DOCSLIB.ORG

Value Cluster LEFTY1 2.690865644 0.899 0.067 0.00E+00 C1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Value Cluster LEFTY1 2.690865644 0.899 0.067 0.00E+00 C1 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut Supplementary Table 3. Marker genes in each malignant epithelial cells cluster Gene Log(Fold-change) Pct.1 Pct.2 Adj p- value Cluster LEFTY1 2.690865644 0.899 0.067 0.00E+00 C1 TFF2 2.186713379 0.855 0.36 0.00E+00 C1 CCT2 1.701377329 0.801 0.283 0.00E+00 C1 SPINK4 1.663911876 0.654 0.128 0.00E+00 C1 TFF3 1.632604627 0.882 0.43 0.00E+00 C1 CXCL17 1.616238928 0.659 0.079 0.00E+00 C1 LDHB 1.407263152 0.711 0.137 0.00E+00 C1 CLDN18 1.398880496 0.825 0.278 0.00E+00 C1 TESC 1.382790712 0.79 0.212 0.00E+00 C1 PDIA6 1.295630983 0.789 0.404 0.00E+00 C1 PSCA 1.263596359 0.922 0.241 0.00E+00 C1 SRD5A3 1.246561606 0.586 0.098 0.00E+00 C1 PDIA4 1.180717046 0.849 0.419 0.00E+00 C1 DPCR1 1.175754587 0.506 0.06 0.00E+00 C1 WBP5 1.163957541 0.734 0.106 0.00E+00 C1 LYZ 1.141614179 0.969 0.727 0.00E+00 C1 RAP1B 1.125989315 0.68 0.255 0.00E+00 C1 S100P 1.055862172 0.962 0.758 0.00E+00 C1 OS9 1.05478066 0.787 0.338 0.00E+00 C1 R3HDM2 1.031695733 0.742 0.167 0.00E+00 C1 B3GNT7 1.031632795 0.549 0.088 0.00E+00 C1 MORF4L1 1.023176967 0.768 0.409 0.00E+00 C1 TMEM165 0.999912261 0.649 0.196 0.00E+00 C1 GALNT3 0.995165397 0.705 0.254 0.00E+00 C1 TFF1 0.962929536 0.96 0.591 0.00E+00 C1 LY6D 0.94328396 0.484 0.007 0.00E+00 C1 MIA 0.895355862 0.623 0.103 0.00E+00 C1 MDM2 0.864864363 0.615 0.089 0.00E+00 C1 YEATS4 0.864197638 0.585 0.128 0.00E+00 C1 CPM 0.831257805 0.511 0.026 0.00E+00 C1 NGFRAP1 0.776686405 0.552 0.027 0.00E+00 C1 TCEAL8 0.747773737 0.549 0.064 0.00E+00 C1 SFTA2 0.710176136 0.52 0.066 0.00E+00 C1 FKBP10 0.567908872 0.427 0.007 0.00E+00 C1 HOXB2 0.52009395 0.466 0.03 0.00E+00 C1 ALDH1L1 0.478075328 0.386 0.009 0.00E+00 C1 BCAR4 0.405445074 0.384 0 0.00E+00 C1 YWHAE 0.941441648 0.797 0.453 6.63E-301 C1 MUC5B 0.749504079 0.441 0.032 9.41E-296 C1 PKM 1.024781554 0.835 0.518 4.67E-293 C1 ATP1B1 1.094054311 0.838 0.514 5.73E-290 C1 PRKCDBP 0.521875888 0.445 0.04 1.78E-288 C1 PTP4A2 1.006611051 0.74 0.358 1.11E-281 C1 RAB34 0.379470725 0.394 0.022 1.26E-279 C1 C1QBP 1.055652495 0.699 0.29 1.74E-277 C1 AGR2 1.043123785 0.967 0.832 7.02E-277 C1 Zhang M, et al. Gut 2021; 70:1–12. doi: 10.1136/gutjnl-2019-320368 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut VSIG1 0.728079807 0.537 0.093 8.17E-275 C1 NUP107 0.744204709 0.569 0.123 2.00E-274 C1 REG4 1.083913316 0.905 0.499 1.30E-270 C1 RP11-10A14.5 0.297216094 0.321 0 2.05E-269 C1 PTPLAD1 0.947636123 0.666 0.255 8.18E-269 C1 KRT17 0.903244887 0.401 0.03 1.67E-268 C1 DSTN 0.854726665 0.853 0.613 3.41E-268 C1 GALNT7 0.709216869 0.631 0.165 7.55E-268 C1 TFPI 0.753551093 0.647 0.186 1.34E-262 C1 HSP90AB1 0.844714478 0.922 0.665 7.40E-262 C1 SRSF9 0.978838275 0.658 0.282 6.15E-261 C1 GPR110 0.792021592 0.397 0.033 1.05E-256 C1 YWHAQ 0.917645011 0.684 0.318 3.66E-256 C1 SCGB2A1 0.350719764 0.323 0.005 1.20E-255 C1 DCTN2 0.855691592 0.617 0.219 2.39E-255 C1 CDK4 0.96724454 0.603 0.204 5.51E-255 C1 BEX2 0.312185722 0.323 0.006 1.10E-252 C1 ZFAND6 0.859643177 0.62 0.228 7.87E-251 C1 HSP90B1 0.894697739 0.881 0.592 7.89E-251 C1 RP11-2E17.1 0.333995995 0.3 0 1.03E-250 C1 CSTB 1.133047426 0.85 0.649 1.19E-248 C1 ULBP2 0.349850496 0.325 0.009 4.54E-247 C1 PUM1 0.730101664 0.655 0.226 1.47E-245 C1 CLIC1 1.06446547 0.835 0.65 1.46E-244 C1 BACE2 0.776146486 0.629 0.21 1.42E-242 C1 ANXA5 0.701165432 0.568 0.159 9.35E-239 C1 ZFC3H1 0.677887382 0.611 0.17 8.10E-234 C1 MAL2 0.952741646 0.742 0.397 1.27E-233 C1 MBD6 0.504246192 0.497 0.097 3.90E-231 C1 RBM47 0.886709293 0.705 0.357 5.12E-229 C1 TUBB 0.948856295 0.719 0.338 1.85E-228 C1 RAB3IP 0.740840685 0.566 0.161 5.86E-226 C1 SMC5 0.620713614 0.591 0.179 4.29E-224 C1 PIP4K2C 0.444414038 0.423 0.064 6.67E-223 C1 SLC35E3 0.422166937 0.392 0.05 3.86E-221 C1 ARL14 1.302472547 0.738 0.367 1.90E-220 C1 ANXA10 0.781303497 0.751 0.311 4.97E-220 C1 FRS2 0.36581964 0.368 0.039 5.55E-219 C1 SERINC2 0.751146496 0.785 0.471 1.10E-218 C1 HMGA1 0.836465129 0.781 0.485 1.33E-218 C1 C8orf4 0.869162861 0.726 0.288 7.08E-215 C1 RP11-519G16.5 0.275871768 0.278 0.005 2.19E-214 C1 FDFT1 0.88076215 0.625 0.257 6.92E-212 C1 TMED2 0.851218937 0.676 0.347 6.88E-210 C1 KRT19 0.82881006 0.969 0.874 4.18E-209 C1 CHMP1B 0.767154492 0.692 0.311 8.40E-209 C1 MTDH 0.719515427 0.792 0.488 4.07E-208 C1 RAB32 0.275438262 0.344 0.032 1.08E-204 C1 Zhang M, et al. Gut 2021; 70:1–12. doi: 10.1136/gutjnl-2019-320368 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) Gut RAB21 0.481720994 0.478 0.11 8.39E-204 C1 CAP1 0.845841827 0.641 0.316 3.80E-203 C1 MYL12A 0.947954026 0.817 0.649 7.09E-203 C1 SDCBP 0.777669854 0.685 0.346 1.33E-202 C1 STARD10 0.733799598 0.854 0.536 1.36E-202 C1 SRP9 0.782786299 0.677 0.355 4.62E-202 C1 AHR 0.538273196 0.573 0.167 5.71E-202 C1 AKIRIN1 0.47764806 0.499 0.126 1.29E-201 C1 PDIA3 0.795061975 0.766 0.484 2.87E-197 C1 AKAP13 0.749638262 0.693 0.319 4.44E-197 C1 DST 0.680727101 0.706 0.282 5.07E-197 C1 TSPAN31 0.445008926 0.459 0.103 4.70E-196 C1 ANXA1 0.990611597 0.623 0.236 2.26E-195 C1 ANXA2 0.923005092 0.867 0.733 1.09E-194 C1 TFPT 0.433556663 0.492 0.12 3.67E-194 C1 SYNE4 0.276709421 0.295 0.018 5.91E-194 C1 PABPC1 0.58828564 0.933 0.752 9.95E-194 C1 MGST1 0.72142683 0.648 0.274 3.87E-193 C1 HIST1H2BK 0.845917465 0.665 0.342 6.48E-193 C1 MAGED1 0.397100639 0.427 0.082 1.45E-192 C1 CRK 0.526217931 0.559 0.178 2.04E-192 C1 TSPAN3 0.754095483 0.776 0.493 1.67E-191 C1 AGAP2 0.324034798 0.251 0.005 1.72E-191 C1 ARMCX3 0.393037375 0.435 0.087 9.19E-191 C1 MARS 0.507454194 0.464 0.107 1.66E-190 C1 RAN 0.831480759 0.747 0.465 1.81E-190 C1 ECI2 0.572148619 0.455 0.112 3.03E-190 C1 RHBDL2 0.416071426 0.456 0.102 9.05E-190 C1 HSPA5 0.813668975 0.775 0.442 5.45E-189 C1 ICAM2 0.282680792 0.283 0.017 1.47E-188 C1 CTSE 0.630732705 0.717 0.316 1.78E-187 C1 ZNF430 0.427332087 0.379 0.063 2.47E-187 C1 TM4SF1 1.0672273 0.705 0.377 4.05E-187 C1 VAPA 0.771645976 0.65 0.343 1.27E-186 C1 RCAN1 0.635068931 0.409 0.077 5.09E-186 C1 FRMD4B 0.610702297 0.43 0.092 1.65E-185 C1 DDIT3 0.796008573 0.606 0.219 1.93E-185 C1 PRPF4B 0.740129307 0.815 0.408 7.56E-184 C1 ABCF1 0.663423185 0.722 0.338 8.01E-184 C1 LDLR 0.774135152 0.71 0.337 2.04E-183 C1 TSPAN13 0.69173611 0.603 0.26 3.34E-183 C1 ACTR2 0.644131887 0.651 0.298 1.18E-182 C1 RAB11FIP1 0.797810148 0.766 0.437 3.38E-181 C1 NDUFV2 0.780467632 0.671 0.38 5.18E-180 C1 KRT7 0.686045312 0.698 0.306 1.03E-179 C1 NMB 0.452105539 0.428 0.099 1.55E-179 C1 SQLE 0.820767424 0.628 0.258 1.61E-179 C1 ADAM17 0.421792244 0.455 0.111 2.05E-178 C1 Zhang M, et al.
Load more

Recommended publications
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Eif3j Antibody A
    Revision 1 C 0 2 - t eIF3J Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 1 6 Web: [email protected] 2 www.cellsignal.com 3 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP H M R Endogenous 35 Rabbit O75822 8669 Product Usage Information (5). eIF3J has been shown to associate with the aminoacyl site and mRNA entry channel of the 40S ribosomal subunit (6). eIF3J has also been shown to have an additional role in Application Dilution the recycling of post-termination complexes (7). 1. Masutani, M. et al. (2007) EMBO J 26, 3373-83. Western Blotting 1:1000 2. Chaudhuri, J. et al. (1999) J Biol Chem 274, 17975-80. Immunoprecipitation 1:50 3. Holz, M.K. et al. (2005) Cell 123, 569-80. 4. Harris, T.E. et al. (2006) EMBO J 25, 1659-68. 5. Fraser, C.S. et al. (2004) J Biol Chem 279, 8946-56. Storage 6. Fraser, C.S. et al. (2007) Mol Cell 26, 811-9. Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% 7. Pisarev, A.V. et al. (2007) Cell 131, 286-99. glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity eIF3J Antibody detects endogenous levels of total eIF3J protein. Species Reactivity: Human, Mouse, Rat Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to the sequence of human eIF3J.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • TTDN1 (MPLKIP) (NM 138701) Human 3' UTR Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC204348 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: MPLKIP Synonyms: ABHS; C7orf11; ORF20; TTD4 ACCN: NM_138701 Insert Size: 2000 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 TTDN1 (MPLKIP) (NM_138701) Human 3' UTR Clone – SC204348 Insert Sequence: >SC204348 3’UTR clone of NM_138701 The sequence shown below is from the reference sequence of NM_138701. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC ACAGGCAAAAAAGGAAGATACTTTTGTTAACATTTCTGAAATTCAACTGGAAGCTTCATGTGTCAGGAA CATCTTGGACAAAACTTTAAGTTGTGTTGATATAAATTTACCCAAAGATGATGACTTTGATTGGATAAT TAGTAAGGTCTTTTTGTTATTTTTCATCGTATCAGGTATTGTTGATATTAGAGAAAAAAGTAGGATAAC TTGCAACATTTAGCTCTGGAAGTACCTACCACATTTTAGAGATTTACCGTTTCCATATATTTAACATTC CTGGTTACATAATGGACATTTGTCTTTTAATGTTTTTTCAATGTTTTAAAATAAAACATTTTGTCTTCT AGCTATTGTGGTTTTGTGGTATGATAAAGAAGTAGACTTACTACAGTAATGCTTTGTAGTCACTTAGAG TTCATAGGTAAATGTTTTGCAAATTATTTTTGAAAATGAAATAGGTAAACCATCCTTTGAGCTGTAGAC
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Gene Expression Profiling Analysis Contributes to Understanding the Association Between Non-Syndromic Cleft Lip and Palate, and Cancer
    2110 MOLECULAR MEDICINE REPORTS 13: 2110-2116, 2016 Gene expression profiling analysis contributes to understanding the association between non-syndromic cleft lip and palate, and cancer HONGYI WANG, TAO QIU, JIE SHI, JIULONG LIANG, YANG WANG, LIANGLIANG QUAN, YU ZHANG, QIAN ZHANG and KAI TAO Department of Plastic Surgery, General Hospital of Shenyang Military Area Command, PLA, Shenyang, Liaoning 110016, P.R. China Received March 10, 2015; Accepted December 18, 2015 DOI: 10.3892/mmr.2016.4802 Abstract. The present study aimed to investigate the for NSCL/P were implicated predominantly in the TGF-β molecular mechanisms underlying non-syndromic cleft lip, signaling pathway, the cell cycle and in viral carcinogenesis. with or without cleft palate (NSCL/P), and the association The TP53, CDK1, SMAD3, PIK3R1 and CASP3 genes were between this disease and cancer. The GSE42589 data set found to be associated, not only with NSCL/P, but also with was downloaded from the Gene Expression Omnibus data- cancer. These results may contribute to a better understanding base, and contained seven dental pulp stem cell samples of the molecular mechanisms of NSCL/P. from children with NSCL/P in the exfoliation period, and six controls. Differentially expressed genes (DEGs) were Introduction screened using the RankProd method, and their potential functions were revealed by pathway enrichment analysis and Non-syndromic cleft lip, with or without cleft palate (NSCL/P) construction of a pathway interaction network. Subsequently, is one of the most common types of congenital defect and cancer genes were obtained from six cancer databases, and affects 3.4-22.9/10,000 individuals worldwide (1).
    [Show full text]
  • Novel Mutation of Type 1 Insulin-Like Growth Factor Receptor (IGF1R) Gene in a Severe Short Stature Pedigree Identified by Targeted Next-Generation Sequencing
    Research Article Novel mutation of type 1 insulin-like growth factor receptor (IGF1R) gene in a severe short stature pedigree identified by targeted next-generation sequencing Running title: Novel mutation of type I insulin-like growth factor receptor Yu Yang1*, Hui Huang2, Ka Chen2, Li Yang1, Li-ling Xie1, Ting Xiong1, and Xian Wu1 1Department of Endocrinology, Metabolism, and Genetics, Jiangxi Provincial Children’s Hospital, Nanchang 330006, Jiangxi, China 2Central laboratory, Jiangxi Provincial Children’s Hospital, Nanchang 330006, Jiangxi, China *Corresponding author: Yu Yang, Department of Endocrinology, Metabolism, and Genetics, Jiangxi Provincial Children’s Hospital, 1 No. 122 Yangming Road Donghu District, Nanchang 330006, Jiangxi, China E-mail: [email protected] Abstract Background: Insulin-like growth factor receptor IGF-1R deficiency is a rare form of short stature, and is difficult to clinically diagnose. Targeted next-generation sequencing (NGS) allows for the rapid and inexpensive assessment of short stature. Case presentation: We identified mutations in the pedigree of a Chinese boy with severe short stature using targeted NGS; we then assessed the clinical characteristics and evaluated the efficacy of growth hormone therapy. NGS analysis revealed a novel heterozygous missense mutation in exon3 (c.926C>T, p.S309L) of the type I IGF-1R gene in the proband, which was inherited from the mother. The proband, mother, and grandfather suffered from severe growth failure. After recombinant human growth hormone therapy, the patient’s growth rate increased. Conclusions: The novel missense mutation in IGF1R (c.926C>T, p.S309L), is associated with severe short stature in Chinese individuals. Targeted NGS may enable efficient diagnosis and genetic consultation of children with short stature.
    [Show full text]
  • Bioinformatics Analysis for the Identification of Differentially Expressed Genes and Related Signaling Pathways in H
    Bioinformatics analysis for the identification of differentially expressed genes and related signaling pathways in H. pylori-CagA transfected gastric cancer cells Dingyu Chen*, Chao Li, Yan Zhao, Jianjiang Zhou, Qinrong Wang and Yuan Xie* Key Laboratory of Endemic and Ethnic Diseases , Ministry of Education, Guizhou Medical University, Guiyang, China * These authors contributed equally to this work. ABSTRACT Aim. Helicobacter pylori cytotoxin-associated protein A (CagA) is an important vir- ulence factor known to induce gastric cancer development. However, the cause and the underlying molecular events of CagA induction remain unclear. Here, we applied integrated bioinformatics to identify the key genes involved in the process of CagA- induced gastric epithelial cell inflammation and can ceration to comprehend the potential molecular mechanisms involved. Materials and Methods. AGS cells were transected with pcDNA3.1 and pcDNA3.1::CagA for 24 h. The transfected cells were subjected to transcriptome sequencing to obtain the expressed genes. Differentially expressed genes (DEG) with adjusted P value < 0.05, | logFC |> 2 were screened, and the R package was applied for gene ontology (GO) enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The differential gene protein–protein interaction (PPI) network was constructed using the STRING Cytoscape application, which conducted visual analysis to create the key function networks and identify the key genes. Next, the Submitted 20 August 2020 Kaplan–Meier plotter survival analysis tool was employed to analyze the survival of the Accepted 11 March 2021 key genes derived from the PPI network. Further analysis of the key gene expressions Published 15 April 2021 in gastric cancer and normal tissues were performed based on The Cancer Genome Corresponding author Atlas (TCGA) database and RT-qPCR verification.
    [Show full text]
  • Translation Initiation Factor Eif3h Targets Specific Transcripts To
    Translation initiation factor eIF3h targets specific transcripts to polysomes during embryogenesis Avik Choudhuria,b, Umadas Maitraa,1, and Todd Evansb,1 aDepartment of Developmental and Molecular Biology, Albert Einstein College of Medicine of Yeshiva University, Bronx, NY 10461; and bDepartment of Surgery, Weill Cornell Medical College, New York, NY 10065 Edited by Igor B. Dawid, The Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD, and approved April 30, 2013 (received for review February 14, 2013) Eukaryotic translation initiation factor 3 (eIF3) plays a central role eukaryotes. These—eIF3d, eIF3e, eIF3f, eIF3h, eIF3j, eIF3k, in translation initiation and consists of five core (conserved) sub- eIF3l, and eIF3m—were designated “non-core” subunits (4). units present in both budding yeast and higher eukaryotes. Higher In contrast to the budding yeast, the genome of the fission eukaryotic eIF3 contains additional (noncore or nonconserved) yeast Schizosaccharomyces pombe contains structural homologs subunits of poorly defined function, including sub-unit h (eIF3h), of at least five noncore (nonconserved) eIF3 subunits—eIF3d, which in zebrafish is encoded by two distinct genes (eif3ha and eIF3e, eIF3f, eIF3h, and eIF3m. The gene encoding eIF3f is eif3hb). Previously we showed that eif3ha encodes the predominant essential for growth, whereas eIF3d, eIF3e, and eIF3h are dis- isoform during zebrafish embryogenesis and that depletion of this pensable for growth and viability (5–11). However, deleted factor causes defects in the development of the brain and eyes. To strains show specific phenotypes including defects in meiosis/ investigate the molecular mechanism governing this regulation, we sporulation (6, 9, 11).
    [Show full text]
  • Supplemental Table 1. 3 Types of Signals That Are Involved in T Cell Activation
    Supplemental Table 1. 3 types of signals that are involved in T cell activation Syn-T cells Allo-T cells CD3/28- T cells First signal Not engaged MHC-alloantigen- CD3-Engaged MHC-TCR-CD3 TCR-CD3 Engaged pathway Second signal Co- Not sure CD28, CTLA4, CD28 signaling stimulatory ICOS, OX40, CD30, molecules CD153 Third signal Not sure Cytokines from Allo- Cytokines from cytokines DCs and Allo-T cells CD3/28-T cells Supplementary Figure 1 Pearson Correlation Coefficient R A Exp.2 Exp.2 Exp.2 Syn Allo CD3/28 Exp.1 Exp.3 Exp.1 Exp.3 Exp.1 Exp.3 R=0.800981 R=0.815741 R=0.818577 Allo Allo Allo B Exp1 Exp2 Exp3 E Exp2 Syn CD3/28 Syn CD3/28 Syn CD3/28 R=0.6701227 R=0.6504327 R=0.6680361 Pearson Correlation Coefficient R for 9 biological replicates for affymatrix microarrays Allo C D Allo miRNA Exp1 Exp2 E Syn CD3/28 Syn CD3/28 R=0.938515(CD3/28) R=0.703578681 R=0.753278283 Pearson Correlation Coefficient R for 6 biological replicates for miRNA microarrays Supplementary Table 2 .Enrichments of Transcripts differentially Increased in Allo- T cells Fold Ch. Fold Ch. Fold Ch. Fold Fold Symbol ( Log) Symbol ( Log) Symbol (Log) Symbol Cha.(log) Symbol Ch.(Log) Alg8 2.060308 Cpsf6 1.22965 Arl6ip6 1.145309 5730471H19Rik 1.081846 Gmfb 1.029386 Melk 1.980582 Pno1 1.22959 C80350 1.143319 Grsf1 1.081728 Psmb7 1.028187 Eif3j 1.939782 BF228097 1.22056 Eif4a1 1.13752 Lmnb1 1.073975 Gltp 1.027779 Rg9mtd2 1.81345 Oxnad1 1.20962 Appbp2 1.137063 Senp1 1.073847 Fundc2 1.0272 Plk4 1.791148 BF228097 1.20522 Prkaca 1.136359 Psmd6 1.072738 Narfl 1.026824 Ikzf4 1.759402
    [Show full text]
  • MPLKIP Gene M-Phase Specific PLK1 Interacting Protein
    MPLKIP gene M-phase specific PLK1 interacting protein Normal Function The MPLKIP gene (formerly known as C7orf11) provides instructions for making a protein called M-phase specific PLK1 interacting protein. The function of this protein is unclear. Based on its interaction with a protein called Plk1, the MPLKIP protein is thought to play a role in cell growth and division. In particular, it may help regulate the cell cycle, which is the cell's way of replicating itself in an organized, step-by-step fashion. Researchers speculate that the MPLKIP protein may also be involved in gene transcription, which is the first step in protein production. Health Conditions Related to Genetic Changes Trichothiodystrophy At least eight mutations in the MPLKIP gene have been identified in people with trichothiodystrophy. These mutations cause some cases of the non-photosensitive form of the disorder, which is not associated with extreme sensitivity to ultraviolet (UV) rays from sunlight. All of the known MPLKIP gene mutations prevent the production of any functional MPLKIP protein. It is unknown how a loss of this protein leads to the characteristic features of trichothiodystrophy, including slow growth, intellectual disability, and brittle hair. Other Names for This Gene • ABHS • C7orf11 • chromosome 7 open reading frame 11 • ORF20 • TTD non-photosensitive 1 protein • TTDN1 • TTDN1_HUMAN Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 A dditional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of MPLKIP
    [Show full text]