Mapping of Nrda and Nrdb in Escherichia Coli K-12 JAMES A

Total Page:16

File Type:pdf, Size:1020Kb

Load more

JOURNAL OF BACTERIOLOGY, Dec. 1976, p. 810-814 Vol. 128, No. 3 Copyright © 1976 American Society for Microbiology Printed in U.S.A. Mapping of nrdA and nrdB in Escherichia coli K-12 JAMES A. FUCHS* AND H. OLLE KARLSTROM' Medicinska Nobelinstitutet, Biokemiska Avdelningen, Karolinska Institutet, Stockholm, Sweden, and Department ofBiochemistry, University of Minnesota, College ofBiological Sciences, St. Paul, Minnesota 55108* Received for publication 15 July 1976 The structural genes coding for the Bi and B2 subunits of the enzyme ribonucleoside diphosphate reductase, nrdA (formerly designated dnaF) and nrdB, respectively, have been mapped in Escherichia coli. They are located at approximately 48 min. The gene order in this region of the E. coli chromosome was found to be purF glpT nrdB nrdA nalA cdd dcd his. In Escherichia coli, the enzyme ribonucleo- thioredoxin reductase obtained from E. coli B were side diphosphate reductase (RDP reductase) available in our laboratory. Davis minimal medium (E.C. 1.17.4.1) is responsible for the conversion (6) and L broth (15) were used. of ribonucleotides to deoxyribonucleotides. It Bacterial strains. All ofthe bacterial strains used thus in this study were derivatives ofE. coli K-12 and are catalyzes the first reaction in a pathway described in Table 1. specific for the synthesis of deoxyribonucleic Selection and testing of phenotypes. The follow- acid precursors (4). RDP reductase contains two ing conditions were used to detect the phenotypes subunits designated Bi and B2. Each of the caused by the indicated mutations: subunits is composed of two polypeptide chains nrdA (formerly dnaF [20]): Failure of cells to (4). A mutant containing a structurally altered grow at 40°C on either enriched or minimal plates Bi subunit (8) and a mutant containing a struc- supplemented with 20 Ag of thymidine per ml. turally altered B2 subunit (7, 9) have been nrdB: Inhibition of growth by hydroxyurea (0.25, characterized. The mutations present in these 0.50, or 1.0 mg/ml) in minimal media in the pres- strains have been designated nrdA and ence of 20 gg of thymidine per ml. Sensitivity of nrdB, both nrdB and nrdB+ is increased at a lower tem- respectively. The mutated Bi subunit was perature (30°C) and in thymine auxotrophs. shown to be extremely thermolabile in vitro (8), nalA: Resistance to 40 ,ug of nalidixic acid per ml. and the mutated B2 subunit was found to have cdd in thyA+ strains: Inhibition of growth by 5- a greatly decreased activity, which could be fluorodeoxycytidine (0.2 /,g/ml). partially restored by the addition of high con- cdd in thyA strains: Growth with 5-methyl de- centrations of sodium acetate (7). The nrdA oxycytidine as thymine source. mutation prevents the growth of strains har- cdd in pyr strains: Growth with deoxycytidine boring it at temperatures above 40°C even in (20 ,ug/ml) as pyrimidine source. enriched media. The nrdB mutant was isolated cdd in thyA pyr strains: Growth with 5-methyl deoxycytidine and deoxycytidine as thymine and from a specially constructed strain as a deoxy- pyrimidine sources, respectively. uridine auxotroph (7), but the mutation was gipT: Inability to utilize 0.4% a-glycerol phos- found to be more easily recognizable by the phate as a carbon source. Isolation ofgipT mutants increased sensitivity to hydroxyurea that it was accomplished by planting a culture on minimal conferred to strains harboring it. We have used plates containing 0.4% glycerol as a carbon source these properties to map the nrdA and nrdB and 0.2 mg of phosphonomycin per ml. Resistant genes. In the course of these studies we also colonies were purified and screened for those unable located the approximate map position of two to use 0.4% a-glycerol phosphate as a carbon source additional deoxyribonucleotide-metabolizing (13). genes, cdd and dcd, the genes dcd (formerly paxA [16]): Sensitivity to 100 pAg of coding for deoxy- 5-bromodeoxyuridine per ml at 42°C. cytidine (cytidine) deaminase and deoxycyti- Conjugation. Matings between many different dine triphosphate deaminase, respectively. Hfr strains and a single female were carried out as follows. A total of 25 Hfr strains were grown over- MATERIALS AND METHODS night in 0.1 ml of L broth in separate compartments Materials. [3H]cytidine diphosphate was obtained of an autoclavable nylon microculture container from Schwarz/Mann. Hydroxyurea was a gift from (E.L.E.S.A., 20129 Milan, Italy). The cultures were E. R. Squibb and Sons. Purified thioredoxin and diluted 10-fold and grown for 2 h. A 0.3-ml sample of each Hfr was transferred to a new block and com- ' Present address: University Institute of Microbiology, bined with 0.3 ml of the exponentially growing fe- Copenhagen, Denmark. male. At various times samples from each mating 810 VOL. 128, 1976 RDP REDUCTASE-DEFICIENT MUTANTS OF E. COLI 811 TABLE 1. E. coli strains used Strain Sex of chromosome Source of Genotype derivation/reference KL16 Hfr AB2572 Hfr CGSC4280 F'129 argG metB leu his recA mtl xyl malA gal lacY or lacZ str Barbara Bachman (KLF29/JC1553) LD195 F- his argG metB leu lacY or klcZ malA xyl mtl gal str tpp cdd dcd nrdB 7, 9 (P1) E101 F- thr leu thi thyA dra drm pup tonA lacY supE nrdA J. Gross (20) K-43 F- thi tonB trp his met cys str gal lac tonA tsx (A) G. Bertani KK391 F- thi met cys str gal lac tonA tsx nrdB cdd See text KK395 F- thr leu thi thyA dra drm pup tonA lacY supE nrdA nalA From E101 KK408 F- thi met cys str gal lac tonA tsx nrdB cdd thyA From KK391 KK419 F- met drm thyA nalA glpT Constructed in our lab KK420 F- thi met cys str gal lac tonA tsx nrdB cdd thyA glpT From KK395 KK424 F- thr leu thi thyA dra drm pup tonA lacY supE nrdA nalA glpT From KK395 KK342 F'129 his metB leu lacY or lacZ nalA str xyl dcd cdd tpp nrdB (P1) See text KK343 F'129 his metB leu lacY or kzcZ naIA str xyl dcd cdd tpp nrdB (P1) See text HD1038 F- his metB leu argG lacY or lacZ malA str xyl mtl dcd gal 17 JC411 F- his metB leu argG lacY or kacZ malA str xyl gal mtl 17 LD181 F- his metB leu lacY or lacZ malA gal str xyl mtl dcd cdd tpp 7 CGSC4249 F'103 argG metB his trp leu mtl xyl malA gal lacY or lacZ str Barbara Bachman (KLF3/JC1153) LD188 F- his metB his trp leu lacY malA str xyl mtl dcd cdd tpp pyrE thyA 6 were transferred to selective agar plates by inverted recombinants from noninterrupted matings nails held by a Plexiglas template. were analyzed for unselected markers. Since Interrupted and long-term matings were per- the recipient contains cdd (mutation in the formed as described by Curtiss et al. (5). P1 transduction. P1 transductions were con- gene coding for cytidine [deoxycytidine] deami- ducted essentially as described by Lennox (12) ex- nase) which had previously been located clock- cept that phage P1 vir-1 was used. Map locations are wise from his (0. Karlstrom, unpublished given according to the 100-min map (1). data, and in Salmonella [2]), cdd+ was ana- Enzyme assays. RDP reductase assays were con- lyzed as well. Table 2 indicates that the selec- ducted as previously described (4). tion of nrd+ resulted in a low frequency of Protein estimation. Protein concentrations in inheritance of unselected markers. Selection of crude extracts were estimated from the absorbance his+ was accompanied by a much higher fre- at 280 and 260 nm (1-cm light path) by the following quency of cdd+ and nrd+. Furthermore, cdd+ equation: protein concentration (milligrams per and nrd+ usually appeared together. This milliliter) = 1.55 A280 - 0.76 A26 (19). would indicate a gene order ofnrdB cdd his. In this experiment, unselected markers were un- RESULTS AND DISCUSSION derrepresented due to the restriction exerted by Mapping ofnrdB by conjugation. A series of phage P1, which is present as a prophage in Hfr strains was crossed to the nrdB mutant LD195. LD195, and after 30 min samples were spotted Before the nrdB mutation could be trans- on plates containing streptomycin (500 ug/ml) ferred via P1 transduction, it was necessary to and hydroxyurea (1 mg/ml). Hfr KL16, which transfer it to a nonlysogenic strain. F'129, transfers counterclockwise with an origin at which includes the region ofthe E. coli chromo- approximately 60.5 min, gave numerous recom- some from 44 to 50 min including the nrd+ binants, whereas Hfr AB2572, which also genes, from strain CGSC428 was transferred to transfers counterclockwise but with an origin of strain LD195 by selecting for his+ to obtain transfer of approximately 45.5 min, gave no strain KK342. An nrdB cdd homozygote KK343 recombinants. This indicates that nrdB lies be- was obtained from strain KK342 by selecting tween 45.5 and 60.5 min. An interrupted mat- for resistance to 0.1 ,ug of 5-fluorodeoxycytidine ing utilizing strains KL16 and LD195 was car- per ml. Since difficulties were experienced in ried out, selecting for either hydroxyurea and transferring the nrdB mutation to the chromo- streptomycin resistance or histidine prototro- some ofanother strain via episome transfer and phy and streptomycin resistance. The results homozygotization, strain KK343 was subjected indicated that hydroxyurea resistance is trans- to ultraviolet light and crossed to strain K-43 in ferred 2.7 to 5.0 min before his, and thus nrdB an Hfr-type mating selecting for trp+ recombi- is located between 47 and 49 min.
Recommended publications
  • Journal of Biotechnology 193 (2015) 37–40

    Journal of Biotechnology 193 (2015) 37–40

    Journal of Biotechnology 193 (2015) 37–40 Contents lists available at ScienceDirect Journal of Biotechnology j ournal homepage: www.elsevier.com/locate/jbiotec Short communication Blockage of the pyrimidine biosynthetic pathway affects riboflavin production in Ashbya gossypii 1 1 ∗ Rui Silva , Tatiana Q. Aguiar , Lucília Domingues CEB – Centre of Biological Engineering, University of Minho, 4710-057 Braga, Portugal a r t i c l e i n f o a b s t r a c t Article history: The Ashbya gossypii riboflavin biosynthetic pathway and its connection with the purine pathway have Received 10 September 2014 been well studied. However, the outcome of genetic alterations in the pyrimidine pathway on riboflavin Received in revised form 6 November 2014 production by A. gossypii had not yet been assessed. Here, we report that the blockage of the de novo Accepted 7 November 2014 pyrimidine biosynthetic pathway in the recently generated A. gossypii Agura3 uridine/uracil auxotrophic Available online 15 November 2014 strain led to improved riboflavin production on standard agar-solidified complex medium. When extra uridine/uracil was supplied, the production of riboflavin by this auxotroph was repressed. High concen- Keywords: trations of uracil hampered this (and the parent) strain growth, whereas excess uridine favored the A. Ashbya gossypii gossypii Agura3 growth. Considering that the riboflavin and the pyrimidine pathways share the same Pyrimidine pathway precursors and that riboflavin overproduction may be triggered by nutritional stress, we suggest that Riboflavin production Uridine/uracil auxotrophy overproduction of riboflavin by the A. gossypii Agura3 may occur as an outcome of a nutritional stress Nutritional stress response and/or of an increased availability in precursors for riboflavin biosynthesis, due to their reduced consumption by the pyrimidine pathway.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Discontinuous Variability, in the Form of a Geometric Progression, Of

    Discontinuous Variability, in the Form of a Geometric Progression, Of

    Proc. Nat. Acad. Sci. USA Vol. 71, No. 5, pp. 2062-2066, May 1974 Discontinuous Variability, in the Form of a Geometric Progression, of Albumin Production in Hepatoma and Hybrid Cells (reiterated genes/control of gene expression and differentiation) JERRY A. PETERSON* Centre de Gbnbtique Molkculaire, C.N.R.S., 91, Gif-sur-Yvette, France Communicated by Daniel Mazia, February 7, 1974 ABSTRACT A clonal rat hepatoma cell line (Fu5) activation of a gene(s) that was repressed during differentia- produces rat serum albumin at a constant rate over at least tion. These results have been confirmed in other interspecific 3 months of continuous cultivation. Ten hybrid cell clones derived from the fusion of Fu5 cells and mouse fibroblasts, hybrid cells (6, 7). The reappearance in hybrids of enzymes as well as 14 hepatoma subclones of Fu5 cells, all produce that were lost during cultivation in vitro of one of the parental albumin but at different rates, ranging from about 0.09 to cell lines has also been observed (8, 9). 36.7 Mg/mg of protein per 72 hr. Despite this variability in- The present paper deals with the other example of pheno- albumin production, the distribution of clones is not in and hybrid cells, namely a random but discontinuous, with both hepatoma and typic variability hepatoma hybrid clones clustering around discrete values that can be variation in constitutive level of albumin production. fitted to the geometric progression: a, a(V/2)1, a(V22)2..... MATERIALS AND METHODS a(V/2)". The values of the majority of clones fall into alternate members of this geometric progression, which Cells were cultured in a modified Ham's F12 medium supple- differ by a factor of 2.
  • A Path Towards SARS-Cov-2 Attenuation: Metabolic Pressure on CTP Synthesis Rules the Virus Evolution

    A Path Towards SARS-Cov-2 Attenuation: Metabolic Pressure on CTP Synthesis Rules the Virus Evolution

    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.162933; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 A path towards SARS-CoV-2 attenuation: metabolic pressure on CTP synthesis rules the virus evolution Zhihua Ou1,2, Christos Ouzounis3, Daxi Wang1,2, Wanying Sun1,2,4, Junhua Li1,2, Weijun Chen2,5*, Philippe Marlière6, Antoine Danchin7,8* 1. BGI-Shenzhen, Shenzhen 518083, China. 2. Shenzhen Key Laboratory of Unknown Pathogen Identification, BGI-Shenzhen, Shenzhen 518083, China. 3. Biological Computation and Process Laboratory, Centre for Research and Technology Hellas, Chemical Process and Energy Resources Institute, Thessalonica 57001, Greece 4. BGI Education Center, University of Chinese Academy of Sciences, Shenzhen, 518083, China. 5. BGI PathoGenesis Pharmaceutical Technology, BGI-Shenzhen, Shenzhen, China. 6. TESSSI, The European Syndicate of Synthetic Scientists and Industrialists, 81 rue Réaumur, 75002, Paris, France 7. Kodikos Labs, Institut Cochin, 24, rue du Faubourg Saint-Jacques Paris 75014, France. 8. School of Biomedical Sciences, Li KaShing Faculty of Medicine, Hong Kong University, 21 Sassoon Road, Pokfulam, Hong Kong. * To whom correspondence should be addressed Tel: +331 4441 2551; Fax: +331 4441 2559 E-mail: [email protected] Correspondence may also be addressed to [email protected] Keywords ABCE1; cytoophidia; innate immunity; Maxwell’s demon; Nsp1; phosphoribosyltransferase; queuine bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.162933; this version posted June 21, 2020.
  • Receptor-Like Kinase (RLK) As a Candidate Gene Conferring Resistance to Hemileia Vastatrix in Coffee

    Receptor-Like Kinase (RLK) As a Candidate Gene Conferring Resistance to Hemileia Vastatrix in Coffee

    DOI: http://doi.org/10.1590/1678-992X-2020-0023 ISSN 1678-992X Research Article Receptor-Like Kinase (RLK) as a candidate gene conferring resistance to Hemileia vastatrix in coffee Dênia Pires de Almeida1 , Isabel Samila Lima Castro1 , Tiago Antônio de Oliveira Mendes2 , Danúbia Rodrigues Alves1 , Geleta Dugassa Barka1 , Pedro Ricardo Rossi Marques Barreiros1 , Laércio Zambolim3 , Ney Sussumu Sakiyama4 , Eveline Teixeira Caixeta5* 1Universidade Federal de Viçosa/Instituto de Biotecnologia ABSTRACT: The biotrophic fungus Hemileia vastatrix causes coffee leaf rust (CLR), one of the Aplicada à Agropecuária – BioCafé, Av. Peter Henry Rolfs, most devastating diseases in Coffea arabica. Coffee, like other plants, has developed effective s/n – 36570-900 – Viçosa, MG – Brasil. mechanisms to recognize and respond to infections caused by pathogens. Plant resistance 2Universidade Federal de Viçosa – Depto. de Bioquímica e gene analogs (RGAs) have been identified in certain plants as candidates for resistance (R) Genetics and Plant Breeding Biologia Molecular, Av. Peter Henry Rolfs, s/n – 36570-900 genes or membrane receptors that activate the R genes. The RGAs identified in different plants – Viçosa, MG – Brasil. possess conserved domains that play specific roles in the fight against pathogens. Despite the 3Universidade Federal de Viçosa – Depto. de Fitopatologia, importance of RGAs, in coffee plants these genes and other molecular mechanisms of disease Av. Peter Henry Rolfs, s/n – 36570-900 – Viçosa, MG – resistance are still unknown. This study aimed to sequence and characterize candidate genes Brasil. from coffee plants with the potential for involvement in resistance to H. vastatrix. Sequencing 4Universidade Federal de Viçosa – Depto. de Fitotecnia, Av. was performed based on a library of bacterial artificial chromosomes (BAC) of the coffee clone Peter Henry Rolfs, s/n – 36570-900 – Viçosa, MG – Brasil.
  • Genetic Factors Influencing Pyrimidine- Antagonist Chemotherapy

    Genetic Factors Influencing Pyrimidine- Antagonist Chemotherapy

    The Pharmacogenomics Journal (2005) 5, 226–243 & 2005 Nature Publishing Group All rights reserved 1470-269X/05 $30.00 www.nature.com/tpj REVIEW Genetic factors influencing Pyrimidine- antagonist chemotherapy JG Maring1 ABSTRACT 2 Pyrimidine antagonists, for example, 5-fluorouracil (5-FU), cytarabine (ara-C) HJM Groen and gemcitabine (dFdC), are widely used in chemotherapy regimes for 2 FM Wachters colorectal, breast, head and neck, non-small-cell lung cancer, pancreatic DRA Uges3 cancer and leukaemias. Extensive metabolism is a prerequisite for conversion EGE de Vries4 of these pyrimidine prodrugs into active compounds. Interindividual variation in the activity of metabolising enzymes can affect the extent of 1Department of Pharmacy, Diaconessen Hospital prodrug activation and, as a result, act on the efficacy of chemotherapy Meppel & Bethesda Hospital Hoogeveen, Meppel, treatment. Genetic factors at least partly explain interindividual variation in 2 The Netherlands; Department of Pulmonary antitumour efficacy and toxicity of pyrimidine antagonists. In this review, Diseases, University of Groningen & University Medical Center Groningen, Groningen, The proteins relevant for the efficacy and toxicity of pyrimidine antagonists will Netherlands; 3Department of Pharmacy, be summarised. In addition, the role of germline polymorphisms, tumour- University of Groningen & University Medical specific somatic mutations and protein expression levels in the metabolic Center Groningen, Groningen, The Netherlands; pathways and clinical pharmacology
  • A Genetically Adaptable Strategy for Ribose Scavenging in a Human Gut Symbiont Plays a 4 Diet-Dependent Role in Colon Colonization 5 6 7 8 Robert W

    A Genetically Adaptable Strategy for Ribose Scavenging in a Human Gut Symbiont Plays a 4 Diet-Dependent Role in Colon Colonization 5 6 7 8 Robert W

    1 2 3 A genetically adaptable strategy for ribose scavenging in a human gut symbiont plays a 4 diet-dependent role in colon colonization 5 6 7 8 Robert W. P. Glowacki1, Nicholas A. Pudlo1, Yunus Tuncil2,3, Ana S. Luis1, Anton I. Terekhov2, 9 Bruce R. Hamaker2 and Eric C. Martens1,# 10 11 12 13 1Department of Microbiology and Immunology, University of Michigan Medical School, Ann 14 Arbor, MI 48109 15 16 2Department of Food Science and Whistler Center for Carbohydrate Research, Purdue 17 University, West Lafayette, IN 47907 18 19 3Current location: Department of Food Engineering, Ordu University, Ordu, Turkey 20 21 22 23 Correspondence to: [email protected] 24 #Lead contact 25 26 Running Title: Bacteroides ribose utilization 27 28 29 30 31 32 33 34 35 36 37 38 Summary 39 40 Efficient nutrient acquisition in the competitive human gut is essential for microbial 41 persistence. While polysaccharides have been well-studied nutrients for the gut microbiome, 42 other resources such as co-factors and nucleic acids have been less examined. We describe a 43 series of ribose utilization systems (RUSs) that are broadly represented in Bacteroidetes and 44 appear to have diversified to allow access to ribose from a variety of substrates. One Bacteroides 45 thetaiotaomicron RUS variant is critical for competitive gut colonization in a diet-specific 46 fashion. Using molecular genetics, we probed the nature of the ribose source underlying this diet- 47 specific phenotype, revealing that hydrolytic functions in RUS (e.g., to cleave ribonucleosides) 48 are present but dispensable. Instead, ribokinases that are activated in vivo and participate in 49 cellular ribose-phosphate metabolism are essential.
  • 214 Thymidine Incorporation in Nucleoside Transport

    214 Thymidine Incorporation in Nucleoside Transport

    REGULATION OF ENZYMES BY LIGAND INDUCED CHANGE IN THYMIDINE INCORPORATION IN NUCLEOSIDE TRANSPORT 211 POLYMERIZATION. 214 DEFICIENT T LYMPHOMA CELLS. Buddy Ullman and Bruce Thomas W. Traut, Nancy Cheng, and Margaret M. Aronow. Univ. KY Medical Center, -- Matthews, University of North Carolina School of Medicine, Biochemistry, Lexington, KY, U.S.A. Nucleoside transport Department of Biochemistry, Chapel Hill, North Carolina , USA deficiency in mammalian cells is generally associated with an Many enzymes readily change their aggregation state, by inability to transport all nucleosides and an inability to bind dissociation or association of subunits. This constitutes a or be affected by p-nitrobenzylthioinosine (NBMPR), a potent mechanism for regulation, if the different molecular weight spe­ inhibitor of nucleoside transport. Among nucleoside cies vary in their specific activity, and if the equilibrium transport-deficient (NT-) 549 T lymphoma clones, however, the between these species is readily perturbed by physiological ability to take up and respond to the physiological effects of effectors. Our studies show that several enzymes involved in thymidine varied considerably. The NT- clone, AEJ, was the synthesis or degradation of pyrimidines exhibit such regula­ almost as capable of incorporating thymidine into TTP as the tion: The multifunctional protein UMP synthase (EC 2.4.2.10 + wildtype parent. This incorporation of thymidine into TTP by EC 4.1.1.23), and uridine kinase (EC 2.7 . 1.48) from Ehrlich AE 1 cells and a large percentage of thymidine incorporation ascites cells, and N-carbamoyl-P-alanine amidohydrolase into TTP by wildtype cells were unresponsive to NBMPR. Thus, (EC 3.5.1.6) from rat liver .
  • Association of Decreased Uridine and Deoxycytidine Kinase With

    Association of Decreased Uridine and Deoxycytidine Kinase With

    (CANCER RESEARCH 30, 2180-2186, August 1970] Association of Decreased Uridine and Deoxycytidine Kinase with Enhanced RNA and DNA Polymerase in Mouse Leukemic Cells Resistant to 5-Azacytidine and 5-Aza-2'-deoxycytidine V Y J. Vesely, A. Cihák, and F. Sorm Institute of Organic Chemistry and Biochemistry, Czechoslovak Academy of Sciences, Prague, Czechoslovakia and the liver proteosynthesis presumably by abolishing the SUMMARY heavy polyribosomes (6, 20). 5-Aza-2'-deoxycytidine inhibits Resistance of mouse leukemic cells to 5-azacytidine and the incorporation of 2'-deoxycytidine into mouse leukemia 5-aza-2'-deoxycytidine is associated with the partial loss of cells in vivo and in vitro (35). 5-Azacytidine, but not its deoxycytidine kinase; at the same time, in 5-azacytidine- 2'-deoxy derivative, is an effective inhibitor of the hormonal resistant leukemic cells uridine kinase is decreased. Further and dietary induction of different liver enzymes both in more, the 5-azacytidine-resistant subline exhibits increased normal and regenerating rat liver (6, 7). DNA-dependent RNA and DNA polymerase activities, while Previously, we have observed that the development of its 5-aza-2-deoxycytidine-resistant counterpart shows an resistance of mouse leukemic cells to 5-azacytidine is enhanced RNA polymerase only. The deletion of both associated with the stepwise decline of uridine kinase activity kinases could explain cross-resistance of 5-azacytidine-resis (33). In analogy, resistance of leukemic cells to 5-aza-2'- tant leukemic cells to 5-aza-2-deoxycytidine. 5-Aza-2- deoxycytidine results in a diminished activity of deoxy deoxycytidine-resistant leukemic cells with unchanged cytidine kinase (35).
  • NAPRALERT Classification Codes

    NAPRALERT Classification Codes

    NAPRALERT Classification Codes June 1993 STN International® Copyright © 1993 American Chemical Society Quoting or copying of material from this publication for educational purposes is encouraged, providing acknowledgement is made of the source of such material. Classification Codes in NAPRALERT The NAPRALERT File contains classification codes that designate pharmacological activities. The code and a corresponding textual description are searchable in the /CC field. To be comprehensive, both the code and the text should be searched. Either may be posted, but not both. The following tables list the code and the text for the various categories. The first two digits of the code describe the categories. Each table lists the category described by codes. The last table (starting on page 56) lists the Classification Codes alphabetically. The text is followed by the code that also describes the category. General types of pharmacological activities may encompass several different categories of effect. You may want to search several classification codes, depending upon how general or specific you want the retrievals to be. By reading through the list, you may find several categories related to the information of interest to you. For example, if you are looking for information on diabetes, you might want to included both HYPOGLYCEMIC ACTIVITY/CC and ANTIHYPERGLYCEMIC ACTIVITY/CC and their codes in the search profile. Use the EXPAND command to verify search terms. => S HYPOGLYCEMIC ACTIVITY/CC OR 17006/CC OR ANTIHYPERGLYCEMIC ACTIVITY/CC OR 17007/CC 490 “HYPOGLYCEMIC”/CC 26131 “ACTIVITY”/CC 490 HYPOGLYCEMIC ACTIVITY/CC ((“HYPOGLYCEMIC”(S)”ACTIVITY”)/CC) 6 17006/CC 776 “ANTIHYPERGLYCEMIC”/CC 26131 “ACTIVITY”/CC 776 ANTIHYPERGLYCEMIC ACTIVITY/CC ((“ANTIHYPERGLYCEMIC”(S)”ACTIVITY”)/CC) 3 17007/CC L1 1038 HYPOGLYCEMIC ACTIVITY/CC OR 17006/CC OR ANTIHYPERGLYCEMIC ACTIVITY/CC OR 17007/CC 2 This search retrieves records with the searched classification codes such as the ones shown here.
  • Uridine Kinase Activities in Developing, Adult and Neoplastic Rat Tissues by Annemarie HERZFELD and Suzanne M

    Uridine Kinase Activities in Developing, Adult and Neoplastic Rat Tissues by Annemarie HERZFELD and Suzanne M

    Biochem. J. (1979) 182, 771-778 771 Printed in Great Britain Uridine Kinase Activities in Developing, Adult and Neoplastic Rat Tissues By Annemarie HERZFELD and Suzanne M. RAPER Cancer Research Institiute of the Newv Englanid Deaconess Hospital and the Department of Biological Chemistry, Harvard Medical School, Boston, MA 02215, U.S.A. (Received 18 April 1979) Uridine kinase activities were found chiefly in the soluble fractions of rat tissues. In normal adults the activities ranged from 13 munits/g in skeletal muscle to 178 munits/g in colon. Enzyme activities in several rat neoplasms were significantly higher (e.g. in a fibrosarcoma, mammary carcinoma, renal carcinoma, pancreatic carcinoma and lymphocytic lymphoma, but not in a fast-growing Morris hepatoma). The activities were not related to tumour growth rates or sizes. In normal foetal liver, lung, brain. heart and kidney, uridine kinase concentrations equalled or exceeded those in the adult homologous tissue, but maximal activities in liver were reached 3-5 days post partutm. In suckling rats the intestinal activity decreased substantially immediately after birth and normally did not rise again until late in the third postnatal week. Premature upsurges could be evoked by an injection of cortisol or by starvation of the pups overnight. Pancreatic activity was absent from 1-day-old rats, and only about 5 % of the adult activity was reached by day 20; adult activities wer e attained rapidly after weaning. In pancreas, precocious forma- tion of uridine kinase was elicited by overnight starvation of 2-week-old rats. The phosphorylation of uridine by uridine kinase induced by cortisol in the intestine of rats younger (EC 2.7.1.48) is considered an important step in the than 12 days, and its accumulation was triggered in salvage pathway for the formation of RNA (Reichard small intestine and pancreas throughout the suckling & Skold, 1958; Canellakis et al., 1959; Skold, period by overnight starvation.
  • Studies on the Pathway of Incorporation of 2-Aminopurine Into the Deoxyribonucleic Acid of Escherichia Coli' ELEANOR G

    Studies on the Pathway of Incorporation of 2-Aminopurine Into the Deoxyribonucleic Acid of Escherichia Coli' ELEANOR G

    JOURNAL OF BACrERIOLOGY, Sept. 1970, p. 622-633 Vol. 103, No. 3 Copyright 0 1970 American Society for Microbiology Printed in U.S.A. Studies on the Pathway of Incorporation of 2-Aminopurine into the Deoxyribonucleic Acid of Escherichia coli' ELEANOR G. ROGAN2 AND MAURICE J. BESSMAN McCollum-Pratt Institute and Department of Biology, Johns Hopkins University, Baltimore, Maryland 21218 Received for publication 18 May 1970 A pathway for the incorporation of 2-aminopurine into deoxyribonucleic acid (DNA) was studied in cell-free extracts of Escherichia coli. It was demonstrated that the free base can be converted to the deoxynucleoside, and that the deoxy- nucleotide can be phosphorylated to the di- and triphosphates and then incor- porated into the DNA. From a consideration of the individual reactions in crude extracts, it is likely that the rate-limiting step in this pathway is the formation of the deoxynucleotide. Of especial interest is the observation that 2-aminopurine may be viewed as an analogue of either guanine or adenine, depending on which enzymatic step is being considered. On the one hand, it resembles guanine in that it is spe- cifically converted from the mono- to the diphosphate by guanylate kinase and not by adenylate kinase. On the other hand, it replaces adenine rather than guanine in the DNA synthesized with purified DNA polymerases. E. coli DNA polymerase utilizes aminopurine deoxynucleoside triphosphate as a substrate for DNA synthe- sis much better than does purified phage T5-induced DNA polymerase and is also much less inhibited by this analogue than the T5 enzyme. These experiments in vitro correlate with known differential effects of 2-aminopurine on E.