DOCSLIB.ORG

Some Properties of Uridine-Cytidine Kinase from a Human Malignant Lymphoma1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Some Properties of Uridine-Cytidine Kinase from a Human Malignant Lymphoma1 [CANCER RESEARCH 39, 3102-3106, August 1979] 0008-5472/79/0039-0000$02.O0 Some Properties of Uridine-Cytidine Kinase from a Human Malignant Lymphoma1 Nahed K. Ahmed2and Arnold D. Welch Division of Biochemical and Clinical Pharmacology, St. Jude Children ‘sResearchHospital, Memphis, Tennessee38101 ABSTRACT partially purified from rat liver (4, 17), muninetumor cells (5, 6, 13), calf thymus (12), human neoplastic lymphoid cells (3), Unidine-cytidine kinase has been partially purified from a Ehrlich ascites tumor (21), Novikoff ascites rat tumor (17), and malignant human lymphoma, and some of its properties have also from Tetrahymena pyriformis (18). Urd-Cyd kinase cata been described. The apparent Michaelis constants for unidine lyzes the following reaction: and adenosine 5'-triphosphate are 7 x 1O@and 4 x i O@M, .. .. (Urd-Cyd)-kinase respectively. Maximal enzyme activity is observed between pH Urldine or cytldlne + NTP 6.5 and 8.5, and temperatures of incubation are observed uridine5'-monophosphateorcytidine5'-monophosphate+ NDP between 37 and 42°.The enzyme requires Mg2@for full enzy matic activity and exists in two isozymic forms, as indicated by where NTP is nucleoside tniphosphate, and NDP is nucleoside isoelectric focusing and column chromatography on Sepharose diphosphate. Previous partial purifications and the proper 6B. The roles of these two isozymes, i.e., the adult (I) and the ties of the enzyme have been reviewed (1, 2). The enzyme embryonic (II) forms, are not yet clear; conceivably, however, appears to require the nibofuranosyl moiety because 2'-deoxy they may have relevance to the problem of the development of nibonucleosides and certain arabinofuranosyl- and xylofura resistance to chemotherapeutic analogs that require unidine nosyl-containing nucleosides tested have not been phospho @ cytidine kinase for their ‘activation.― rylated (i 3, 18, 21). Urd-Cyd kinase has a requirement for Potent inhibitors (pyrazofunin and N-phosphonacetyl-L-as Mg2@that was only partially fulfilled by Mn2―(13, 16) and Fe2@ partic acid) of the biosynthesis de novo of unidine 5'-mono (i 3, 18). Various pH optima, mostly between 6.5 and 8.5, have phosphate have not inhibited significantly the growth of other been reported for different preparations of the enzyme (2, 13, than a relatively few experimental tumors. Most neoplastic cells 17, 21). The apparent Km'5of the enzyme have been described; also can derive their essential supplies of unidine 5'-mono these approximate 1O@ M for the nucleoside substrate and phosphate by one on another route, especially through the i03 to i0@4 M for ATP (10, 18, i9, 21). Also, patterns salvage of unidineand cytidine, as catalyzed by uridine-cytidine obtained with Urd-Cyd kinase purified 250-fold from a murine kinase. No effective inhibitor of this key enzyme in the salvage mast cell neoplasm, P815, showed a Kmof 1.5 x 1O'@M for pathway has been reported. Among a variety of compounds uridine and 4.5 x 1O@ M for cytidine (14). Although the (20 substances) so far examined by us for their possible ability molecular weight of the enzyme has been reported to be quite to interfere with the phosphorylation of [5-3H]unidine by aden high, namely, in the region of 150,000 to 200,000 as judged osine 5'-triphosphate, as catalyzed by unidine-cytidine kinase, by gel filtration (13, 18), those kinases obtained from rat liver none is a powerful inhibitor of this enzyme, although leads for (1 1) and from Ehrlich ascites cells (10), respectively, were future development have been obtained. In the meantime, described as existing in 2 isozymic species: one of molecular information concerning the uridine-cytidine kinase activity of a weight of about 120,000, and the other with a molecular weight variety of munine and human neoplasms (particularly of cob of about 30,000. rectal origin), as well as in normal tissues, is being expanded; The reaction that this enzyme catalyzes is part of the ana these findings may contribute to the design and prospective bolic pathway by which preformed unidine and cytidine can be syntheses of potential chemotherapeutic agents, functioning salvaged for nucleic acid biosynthesis. Because our primary as inhibitors of the salvage of uridine and cytidine. interest is in delineating the roles of salvage, and in discovering effective inhibitors of these processes, especially that step INTRODUCTION catalyzed by Urd-Cyd kinase, the present investigation was undertaken. The principal objective of the investigation has Urd-Cyd3-kinase (ATP:unidine 5'-phosphotransferase, EC been to provide more information concerning the properties of 2.7.1 .48) catalyzes the phosphorylation, particularly by ATP, a partially purified Urd-Cyd kinase isolated from a human of unidine, cytidine, and some nucleoside analogs (6-azauni malignant lymphoma and its activity relative to different unidine dine, 5-fluorounidine, 5-fluorocytidine, 5-azacytidine, 3-dea and cytidine derivatives (potential inhibitors), which could affect zauridine, etc.). This enzyme has been previously isolated and the activity of this enzyme and its role in the salvage pathway. I This investigation was supported by the Whitehall Foundation, Grant MATERIALSAND METHODS CA21677 from the National Cancer Institute, Department of Health, Education, and Welfare, and American Lebanese Syrian Associated Charities. [5-3H]Uridine, DE81 discs, and ATP were purchased from 2 To whom requests for reprints should be addressed, at St. Jude Children's Research Hospital, P. 0. Box 318, Memphis, Tenn. 38101. Monavek Biochemicals (City of Industry, Calif.), Whatman, Inc. 3The abbreviations used are: Urd-Cyd kinase, uridine-cytidine kinase; DE81, (Clifton, N. J.) and Sigma Chemical Co. (St. Louis, Mo.), re DEAE-cellulese paper; BME, fl-mercapteethanol; PALA, N-phosphenacetyl-L-as partic acid. spectively. RiaSolve II was obtained from Research Products Received January 24, 1979; accepted May 8, 1979. International Corp. (Elk Grove Village, Ill.); all other reagents 3102 CANCERRESEARCHVOL. 39 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 1979 American Association for Cancer Research. Properties of a Human Lymphoma Uridine Kinase and solvents were of the purest grade available. an LKB 8101 ebectrofocusing column (1 10-mI capacity) with 1% carrier ampholyte (pH range, 3 to 10) and a stabilizing sucrose-gradient containing 0.5 mM dithiothreitol. Dialyzed METHODS ammonium sulfate fractions were introduced into the middle of Enzyme Preparation. A human malignant lymphoma was the sucrose gradient of the column. Electrofocusing lasted obtained at autopsy (within 6 hr of death), and the neoplastic about 24 hr at 4°,with an initial power of 5.0 watts. After tissue was separated, insofar as possible, from fibrous and electrofocusing was completed, the column contents were necrotic materials. The neoplastic mass was then divided into collected in 1-ml fractions at a flow rate of 60 ml/hr; pH small portions, wrapped, and frozen for subsequent prepara measurements and assays of Urd-Cyd kinase activities were tions of the enzyme; all steps concerning the preparation and performed immediately. uses of the enzyme were performed at 0—4°. Determination of pH Profile. The pH profile of the kinase The tissues were homogenized in ice-cold Tris-HCI buffer was determined in the indicated buffers at concentrations (200 mM) (pH 7.5), containing 10 mM BME. The supernatant giving conductivity readings of 4700 to 5200 m@2;otherwise, fraction of the homogenate, obtained after a preliminary cen assays were identical to those described under . Materials and trifugation at 15,000 x g, was then subjected to high-speed Methods.― centrifugation (100,000 x g) for 90 mm at 4°.Thesupernatant Chromatography with Sepharose 6B. The dialyzed 30 to fluid was treated with solid ammonium sulfate to yield a level of 50% ammonium sulfate fraction, equivalent to 10.6 mg of saturation of 30%; the supernatant material obtained after protein, was applied to a 2.3- x 27-cm Sepharose 6B column. centnfugation was retained for retreatment with solid ammo The Sepharose column was equilibrated, and 1-ml fractions nium sulfate to yield a level of 50% saturation. The recovered were eluted with 200 mt@iTris—HCIbuffer(pH7.5), 20 [email protected], precipitate was dialyzed against 2 changes (each of i OOx and 20% glycerol; 8O-@tlaliquots of the eluted fraction were volume at 4°)of the homogenizing buffer; this fraction served assayed for Urd-Cyd kinase activity. as a source of the enzyme activity used in all the experiments described in this study. RESULTS Protein Determinations. Protein determinationswere per formed by the method of Lowry et a!. (15). The enzymatic formation of uridine nucbeotides, as functions Uridine Kinase Assay. Uridine kinase activitywas assayed of enzyme concentration and time, was studied. A linear reba by a recently modified procedure4 utilizing DE81 discs. The tionship was obtained up to 200 j@gofenzyme protein; nucleo following mixture ordinarily was used in a final volume of 0.2 tide formation also was linear with respect to time for periods ml: Tris-HCI buffer (pH 7.5 to 7.7), 200 mM; BME, 10.0 mM; of up to 10 mm. Accordingly, most of the assays were carried MgCl2, 7.5 mM;ATP, 3.9 mM;[5-3H)uridine(0.1 MCi),0.5 mM; out with 100 to 150 ,sgof enzyme protein during an incubation and 100 to 200 ,@gofthe dialyzed ammonium sulfate fraction. timeof 5 mm. Incubation was carried out in tubes for 5 to 10 mm (37—40°), Dependence on Substrate Concentration. The Lineweaver and the reaction was stopped by immersion of the tubes in Burk plots in Charts 1 and 2 demonstrate the dependence of water at 100°for 3 mm; denatured protein was removed by the reaction rate on the concentrations of uridine and ATP. centrifugation. The content of [5-3Hjuridine 5'-phosphate (as Slight inhibition was observed at a concentration of ATP of well as any higher phosphate esters of the radioactive uridine) about 18 x Km.The apparent Km'5for ATP and uridine were 4 was measured by spotting the supernatant fluid on DE8i discs.
Load more

Recommended publications
  • Journal of Biotechnology 193 (2015) 37–40
    Journal of Biotechnology 193 (2015) 37–40 Contents lists available at ScienceDirect Journal of Biotechnology j ournal homepage: www.elsevier.com/locate/jbiotec Short communication Blockage of the pyrimidine biosynthetic pathway affects riboflavin production in Ashbya gossypii 1 1 ∗ Rui Silva , Tatiana Q. Aguiar , Lucília Domingues CEB – Centre of Biological Engineering, University of Minho, 4710-057 Braga, Portugal a r t i c l e i n f o a b s t r a c t Article history: The Ashbya gossypii riboflavin biosynthetic pathway and its connection with the purine pathway have Received 10 September 2014 been well studied. However, the outcome of genetic alterations in the pyrimidine pathway on riboflavin Received in revised form 6 November 2014 production by A. gossypii had not yet been assessed. Here, we report that the blockage of the de novo Accepted 7 November 2014 pyrimidine biosynthetic pathway in the recently generated A. gossypii Agura3 uridine/uracil auxotrophic Available online 15 November 2014 strain led to improved riboflavin production on standard agar-solidified complex medium. When extra uridine/uracil was supplied, the production of riboflavin by this auxotroph was repressed. High concen- Keywords: trations of uracil hampered this (and the parent) strain growth, whereas excess uridine favored the A. Ashbya gossypii gossypii Agura3 growth. Considering that the riboflavin and the pyrimidine pathways share the same Pyrimidine pathway precursors and that riboflavin overproduction may be triggered by nutritional stress, we suggest that Riboflavin production Uridine/uracil auxotrophy overproduction of riboflavin by the A. gossypii Agura3 may occur as an outcome of a nutritional stress Nutritional stress response and/or of an increased availability in precursors for riboflavin biosynthesis, due to their reduced consumption by the pyrimidine pathway.
    [Show full text]
  • Bacillus Anthracis Edema Factor Substrate Specificity: Evidence for New Modes of Action
    Toxins 2012, 4, 505-535; doi:10.3390/toxins4070505 OPEN ACCESS toxins ISSN 2072–6651 www.mdpi.com/journal/toxins Review Bacillus anthracis Edema Factor Substrate Specificity: Evidence for New Modes of Action Martin Göttle 1,*, Stefan Dove 2 and Roland Seifert 3 1 Department of Neurology, Emory University School of Medicine, 6302 Woodruff Memorial Research Building, 101 Woodruff Circle, Atlanta, GA 30322, USA 2 Department of Medicinal/Pharmaceutical Chemistry II, University of Regensburg, D-93040 Regensburg, Germany; E-Mail: [email protected] 3 Institute of Pharmacology, Medical School of Hannover, Carl-Neuberg-Str. 1, D-30625 Hannover, Germany; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-404-727-1678; Fax: +1-404-727-3157. Received: 23 April 2012; in revised form: 15 June 2012 / Accepted: 27 June 2012 / Published: 6 July 2012 Abstract: Since the isolation of Bacillus anthracis exotoxins in the 1960s, the detrimental activity of edema factor (EF) was considered as adenylyl cyclase activity only. Yet the catalytic site of EF was recently shown to accomplish cyclization of cytidine 5′-triphosphate, uridine 5′-triphosphate and inosine 5′-triphosphate, in addition to adenosine 5′-triphosphate. This review discusses the broad EF substrate specificity and possible implications of intracellular accumulation of cyclic cytidine 3′:5′-monophosphate, cyclic uridine 3′:5′-monophosphate and cyclic inosine 3′:5′-monophosphate on cellular functions vital for host defense. In particular, cAMP-independent mechanisms of action of EF on host cell signaling via protein kinase A, protein kinase G, phosphodiesterases and CNG channels are discussed.
    [Show full text]
  • DNA DEAMINATION REPAIR ENZYMES in BACTERIAL and HUMAN SYSTEMS Rongjuan Mi Clemson University, [email protected]
    Clemson University TigerPrints All Dissertations Dissertations 12-2008 DNA DEAMINATION REPAIR ENZYMES IN BACTERIAL AND HUMAN SYSTEMS Rongjuan Mi Clemson University, [email protected] Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Biochemistry Commons Recommended Citation Mi, Rongjuan, "DNA DEAMINATION REPAIR ENZYMES IN BACTERIAL AND HUMAN SYSTEMS" (2008). All Dissertations. 315. https://tigerprints.clemson.edu/all_dissertations/315 This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected]. DNA DEAMINATION REPAIR ENZYMES IN BACTERIAL AND HUMAN SYSTEMS A Dissertation Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Biochemistry by Rongjuan Mi December 2008 Accepted by: Dr. Weiguo Cao, Committee Chair Dr. Chin-Fu Chen Dr. James C. Morris Dr. Gary Powell ABSTRACT DNA repair enzymes and pathways are diverse and critical for living cells to maintain correct genetic information. Single-strand-selective monofunctional uracil DNA glycosylase (SMUG1) belongs to Family 3 of the uracil DNA glycosylase superfamily. We report that a bacterial SMUG1 ortholog in Geobacter metallireducens (Gme) and the human SMUG1 enzyme are not only uracil DNA glycosylases (UDG), but also xanthine DNA glycosylases (XDG). Mutations at M57 (M57L) and H210 (H210G, H210M, H210N) can cause substantial reductions in XDG and UDG activities. Increased selectivity is achieved in the A214R mutant of Gme SMUG1 and G60Y completely abolishes XDG and UDG activity. Most interestingly, a proline substitution at the G63 position switches the Gme SMUG1 enzyme to an exclusive uracil DNA glycosylase.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Discontinuous Variability, in the Form of a Geometric Progression, Of
    Proc. Nat. Acad. Sci. USA Vol. 71, No. 5, pp. 2062-2066, May 1974 Discontinuous Variability, in the Form of a Geometric Progression, of Albumin Production in Hepatoma and Hybrid Cells (reiterated genes/control of gene expression and differentiation) JERRY A. PETERSON* Centre de Gbnbtique Molkculaire, C.N.R.S., 91, Gif-sur-Yvette, France Communicated by Daniel Mazia, February 7, 1974 ABSTRACT A clonal rat hepatoma cell line (Fu5) activation of a gene(s) that was repressed during differentia- produces rat serum albumin at a constant rate over at least tion. These results have been confirmed in other interspecific 3 months of continuous cultivation. Ten hybrid cell clones derived from the fusion of Fu5 cells and mouse fibroblasts, hybrid cells (6, 7). The reappearance in hybrids of enzymes as well as 14 hepatoma subclones of Fu5 cells, all produce that were lost during cultivation in vitro of one of the parental albumin but at different rates, ranging from about 0.09 to cell lines has also been observed (8, 9). 36.7 Mg/mg of protein per 72 hr. Despite this variability in- The present paper deals with the other example of pheno- albumin production, the distribution of clones is not in and hybrid cells, namely a random but discontinuous, with both hepatoma and typic variability hepatoma hybrid clones clustering around discrete values that can be variation in constitutive level of albumin production. fitted to the geometric progression: a, a(V/2)1, a(V22)2..... MATERIALS AND METHODS a(V/2)". The values of the majority of clones fall into alternate members of this geometric progression, which Cells were cultured in a modified Ham's F12 medium supple- differ by a factor of 2.
    [Show full text]
  • Triphosphates of Linear-Benzoguanosine, Linear-Benzoinosine, and Linear-Benzoxanthosine
    Proc. Natl. Acad. Sci. USA Vol. 76, No. 9, pp. 4262-4264, September 1979 Biochemistry Synthesis of fluorescent nucleotide analogues: 5'-Mono-, di-, and triphosphates of linear-benzoguanosine, linear-benzoinosine, and linear-benzoxanthosine (phosphorylation/xanthine oxidase oxidation/quantum yield/lifetime/dimensional probes) NELSON J. LEONARD AND GENE E. KEYSER Roger Adams Laboratory, School of Chemical Sciences, University of Illinois, Urbana, Illinois 61801 Contributed by Nelson J. Leonard, May 29, 1979 ABSTRACT The fluorescent nucleotide analogues (the 5'- 0 mono-, di-, and triphosphates of lin-benzoguanosine, ftn-ben- 8 9 zoxanthosine, and Iin-benzoinosine) have been prepared for use 7 N 1 as dimensional probes of enzyme binding sites. They have HN N > quantum yields in aqueous solution of 0.39,0.55, and 0.04 and fluorescent lifetimes of 6, 9, and t1.5 nsec, respectively. Un- H2N*J'N 3 Benzoinosine 5'-monophosphate is a substrate for xanthine 5 4 1 oxidase (xanthine:oxygen oxidoreductase, EC 1.2.3.2), providing R lin-benzoxanthosine 5'-monophosphate, and lin-benzoinosine 5'-diphosphate is a substrate for polynucleotide phosphorylase (polyribonucleotide:orthophosphate nucleotidyltransferase, EC 2.7.7.8), giving poly(lin-benzoinosinic acid). The benzologues of the purine diphosphates are substrates for pyruvate kinase (ATP:pyruvate 2-O-phosphotransferase, EC 2.7.1.40), which is I.N used to prepare the triphosphates. Fluorescent analogues or derivatives of adenine-containing O NN 'N nucleotides have been prepared to aid in the definition of en- H I H zyme binding sites and in the determination of interactions in 2 3 nucleic acids (1-6).
    [Show full text]
  • A Path Towards SARS-Cov-2 Attenuation: Metabolic Pressure on CTP Synthesis Rules the Virus Evolution
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.162933; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 A path towards SARS-CoV-2 attenuation: metabolic pressure on CTP synthesis rules the virus evolution Zhihua Ou1,2, Christos Ouzounis3, Daxi Wang1,2, Wanying Sun1,2,4, Junhua Li1,2, Weijun Chen2,5*, Philippe Marlière6, Antoine Danchin7,8* 1. BGI-Shenzhen, Shenzhen 518083, China. 2. Shenzhen Key Laboratory of Unknown Pathogen Identification, BGI-Shenzhen, Shenzhen 518083, China. 3. Biological Computation and Process Laboratory, Centre for Research and Technology Hellas, Chemical Process and Energy Resources Institute, Thessalonica 57001, Greece 4. BGI Education Center, University of Chinese Academy of Sciences, Shenzhen, 518083, China. 5. BGI PathoGenesis Pharmaceutical Technology, BGI-Shenzhen, Shenzhen, China. 6. TESSSI, The European Syndicate of Synthetic Scientists and Industrialists, 81 rue Réaumur, 75002, Paris, France 7. Kodikos Labs, Institut Cochin, 24, rue du Faubourg Saint-Jacques Paris 75014, France. 8. School of Biomedical Sciences, Li KaShing Faculty of Medicine, Hong Kong University, 21 Sassoon Road, Pokfulam, Hong Kong. * To whom correspondence should be addressed Tel: +331 4441 2551; Fax: +331 4441 2559 E-mail: [email protected] Correspondence may also be addressed to [email protected] Keywords ABCE1; cytoophidia; innate immunity; Maxwell’s demon; Nsp1; phosphoribosyltransferase; queuine bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.162933; this version posted June 21, 2020.
    [Show full text]
  • Receptor-Like Kinase (RLK) As a Candidate Gene Conferring Resistance to Hemileia Vastatrix in Coffee
    DOI: http://doi.org/10.1590/1678-992X-2020-0023 ISSN 1678-992X Research Article Receptor-Like Kinase (RLK) as a candidate gene conferring resistance to Hemileia vastatrix in coffee Dênia Pires de Almeida1 , Isabel Samila Lima Castro1 , Tiago Antônio de Oliveira Mendes2 , Danúbia Rodrigues Alves1 , Geleta Dugassa Barka1 , Pedro Ricardo Rossi Marques Barreiros1 , Laércio Zambolim3 , Ney Sussumu Sakiyama4 , Eveline Teixeira Caixeta5* 1Universidade Federal de Viçosa/Instituto de Biotecnologia ABSTRACT: The biotrophic fungus Hemileia vastatrix causes coffee leaf rust (CLR), one of the Aplicada à Agropecuária – BioCafé, Av. Peter Henry Rolfs, most devastating diseases in Coffea arabica. Coffee, like other plants, has developed effective s/n – 36570-900 – Viçosa, MG – Brasil. mechanisms to recognize and respond to infections caused by pathogens. Plant resistance 2Universidade Federal de Viçosa – Depto. de Bioquímica e gene analogs (RGAs) have been identified in certain plants as candidates for resistance (R) Genetics and Plant Breeding Biologia Molecular, Av. Peter Henry Rolfs, s/n – 36570-900 genes or membrane receptors that activate the R genes. The RGAs identified in different plants – Viçosa, MG – Brasil. possess conserved domains that play specific roles in the fight against pathogens. Despite the 3Universidade Federal de Viçosa – Depto. de Fitopatologia, importance of RGAs, in coffee plants these genes and other molecular mechanisms of disease Av. Peter Henry Rolfs, s/n – 36570-900 – Viçosa, MG – resistance are still unknown. This study aimed to sequence and characterize candidate genes Brasil. from coffee plants with the potential for involvement in resistance to H. vastatrix. Sequencing 4Universidade Federal de Viçosa – Depto. de Fitotecnia, Av. was performed based on a library of bacterial artificial chromosomes (BAC) of the coffee clone Peter Henry Rolfs, s/n – 36570-900 – Viçosa, MG – Brasil.
    [Show full text]
  • De Novo Nucleic Acids: a Review of Synthetic Alternatives to DNA and RNA That Could Act As † Bio-Information Storage Molecules
    life Review De Novo Nucleic Acids: A Review of Synthetic Alternatives to DNA and RNA That Could Act as y Bio-Information Storage Molecules Kevin G Devine 1 and Sohan Jheeta 2,* 1 School of Human Sciences, London Metropolitan University, 166-220 Holloway Rd, London N7 8BD, UK; [email protected] 2 Network of Researchers on the Chemical Evolution of Life (NoR CEL), Leeds LS7 3RB, UK * Correspondence: [email protected] This paper is dedicated to Professor Colin B Reese, Daniell Professor of Chemistry, Kings College London, y on the occasion of his 90th Birthday. Received: 17 November 2020; Accepted: 9 December 2020; Published: 11 December 2020 Abstract: Modern terran life uses several essential biopolymers like nucleic acids, proteins and polysaccharides. The nucleic acids, DNA and RNA are arguably life’s most important, acting as the stores and translators of genetic information contained in their base sequences, which ultimately manifest themselves in the amino acid sequences of proteins. But just what is it about their structures; an aromatic heterocyclic base appended to a (five-atom ring) sugar-phosphate backbone that enables them to carry out these functions with such high fidelity? In the past three decades, leading chemists have created in their laboratories synthetic analogues of nucleic acids which differ from their natural counterparts in three key areas as follows: (a) replacement of the phosphate moiety with an uncharged analogue, (b) replacement of the pentose sugars ribose and deoxyribose with alternative acyclic, pentose and hexose derivatives and, finally, (c) replacement of the two heterocyclic base pairs adenine/thymine and guanine/cytosine with non-standard analogues that obey the Watson–Crick pairing rules.
    [Show full text]
  • Endoq, Exoiii, and Family-4 UDG
    www.nature.com/scientificreports OPEN The mesophilic archaeon Methanosarcina acetivorans counteracts uracil in DNA with Received: 21 May 2018 Accepted: 25 September 2018 multiple enzymes: EndoQ, ExoIII, Published: xx xx xxxx and UDG Miyako Shiraishi 1,4,5,6, Sonoko Ishino1, Matthew Hefernan4, Isaac Cann2,3,4,5 & Yoshizumi Ishino1,4,5 Cytosine deamination into uracil is one of the most prevalent and pro-mutagenic forms of damage to DNA. Base excision repair is a well-known process of uracil removal in DNA, which is achieved by uracil DNA glycosylase (UDG) that is found in all three domains of life. However, other strategies for uracil removal seem to have been evolved in Archaea. Exonuclease III (ExoIII) from the euryarchaeon Methanothermobacter thermautotrophicus has been described to exhibit endonuclease activity toward uracil-containing DNA. Another uracil-acting protein, endonuclease Q (EndoQ), was recently identifed from the euryarchaeon Pyrococcus furiosus. Here, we describe the uracil-counteracting system in the mesophilic euryarchaeon Methanosarcina acetivorans through genomic sequence analyses and biochemical characterizations. Three enzymes, UDG, ExoIII, and EndoQ, from M. acetivorans exhibited uracil cleavage activities in DNA with a distinct range of substrate specifcities in vitro, and the transcripts for these three enzymes were detected in the M. acetivorans cells. Thus, this organism appears to conduct uracil repair using at least three distinct pathways. Distribution of the homologs of these uracil-targeting proteins in Archaea showed that this tendency is not restricted to M. acetivorans, but is prevalent and diverse in most Archaea. This work further underscores the importance of uracil- removal systems to maintain genome integrity in Archaea, including ‘UDG lacking’ organisms.
    [Show full text]
  • Genetic Factors Influencing Pyrimidine- Antagonist Chemotherapy
    The Pharmacogenomics Journal (2005) 5, 226–243 & 2005 Nature Publishing Group All rights reserved 1470-269X/05 $30.00 www.nature.com/tpj REVIEW Genetic factors influencing Pyrimidine- antagonist chemotherapy JG Maring1 ABSTRACT 2 Pyrimidine antagonists, for example, 5-fluorouracil (5-FU), cytarabine (ara-C) HJM Groen and gemcitabine (dFdC), are widely used in chemotherapy regimes for 2 FM Wachters colorectal, breast, head and neck, non-small-cell lung cancer, pancreatic DRA Uges3 cancer and leukaemias. Extensive metabolism is a prerequisite for conversion EGE de Vries4 of these pyrimidine prodrugs into active compounds. Interindividual variation in the activity of metabolising enzymes can affect the extent of 1Department of Pharmacy, Diaconessen Hospital prodrug activation and, as a result, act on the efficacy of chemotherapy Meppel & Bethesda Hospital Hoogeveen, Meppel, treatment. Genetic factors at least partly explain interindividual variation in 2 The Netherlands; Department of Pulmonary antitumour efficacy and toxicity of pyrimidine antagonists. In this review, Diseases, University of Groningen & University Medical Center Groningen, Groningen, The proteins relevant for the efficacy and toxicity of pyrimidine antagonists will Netherlands; 3Department of Pharmacy, be summarised. In addition, the role of germline polymorphisms, tumour- University of Groningen & University Medical specific somatic mutations and protein expression levels in the metabolic Center Groningen, Groningen, The Netherlands; pathways and clinical pharmacology
    [Show full text]
  • Metabolite Name Chemical Formula KEGG/HMDB/ Pubchem Identifier Glyoxylate C2H2O3 C00048 Glycolate C2H4O3 C00160 Pyruvate C3H4O3
    Metabolite name Chemical formula KEGG/HMDB/ PubChem Identifier glyoxylate C2H2O3 C00048 glycolate C2H4O3 C00160 pyruvate C3H4O3 C00022 lactate C3H6O3 C00186 2-oxobutanoate C4H6O3 C00109 acetoacetate C4H6O3 C00164 glycerate C3H6O4 C00258 uracil C4H4N2O2 C00106 fumarate C4H4O4 C00122 Maleic acid C4H4O4 C01384 2-keto-isovalerate C5H8O3 C00141 Guanidoacetic acid C3H7N3O2 C00581 succinate C4H6O4 C00042 Methylmalonic acid C4H6O4 C02170 3-S-methylthiopropionate C4H8O2S C08276 nicotinate C6H5NO2 C00253 taurine C2H7NO3S C00245 Pyroglutamic acid C5H7NO3 C01879 Citraconic acid C5H6O4 C02226 2-ketohaxanoic acid C6H10O3 HMDB01864 N-Acetyl-L-alanine C5H9NO3 C01073 oxaloacetate C4H4O5 C00036 Hydroxyisocaproic acid C6H12O3 HMDB00746 malate C4H6O5 C00149 hypoxanthine C5H4N4O C00262 anthranilate C7H7NO2 C00108 p-aminobenzoate C7H7NO2 C00568 p-hydroxybenzoate C7H6O3 C00156 acetylphosphate C2H5O5P C00227 Carbamoyl phosphate CH4NO5P C00169 a-ketoglutarate C5H6O5 C00026 Phenylpropiolic acid C9H6O2 HMDB00563 2-oxo-4-methylthiobutanoate C5H8O3S C01180 2-Hydroxy-2-methylbutanedioic acid C5H8O5 C02612 3-methylphenylacetic acid C9H10O2 HMDB02222 xanthine C5H4N4O2 C00385 Hydroxyphenylacetic acid C8H8O3 C05852 2,3-dihydroxybenzoic acid C7H6O4 C00196 orotate C5H4N2O4 C00295 dihydroorotate C5H6N2O4 C00337 allantoin C4H6N4O3 C01551 Aminoadipic acid C6H11NO4 C00956 Indole-3-carboxylic acid C9H7NO2 HMDB03320 phenylpyruvate C9H8O3 C00166 Atrolactic acid C9H10O3 HMDB00475 Phenyllactic acid C9H10O3 C01479 quinolinate C7H5NO4 C03722 phosphoenolpyruvate C3H5O6P C00074 Uric
    [Show full text]