEPATITIS B VIRUS (HBV) CORE ANTIGEN (HBC): FUNCTION IN VIRUS BIOSYNTHESIS AND HOST GENE REGULATION ................................................................... 9 2.1 Introduction ...................................................................................................... 9 2.2 HBc structure .................................................................................................. 10 2.3 HBc, a nucleic acid chaperone ........................................................................ 12 2.4 HBc localization .............................................................................................. 13 2.5 HBc phosphorylation ...................................................................................... 16 2.6 HBc and interaction with host factors ............................................................ 19 v Page 2.7 HBc as a regulator of transcription ................................................................. 22 2.8 Unanswered questions and future directions ................................................ 24 2.9 References ...................................................................................................... 26 2.10 Figures............................................................................................................. 39 CHAPTER 3. MATERIALS AND METHODS .................................................................... 40 3.1 Cellular models ............................................................................................... 40 3.1.1 HepaRG cell lines......................................................................................... 40 3.1.1.1 HepaRG cell culture: ................................................................................ 40 3.1.1.2 HepaRG-TR-PLK1 cell lines: ..................................................................... 41 3.1.1.3 Infection in HepaRG cells and Primary Human Hepatocytes .................. 41 3.1.2 HepG2-NTCP cell line and infection ............................................................ 42 3.2 Production of HBV inoculum in HepG2.2.15 cells: ......................................... 43 3.2.1 Materials ..................................................................................................... 43 3.2.2 Protocol ....................................................................................................... 43 3.3 Tables .............................................................................................................. 46 3.4 References: ..................................................................................................... 47 CHAPTER 4. POLO-LIKE-KINASE 1 IS A PROVIRAL HOST-FACTOR FOR HEPATITIS B VIRUS REPLICATION: THERAPUTIC IMPLICATIONS ........................................................... 48 4.1 Abstract........................................................................................................... 48 4.2 Introduction .................................................................................................... 49 4.3 Results ............................................................................................................. 52 4.3.1 PLK1 is activated by HBV infection in non-dividing/differentiated hepatocytes ............................................................................................................... 52 4.3.2 PLK1 inhibitors, including BI 2536, suppress HBV DNA accumulation in persistently HBV-infected hepatocytes ....................................................................
Recommended publications
  • FK506-Binding Protein 12.6/1B, a Negative Regulator of [Ca2+], Rescues Memory and Restores Genomic Regulation in the Hippocampus of Aging Rats

    FK506-Binding Protein 12.6/1B, a Negative Regulator of [Ca2+], Rescues Memory and Restores Genomic Regulation in the Hippocampus of Aging Rats

    This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. A link to any extended data will be provided when the final version is posted online. Research Articles: Neurobiology of Disease FK506-Binding Protein 12.6/1b, a negative regulator of [Ca2+], rescues memory and restores genomic regulation in the hippocampus of aging rats John C. Gant1, Eric M. Blalock1, Kuey-Chu Chen1, Inga Kadish2, Olivier Thibault1, Nada M. Porter1 and Philip W. Landfield1 1Department of Pharmacology & Nutritional Sciences, University of Kentucky, Lexington, KY 40536 2Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, Birmingham, AL 35294 DOI: 10.1523/JNEUROSCI.2234-17.2017 Received: 7 August 2017 Revised: 10 October 2017 Accepted: 24 November 2017 Published: 18 December 2017 Author contributions: J.C.G. and P.W.L. designed research; J.C.G., E.M.B., K.-c.C., and I.K. performed research; J.C.G., E.M.B., K.-c.C., I.K., and P.W.L. analyzed data; J.C.G., E.M.B., O.T., N.M.P., and P.W.L. wrote the paper. Conflict of Interest: The authors declare no competing financial interests. NIH grants AG004542, AG033649, AG052050, AG037868 and McAlpine Foundation for Neuroscience Research Corresponding author: Philip W. Landfield, [email protected], Department of Pharmacology & Nutritional Sciences, University of Kentucky, 800 Rose Street, UKMC MS 307, Lexington, KY 40536 Cite as: J. Neurosci ; 10.1523/JNEUROSCI.2234-17.2017 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published.
  • C8cc08685k1.Pdf

    C8cc08685k1.Pdf

    Electronic Supplementary Material (ESI) for ChemComm. This journal is © The Royal Society of Chemistry 2018 Supporting Information Minimalist Linkers Suitable for Irreversible Inhibitors in Simultaneous Proteome Profiling, Live-Cell Imaging and Drug Screening Cuiping Guo,Yu Chang, Xin Wang, Chengqian Zhang, Piliang Hao*, Ke Ding and Zhengqiu Li* School of Pharmacy, Jinan University, Guangzhou, China 510632 *Corresponding author ([email protected]) 1. General Information All chemicals were purchased from commercial vendors and used without further purification, unless indicated otherwise. All reactions requiring anhydrous conditions were carried out under argon or nitrogen atmosphere using oven-dried glassware. AR-grade solvents were used for all reactions. Reaction progress was monitored by TLC on pre-coated silica plates (Merck 60 F254 nm, 0.25 µm) and spots were visualized by UV, iodine or other suitable stains. Flash column chromatography was carried out using silica gel (Qingdao Ocean). All NMR spectra (1H-NMR, 13C-NMR) were recorded on Bruker 300 MHz/400 MHz NMR spectrometers. Chemical shifts were reported in parts per million (ppm) referenced with respect to appropriate internal standards or residual solvent peaks (CDCl3 = 7.26 ppm, DMSO-d6 = 2.50 ppm). The following abbreviations were used in reporting spectra, br s (broad singlet), s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), dd (doublet of doublets). Mass spectra were obtained on Agilent LC-ESI-MS system. All analytical HPLC were carried out on Agilent system. Water with 0.1% TFA and acetonitrile with 0.1% TFA were used as eluents and the flow rate was 0.5 mL/min.
  • The Rise and Fall of the Bovine Corpus Luteum

    The Rise and Fall of the Bovine Corpus Luteum

    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
  • Reprogramming of Trna Modifications Controls the Oxidative Stress Response by Codon-Biased Translation of Proteins

    Reprogramming of Trna Modifications Controls the Oxidative Stress Response by Codon-Biased Translation of Proteins

    Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Chan, Clement T.Y. et al. “Reprogramming of tRNA Modifications Controls the Oxidative Stress Response by Codon-biased Translation of Proteins.” Nature Communications 3 (2012): 937. As Published http://dx.doi.org/10.1038/ncomms1938 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/76775 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins Clement T.Y. Chan,1,2 Yan Ling Joy Pang,1 Wenjun Deng,1 I. Ramesh Babu,1 Madhu Dyavaiah,3 Thomas J. Begley3 and Peter C. Dedon1,4* 1Department of Biological Engineering, 2Department of Chemistry and 4Center for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; 3College of Nanoscale Science and Engineering, University at Albany, SUNY, Albany, NY 12203 * Corresponding author: PCD, Department of Biological Engineering, NE47-277, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139; tel 617-253-8017; fax 617-324-7554; email [email protected] 2 ABSTRACT Selective translation of survival proteins is an important facet of cellular stress response. We recently demonstrated that this translational control involves a stress-specific reprogramming of modified ribonucleosides in tRNA.
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish

    Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish

    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
  • Nuclear Pore Proteins and the Control of Genome Functions

    Nuclear Pore Proteins and the Control of Genome Functions

    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Nuclear pore proteins and the control of genome functions Arkaitz Ibarra and Martin W. Hetzer Molecular and Cell Biology Laboratory, Salk Institute for Biological Studies, La Jolla, California 92037, USA Nuclear pore complexes (NPCs) are composed of several Cytoplasmic filaments are mainly formed by Nup358/ copies of ~30 different proteins called nucleoporins (Nups). RanBP2, Nup214, and Nup88, while the nuclear basket is NPCs penetrate the nuclear envelope (NE) and regulate the composed of Nup153 and Tpr (Fig. 1; for Nup othologs, see nucleocytoplasmic trafficking of macromolecules. Beyond Rothballer and Kutay 2012). this vital role, NPC components influence genome func- The selective access of regulatory factors into the tions in a transport-independent manner. Nups play an nucleus and export of specific RNA molecules mediated evolutionarily conserved role in gene expression regulation by the NPC is required for the accurate progression of most that, in metazoans, extends into the nuclear interior. major cellular processes. However, our perception of Additionally, in proliferative cells, Nups play a crucial role the NPC components is rapidly evolving, as accumulating in genome integrity maintenance and mitotic progression. evidence indicates that they can also directly impact Here we discuss genome-related functions of Nups and DNA metabolism by genome-related functions (Liang their impact on essential DNA metabolism processes such and Hetzer 2011). Among these, one of the most remark- as transcription, chromosome duplication, and segregation. able and well-conserved roles of Nups is to associate with specific target genes to regulate their transcriptional activity (Casolari et al.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis

    Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis

    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
  • Supplementary Materials

    Supplementary Materials

    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
  • TTDN1 (MPLKIP) (NM 138701) Human 3' UTR Clone Product Data

    TTDN1 (MPLKIP) (NM 138701) Human 3' UTR Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC204348 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: MPLKIP Synonyms: ABHS; C7orf11; ORF20; TTD4 ACCN: NM_138701 Insert Size: 2000 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone – SC204348 Insert Sequence: >SC204348 3’UTR clone of NM_138701 The sequence shown below is from the reference sequence of NM_138701. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC ACAGGCAAAAAAGGAAGATACTTTTGTTAACATTTCTGAAATTCAACTGGAAGCTTCATGTGTCAGGAA CATCTTGGACAAAACTTTAAGTTGTGTTGATATAAATTTACCCAAAGATGATGACTTTGATTGGATAAT TAGTAAGGTCTTTTTGTTATTTTTCATCGTATCAGGTATTGTTGATATTAGAGAAAAAAGTAGGATAAC TTGCAACATTTAGCTCTGGAAGTACCTACCACATTTTAGAGATTTACCGTTTCCATATATTTAACATTC CTGGTTACATAATGGACATTTGTCTTTTAATGTTTTTTCAATGTTTTAAAATAAAACATTTTGTCTTCT AGCTATTGTGGTTTTGTGGTATGATAAAGAAGTAGACTTACTACAGTAATGCTTTGTAGTCACTTAGAG TTCATAGGTAAATGTTTTGCAAATTATTTTTGAAAATGAAATAGGTAAACCATCCTTTGAGCTGTAGAC
  • Product Data Sheet Purified Anti-NUP153

    Product Data Sheet Purified Anti-NUP153

    Version: 2 Revision Date: 2016-01-08 Product Data Sheet Purified anti-NUP153 Catalog # / Size: 906201 / 100 µl Previously: Covance Catalog# MMS-102P Clone: QE5 Isotype: Mouse IgG1 Immunogen: The QE5 monoclonal antibody was generated against rat liver nuclear envelope proteins. Reactivity: Eukaryote Preparation: The antibody was purified by affinity chromatography. Formulation: Phosphate-buffered solution + 0.03% thimerosal. Concentration: 1 mg/ml Storage: The antibody solution should be stored undiluted between 2°C and 8°C. Please note the storage condition for this antibody has been changed from -20°C to between 2°C and 8°C. You can also check your vial or your Methanol fixed HeLa stained with the CoA to find the most accurate storage condition for this antibody. antibody QE5. This antibody brilliantly highlights the nuclear membrane (green). The golgi is stained with the Applications: antibody to Giantin. Applications: ICC, WB, IF, IP IEM - Reported in literature Recommended Usage: Each lot of this antibody is quality control tested by Immunocytochemistry. The optimal working dilution should be determined for each specific assay condition. • WB: 1:500* • IF: 1:250 • IP: 1:50 Application Notes: This antibody is effective in immunoblotting, immunofluorescence (IF) and immunoprecipitation (IP). *Predicted MW = 250 kD This antibody recognizes NUP153 as well as two related nuclear pore complex proteins: NUP214 and p62. By immunofluorescence, QE5 labels the nuclear envelope of eukaryotic cells giving a punctate staining pattern. Application References: 1. Pare GC, Easlick JL, Mislow JM, McNally EM, Kapiloff MS. Nesprin-1alpha contributes to the targeting of mAKAP to the cardiac myocyte nuclear envelope.