A Respiratory Syncytial Virus Replicon That Is Non-Cytotoxic and Capable of Long-Term Foreign Gene Expression

Home , Bornaviridae, Hepatitis C virus, Replicon (genetics)

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of the Ohio State University

Olga Malykhina

The Integrated Biomedical Science Graduate Program

The Ohio State University

2011

Dissertation Committee:

Mark Peeples

Douglas McCarty

Michael Oglesbee

Jianrong Li

Abstract

Respiratory syncytial virus (RSV) infection of most cultured cell lines causes cell- cell fusion and death. Cell fusion is caused by the fusion (F) glycoprotein and is clearly cytopathic, but other aspects of RSV infection may also contribute to cytopathology. To investigate this possibility, we generated an RSV replicon that lacks all three of its glycoprotein genes and so cannot cause cell-cell fusion or virus spread. This replicon includes a green fluorescent protein gene and an antibiotic resistance gene to enable detection and selection of replicon-containing cells. Adaptive mutations in the RSV replicon were not required for replicon maintenance. Cells containing the replicon could be cloned and passaged many times in the absence of antibiotic selection, with 99% or more of the cells retaining the replicon after each cell division. Transient expression of the F and G

(attachment) glycoproteins supported the production of virions that could transfer the replicon into most cell lines tested. Since the RSV replicon is not toxic to these cultured cells and does not affect their rate of cell division, none of the 8 internal viral proteins, the viral RNA transcripts, or the host response to these molecules or their activities are cytopathic. However, the level of replicon genome and gene expression is controlled in some manner, well below that of complete virus and, as such, might avoid cytotoxicity. RSV replicons could be useful for cytoplasmic gene expression in vitro and in vivo, and for screening compounds active against the viral polymerase.

Dedication

To:

Elena Malykhina

Serguei Malykine

My Pulie

iii

Acknowledgments

I would like to thank Mark Peeples for his guidance throughout my scientific career. Thank you everyone in Peeples’ lab for assisting me in my research through contribution of ideas and help with experiments.

Specifically I would like to thank Mark Yednak for starting the replicon project,

Charles Rice for the BHK-SR19-T7 cells, Russell and Joan Durbin for help with the IFN assay, Cynthia McAllister for help with flow sorting, Barb Newton and

Steven Kwilas for excellent technical assistance, Beth McNally and Emilio Flano for their help with the qPCR, Rachel Fearns for the full-length RSV cDNA clone,

D53/BsiWI, and Asuncion Mejias, Blerta Dimo, and Yannis Ioannidis for the help with microarrays.

Additionally, I would like to thank Koi and Heather for the fun times we had in the lab together. =)

This work was supported by Apath, LLC, and by grants AI047213 and HL051818 from the National Institutes of Health. PLC was supported by the NIAID, NIH

Intramural Research Program.

Vita

Bachelor of Science 1998-2002

Major: Biology

Minor: Chemistry

North Park University

Doctor of Philosophy 2004-present

Integrated Biomedical Science

The Ohio State University

Publication

Olga Malykhina, Mark A. Yednak, Peter L. Collins, Paul D. Olivo and Mark E.

Peeples. 2011. A Respiratory Syncytial Virus Replicon That Is Non-Cytotoxic and

Capable of Long-Term Foreign Gene Expression. J Virol, 85:4792-4801.

Fields of Study

Major Field: Integrated Biomedical Science

Minor Field: Molecular Virology and Gene Therapy

Table of Contents

Abstract…………………………………………………………………………………...ii

Dedication………………………………………………………………………………..iii

Acknowledgments………………………………………………………………………iv

Vita………………………………………………………………………………………..v

List of Illustrations……………………………………………………………………..viii

Abbreviations…………………………………………………………………………....xi

Chapter 1: Introduction…………………………………………………………………1

Classification…………………………………………………………………….1

The Virion………………………………………………………………………...2

The Viral Proteins……………………………………………………………….2

The F Protein…………………………………………………………….3

The G Protein……………………………………………………………5

The SH Protein…………………………………………………………..7

The M Protein……………………………………………………………8

Replication Complex Proteins………………………………………………9

The M2-1 Protein………………………………………………………11

The M2-2 Protein………………………………………………………12

The NS1 and NS2 Proteins…………………………………………..13

RNA……………………………………………………………………………..14

The RSV Life Cycle……………………………………………………………16

Vaccines………………………………………………………………………..20

Passive Immunization…………………………………………………24

Antiviral Agents………………………………………………………...25

Reverse Genetics……………………………………………………………...26

Infection of immortalized cells in culture.……………………………………29

Infection of experimental animals……………………………………………30

Chapter 2: The RSV Replicon………………………………………………………..32

Introduction……………………………………………………………………..32

Materials and Methods………………………………………………….…….36

Results………………………………………………………………………….44

Discussion………………………………………………………………………71

Chapter 3: Application of the RSV Replicon……………………………………..…78

Replicons that also express viral glycoprotein genes………………….…..79

Virion formation by the RSV replicon………………………………………..80

Identifying a viral mechanism(s) that controls the replication of the

RSV replicon……………………………………………………………………83

Identifying a cellular mechanism(s) that controls the replication of the

RSV replicon……………………………………………………………………84

Replicon-Containing Cell Line for Drug Screening……………………….105

vii

List of Illustrations

List of Figures

Chapter 1:

Figure 1.1: RSV life cycle……………………………………………………………..19

Figure 1.2: Launching recombinant green fluorescent protein expressing RSV (rgRSV) from cDNA……………………………………………………………………28

Chapter 2:

Figure 2.1: Launch of the RSV Replicon from cDNA………………………………35

Figure 2.2: Derivation of the MP295 replicon cDNA……………………………….46

Figure 2.3: RT-PCR analysis of viral RNA from replicon-containing cells………48

Figure 2.4: Fluorescent photomicrograph of BHK-SR19-T7 cells containing the RSV replicon, as indicated by the expression of GFP……………………………..52

Figure 2.5: Replicon stability in cloned cells passaged with and without blastisidin……………………………………………………………………………….57

Figure 2.6: Replicon-containing cells from a clonal BHK-SR19-T7 population and clear cells that appeared in the culture during passage…………………………...60

Figure 2.7: Diagram showing the position of mutations in Rep295.2 and Rep295.5 genomes……………………………………………………………………63

Figure 2.8: Growth rate of replicon-containing cells compared to parental cells……………………………………………………………………………………...64

Figure 2.9: Level of viral genome and protein in replicon-containing cells compared to rgRSV-infected cells…………………………………………………...67

viii

Chapter 3:

Figure 3.1: Production of virions by replicon-containing HeLa cells……………..82

Figure 3.2: Gene Trees of expressed genes from replicon-containing A546 cells and RSV infected A549 cells at 24 hr p.i. compared to non-infected A549 control cells……………………………………………………………………………………...88

Figure 3.3: Modular Map of gene expression in replicon-containing A546 cells and RSV infected A549 cells…………………………………………………………91

Figure 3.4: Expression of pro-apoptotic genes in RSV-infected (24 h p.i.) and replicon containing A549 cells………………………………………………………..94

Figure 3.5: Expression of anti-apoptotic genes in RSV-infected (24 h p.i.) and replicon containing A549 cells………………………………………………………..94

Figure 3.6: List of genes highly overexpressed in the replicon-containing A549 cells but not RSV-infected A549 cells (24 h p.i.)…………………………………...96

Figure 3.7: List of genes highly overexpressed in RSV-infected A549 cells (24 h p.i.) but not replicon-containing A549 cells…………………………………………97

Figure 3.8: Replicon Network 1………………………………………………………99

Figure 3.9: RSV Network 19………………………………………………………...100

Figure 3.10: Side-by-side comparison of Replicon Network 1 with RSV Network 19………………………………………………………………………………………101

Figure 3.11: Replicon Network 2……………………………………………………102

Figure 3.12: RSV Network 1………………………………………………………...103

Figure 3.13: RSV Network 2………………………………………………………...104

Figure 3.14: Plasmid containing the RSV replicon cDNA with the Renilla green fluorescent protein (RrFP) gene and the humanized Renilla luciferase (hRLuc) gene……………………………………………………………………………………107

Figure 3.15: Luciferase expression driven by the ts or wt luciferase GS in RSV replicons incubated at 33°C or 38°C and shifted to 33°C………………………..110

List of Tables

Chapter 2:

Table 2.1: Interferon released by replicon-containing A549 cells, determined by bioassay………………………………………………………………………………...70

Chapter 3:

Table 3.1: RSV replicon and virion cDNA constructs with a constant number of genes and with the viral glycoprotein genes in their natural positions………….80

Abbreviations

A Adenine

AFP Alpha-fetal protein

AU Arbitrary Units

A549 Type II alveolar epithelial lung carcinoma cell line

BHK Baby hamster kidney immortalized cell line

BSD Blasticidin S deaminase cDNA Complementary DNA

CMV Cytomegalovirus cpRSV Cold-passage RSV

CsCl Cesium Chloride

Cys Cysteine

DAOY IFN-sensitive medulloblastoma cell line

DMEM Dulbecco’s modified Eagle medium

DNA Deoxyribonucleic acid

DRbz Hepatitis D virus ribozyme

F Fusion protein

F0 Precursor form of the fusion protein

F1 Larger subunit of the fusion protein formed after furin

cleavage

F2 Smaller subunit of the fusion protein formed after furin

cleavage fbs Fetal bovine serum

FI-RSV Formalin-inactivated RSV

G Glycoprotein (attachment)

G Guanine

GAGs Glycosaminoglycans

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

GE Gene end

GFP Green fluorescent protein

GS Gene start

GT Guanylyltransferase

GTP Guanine triphosphate

H Hemagglutinin

HAE Human airway primary epithelial cells

HCl Hydrochloric acid

HCV Hepatitis C virus

HEK-293 Human embryonic immortalized kidney cell line

HeLa Human cell line derived from cervical adenocarcinoma

HEp-2 Human epithelial cell line type 2

HN Hemagglutinin-neuraminidase

HRbz Hammerhead ribozyme

HS Heparan sulfate

xii

Huh7 Human hepatocarcinoma cell line

Huh7.5 Huh7-derived cell line that is RIG-I deficient

IFN Interferon

IG Intergenic region

IgA Immunoglobulin A

IKKε Inhibitor of nuclear factor κB-kinase

IRES Internal ribosome entry site

IRF3 Interferon regulatory factor 3 kDa Kilodalton

L Large protein (polymerase)

Le Leader

M Matrix protein

MDCK Madin-Darby Canine Kidney immortalized epithelial cell line

Met Methionine

MEM Minimum Essential Media mRNA messenger RNA

MW Molecular weight

N Nucleoprotein

NS1 Nonstructural protein 1

NS2 Nonstructural protein 2

ORF Open reading frame

OSV One Step Virion

P Phosphoprotein

xiii

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PFP Purified F protein p.i. Post infection

PIV5 Parainfluenza virus type 5

RACE Rapid Amplification of cDNA Ends rg Recombinant green

RIG-I Retinoic acid inducible–gene I

RNA Ribonucleic acid

RPMI Roswell Park Memorial Institute medium

RSV Respiratory syncytial virus

RT-PCR Reverse transcriptase PCR

SDS-PAGE Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

Ser Serine sG Soluble G

SH Small hydrophobic protein siRNA Silencing RNA

SR19 Sindbis virus replicon 19

STAT2 Signal Transducers and Activators of Transcription 2

SV5 Simian virus type 5

Th2 Helper T cell response 2

Thr Threonine

TLR Toll-like receptor

xiv

TNF-α Tumor necrosis factor alpha

Tr Trailer

TRAF3 TNF receptor-associated factor 3

TrC Trailer complement

Ts temperature sensitive

U Uridine

Vero African green monkey kidney cells

VSV Vesicular stomatitis virus

Wt Wild type

Chapter 1: Introduction

Respiratory syncytial virus (RSV) was first isolated in 1956 from a symptomatic laboratory chimpanzee (158). Shortly thereafter, RSV was recognized as one of the most important viral agents causing significant disease in the pediatric, elderly, and immunocompromised population (7, 67, 112, 163, 200). No vaccine is available to protect against RSV disease and no antiviral therapy is available to combat RSV infection. However, an effective but costly prophylaxic treatment with RSV-neutralizing antibodies is used to protect high-risk individuals, particularly babies born prematurely (41, 63, 165). Vaccine development against

RSV has been hampered by the fact that killed virus vaccine causes enhanced disease upon subsequent infection and that wild-type virus infection does not protect against subsequent infections and by the lack of representative small animal models for robust infection and authentic disease.

Classification

RSV is an RNA virus of the Pneumovirinae subfamily of the Paramyxoviridae family and of the Mononegavirales order, which consists of nonsegmented negative strand RNA viruses. Common characteristics of the Paramyxoviridae family include: 1) a single strand, negative sense RNA genome encapsidated in an RNase-resistant helical nucleocapsid with the viral polymerase; 2) the

1 polymerase interacts with cis-acting signals, which guide the polymerase to transcribe the genome in a stop-restart mode; 3) the replication cycle is cytoplasmic; 4) virions bud at the plasma membrane and acquire a lipid envelope; 5) virions enter the host cell through fusion with the cell-surface.

Members of the Paramyxoviridae also have six proteins in common: 1) the nucleocapsid (N) protein that covers the RNA genome forming a helical nucleocapsid; 2) the phosphoprotein (P) that is nucleocapsid associated; 3) the large (L) protein that is the polymerase; 4) the matrix (M) protein that organizes the virion components during budding; 5) the attachment glycoprotein (G, H, or

HN); and 6) the fusion (F) glycoprotein that causes membrane fusion during entry.

The Virion

RSV virions are pleomorphic lipid enveloped particles that range in diameter from

150 to 300 nm. Filamentous forms are also common (17, 190). The lipid envelope is derived from the host plasma membrane. It contains three glycoproteins G (glycoprotein), F, and SH (small hydrophobic). The M protein lies underneath the lipid envelope, associated with the nucleocapsid. The nucleocapsid consists of the RNA genome and four nucleocapsid proteins: N, P,

L, and M2-1. The M2-1 protein is a transcription anti-termination factor that is unique to the Pneumovirinae subfamily.

The Viral Proteins

The RSV genome encodes 11 proteins from 10 genes in a linear order: NS1,

NS2, N, P, M, SH, G, F, M2-1/M2-2, and L. Each gene unit begins with a gene start sequence that marks the initiation of transcription, ends with a gene end sequence that marks the end of transcription and causes the mRNA to be polyadenylated, and is separated from the next gene by an intergenic region. All of the RSV genes are separate from each other except for the M2 and L genes, which overlap. The M2 gene consists of two open reading frames, encoding M2-

1 and M2-2 proteins. M2-2 overlaps M2-1 and is expressed by the translation termination-reinitiation mechanism. The L gene overlaps the M2 gene by 68 nucleotides.

The F Protein

The RSV F protein is responsible for fusing the viral envelope with the host cell plasma membrane. The F protein is also responsible for the notable cytopathic effect of RSV, its ability to cause syncytia in vitro. A syncytium is a giant, multinucleated cell that results from the fusion of individual cells. There is also evidence that the F protein triggers caspase-dependent cell death. The expression of the F protein in epithelial cells in vitro has been shown to cause phosphorylation of the tumor suppressor protein p53, activation of p53 transcriptional activity, and activation of proapoptotic Bax. These events may lead to epithelial cell shedding, airway obstruction, secondary necrosis, and inflammation in vivo (62).

The F protein is synthesized as a precursor F0 that forms a trimer, each subunit of which is cleaved by a cellular furin-like protease in two places as it passes through the trans Golgi compartment on its way to the cell surface. Two of the resulting three fragments remain associated, linked in two positions by disulfide bonds, while the third fragment, a 27 amino acid peptide, it released. The result is a trimer of disulfide-linked F2-F1 heterodimers. The cleavages activate the F protein by releasing the hydrophobic “fusion peptide” at the N-terminus of the F1 subunit. The F protein is produced in a spring-loaded form. Upon triggering, the F protein undergoes major shape changes to insert the fusion peptide into the target cell membrane and fold back on itself to bring the two membranes together to initiate membrane fusion.

Members of the Paramyxovirinae subfamily, the other larger subfamily within

Paramyxoviridae, require their attachment protein to bind to the cellular receptor and to trigger the F protein to cause fusion (201). However, the RSV F protein can bind to a target cell and cause fusion independent of its attachment protein.

RSV missing its G protein infects and spreads in cell culture, indicating that the

RSV F protein is able to bind and fuse sufficiently to allow for viral entry (126,

127, 214). Transient expression of the RSV F protein in cultured cells causes syncytial formation (14). Although, F protein fusion is independent, coexpression of the attachment G glycoprotein increases the size of syncytia formed (14, 108) probably by enhancing the contact between neighboring cells.

The G Protein

The G glycoprotein was identified as the main attachment protein because antibodies against G blocked virions from binding to HeLa cells, while anti-F antibodies prevented fusion but not binding (145, 227). The G protein is very different in structure and sequence from the HN or H attachment proteins of the

Paramyxovirinae subfamily which are related to each other. The G and HN/H glycoproteins share the same membrane orientation: their N-termini are membrane-associated by the single hydrophobic region that serves as both a signal peptide and an anchor. The C-termini of the G and HN/H proteins are external. The HN/H glycoprotein has a globular head supported on a stalk (132).

The structure of the G protein has not been solved, but is heavily glycosylated, similar to mucins.

The G protein is glycosylated with 4 to 5 N-linked carbohydrate chains, and is heavily glycosylated with O-linked sugars. In addition, it is palmitylated (48). The unglycosylated polypeptide backbone of G is 32 kDa. The addition of N-linked sugars, which occurs cotranslationally, increases its MW to 45 kDa. The addition of O-linked sugars occurs later in the trans Golgi, doubling the MW of the mature

G protein from 45 kDa to 90 kDa. The large number of O-linked sugars and the abundance of serine, threonine, and proline residues in the G protein is similar to mucins. Mucins are host glycoproteins that form a protective barrier over the respiratory, gastrointestinal, and reproductive tracts.

The G protein is also synthesized in a secreted form (sG), which is derived from translation initiation at the second AUG codon in the G reading frame. This

5 protein has a partial transmembrane domain which is cleaved to release the sG protein. The sG form comprises 80% of the G protein released from some cell types at 24 h post infection, with the remainder being in virions (110, 191).

The G protein is the least conserved RSV protein. Its antigenicity also varies among RSV strains. This diversity is mostly limited to the ectodomain of G.

However, there is highly conserved segment in the middle of the G protein that has 4 conserved cysteines that form a “cysteine noose”. This region has no O- linked glycans because it lacks Ser and Thr and is thought to be important in receptor attachment. Additionally, there is a highly basic heparin-binding site close to the conserved region, which is involved in attachment to cellular glycosaminoglycans (73).

Surprisingly, the G protein is not essential for virus propagation, although the absence of G decreases the viral growth rate and titer. The non-essential nature of the G protein was first identified in a highly attenuated virus with a spontaneous deletion of G and SH (designated B1 cp-52) that was recovered after many passages in Vero cells (127). This mutant virus replicated efficiently in Vero cells, to an intermediate level in cotton rats, and at a very low level in humans. Using reverse genetics our lab generated a recombinant green fluorescent protein (GFP)-expressing (rg)RSV that is missing the SH and G genes. The rgRSV attached one-third as efficiently as a virus with the G protein, but the rate of entry into the cell of the attached virus was similar (214). This observation indicates that the G protein enhances attachment but is not essential for it.

There is evidence that the G protein plays a role in viral immune evasion. The sG protein has been shown to inhibit TLR3/4, act as an antigen decoy, and modulate leukocytes bearing Fc receptors (28, 197). Additionally, the cysteine noose in the conserved region of the G protein shares sequence homology with the CXC3 chemokine fractalkine. Fractalkine is known to increase leukocyte chemotaxis. It has been demonstrated that the G protein binds to the CXC3 chemokine fractalkine receptor and modifies the chemotaxis of leukocytes carrying that receptor (103, 221).

The SH Protein

The SH (small hydrophobic) protein is a short integral membrane protein with its

C-terminus oriented extracellularly anchored by a hydrophobic signal-anchor sequence (50). Intracellularly SH exists in several different forms: SH0 is a full- length nonglycosylated species of MW 7.5 kDa; SHg is 13 to 15 kDa and it contains a single N-linked sugar chain; SHp is 21 or more kDa and has N-linked sugars that have been further modified with the addition of polylactosaminoglycan; SHt is 4.8 kDa and is nonglycosylated, derived from an alternate gene start in the ORF. The two predominant forms in the virion are SH0 and SHp.

The growth and propagation of recombinant RSV from which SH gene has been deleted is not affected in cultured cells (27). In fact, it showed a modest growth advantage in certain cell lines, which might be due to the smaller genome length.

In vivo it was attenuated in the upper, but not lower respiratory tract of mice and was slightly attenuated in upper and lower tract in chimpanzees (27, 229).

There is evidence that SH might play a role in preventing apoptosis after infection. The SH protein of RSV was functionally able to replace the SH protein in parainfluenza virus 5 (PIV5), which is known to prevent TNF-α induced apoptosis (82). SH may also form an ion channel; however, the purpose of this ion channel is unknown (84, 133, 178).

The M Protein

The M (matrix) protein of RSV is thought to be critical for assembly of RSV proteins at the cell membrane (217), based on studies with other paramyxoviruses that demonstrate that it is an organizer of the other viral proteins during the budding process (88). This model is largely based on a measles virus mutant that lacks its M gene. The titers of this M-less measles virus were reduced about 250-fold and co-localization between the ribonucleocapsids and glycoproteins was largely lost, indicating the role of M protein as the virus assembly organizer (36). RSV M seems to fit this model since the M, along with the N and the G proteins, has been shown to co-localize with lipid rafts in the plasma membrane where RSV budding occurs (26, 152,

155). Several studies have also demonstrated associations between RSV M protein and other RSV proteins (93, 94, 109, 152, 189). Additionally, the M protein seems to be critical for production of virions. The absence of the RSV M protein during virion assembly prevented the production of infectious “minivirions”

8 in a multicomponent transfection system (217), but it was not clear whether it prevented the production of virions.

Replication Complex Proteins

RSV replication complexes are detected as large cytoplasmic inclusions, which are thought to be sites of high viral RNA synthesis (87). The RSV N

(nucleocapsid) protein is responsible for encapsidating the RSV genome and antigenome to form helical, RNase-resistant nucleocapsids. The RSV nucleocapsid has recently been crystallized in a ring form. The viral genomic

RNA fits in a groove of each N protein subunit with seven nucleotides contacting each N subunit, alternating rows of four and three stacked bases that are exposed and buried, respectively, within the protein groove (213).

The RSV P protein is a highly phosphorylated protein that has been shown to be a polymerase cofactor (13, 61). There is evidence that phosphorylation of the P protein at S54 is critical for the disassociation of the viral ribonucleoproteins from the M protein during the uncoating process, which is needed for the initiation of viral transcription (4). The P protein has also been shown to be a chaperon for the RSV N protein, enabling it to package the RSV genome and antigenome (5,

72).

The RSV L is the viral polymerase (204). The L protein has a molecular weight greater than 200 kDa and it is the least abundant of all the structural proteins in the paramyxovirion. The comparison of the L protein amino acid sequence

9 between several paramyxoviruses revealed six conserved regions (181, 198), which are suspected to be essential for the activity of the L proteins. Interaction between the P and the L protein is needed to form a functional RNA polymerase complex that transcribes and replicates the nucleocapsid as it has been shown with other paramyxoviruses (100, 153, 205). The functional interaction between the P and the L protein is poorly understood but the critical regions responsible for this interaction have been mapped to the N-terminal amino acids of the L protein of simian virus 5 and Sendai virus (38, 175) and the first 408 amino acids of the L protein of measles virus (114). It is not known what exactly comprises the L/P polymerase complex but there is evidence that cytoskeleton proteins such as actin and profilin are critical for RSV RNA synthesis (12, 29, 85, 123,

223). It is believed that RSV nucleocapsids interact with these cytoskeleton proteins to form scaffolds where RNA synthesis would take place.

The Paramyxoviridae polymerase complex in vitro has been shown to execute 5’ capping and polyadenylation of mRNA (132). Similarly to the L protein of vesicular stomatitis virus (VSV) the L proteins of the paramyxoviruses are thought to be responsible for all the catalytic steps in mRNA synthesis such as capping the mRNA, methylating the cap, and polyadenylating the mRNA (226). A bioinformatics study has predicted a 2’-O-methyltransferase domain involved in the synthesis of type 1 cap of viral mRNAs in the C-terminal region of all

Mononegavirales polymerases, except Bornaviridae and Nucleorhabdoviruses

(77). The methyltransferase activity of the predicted region in the Sendai virus polymerase has also been demonstrated biochemically in vitro (166).

There are a few studies that suggest that the Mononegavirales polymerase executes the capping of the viral mRNAs. Studies with VSV L protein have revealed a unique capping activity of its L protein, which excluded the cellular guanylyltransferase (GT) as a capping enzyme of viral mRNAs (97). The VSV polymerase has been shown to incorporate the α- and β-phosphates of GTP into the 5’ cap unlike the GT, which incorporates the α-phosphate of GTP into the cap. Additionally, an inhibitor of RSV mRNA capping has been discovered, which led to the discovery of escape mutants that carried mutations within the L gene

(148). The mutations were within a motif that was distinct from the catalytic region of the L protein. This motif resembled the nucleotide binding domain within nucleoside diphosphate kinases. The findings of this study showed that this unique motif in the RSV L protein is responsible, either directly or indirectly, for capping of viral mRNAs.

The M2-1 protein

The M2-1 protein is encoded by the first of the two open reading frames in the

M2 gene. The M2-1 protein of RSV is a transcription anti-termination factor and is critical for the processivity of transcription. It enables the synthesis of complete mRNA (43, 47, 48, 70, 104, 106). During infection, M2-1 associates with the cytoplasmic inclusion bodies that contain the P and N proteins, and probably the

L protein (87). A physical interaction between M2-1 and P, N, and M proteins has been reported (87, 147). In fact, M2-1 has an adaptor protein role in allowing M protein to associate with the cytoplasmic inclusion bodies (147). Interaction

11 between P and M2-1 is regulated by phosphorylation of Thr108 in the P protein.

Its phosphorylation leads to the disassociation of M2-1 from the P protein and loss of the transcriptional anti-termination activity of M2-1 on the viral polymerase

(4). M2-1 has also been shown to have RNA-binding activity but its binding specificity has not been determined (35, 55). The interaction between M2-1 and viral RNA is needed for M2-1 and N protein association (55). In infected cells M2-

1 is mostly found in an unphosphorylated form but a minor phosphorylated form is also found. M2-1 phosphorylation has been shown to be important for its function but not for its interaction with N protein or RNA (35). There is a zinc finger motif found at the N terminus of M2-1 which has been shown to be essential for M2-1 anti-termination function and for its interaction with viral RNA

(35) and the N protein (105, 212). The integrity of this zinc finger motif is vital for

M2-1 phosphorylation and thus function (106).

The M2-2 Protein

The M2-2 ORF follows and overlaps the ORF of M2-1 by 31 nucleotides. The

M2-2 protein is expressed by a translation termination-reinitiation mechanism.

The next-to-last gene location of M2-2 and its initiation by ribosome reverse translocation imply that M2-2 is produced at a low level. It has been shown to accumulate slowly, being below the threshold of detection at 12 or 18 hr p.i. but accumulating enough to be detected at 24 hrs p.i. and continue to accumulate throughout the infection (2). The slow and steady increase of M2-2 over time suggests that it is a stable protein that is needed in the late stages of infection.

Additionally, M2-2 over-expression completely inhibits RSV replication, implying that the level of M2-2 is critical for RSV replication (40). M2-2 does not seem to be an essential gene, but the growth of M2-2 deleted virus has been shown to be slower than wild-type (wt) virus in HEp-2 cells (16, 121). This M2-2 deleted virus produced more mRNA and less genome compared with wt virus, implying that

M2-2 plays a role in regulating RNA synthesis by causing the polymerase to switch from mRNA transcription to replication (16, 48). In rodents and chimpanzees the M2-2 deleted virus was very attenuated but it did induce a protective immune response (218).

The NS1 and NS2 Proteins

NS1 and NS2 are nonstructural proteins of RSV, meaning that they are not found in the virion. In a minigenome replication system the over-expression of NS1 was very inhibitory to transcription and RNA replication. This observation suggests that NS1 might play a regulatory role in RNA synthesis. NS1 and NS2 do not appear to have an important role in assembly or passage of virus-like particles

(217).

An important function of NS1 and NS2 proteins is to antagonize the interferon

(IFN) response (24, 202, 203). Both NS1 and NS2 target TRAF3, a major downstream player in the initial induction of IFN. NS2 targets STAT2, a critical transcription factor for IFN-inducible antiviral genes. NS1 targets IKKε, a key protein kinase that phosphorylates and activates IRF3 (210). Inhibition of these

13 two signaling molecules inhibits the induction of the anti-viral response in infected cells.

Recombinant RSV deleted for the NS1, NS2, or NS1/NS2 replicated very poorly in IFN-proficient cells in vitro. They replicate much better in IFN-negative Vero cells, but still less efficiently that wt RSV, suggesting that the NS proteins also play a direct role in virus replication (23, 216). NS1/NS2-deleted RSV is highly attenuated in vivo (218, 229).

RNA

Genomic and antigenomic RNA

Both the genomic and antigenomic RNAs of RSV are encapsidated by the N protein in a helical form protecting them from RNase. These RNAs are exact complementary copies of each other. The nucleocapsid containing the antigenomic RNA serves as the template for transcribing the genomic RNA. The nucleocapsid containing the genomic RNA serves as the template for transcribing the 10 individual mRNAs and the complete antigenomic RNA. The 3’ ends of the genomic and antigenomic RNAs are 81% identical. This conserved region contains the required cis-acting signals for replication (71).

mRNA

The RSV genome is composed of 10 viral genes in this order: NS1, NS2, N, P,

M, SH, G, F, M2, and L. Each gene contains a single ORF except for M2, which has M2-1 and M2-2 ORFs. The transcribed mRNAs are capped and cap

14 methylated, and polyadenylated. Capping, cap-methylation, and polyadenylation are mediated by the viral polymerase as demonstrated by the in vitro studies with the RNP complex isolated from RSV-infected cells and vesicular stomatitis virus

(VSV)-infected cells. VSV is a negative strand RNA virus in the Rhabdoviridae family (11, 12, 97, 148, 154). Discovery of 5’ capping inhibitor demonstrated the importance of the GpppGp cap at the 5’ end of RSV mRNA (148, 154). Inhibition of cap-formation resulted in short, abortive transcripts that were not polyadenylated. Methylation of the GpppGp cap does not appear to be critical for

RSV transcription since it is not affected when methylation is inhibited (148).

Every RSV gene begins with a highly conserved 10-nucleotide gene-start (GS) sequence: 3’CCCCGUUUA(U/C). The L gene is the only exception having a slightly different GS: 3’CCCUGUUUUA. These differences in the GS do not seem to have any functional significance (136). Each gene also has a semi-conserved

12-13 nucleotide gene-end (GE) (209). The RSV gene-end consists of a conserved pentanucleotide 3’-UCAAU, followed by a 3 nucleotide middle region that is AU-rich but not conserved and ending with a 4 or 5 nucleotide poly U region that is believed to generate the poly A tail of the viral mRNA through reiterative copying by the viral polymerase (44, 136, 138, 209).

Due to inefficient termination at various genes approximately 10% of total mRNA generated is readthrough, containing the sequence of two neighboring genes.

Only the first ORF of a readthrough mRNA is translated efficiently in most cases, thus reducing the amount of a downstream gene expression.

Intergenic (IG) regions separate the first nine genes and range in length from one to 56 nucleotides among the known strains of RSV. The IG sequences are not highly conserved among strains, however, the general length of the IG regions, short (N/P) or long (F/M2), is similar in all strains (44, 122). The M2 and the L genes overlap by 68 nucleotides, so the GS of L is located inside of the M2 gene, suggesting that the polymerase must transcribe this sequence twice, once during the synthesis of M2 mRNA, slip backwards to find the L gene GS sequence, and transcribe the overlap region a second time during the synthesis of L mRNA (69).

The RSV Life Cycle

Attachment and entry

The RSV life cycle in cultured, immortalized cells begins with the G glycoprotein binding to heparan sulfate (HS), and possibly chondroitin sulfate B, which are iduronic acid-containing glycosaminoglycans (GAGs) linked to proteins on the cell surface (99) (Fig. 1.1). RSV enters the cell by fusion of the virion and cell membranes mediated by its F protein. The replicative cycle of RSV occurs solely in the cytoplasm without nuclear involvement. However, RSV M protein has been shown to localize to the nucleus and contain nuclear-cytoplasmic trafficking signals (89-92).

Transcription and replication

As the virion fuses with the cell membrane the nucleocapsid is released into the cytoplasm and transcription of the genome begins. The termini of the genomic

RNA contain the leader (Le) and trailer (Tr) sequences, at the 3’ and 5’ ends, respectively. The Le and Tr contain the cis-acting signals for polymerase binding, transcription, and replication (49, 156). During mRNA transcription the polymerase binds to the Le and slides along the genome, initiating mRNA transcription at every GS and terminating and polyadenylating at every GE. The

GE contains a polyuridylate rich region, which the polymerase copies several times to create a poly A tail before the mRNA is released.

The polymerase disassociates from the genome with some frequency as it crosses each IG region, that is, after it releases the previous mRNA and before it begins transcription at the next GS sequence. This phenomenon creates a polar gradient of transcripts, with those closest to the 3’ end produced at a higher amount than those closer to the 5’ end (40, 51, 106, 134, 137).

During the replication cycle, a switch from transcription to replication of the genome occurs. The M2-2 protein is thought to be at least partially responsible for this switch (16) Experiments with M2-2 deleted RSV virus exhibited an increase in mRNA transcription and decrease in genome replication. During genome replication, the polymerase binds to the Le and copies the full length of the genome, ignoring all the GSs and GEs, to synthesize the antigenome. At the

3’ end the antigenome, the Tr complement (TrC), which has a similar promoter

17 sequence to that of the Le. This promoter is used by the polymerase to initiate negative sense RNA genome synthesis.

It is thought that the N protein might be responsible for the switch from transcription to replication in paramyxoviruses (132). It is believed that the level of unassembled N protein determines whether the viral polymerase will replicate or transcribe the genome; low availability of the N protein would direct the polymerase to make transcripts instead of replicating the genome because there would not be enough N protein to encapsidate the antigenome, while high availability of N would encapsidate the leader RNA and downstream RNA.

However, minigenome study with RSV showed no evidence of the increased N protein expression skewing the balance from transcription to replication (72).

Assembly and Budding

Virion assembly occurs at cholesterol-rich regions at the cell membrane called lipid rafts. The M protein has been shown to strongly associate with the lipid rafts

(109), where it colocalizes and interacts with other viral components to organize the assembly and budding of progeny virions. In non-polarized cells budding occurs from all surfaces. In polarized cells, such as human airway epithelial cells that are the target for virus infection in vivo, virion budding occurs strictly from the apical surface, implicating the existence of a specialized apical sorting pathway

(190, 239).

Fig. 1.1. RSV life cycle. Prepared by Sunee Techaarpornkul and used with her permission.

Vaccines

The most effective method to protect the human population from an infectious disease is vaccination. Because of its important impact on human health, a great deal of effort has gone into developing a vaccine for RSV. Complete protection from RSV infection is probably not possible, but protection from severe lower respiratory infections with RSV may be. However, several factors need to be considered when making an effective vaccine (159). First, the immature immune system and the presence of maternal anti-RSV antibodies in infants might counteract the development of a robust immune response following vaccination.

Second, in order for the vaccine to be successful it must protect against both A and B RSV subtypes. This requirement is made difficult by the sequence variability in the G protein and its high level of glycosylation. The F protein, on the other hand is highly, though not perfectly, conserved. Third, a natural infection with RSV results in incomplete immunity: one can be infected with RSV repeatedly throughout life, and even with the identical strain (98). Lastly, the initial experimental vaccine against RSV administered to infants was a formalin- inactivated whole virus preparation (FI-RSV). This vaccine caused enhanced disease rather than protection after subsequent RSV infection (125, 130).

Inactivated Virus Vaccine

The FI-RSV vaccine apparently failed due to induction of an ineffective Th2 inflammatory response upon subsequent infection with RSV. This response included pulmonary infiltration of eosinophils, which resulted in dangerous swelling and narrowing of the airways (42, 130, 143). This Th2 response led to

20 dramatically enhanced disease symptoms after subsequent RSV infection, resulting in a high rate of hospitalization and two deaths (125, 130).

Aside from causing more severe disease upon subsequent infection, the FI-RSV vaccine also failed to induce neutralizing antibodies against RSV (83). Some of the possible reasons for this are denaturation of B cell epitopes caused by the formalin treatment (172, 185, 228) and the possible lack of Toll-like receptor stimulation by the vaccine (57). Parenteral administration of the vaccine may have also contributed to the ineffectiveness of this vaccine by failing to induce anti-RSV secretory IgA antibodies.

Live-attenuated RSV Vaccine

The goal of the live-attenuated RSV vaccine is to generate a broad and protective immune response without causing significant illness. To make an attenuated strain for a live vaccine, RSV was mutagenized resulting in RSV

(temperature sensitive, ts1C) which showed promise as a vaccine candidate in the adult population (187). It is a triple mutant which is unable to replicate at 37°C and above. It showed promise as a live vaccine candidate because it induced only mild respiratory tract disease symptoms in the recipients, induced more than a 2-fold increase in serum neutralizing antibodies, and it demonstrated greater genetic stability than previous mutants. However, this vaccine has not developed further. Another group extensively passaged RSV at low temperature and isolated a cold-passage (cpRSV) strain of the virus and combined it with a ts mutation (80). This cpRSV strain, cpts248/404, among others was further

21 attenuated by mutagenesis (232). Immunization of 1-2 month old infants with this strain showed a promising protective immune response. However, more than

70% of infants developed nasal congestion of short duration and thus this strain was deemed insufficiently attenuated.

Reverse genetics were also used to attenuate RSV strains by engineering mutations in and/or by deleting genes. An SH-deleted RSV strain was a candidate because its replication in chimpanzees was slightly reduced; however, the deletion of SH from a highly attenuated vaccine strain was not effective enough in reducing its pathogenicity in young infants to an acceptable level

(128). The deletion of NS1/NS2 was also found to further attenuate the virus and possibly boost the protective immune response (218, 230). The several strains that were created using reverse genetics to combine known attenuating mutations in novel combinations showed variable success. Some of these strains were either over- or under-attenuated or showed signs of genetic instability.

Although live attenuated RSV vaccine does show promise, a major challenge remains to create a vaccine strain that is effective and minimally pathogenic

(128, 233).

Subunit Vaccine

Since antibodies against RSV F or G neutralize the virus, several vaccines were tested using just F and G proteins. Unfortunately, rodents immunized with such a vaccine developed pathologies after challenge with RSV that were similar to those following the FI-RSV vaccine (161). The addition of adjuvants, particularly

22 those that stimulate TLRs, have shown promise for the subunit vaccine (101,

182).

Significant anti-RSV neutralizing antibody titers without adverse effects were seen in clinical trials with purified F protein (PFP) (159); however, there was no difference in the rate of RSV infection between the vaccinated and control groups after vaccinating with one of PFP derivatives (180). Adverse effects and a rapid decline in neutralizing antibodies were observed in elderly adults when vaccinating with bacterially derived G protein (159).

Vector-based RSV Vaccine

Several live virus vectors bearing RSV F/G have been generated as potential vaccines against RSV (159). Such vectors included vaccinia virus, adenovirus, alphavirus, Newcastle disease virus, and human rhinovirus. Most of these viral vectors proved to be immunogenic and protective to varying degrees in mouse or primate RSV challenge studies. One vector vaccine that has been shown to be immunogenic and efficacious in primate studies is chimeric bovine parainfluenza virus expressing RSV F. It is currently being evaluated in clinical studies.

DNA Vaccines

An RSV DNA vaccine presents many technical challenges and so far it has been limited in its immunogenicity and protection in rodent RSV challenges. However,

DNA-based RSV vaccines would potentially be advantageous in infants where

RSV-encoded proteins would be expressed in their native structure avoiding the maternal antibody-associated suppression of anti-RSV response (159).

Passive Immunization

The current method for preventing severe respiratory tract disease caused by

RSV infections is through passive immunization. A humanized monoclonal antibody (known as palivizumab or by its brand name Synagis) against an epitope in the RSV F protein has been developed by MedImmune. The standard administration of Synagis is a once a month injection to at-risk children during the

RSV season. In two clinical trials the administration of Synagis has shown to reduce the risk of hospitalization due to RSV infection by 45-55% (115).

Palivizumab, however, does not effectively inhibit RSV replication in the upper respiratory tract and there is a small percentage of patients that are not protected by it (234). For that reason, palivizumab was affinity-matured. The result, motavizumab, contained changes in three residues. These changes greatly diminished non-specific antibody binding that was seen with palivizumab and increased RSV F protein binding by 70-fold in vitro with100-fold greater neutralization activity in cotton rats. Additionally, motavizumab was very effective in inhibiting RSV replication in the upper respiratory tract of cotton rats, unlike palivizumab. A phase 3 clinical trial revealed a 50% reduction in medically attended lower respiratory tract RSV infections in patients that were treated with motavizumab compared to patients that were treated with palivizumab with

24 similar adverse effects (33). Motavizumab is currently under FDA review for licensing approval.

Antiviral Agents

Nucleoside Analog

Ribavirin is the currently approved drug for treating severe RSV infections.

Ribavirin is a nucleoside analog, which resembles purine RNA nucleotides when metabolized. In that form ribavirin interferes with RNA synthesis. However, it is not known exactly how it interferes with viral replication. Ribavirin’s use in treating RSV infections is controversial because its effectiveness is questionable

(135). It is, therefore, seldom used.

Fusion Inhibitors

The F protein of RSV is the main target for developing antiviral small molecules because it is such an essential protein in RSV life-cycle. There are two small- molecule fusion inhibitors (BTA-9881 and TMC-353121) that show promise in

RSV infection treatment (21). In RSV infected rats TMC-353121 treatment resulted in 90% inhibition of viral replication. BTA-9881 is currently being tested in clinical trials (65).

Attachment and Replication Inhibitors

Small-molecule inhibitors against RSV G, L, and N proteins have also been developed (65). MBX-300, RSV G protein inhibitor, has demonstrated a safe,

25 specific, and significant activity against RSV in rats and monkeys (59, 65, 131,

199). MBX-300 was found to inhibit both the binding of RSV to the cells and penetration of RSV into the cells (131). The purpose of creating inhibitors against RSV L and N proteins is to target RSV replication after infection has taken place. YM-53403, an anti-L compound, has been shown to be 76-105 times more potent than ribavirin in inhibiting the replication of a wide range of

RSV strains in vitro (206). Preclinical studies are currently ongoing for YM-53403.

RSV604 is an oral benzodiazepine that appears to target the RSV N protein (65).

It displays antiviral activity against most clinical isolates of the two RSV subgroups. Unlike the fusion inhibitors, RSV604 demonstrates antiviral activity after RSV infection. Clinical trials with RSV604 are currently ongoing.

RNA Interference Inhibitors

RNA interference technology has also been utilized to inhibit RSV replication. siRNA targeting RSV P mRNA (18), NS1 mRNA (238), and N mRNA has been developed (3). Out of these three siRNA, an siRNA targeting the N mRNA (ALN-

RSV01) is currently being tested in adult clinical trials (65). ALN-RSV01 demonstrated a 38% reduction in RSV titer when given two days before and 3 days after RSV inoculation, compared to the placebo treated subjects.

Reverse Genetics

Studies and manipulations of RSV and many other mononegaviruses were made possible by reverse genetics, where modified or wild-type infectious virus can be

26 recovered from cDNA. In order to convert the cDNA into replicating RSV in the cytoplasm, antigenomic RNA and the N, P, L, and M2-1 “support” proteins must be co-expressed (Fig.1.2) (43, 46, 120). The support proteins are necessary for a formation of the RSV replication complex. RSV is distinguished from other paramyxoviruses by its requirement for M2-1 as a fourth support protein (43).

The cDNA copy of the genome and the support plasmid ORFs are all flanked by a T7 polymerase promoter and terminator. The cDNA plasmids are transcribed by T7 polymerase provided by MVA-T7, an attenuated, recombinant vaccinia virus expressing T7 polymerase (235) (Fig. 1.2) or a noncytopathic Sindbis virus replicon expressing T7 polymerase (167).

Transcription by the T7 polymerase generates the RSV antigenome, and the proteins needed for RSV replication: N, P, L, and M2-1. The mRNAs produced by

T7 polymerase in the cytoplasm are not capped and would not be translated efficiently. To improve translation, an internal ribosome entry site (IRES) from encephalomyocarditis virus is inserted upstream of the coding sequence to provide an RNA cap substitute. IRES is a highly structured RNA sequence that recruits ribosomes for the initiation of mRNA translation in the absence of the 5’ cap (79)

In the RSV antigenome plasmid, a delta ribozyme sequence from hepatitis D virus is inserted between the end of the genome and the T7 terminator. This ribozyme cuts the RNA transcript, removing the extra sequence generated by the

T7 polymerase to yield the native RSV 3’ terminus. In our laboratory, we have also inserted a hammerhead ribozyme after the T7 promoter to yield a native SV

5’ terminus in some of our constructs (139). The antigenome transcript is then encapsidated by the N protein and transcribed by the viral polymerase to produce more genome. The genome is also encapsidated by the N protein and used by the polymerase to produce viral mRNAs, antigenome, and more genome. At this point RSV replication becomes autonomous, without any further need for the DNA templates.

Fig. 1.2. Launching recombinant green fluorescent protein expressing RSV (rgRSV) from cDNA.

Infection of immortalized cells in culture

RSV is able to infect and grow in a wide variety of human and animal cell lines.

Fresh RSV isolates do not appear to require adaptation to infect these cells (48).

Infection begins with RSV binding to heparan sulfate or other GAGs. The most commonly used cell line for propagation of RSV is HEp-2, which originally was from an epithelial carcinoma of the larynx but is now considered by the American

Type Culture Collection to be a sub-line of HeLa (epithelial cells from a cervical adenocarcinoma) cells. Another cell line that is commonly used is Vero. Vero cells were derived from African green monkey kidney cells. The Vero cell line is thought to be ideal for viral propagation because it does not produce IFN and is approved by the World Health Organization for use in human vaccine production.

The A549 (type II alveolar epithelial lung carcinoma) cells are also commonly used. There are potential problems with studying RSV in vitro: one problem is that there is a relatively poor virus yield from immortalized cells (6, 146). Another issue is that the immortalized cells might not reflect the life cycle of RSV in all ways.

Primary well differentiated human airway epithelial (HAE) primary cells are more representive of the cells in the human respiratory tract. HAE cells are being used increasingly to study respiratory infections. These cells are derived from undifferentiated basal lung cells harvested from fresh human airways. HAE cultures are grown on a transwell insert with media above and below until tight junctions form. At that point, the media above the cells is removed creating an air liquid interface. Over the span of 4 weeks the HAE cells develop into 29 pseudostratified, multilayered polarized epithelial cells that resemble the lining of airways.

The use of an HAE cultures and other polarized cells for RSV infection has revealed that: 1) RSV only infects the apical layer of the polarized epithelial cells;

2) only the ciliated cells are infected; 3) syncytia are absent probably because the RSV glycoproteins are sorted only to the apical membrane ; 4) In the absence of the immune response RSV infection is not highly toxic (190, 238,

239); and 5) RSV likely uses a different receptor in vivo than in vitro because heparan sulfate is absent from the apical surface (140). These observations represent a more natural life cycle of RSV and also make RSV a potential candidate for cystic fibrosis gene therapy in the lung (139).

Infection of experimental animals

A wide range of animals can be infected with RSV (15, 31), however, only chimpanzee infection resemble human RSV infection in a mild form (15).

Chimpanzee experiments are difficult because of low availability, high rate of seropositivity, and high cost.

The most accessible and commonly used animal model for RSV infection and disease is the BALB/c mouse. The advantage of using mice is the availability of a wide array of immunologic reagents and genetically pure strains. Some of the disadvantages are: 1) inbred strains can vary as much as 100-fold in permissiveness for RSV replication; 2) an unnaturally large amount of the virus is

30 needed to cause a low level of replication in the respiratory tract (53, 160); and 3) rodents do not exhibit overt respiratory disease and clear infection quickly after 4 days, while recovery in children occurs after an illness of 7 to 12 days (48).

These disadvantages can cause uncertainty in extrapolating findings to humans.

Cotton rats on the other hand require much less RSV inoculum to cause a mild inflammatory bronchiolitis which better represents RSV pathogenesis in humans

(58). The use of cotton rats in studying RSV infections led to significant advances in understanding the disease caused by RSV and its prevention and treatment.

The use of the cotton rat model in the preclinical studies to demonstrate the protective effects of an anti-RSV antibody lead to subsequent infant studies and approval of Palivizumab as a prophylactic anti-RSV drug (58, 183, 184). Better anti-inflammatory and immunomodulatory treatments for RSV-caused disease resulted from cotton rat studies (58). Vaccine-associated enhancement of disease has also been reproduced and studied in cotton rats (185).

Although, the cotton rat seems to be good animal model for RSV infection it has several drawbacks (58). Reagents for studying the cotton rat immune response are limited compared to other rodent models. Also, attempts to generate transgenic or gene-deleted cotton rat strains has so far been unsuccessful. The greatest disadvantage still lies in the fact that even though the cotton rat is the most permissive rodent model it still requires an unnaturally high inoculum to achieve only a modest degree of replication (58).

Chapter 2: The RSV Replicon

INTRODUCTION

Respiratory syncytial virus (RSV) is an important human respiratory pathogen, particularly for infants and older adults (45, 68). It is a non-segmented, negative sense RNA virus of the subfamily Pneumovirinae, family Paramyxoviridae, order

Mononegavirales. All paramyxoviruses enter target cells by membrane fusion mediated by the viral fusion (F) protein, in most cases at neutral pH. They execute gene expression and genome replication entirely in the cytoplasm, and bud through the plasma membrane to produce progeny virions. RSV infection of immortalized cells in culture results in syncytial cytopathology. These multinucleated giant cells form because the F protein reaches the plasma membrane in a functional form and causes fusion between the plasma membranes of infected cells and their neighboring cells. The attachment glycoprotein (G) enhances fusion activity, but the third, small hydrophobic (SH) glycoprotein does not (215).

The 15.2 kb RSV genome is protected by the nucleocapsid (N) protein in a helical nucleocapsid structure that is used by the large viral polymerase (L) protein, assisted by the phosphoprotein (P), to transcribe mRNAs and the full- length replicative intermediate RNA, the antigenome. The transcription processivity (M2-1) protein is also involved in mRNA transcription. Like the

32 genome, the antigenome is encapsidated. It is copied by the polymerase to produce progeny genomes.

Deletion of all three glycoprotein genes from RSV or another paramyxovirus,

Sendai virus, results in replicons that can be propagated by supplying a heterologous attachment/fusion glycoprotein or the missing viral glycoprotein genes, respectively, in trans (170, 237). Clearly, these replicons can replicate within a cell, and can be mobilized from cell to cell by providing the missing proteins. But because the approaches used in these experiments rely on continuous virus spread, it is not clear whether the replication of these viruses eventually kills the cells they infect, in the absence of viral glycoprotein expression.

Non-cytopathic replicons have previously been generated for positive strand

RNA viruses such as Sindbis virus and hepatitis C virus (HCV) by removing the viral glycoprotein and capsid genes and inserting a gene for antibiotic selection

(19, 81, 150). However, in addition to antibiotic selection, biological selection was necessary for the isolation of non-cytopathic Sindbis and HCV genotype 1 replicons, but not HCV genotype 2 replicons (129). In the case of the Sindbis virus, a mutation in the nsP2 gene led to a non-cytopathic phenotype in both the virus and the replicon (60, 81). Independent isolation of non-cytotoxic HCV genotype 1 replicons generally resulted in adaptive mutations in the NS5a gene, either point mutations or deletions (19), though mutations in other nonstructural proteins have also been found (149). The role of these mutations in replicon maintenance is not yet clear.

To determine whether RSV genome replication and transcription is inherently cytopathic, we removed the three glycoprotein genes, F, G, and SH, from a full- length RSV cDNA clone, replacing them with the blasticidin S deaminase (bsd) selectable marker gene and launched this replicon in baby hamster kidney (BHK) cells. Inclusion of blasticidin in the culture media enabled the selection of replicon-containing cells that were subsequently cloned. These cells continued to divide and the replicon was maintained in progeny cells of each generation.

Mutations were not required for the establishment of the replicon, indicating that wild-type RSV replication in the absence of glycoprotein production is not cytopathic. By supplying F and G genes in trans we were able to “mobilize” three replicon clones to 8 other cell lines.

Reporter genes have been expressed previously from recombinant RSV and

RSV minigenomes (167) , but neither provide long term expression of these genes. Infectious RSV ultimately kills its host cell, and an RSV minigenome does not contain a full complement of RSV replication proteins and therefore replicates and expresses genes transiently and only while the viral replication proteins are provided by cotransfected plasmids.

Using reverse genetics we were able to “launch” an autonomous RSV replicon replication in vitro by plasmid transfection (Fig. 2.1). Following launch, the replicon began to replicate on its own, no longer needing plasmids to supply replication proteins. The replicon was non-cytotoxic in most of the cell lines tested and relatively stable over many passages, making it a potential vector for gene expression in vitro and in vivo. Additionally, RSV replicon-containing cells

34 could provide a system for screening libraries of compounds to identify novel viral inhibitors of the RSV polymerase.

replicon cDNA (GFP-NS1-NS2–N–P–M–bsd-M2-L)

P BHK-SR19-T7 BHK-SR19-T7-RSV-Rep

M2-1

Fig. 2.1. Launch of the RSV Replicon from cDNA.

MATERIALS AND METHODS

Cells. The baby hamster kidney (BHK) cell line, BHK-SR19-T7, carrying the non- cytotoxic Sindbis virus replicon that expresses T7 polymerase, was a gift from

Charles Rice (Rockefeller University). It was maintained in MEM supplemented with 10% fetal bovine serum (fbs) and 4 g/ml puromycin (1). All other cell lines were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 7.5% fbs, except for Vero cells, which were grown in RPMI with 7.5% fbs. All

o cells were incubated at 37 C in 5% CO2. Replicon-containing cells were maintained in the same medium as the parental cell line, but supplemented with blasticidin. The concentration of blasticidin used for each cell line was determined by starting at 50 µg/ml and decreasing the amount if toxicity was noted.

Construction of the RSV replicon plasmid. The RSV replicon cDNA-containing plasmid, MP295, was constructed from SN3 (215) in which the three glycoprotein genes from the full-length RSV genomic cDNA plasmid, MP224, had been deleted and replaced with PvuI and XhoI sites (Fig. 2.2). SN3, like MP224, includes the green fluorescent protein gene (GFP) in the first position. The hammerhead ribozyme sequence following the RSV trailer was replaced with the antigenomic hepatitis delta virus ribozyme sequence by moving the analogous

BamHI/AgeI fragment containing most of the L gene and the ribozyme from the full-length RSV cDNA clone D53/BsiWI into SN3 digested completely with AgeI and partially with BamHI to generate YM6. D53/BsiWI is a version of the previously-described full length RSV cDNA clone (46) in which (i) the

36 hammerhead ribozyme was replaced with the antigenomic hepatitis delta virus ribozyme (179) and (ii) three nucleotide substitutions were introduced in the trailer region at positions 10, 13, and 14 downstream of the L gene-end signal, creating a BsiWI site (GTATATT to GCATGCT) (102).

The bsd gene from pEF/Bsd (Invitrogen, Inc.) was mutated by a reverse PCR method (30, 116) to remove an internal Pvul site without changing the encoded protein. This modified bsd gene was PCR amplified with primers containing the

Pvul site (bold) and the RSV GS signal (italics)

(GCATGGATCCGATCGTGGATGGGGCAAATACTA), and the Xhol site (bold) and a consensus RSV GE sequence (italics)

(GCATGGGCCCTCTCGAGCCGGGTTTTTAAATAACTT). This PCR product was inserted into the Pvul and Xhol sites of YM6, yielding MP295.

Replicon launch, selection, and mobilization. The MP295 replicon was launched by transfecting BHK-SR19-T7 cells in 35 mm tissue culture wells with the MP295 replicon cDNA plasmid (1.2 g), along with pTM1-N (0.4 g), pTM1-P

(0.2 g), pTM1-L (0.1 g), and pTM1-M2-1 (0.1 g) support plasmids expressing the indicated RSV protein, in the absence of all antibiotics as described previously for the recovery of complete virus (46). TranslT-LT1 (Mirus, Corp.) was used as the transfection agent. Transcription of the transfected plasmids was mediated by T7 polymerase produced by the SinRep19-T7 Sindbis virus replicon present in the BHK-SR19-T7 cells. The transient expression of the viral

N, P, L, and M2-1 proteins from the pTM1 plasmids enabled initiation of self- sustaining gene expression and replication by the RSV replicon.

Replicon-containing cells were selected by treatment with blasticidin (InvivoGen,

San Diego, CA) at 50 g/ml beginning two to three days post-transfection, when the replicon-containing cells expressed GFP. At that time cells were also moved to a 100 mm tissue culture dish. After one week, green colonies were isolated and grown as separate cultures. Alternatively, individual green cells were isolated by flow cytometry, distributed into a 96-well plate, and grown in the presence of blasticidin. Wells with single green cell colonies and no clear (non-green) cells were expanded.

Replicons were mobilized into “One Step Virions (OSV)” by transfecting replicon- containing cells with plasmids MP340 and MP341 that contain codon-optimized versions of the RSV, strain A2, G gene and the D53 (A strain) F gene, respectively. Without codon optimization, the F gene cannot be expressed from the nucleus, probably due to cryptic splicing or cryptic polyadenylation (219).

These plasmids were derived from pcDNA3.1 (Invitrogen) in which transcription is driven from a CMV promoter. OSV were harvested at 48 hr post-transfection by scraping the cells from the tissue culture dishes into the media with a rubber policeman, vortexing to release loosely bound virus, and centrifuged at 1,500 rpm in a Heraeus Megafuge 1.0 centrifuge for 5 min to remove the cells. The media was then removed, leaving the cell pellet and approximately 0.5 ml of media at the bottom of the tube and centrifuged again to remove any remaining cells. The media was quickly frozen on dry ice and thawed at 37°C to disrupt any cells that might still be present. This OSV-containing media was then used to inoculate other cell lines to initiate the replicon in those cells. The new replicon-

38 containing cells were selected with blasticidin at 10-50 µg/ml depending on the sensitivity of the cell line and cloned as described above. Finally, the cell lines were tested to be certain that they did not contain BHK cells, using the actin sequencing protocol described below.

Replicon sequencing. Replicon-containing cell clones were isolated from separate replicon-containing cell populations by physically picking the colonies 2-

4 weeks after launching the replicon. The clones were grown for an additional 2-4 weeks before extracting the RNA. Total RNA was extracted from five independent replicon-containing BHK-SR19-T7 cell clones, and replicon cDNA was prepared by RT-PCR. Pairs of primers were used to amplify cDNA fragments that were overlapping. Each fragment was sequenced with the ABl Big

Dye 3.1 kit and the sequence determined by the TRINCH Core Sequencing

Facility.

To sequence the genome termini, replicon-containing BHK-SR19-T7 cells were lysed in PBS containing 1% Triton X-100. After centrifugation at 5000xg for 5 min to pellet the nuclei and cell debris, the supernatant was combined with CsCl to a final concentration of 40% CsCl, overlaid with layers of 30% CsCl, 25% CsCl and

5% sucrose, all in 25 mM Tris-hydrochloride (pH 7.5), 50 mM NaCl, 2 mM EDTA, and 0.2% (wt/vol) sodium lauroyl sarcosinate (Sarkosyl) (222). The gradient was centrifuged in a Sorvall Ultraspeed Centrifuge at 38,000 rpm at 4ºC for 19 hr. The visible band containing the nucleocapsids was removed with a pipetman, diluted in PBS and pelleted through 15% sucrose at 20,000xg for 1hr. The pellet was solubilized in 2 ml of LEH buffer (10 mM HEPES [pH 7.5], 100 mM LiCl, 1 mM

EDTA) containing 1% SDS, followed by extraction with RNA Bee (TEL-Test,

Friendswood, TX). The resulting genomic RNA was used in 5’ and 3’ RACE

(Invitrogen) to determine the sequence of the replicon termini.

Actin sequencing to determine the cell source. Total cellular RNA was extracted with RNA Bee (Tel-Test) and cDNA was prepared by RT-PCR using random hexamers. A pair of primers designed to amplify either the primate or the hamster actin mRNA, 5’-GCTCGTTGTCGACAACGGCTC and 5’-

AAACATGATCTGGGTCATCTTTTC, were used in a PCR reaction (94°C for

30s/54°C for 30s/72°C for 1min) for 40 cycles. The amplified PCR product was then sequenced from each of the original primers, using the Big Dye 3.1 kit (ABl) and read by the TRINCH Core Sequencing Facility.

Analysis of viral protein synthesis. Replicon-containing A549, BHK, HeLa, and

Vero cells were compared to cells acutely infected with recombinant, green fluorescent protein-expressing RSV (rgRSV) at an MOI of 3. At 24 hr post inoculation (p.i.) 80-90% of both sets of cells were green. Cells were metabolically labeled with 20 Ci 35S-methionine/cysteine (Met/Cys)/ml (MP

Biomedicals, Irvine, CA) for 6 hr in 6-well tissue culture dishes in 2 ml of medium.

The medium was a 9:1 mix of Met/Cys-free DMEM and complete DMEM with

10% fbs. Cells were rinsed with PBS and lysed with 300 µl of RIPA buffer (150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate, 50 mM Tris, pH 7.5), and the protein content of each sample was determined with the BCA protein assay (Pierce, Rockford, IL).

Lysates in triplicates (2 µg) from the 4 cell lines were immunoprecipitated with 6.5

µl of goat anti-RSV polyclonal antibody (Chemicon International) and 25 µg of protein-G agarose beads (KPL, Gaithersburg, Maryland). Immunoprecipitation was performed as follows: the sample-antibody mixture was incubated for 18 hr at 4oC; the protein-G agarose beads were added and incubated for 18 hr at 4oC; the beads were washed two times with RIPA buffer containing 0.5 M NaCl, two times with RIPA buffer containing 0.15 M NaCl, and once with 50 mM Tris (pH

7.4) containing 0.15 M NaCl and 0.25 mM EDTA. Samples were boiled in sample buffer containing 2-mercaptoethanol and separated by 10% SDS-polyacrylamide gel (SDS-PAGE)(141). Gels were soaked in 10% glacial acetic acid and 20% methanol for 1 hr, followed by 20% methanol and 3% glycerol for 16 hr, and dried. Images were collected on film and digitally with the Typhoon

Phosphorimager (GE Healthcare). The amount of N protein was quantified using

ImageQuant (Version 5.0 Molecular Dynamics). To confirm that the immunoprecipitation was efficient, supernatants from the original precipitations were added to a second aliquot of RSV-specific antibody and subjected to a second round of immunoprecipitation. The amount of viral protein in the second round was less than 10% of the initial precipitation, indicating that the initial precipitation had been efficient.

Quantification of the replicon genome by Real Time PCR. Infected and replicon-containing cells grown in 12-well plate were gently lysed in 10 mM NaCl,

10 mM Tris ph 7.5, 1.5 mM MgCl2, 1% Triton X-100, 0.5% DOC, Complete

Protease inhibitor, 1 mM CaCl2. This lysis disrupts cells without disturbing the

41 viral nucleocapsids. Half of the lysate from each sample was digested with micrococcal nuclease for 1 hr at 37°C to remove free mRNA and the other half was similarly incubated but without digestion. RNA Bee (Tel-Test) was used to extract the total RNA remaining after digestion. cDNA synthesis was performed using random hexamers on 6 ul of total RNA using High-Capacity cDNA Reverse

Transcription Kit (Applied Biosystems). 2 ul of cDNA was used in Real Time PCR with Power SYBR Green PCR Master Mix (Applied Biosystems). Primers specific for GAPDH mRNA from human (GGTCGGAGTCAACGGATTTGGT and

GCAAATGAGCCCCAGCCTTCTCC) and monkey (GGTCGGAGTCAATGGATT

TGGT and GCAAATGAACCCCAGCCTTCTCC) were used to amplify GAPDH as an internal control. RSV N gene primers (CAGATCTGGTCTTACAGCCGTG and

AGCTGTTGGCTATGTCCTTGG) were used to amplify a portion of the viral genome. The RSV genome quantity is expressed as a ratio between the first

PCR cycle in which the N gene product and the GAPDH mRNA were detected.

Growth rate of replicon-containing cells. Equal quantities of replicon- containing and uninfected A549, BHK, HeLa, and Vero cells were plated in 5 plates for each condition. Every 24 hr the cells were trypsinized and suspended in PBS, 1% paraformaldehyde, 2% FBS and quantified with flow cytometry. Only the replicon-containing BHK cell lines had been cloned. The other replicon- containing cell lines were derived from the mobilization of OSV from individual

BHK cell clones.

Bioassay for type I IFN. RSV-infected and replicon-containing cells were grown in 12 well plates. 40 hr p.i. media was collected from replicon-containing and

RSV-infected A549 and HeLa cells. The media was treated with 15 ul of 1N HCl for 1 hr to destroy any virions present and then the pH was neutralized with 25 ul of 7.5%NaHCO3. The media, in parallel with a known amount of IFN alpha-2b

(Intron/Schering-Plough, Kenilworth NJ), was diluted 1:2 eight times in a 96-well dilution plate and then transferred to DAOY (IFN-sensitive medulloblastoma cell line) in a 96-well plate. After 24 hr, the media was removed and cells were inoculated with VSV. Two days later the dead cells were washed away, and the remaining cells were fixed and stained with crystal violet (0.01% crystal violet,

1.85% HCHO, 0.05 M Na2HPO4).

Staining viral antigens in replicon-containing cells. Replicon-containing cell lines were plated in a 96-well plate, fixed with 3% paraformaldehyde for 20 min at

20oC, permeabilized with 0.1% Triton X-100 in PBS for 30 min at 33oC, and incubated with a 1:500 dilution of a goat anti-RSV polyclonal antibody

(Chemicon, International) for 30 min at 33oC followed by a 1:100 dilution of rhodamine-conjugated anti-goat secondary antibody (KPL, Gaithersburg, MD) for

60 min. Before the addition of each antibody, the cells were washed three times with PBS and blocked with 50 µl of 1:20 dilution of milk diluent (KPL) for 30 min at 33oC on a shaker.

RESULTS

Generation of an RSV replicon. We deleted the three glycoprotein genes, SH,

G and F, from a full-length recombinant GFP-expressing (rg)RSV antigenomic cDNA. In their place, we inserted a blasticidin S deaminase (bsd) gene, to generate MP295 (Fig. 2.2). To launch the RSV replicon, we used BHK-SR19-T7 cells that produce T7 polymerase from an endogenously maintained Sindbis virus replicon (1). BHK-SR19-T7 cells were transfected with MP295 and the 4 plasmids that express the viral proteins necessary for RSV genome replication and gene expression, N, P, L, and M2-1. Within two days green cells were visible by fluorescence microscopy, indicating that the RSV replicon had begun to replicate and express its genes in those cells. Cells were passaged into a 150 mm tissue culture dish and blasticidin was added to the media. Over the next two weeks colonies of green cells appeared and most of the “clear” (non-green) cells were killed by the blasticidin.

To confirm that these cells had not been infected with complete virus, spent media from the uncloned replicon-containing BHK-SR19-T7 cultures was centrifuged at a low speed to remove floating cells and used to inoculate HeLa cells. No green cells appeared over the following 48 hr, while control virus inoculation of parallel cultures with rgRSV resulted in green cells within 24 hr

(data not presented). We also extracted RNA from the uncloned replicon- containing cells and tested for the presence of SH, G, F, and M RNA sequences by RT-PCR. Only the M primers yielded a PCR product from the replicon-

44 containing cells (Fig. 2.3), confirming that the viral glycoprotein genes were missing.

Fig. 2.2. Derivation of the MP295 replicon cDNA. MP224 is the original, full- length RSV genomic cDNA including the GFP gene. SN3 was generated from it by removal of the three glycoprotein genes, replacing them with an intergenic region containing two introduced unique restriction sites, Pvul and Xhol (215).

These constructs contain the original hammerhead ribozyme (HRbz). The HRbz in SN3 was replaced with the hepatitis D virus ribozyme (DRbz) in YM6. The bsd gene unit was subcloned into YM6 using PvuI and XhoI to generate MP295, a glycoprotein-free replicon cDNA. The black box at the left (3’) end of the genome represents the leader, and at the right (5’) end represents the trailer sequence.

Transcription to produce a complete RNA copy of each antigenome initiates at a

T7 promoter to the left (not shown) and terminates at the T7 terminators to the right (not shown) of each construct. The ribozyme then executes cleavage that removes all non-viral sequences from the 3’ end. The 5’ end of the antigenome transcript begins with the foreign GGG sequence from the T7 promoter. This

46 sequence is probably lost during replication because it is not present in the replicon clones that we have sequenced.

Fig. 2.3. RT-PCR analysis of viral RNA from replicon-containing cells. RNA was extracted from uncloned replicon-containing BHK-SR19-T7 cells (C) (lane 1) or the supernatant (S) (lane 2) from these cells, or from RSV-infected cells (lane

3) and their supernatant (lane 4). A reaction without RNA was included as a negative control (lane 5). Random hexamers were used to prime the RT reaction.

Specific primer pairs for each of the viral genes were employed for PCR.

Cloning of replicon-containing cells. Well-isolated green colonies were picked and passaged. The green cells that grew into colonies survived either because the wild-type replicon is naturally not cytopathic or because replicon variants were biologically selected for their ability to replicate without killing BHK cells.

Some of these clones were composed of small cells, similar to the original BHK-

SR19-T7 cells, while others were composed of cells approximately twice that size

(Fig. 2.4A). Each clone maintained its original phenotype during subsequent passages. Either replicon or cell variants could be responsible for the enlarged cell phenotype. This question will be address below.

Replicon mobilization. The replicon that was launched in BHK-SR19-T7 cells was apparently not cytopathic. But it is possible that some of these cells were killed by the replicon while others survived. To directly examine the cytotoxicity of the replicon, we “mobilized” the replicon into virions by providing the RSV F and

G proteins in trans. Replicon-containing cells were transfected with plasmids expressing codon-optimized versions of the RSV G and F genes driven by a

CMV promoter. At 48 hr post-transfection, “One Step Virus” (OSV) was harvested and used to inoculate fresh BHK-SR19-T7 cells. Even though T7 polymerase was not needed to sustain the replicon at this point, we inoculated

BHK-SR19-T7 cells because they had been used in the initial launch and we wanted to compare their phenotypes. Green cells appeared among the inoculated cells within 24 hr, indicating transfer of the replicon. Expression of the vesicular stomatitis virus G protein in trans also mobilized the replicon into OSV capable of transmitting the replicon to fresh cells (data not shown). After one

49 week in culture, 50% to 70% of the OSV-inoculated, replicon-containing (green) cells had grown into colonies, similar to the frequency of isolated cells that grow into colonies in the absence of the replicon, indicating that the replicon was not cytopathic.

Most of these colonies were composed of small cells, but a low number of colonies were composed of large cells. To determine whether a particular replicon variant caused the large cell phenotype, OSV derived from large phenotype replicon-containing cell clones (Fig. 2.4B) were used to inoculate fresh cells, resulting in colonies of both large and small cell phenotype (Fig.

2.4C,D). Likewise, OSV from small cell phenotype replicon-containing clones

(Fig. 2.4E) were used to inoculate fresh cells, resulting in colonies of both small and large cell phenotypes (Fig. 2.4F,G). These results indicate that the large cell phenotype is not caused by replicon variants.

The large cells had a much slower growth rate than the small cells (data not shown), which may explain the relatively low number of large compared to small cell colonies. It was possible that these large cells might have been a minor population of contaminating human cells, which are also used in the laboratory.

To test this possibility, we sequenced a portion of the actin transcript that differs between hamster and human. The actin sequence was that of hamster, indicating that the large cells were not a contaminating, non-hamster cell line. It appears then that these large cells represent either a preexisting sub-population, or a small proportion of cells that receive the RSV replicon and are for some reason induced to become large cells. Because the parental BHK-SR19-T7 cells

50 were very homogeneous and small, it seems unlikely that the large cells were preexisting in the culture.

B C D

E F G

Fig. 2.4. Fluorescent photomicrograph of BHK-SR19-T7 cells containing the

RSV replicon, as indicated by the expression of GFP. (A) Two neighboring phenotypically distinct clones. The cell clone in the lower left corner has a “large cell” phenotype, while the clone in the upper right corner has the “small cell” phenotype. The small cell phenotype is similar in appearance to the majority of the cells in the parental cultures. (B) Cloned cell line with the large cell phenotype. OSV mobilized from this clone was used to inoculate BHK-SR9-T7 cells and clones of both (C) large and (D) small cell phenotypes appeared. (E)

Cloned cell line with the small cell phenotype. OSV mobilized from this clone was

52 used to inoculate BHK-SR9-T7 cells and clones of both (F) large and (G) small cell phenotypes appeared. (A) was photographed using a 10X objective and enlarged here to compensate for the difference in magnification with (B-G) which were photographed with a 20X objective.

Mobilization of the replicon to other cell types. To determine whether the

RSV replicon could establish non-cytotoxic replication in other cell types, we used OSV to transfer replicons to eight other cell lines: A549 (human adenocarcinomic alveolar basal epithelial), DAOY (human medulloblastoma),

HeLa (human epithelial cervical cancer cells), HEp-2 (human epidermoid cancer), Huh7 (human hepatocarcinoma), Huh-7.5 (Huh7-derived but with a defect in RIG-I), HEK-293 (human embryonic kidney cells), and Vero (African green monkey kidney). At two days post-inoculation with OSV, green cells were detected in all of these cell lines, indicating that the replicon had entered and begun to express viral genes. At this point, blasticidin was added to each set of cells. Because different cell types varied widely in their sensitivity to blasticidin, we used the lowest concentration that would kill each cell line in the absence of the replicon. Blasticidin treatment caused the “clear” cells, those that lacked the replicon, to die. The green, replicon-containing cells of all cell types tested survived and continued to divide for 4 weeks of culture and beyond, with one exception, DAOY cells. The replicon initiated replication in relatively few DAOY cells and these cells did not divide. After four weeks there were no remaining green DAOY cells. The other 7 cell types containing the replicon were tested by actin transcript sequencing to assure that they did not represent BHK cells that had been carried over with the OSV.

Stability of the replicon in culture. We initially picked green colonies from tissue culture dishes by identifying them under a microscope, loosening them from the plastic with trypsin, and harvesting them with a pipetman. But, cultures

54 grown from these physically isolated colonies always included some clear cells, despite the presence of blasticidin in the media. These clear cells could have been accidentally carried along with the green cells during the isolation procedure, but it was also possible that replicon-containing cells are capable of being cured of the replicon.

To determine whether clear cells could arise from replicon-containing cells, we deposited individual green replicon-containing BKH-SR19-T7 cells into 96-well dishes by flow cytometry sorting, and examined each well daily for the first week.

Wells that initially contained a single green cell, without any clear cells, and that grew into a single colony, were expanded. Any clear cell that subsequently appeared in these wells must have been derived from these replicon-containing cells.

We tested the stability of three of these independent replicon-containing BHK-

SR19-T7 cell clones, through 12 passages in the presence or absence of a low concentration of blasticidin (4 µg/ml) over 8 weeks (Fig. 2.5, squares). Clear cells did appear in all three cultures, indicating that cells could be spontaneously cured of the replicon. However, the clear cells did not overgrow the green, replicon- containing cells. In fact, the proportion of replicon-containing cells remained in the majority in all three cell lines, representing 50% to 70% of the population by passage 12. Because these replicon-containing cells double approximately every

24 hr, 8 weeks would represent approximately 50 cell doublings. Therefore, loss of the replicon from 30% to 50% of the cells over 50 passages represents a rate of 0.6% to 1% loss per cell doubling. In other words, 99% or more of the

55 daughter cells retained the replicon after each cell division. Surprisingly, the blasticidin treatment had little or no effect on the level of clear cells in these cultures. We later realized that BHK-SR19-T7 cells at relatively high cell density, as in this experiment, are resistant to this low level of blasticidin. A 10-fold higher concentration is required to kill BHK cells lacking expression of the bsd gene product.

Fig. 2.5. Replicon stability in cloned cells passaged with and without blastisidin. The three panels indicate independent BHK-SR19-T7 cell clones containing a replicon. The replicon-containing cells were passaged in the presence of 4 µg/ml blasticidin (squares) or in the absence of blasticidin (circles).

Cells at each passage were frozen and stored in liquid nitrogen. After collecting all of the time points, all cells were thawed, cultured for two days and analyzed by flow cytometry to quantify the proportion of green cells. Cells from some of the time points did not survive and account for the absence of some data points.

Therefore, the blasticidin treated cell clones essentially represented a duplicate of the untreated replicon-containing cell clones in this experiment.

Source of the clear cells. The clear cells that appear during passage of cloned replicon-containing cell lines could have lost the replicon or might, alternatively, harbor a replicon whose GFP gene was mutated, resulting in the loss of the GFP expression or the loss of its ability to fluoresce. To test these possibilities, we isolated clear cells from 4 replicon-containing cultures by flow cytometry and grew them in the presence of 10 µg/ml blasticidin. All of these cells died within a week indicating that they no longer contained the replicon. This result also indicates that the clear cells in these cultures are not innately resistant to blasticidin. Therefore, the finding that clear cells survive blasticidin treatment in a mixed culture is likely due to the presence of replicon-containing cells and their ability to metabolize blasticidin in the media, enabling the clear cells to survive.

To confirm the finding that clear cells no longer contain the replicon, we examined 4 separate replicon-containing cell lines that had each originated from a single green cell. Each cell line included clear cells at the time of staining. Two different replicon-containing BHK-SR19-T7 cell clones, one A549 clone, and one

Vero cell clone were stained with RSV antiserum followed by anti-IgG- rhodamine. All replicon-containing cells (green) contained RSV antigens (red) but none of the clear cells did (Fig. 2.6), indicating that the clear cells had been cured of the replicon.

Fig. 2.6. Replicon-containing cells from a clonal BHK-SR19-T7 population and clear cells that appeared in the culture during passage. Cells were stained with goat anti-RSV polyclonal antibody followed by a rhodamine- conjugated anti-goat secondary antibody. Phase contrast detection of a single microscope field showing all cells (A), green, replicon-containing cells (B), and red, RSV antigen-containing cells (C).

Replicon sequence. To determine whether surviving replicons contained mutations, we sequenced replicons from five independent BHK-SR19-T7 clones.

Each clone was grown for 4-8 weeks to generate enough cells for nucleocapsid isolation by CsCl gradient and subsequent genomic RNA extraction. The replicon genomes were copied and amplified by RT-PCR as several overlapping segments, and the PCR products were sequenced. The genome termini were sequenced by 5’ and 3’ RACE. Two of the 5 completely sequenced replicons,

Rep295.3 and Rep295.4, had no mutations indicating that the wild-type replicon is capable of establishing infection without killing its host cell. All but the 3’ terminus (99.5%) of Rep295.1 was also sequenced without finding a mutation,

Rep295.2 contained a single mutation, an “A” insertion 26 codons from the C terminus of the NS1 gene. Rep295.5 contained two mutations near the end of the

P gene, one of which was silent and one of which resulted in an amino acid change from asparagine to serine, as well as two base changes in the following

P/M intergenic region (Fig. 2.7). All 4 of these mutations were A to G transversions.

Effect of the replicon on cell growth. The replicon is not cytopathic since replicon-containing cells grow into colonies and can readily be further expanded.

However the replicon or the cellular responses to the replicon might affect the physiology of the cell. As a gross measure of cell physiology, we compared the growth rate of replicon-containing cells to their parental cell line over a 5 day span. Equal numbers of parental and replicon-containing BHK-SR19-T7, Vero,

A549 and HeLa cells were plated in replicate wells and the number of cells

61 determined each day (Fig. 2.8). No significant difference was detected in the growth rate between uninfected and replicon-containing cells.

Fig. 2.7. Diagram showing the position of mutations in Rep295.2 and

Rep295.5 genomes. The other three replicons that were sequenced had no mutations. The mutation in Rep295.2 resulted in a nonsense mutation in NS1, while a mutation in Rep295.5 resulted in a missense mutation in the P gene with two silent mutations in P/M intergenic region.

A B Days Days

C D Days Days

Fig. 2.8. Growth rate of replicon-containing cells compared to parental cells. Equal numbers cells from A549 (A), BHK (B), HeLa (C), and Vero (D) replicon-containing cell clones and parental cells were plated in 6-well tissue culture dishes. The number of cells was determined every 24 hr over 4-5 days until one of the cultures became confluent. Cells were trypsinized, suspended in

PBS (1% paraformaldehyde, 1% FBS) and counted with a flow cytometer. Only the replicon-containing BHK cells had been cloned before this assay. The other replicon-containing cell lines were initiated with OSV from these replicon- containing BHK cell clones, with the attached number identifying which BHK clone was the source of the OSV.

Effect of the cell on viral replication. To evaluate the level of virus replication in replicon-containing A549, HeLa, and Vero cells, we compared the genome levels in these cells with acutely infected cells of the same type, at 24, 36 and 48 hr p.i. by Real Time PCR (Fig. 2.9, left column). In all cultures in this experiment, greater than 80% of the cells contained replicating RSV, as determined by GFP expression. The RSV genome level in replicon-containing cells was significantly lower than the genome levels in acutely infected cells, between 2% and 35% that of the highest level of acutely infected cells. The lower levels of genome in replicon-containing cells indicate that replicon expansion is in some way controlled in these cells.

To determine how viral protein production in replicon-containing cells compared to acute virus infection, cultures were metabolically labeled with 35S-Met/Cys for

6 hr and immunoprecipitated with polyclonal antiserum against RSV. Viral proteins were separated by SDS-PAGE, and RSV N protein was detected and quantified by phosphorimaging. In all cultures in this experiment, greater than

80% of the cells contained the replicon, as determined by GFP expression. Viral protein production in the acute infection with RSV peaked at different times in the different cell lines (Fig. 2.9, second column). The viral protein production in replicon-containing cell clones was consistently lower (5% to 25%) than the peak protein level in the acute infection of the same cell type; replicon-containing BHK cell clones being at the low end of this range, at 5-12%, with the primate cell lines somewhat higher, 13-25%. This reduced level of viral protein production in

65 replicon-containing cells correlates roughly with the lower genome level in these cells.

Fig. 2.9. Level of viral genome and protein in replicon-containing cells compared to rgRSV-infected cells. For the viral protein comparison replicon- containing BHK (B), A549 (A), HeLa (H), and Vero (V) cells were labeled for 6 hr and RSV-infected cells were labeled for 6 hr at 24, 36, 48 hr p.i. with 20 µCi/ml

35S-Met/Cys. Cells were then lysed and equal amounts of total protein lysates were immunoprecipitated with goat RSV antiserum. The immunoprecipitates were separated on a 10% SDS-PAGE gel under reducing conditions and imaged

67 on the Typhoon Phosphorimager. The N protein band of RSV and replicon was quantified and compared. Real Time PCR was implemented to compare viral genome levels in A549, HeLa, and Vero cells. Mild lysis buffer was used to lyse replicon-containing cells and RSV infected cells at 24, 36, and 48 hr p.i.

Micrococcal nuclease was used to digest unprotected RNA in half of the lysate followed by RNA extraction. GAPDH mRNA in the half of the lysate not treated with nuclease was used to normalize the samples in Real Time PCR. (A) N protein detection in acutely infected BHK cells at 24 and 36 hr p.i. (B24, B36) and replicon-containing BHK cell clones (B1, B4, B5). The Real Time PCR data for

BHK cells is missing because the primers for the primate GAPDH internal control did not function on the hamster transcript. (B) Real Time PCR and N protein detection data for acutely infected A549 cells (A24, A36, A48) and replicon containing-A549 cell clones (A1, A4, A5). (C) Real Time PCR and N protein detection data for acutely infected HeLa cells (H24, H36, H48) and replicon containing-HeLa cell clones (H4, H5). (D) Real Time PCR and N-protein detection data for acutely infected Vero cells (V24, V36, V48) and replicon containing-Vero cell clones (V4, V5). AU stands for arbitrary units. *Statistical significance was measured with a one tailed t-test with df=4 and p=0.05.

IFN production by replicon-containing A549 and HeLa cells. All 4 of the cell lines tested have a suppressed level of replicon replication and gene expression.

To determine if the IFN system is involved in this suppression, we examined

IFNα/β production with a bioassay. The replicon is suppressed in Vero cells even though they do not produce IFNα/β (64) and, therefore, suppression does not require IFNα/β, at least not in these cells. IFNα/β production from replicon- containing A549 and HeLa cells were compared to acutely infected cells. No

IFNα/β was detected in the media from RSV-infected or replicon-containing

HeLa cells, as has been reported for some HeLa cell lines (32) . IFN was detected in the media from RSV-infected and replicon-containing A549 cells

(Table 2.1). However, the level of IFNα/β produced by replicon-containing A549 cells was approximately 14-fold lower than that produced by acutely infected cells. It appears that A549 cells respond less vigorously to the replicon than to the acute infection, in approximate proportion to the lower level of genome present and of viral proteins produced (Fig. 2.9B).

Table 2.1. Interferon released by replicon-containing A549 cells, determined by bioassay

A549 cells U/ml of Type I containing Interferon

rgRSV 50 + 0

Rep295.1 3.6 + 2.4

Rep295.4 4.2 +1.8

Rep295.5 3.1 + 0

DISCUSSION

We have constructed and launched an RSV replicon that lacks all three of its glycoprotein genes. This replicon is able to sustain long-term replication in many cultured cell types without obvious cytopathology. It can express foreign genes, such as GFP and bsd, and can be mobilized into virions by providing the two critical glycoproteins, G and F, in trans. RSV replicon-containing cells can readily be isolated, cloned, and expanded. RSV is an ideal candidate virus for the production of a non-cytopathic replicon because it does not result in inhibition of host cell protein synthesis (144) as many other viruses do.

Replicon survival did not require mutations in the replicon because two of the 5 replicons that were completely sequenced and one replicon that was 99.5% sequenced contained no mutations. However, the remaining two replicons contained mutations. The single mutation in Rep295.2 was an A insertion in a stretch of 6 A’s in the NS1 gene. Insertion or deletion mutations of this type have previously been observed in RSV (86) (data not shown). Interestingly, the 4 mutations in Rep295.5 were all A to G transversions suggesting that either the

T7 polymerase used to launch the replicon or the RSV polymerase that copied the genome thereafter made this mistake repeatedly within this region. It is more likely that the RSV polymerase was responsible for these mutations because A to G hypermutation in a limited region has been detected previously in mutants isolated from a persistent infection (37) of another paramyxovirus, measles virus.

The fact that mutations are not required for survival of the RSV replicon indicates that the wild-type replicon is not cytotoxic. This result is similar to the HCV

71 genotype 2 replicon (129). However, it is strikingly different from the replicons derived from Sindbis virus and HCV genotype 1 (149), in which mutations in the viral genome enabling host cell survival were required to establish replicon- containing cell cultures (60, 81).

The lack of cytotoxicity or even delayed cell growth in RSV replicon-containing cells, which expresses all of the viral RNAs and proteins except for the glycoproteins indicates that the replicon gene products and functions are not cytopathic, per se, and neither are the host cell responses to the replicon.

Infection of the same cell lines with complete RSV does result in cell death, so it is likely that one or more of the genes that are missing in the replicon are responsible for cytopathology. The viral F protein, alone, is cytopathic because it causes cells to fuse and the resulting syncytia are not long lived (14), but it is possible that other aspects of the F protein or another viral glycoprotein is also cytotoxic. Alternatively, since acute infection produces between 3- and 50-fold more viral genomes and proteins than the replicon (Fig. 2.9), it is possible that the higher level of RSV genome and/or viral transcript and/or viral protein produced in acutely infected cells or the cellular response to the higher level of one or more of these viral components causes the cytopathology.

Both RSV replication and viral protein production are reduced in replicon- containing cells. It is not clear which reduction is the cause because fewer genomes would lead to fewer viral proteins, but the opposite is equally true. It is possible that accumulation of one of the viral proteins suppresses replication or transcription. For instance, the M2-2 protein has been shown to suppress

72 transcription (40), the NS1 protein has been shown to inhibit genome replication

(217), and the M protein has been shown to inhibit transcription in RSV (94) and other negative strand viruses (34, 177, 208). If any of these viral proteins are more stable than the others, it may dampen RSV replication. It is also possible that one of the missing glycoproteins is needed in some unknown way for the virus to replicate to its maximal level within a cell.

It is also possible that a cellular factor(s) is controlling the replicon at the level of genome replication, transcription, or translation. Although suppression did not depend on IFNα/β production, a different cellular response may be responsible. If so, identifying that response might provide a target that could be harnessed to dampen acute RSV infection. We are presently examining the differences in gene expression in uninfected, replicon-containing and acutely infected cells.

Establishment of an HCV replicon is greatly facilitated by a cellular mutation that blocks the RIG-I system for recognizing viral pathogens in Huh-7.5 cells (207).

Huh7.5 was an HCV replicon-containing Huh7 cell line that was cured of its replicon (20). Huh-7 cells were unable to support replication with HCV replicon and whole virus genotype 1, while Huh-7.5 cells did (20). To test the importance of RIG-I in the establishment of the RSV replicon, we compared its ability to establish itself in both the Huh7 parental cell line and Huh7.5 cells. The RSV replicon was able to establish itself in both cell lines, indicating that blockage of the RIG-I recognition pathway is not necessary for establishment of the RSV replicon.

The RIG-I recognition system leads to IFN α/β production which might control replication or expression of the RSV replicon. We found that A549 cells containing the RSV replicon did respond by producing IFN α/β, but at a level approximately 14-fold lower than the same cell line acutely infected with RSV.

While the response to this low level of IFN α/β could contribute to the reduction in replicon genome and protein levels in A549 cells, it cannot explain the fact that

Vero and HeLa cells also control the level of the RSV replicon. Vero cells do not produce IFN α/β (64) and we were unable to detect any IFN α/β production by

HeLa cells. These results strongly suggest that neither RIG-I nor the IFN α/β system are required for the establishment of the RSV replicon or its control. Of the 9 cell lines tested only one, DAOY, was unable to maintain the replicon.

DAOY cells are highly sensitive to IFN α/β (Durbin R. and Durbin J., manuscript in preparation), so it is possible that these cells produced and responded to it in an overly exuberant manner, resulting in cell death.

The lack of cytopathology in the RSV replicon-containing cells may help explain the ability of RSV to establish persistent infections of cultured cells (8, 176, 186).

Often the virus released by persistently infected cells produces small plaques in fresh cells, suggesting a defect in F protein function. Such a defect would slow virus spread and reduce the cytopathic effects of cell-cell fusion, such that the virus itself would be non-cytopathic. Persistent RSV infections have also been described in mice, in patients with chronic obstructive pulmonary disease, and in human dendritic cells maintained ex vivo (45, 96, 113, 195, 231).

Recently, recombinant RSV and Sendai virus replicons lacking one or more of their glycoprotein and/or M genes have been launched from cDNA and maintained by virus passage in cells expressing the missing viral proteins or a foreign glycoprotein capable of replacing the function of the native viral glycoproteins (76, 111, 117-119, 168-171, 193, 211, 218, 237). In these experiments, cells infected with gene-deleted viruses have not been examined for long-term survival. Neither have replicon-containing cells been selected and grown in pure culture for characterization, so their ability to co-exist with a host cell over a long period of time and through many cell divisions is not known.

The RSV replicon-containing cultures in our study lost the replicon at a rate of

0.6% to 1% per cell division over 12 cell passages, approximately 50 cell doublings. The mechanism of this loss is not known but may simply involve cell divisions in which all of the replicon genomes segregate into one daughter cell, leaving the other daughter cell replicon-free.

A temperature-sensitive (ts) Sendai virus variant has been described that could be maintained in 99% of the infected cells grown at the non-permissive temperature of 38°C for 180 cell doublings (164). This level of replicon maintenance is much higher than our RSV replicon, in the absence of an effective concentration of blasticidin. This apparent difference may be due to the fact that most ts mutants are leaky and a low amount of infectious Sendai virus may be produced during non-permissive temperature incubation or during cell passaging. Only a small amount of virus would be required to infect the few replicon-free daughter cells produced each cycle. In addition, this ts Sendai virus

75 contained 35 amino acid changes from its parent strain. It is not clear which of these mutations were necessary for its non-cytopathic phenotype. We have found that the RSV replicon without any mutations is non-cytopathic. We have also found that the inclusion of the appropriate concentration of blasticidin in the media can prevent the slow loss of the RSV replicon by killing the cells that have lost their replicon.

The RSV replicon is capable of long-term expression of foreign genes, as shown here by the example of GFP and blasticidin S deaminase. It may be useful as a cytoplasmic vector for long term genes expression in cultured cells. RSV replicon-containing cells may also be a useful tool for high throughput screening to identify antiviral compounds targeting the replicative machinery of RSV. To that end we have recently inserted a luciferase gene into the RSV replicon

(manuscript in preparation). Because we have been able to mobilize the replicon as OSV by providing the RSV G and F proteins in trans while retaining its native targeting ability, some form of the replicon may be useful as an attenuated vaccine for RSV and/or for expressing a foreign viral protein(s). The RSV replicon could also be useful as a self-limiting gene therapy vector, as recently demonstrated for Sendai virus replicons (9, 75, 76, 95, 119, 124, 211, 237). The

RSV replicon has the advantages of relative stability in a cell population over many cell divisions, a lack of cytotoxicity in nearly all the cell lines tested, the ability to express foreign genes, and as an RNA virus, the inability for its genome to be incorporated into the host DNA. Finally, understanding the mechanism by

76 which the RSV replicon is controlled in cells might provide insights for controlling

RSV replication.

Chapter 3: Application of the RSV Replicon

There are many possibilities for why the replicon is non-cytotoxic in so many cell lines and determining how the replicon can be maintained without killing the host cell could lead to discoveries of clinical and technological significance. One striking observation is that the replicon genome and viral protein levels are 3- to

50-fold lower (depending on the cell line) than acute infection with whole RSV. It is possible that this level of RSV replication is too low to induce a cytotoxic response. One interesting question here is why the replication of the replicon is so much lower than that of the complete virus. One possibility is that the glycoproteins are needed in some unknown way for the virus to replicate at its maximal rate. One experiment that could be done to address this possibility is to transfect F and G into the replicon-containing cell line and test for an increase in the amount of replicon genome or viral protein in the cells expressing G and F compared to cells without G and F. A drug inducible F/G cell line that contains the replicon might be a better alternative since transfection of F and G can be inefficient and sometimes cytotoxic. Currently, we are optimizing a tetracycline inducible F/G cell line.

Replicons that also express viral glycoprotein genes.

Another approach would be to build the glycoprotein genes back into the replicon genome, individually or in combination. We have previously constructed viruses with various glycoprotein genes, such as SH and F, G and F, and only F. These viruses could be rescued and amplified because they contained the F protein, the only glycoprotein that is essential for RSV infectivity. However, RSV lacking the F gene cannot be rescued and tested because they will not initiate infection or spread. However, starting with the replicon, we should be able to add G, or SH as the only glycoprotein, or a combination of G and SH. We can also add a mutant F protein that is not cleaved by furin to determine whether the F protein per se is important, or if its functional cleaved form is. We have begun to generate the molecular cDNA clones necessary to launch these replicons. In designing these replicons, we have included “place holder genes” to maintain the normal relative transcription ratios among the viral genes. These added foreign genes have been flanked by an RSV gene start and gene end sequence so that they will be expressed like any viral gene. This system should produce physiologically relevant ratios of all the transcribed viral genes, which would be the most reliable way to determine whether these glycoproteins have an effect on viral replication and/or cytotoxicity. I have created several constructs with these combinations of the viral glycoprotein genes and with a placeholder gene in addition to BSD, the alpha-fetoprotein (AFP) gene (Table 3.1).

Table 3.1. RSV replicon and virion cDNA constructs with viral glycoprotein genes in their natural positions and placeholder genes to maintain normal transcription ratios

Gene 7 Gene 8 Gene 9 Status OM 36 SH AFP BSD Completed OM 38 BSD G AFP Completed OM 39 SH G BSD In progress OM 45 BSD AFP F (non-fusing) In progress OM 48 BSD G F (non-fusing) Completed OM 47 SH BSD F (non-fusing) Launched OM 49 SH G F (non-fusing) In progress

Since the F protein causes cell to cell fusion and it is generally believed that this kills cells it would be interesting to determine whether a replicon containing a non-fusing F is cytotoxic. A previous study of the RSV F protein showed that the

F protein activates p53 in MDCK and A549 cells (62), which leads to apoptosis; however, this study did not determine whether it was the fusion function of the F that caused activation of p53 or the F protein itself. I have created a replicon with a non-fusing F, replicon OM47 and was able to launch it, select it and passage it in BHK cells without any evidence of cytotoxicity. At least in BHK cells the non- fusing F protein is not cytotoxic. It can now be tested in other cell lines as described in Chapter 2.

Virion formation by the RSV replicon.

Additionally, these replicon constructs could reveal the role that glycoproteins play in virion formation. Since the replicon used in our study expresses the M protein and we know that the M protein enables virus budding in other

80 paramyxoviruses such as measles virus, simian virus type 5 (SV5), and Sendai virus (36, 194, 236) we wanted to determine whether the RSV replicon is capable of producing virions. We metabolically radiolabeled replicon-containing HeLa cells in parallel with rgRSV-infected HeLa cells for 16 hr beginning at 24 hr p.i.

Approximately 90% of the cells in both of these cultures were green. Virions were collected from scraped, vortexed cells and purified by equilibrium density gradient centrifugation and then fractionated. Viral proteins were immunoprecipitated with RSV antiserum from each fraction and displayed by

SDS-PAGE (Fig. 3.1). The virion peak from the infected-cell medium (denoted by bracket) was found in fractions 9-12, with a buoyant density of 1.2019-1.1532 g/cm3. A smaller peak containing viral proteins was found at the same density in the replicon-containing cell medium. The efficiency of virion production from the replicon-containing and the virus-infected cells was determined by dividing the amount of N protein in these peak virion fractions by the amount of N protein in the corresponding cell lysates. A comparison of these ratios indicated that the replicon-containing cells produced virions at approximately 19% the efficiency of

RSV-infected cells. The above replicon constructs can help us determine which glycoproteins or combinations of glycoproteins are necessary for optimal virion production.

3 1.2019-1.1532g/cm

Top of Gradient

Fig. 3.1. Production of virions by replicon-containing HeLa cells (A), compared to HeLa cells acutely infected with rgRSV (B). Media containing virions was collected and virions were concentrated by centrifuging through

20% sucrose. The virion pellet was then purified by equilibrium density gradient centrifugation and fractionated. Fractions 9-12 (1.2019-1.1532g/cm3) contain the majority of the RSV and replicon virions. The positions of viral proteins N, P, M and F1 are marked. F1 is the transmembrane portion of the

F protein following cleavage in the Golgi. An unidentified minor band above the N protein in the replicon virions is marked “X”.

Identifying a viral mechanism(s) that controls the replication of the RSV replicon.

Other viral proteins besides the glycoproteins could be responsible for the reduction in replication by replicon. Over time there might be an accumulation of one viral protein more than another if this viral protein were to be more stable than the other viral proteins. The change in ratios of viral proteins might be inhibitory to replication of the viral genome.

As mentioned previously M2-2 level is critical for optimal RSV replication: over- expression completely inhibits replication (40). Additionally, the level of M2-2 has been shown to build up slowly over the duration of infection, demonstrating stability and implying necessity in the late stage of infection (2). It is possible that in our replicon system the build-up of M2-2 over time suppresses the replication of the replicon until a stable balance is reached between replication and M2-2 expression. This type of steady accumulation throughout the infection has also been seen with NS1, but not NS2 which has a high turn-over rate (66, 142).

Over-expression of NS1 is inhibitory to transcription and RNA replication in a minigenome system (5).

We can test the involvement of NS1 or M2-2 in replication by creating an NS1 or

M2-2 deleted replicon or one that is missing both proteins. An M2-2 deleted virus has been shown to spread slower and produce less genome than wild-type (wt) virus in HEp-2 cells (16, 48, 121). An NS1 deleted RSV replicated poorly in IFN- expressing cells but much better in IFN-negative Vero cells, however, still less efficiently than wt RSV (23, 216). A drawback of this system can be that NS1 and

M2-2 might be needed for optimal replication but at a much lower level.

Alternatively, we could knock-down expression of NS1 or M2-2 with specific siRNAs and determine whether viral genome and protein expression is enhanced as a result. If one or both of these proteins are found to be responsible for the low level replication of the RSV replicon, we could change their gene position in the replicon to reduce their expression, for instance, by inserting them following the L gene, as we have done in another project recently (139).

Increased replication and protein expression from the replicon, if not cytotoxic, might be beneficial in circumstances where higher foreign protein expression is desired in a replicon protein expression system or in the production of OSV.

Identifying a cellular mechanism(s) that controls the replication of the RSV replicon

Although it is possible that a specific viral protein is responsible for the reduced level of replicon replication, it is just as likely that the cell is suppressing the replicon. Interferon is not responsible for the reduced replication because there is a similar reduction in replicon-containing cell lines that do not produce interferon.

The differences in gene expression and the activation or suppression of different gene expression pathways might shed some light on how the cells are able to suppress its replication, and also how they tolerate the replicon, avoiding cell death.

Identifying the mechanism of cellular control of chronic viral replication outside of the interferon pathway can also be of significant clinical value. Non-cytopathic

RSV replicon in cell culture, might correspond with reported RSV persistence in vitro (8, 10, 74, 96, 113, 162, 173, 174, 176, 192, 220, 225), except that the replicon was established without biological selection. Perhaps even more similarities can be found in clinical studies with COPD (Chronic Obstructive

Pulmonary Disease) patients that have revealed a low level of RSV RNA in some patients with stable COPD (22, 196, 231). These patients tended to display markers of a more severe form of COPD, suggesting that a low level RSV persistence might add to the severity of COPD (196, 231). Persistent RSV infection in patients with T cell immunodeficiencies has also been reported (52).

A postmortem study of lung tissue from infants who died of other causes has also revealed the presence of RSV sequences in lung tissue regardless of whether death occurred during the winter (peak RSV season) or during the summer, suggesting the possibility of RSV persistence in infants (54). Bovine RSV has also been shown to persist in B cells of symptom-free naturally infected cows

(224).

Human RSV persistence has also been reported in inoculated laboratory animals. RSV tends to persist in normal guinea pigs (25, 107), which overtime develop lung function abnormalities (188). Inoculation of BALB/c mice with human RSV revealed the presence of RSV genome and mRNA in the lung homogenates of these mice 100 days or more after infection but, no infectious virus was detected (195). However depletion of CD4 and CD8 positive T cells from these mice resulted in infectious virus.

There is evidence that suggests that suppression of apoptosis is the mechanism that RSV uses to persist in cells. RSV has been shown to suppress apoptosis in lung epithelial cells by increasing the expression of anti-apoptotic proteins and decreasing the expression of pro-apoptotic proteins (157). A HEp-2 cell line persistently infected with RSV was found to be resistant to drug-induced apoptosis and microarray analysis revealed an up-regulation of anti-apoptotic genes and down-regulation of pro-apoptotic genes, such as caspase-9 (major player in apoptotic pathway) (151). Human dendritic cells and murine macrophages persistently infected with RSV were also shown to be resistant to apoptosis in vitro (113, 162). Additionally, persistently infected murine macrophages demonstrated subversion of apoptosis not just at the transcriptional level but at the protein level: caspase-9 and caspase-3 were expressed, but the level of caspase-3 activity was suppressed, while the level of caspase-9 activity was undetectable (162).

We have performed a microarray analysis (Illumina, HT12V3) comparing cellular gene expression of RSV-infected A549 cells at 24 hr p.i., replicon-containing

A549 cells, and uninfected parental A549 cells. We anticipated that the gene expression in the replicon-containing cells would either be: similar to that in the

RSV infected cells, except that the induction or suppression of gene expression would be less pronounced due to the lower level of replication and gene expression from the replicon; or similar to that of the uninfected cells because the replicon-containing cells appear unchanged, replicating at the same rate as the parental cells without the replicon.

Initial analysis of the microarray data has revealed that neither is true. Instead, the RSV-infected and replicon-containing cells display distinctly different patterns of expression. These differences are evident in Fig. 3.2, which compares, side- by-side, genes that are over- or under-expressed in RSV-infected and replicon- containing A549 cells to normal expression of genes in uninfected A549 parental control cell line.

Uninfected RSV 24 hr p.i. Replicon-containing

Fig. 3.2. Gene Trees of expressed genes from RSV-infected A549 cells

(RSVA) at 24 hr p.i. and replicon-containing A549 cells (RSVR), both compared to uninfected A549 control cells. A parametric statistical approach was used to identify the most significant changes in gene expression (p<0.01).

Each conditional group represents an average of four samples. Genes are grouped in the gene tree according to their expression patterns. Each horizontal line across the three groups in the gene tree represents an individual gene.

Orange through red represents up-regulated genes, while green through blue

88 represents down-regulated genes. The yellow represents baseline expression of genes in the uninfected A549 control cells.

Additionally, the expression levels of functionally related genes was assessed by modular analysis (39) in which genes are organized as groups that are expressed similarly during a particular response or disease state. Replicon- containing cells and RSV-infected cells displayed differences in the intensity of their expression of many of these gene modules (Fig. 3.3). As expected from the lower level of replication of the replicon, the expression of cellular genes in the modules containing interferon- or inflammation-related genes is lower in the replicon-containing cells compared to RSV-infected cells. Interestingly, the gene module representing ribosomal proteins is underexpressed in RSV-infected A549 cells but is normal in replicon-containing A549 cells.

Replicon-containingAll A549 cells

1 2 3 4 5 6 7 8 9 10 11 M1 M2 M3

RSV 24 hr p.i. ofAll A549 cells 1 2 3 4 5 6 7 8 9 10 11 M1 M2

Fig. 3.3. Modular Map of gene expression in replicon-containing A549 cells and RSV-infected A549 cells. Modular maps are based on 13,830 genes expressed in Peripheral Blood Mononuclear Cells (PBMC). Genes were organized into modules based on correlation in expression during a disease state. Red represent up-regulation of the genes in a module, while blue represents down-regulation. The intensity of color represents the intensity of expression of the genes in that module. The legend, on the right, displays the modules that have been characterized. Many have not yet been characterized.

To determine if replicon persistence correlates with suppression of apoptosis, I examined the expression of genes involved in apoptosis. There was a clear difference in pro-apoptotic and anti-apoptotic gene expression between replicon- containing A549 cells and RSV-infected A549 cells. Expression of caspase-9, one of the key genes in the apoptosis pathway, was down-regulated in replicon- containing cells but up-regulated in RSV-infected cells (Fig. 3.4). It would be interesting to examine the caspase-9 enzymatic activity to determine if its activity is suppressed at the protein level also. Interestingly, caspase-9 was also down- regulated in HEp-2 cells persistently infected with RSV (151).

Other pro-apoptotic genes were also down-regulated in the replicon-containing but not in RSV-infected cells. Caspase-2 and p53 were an exception, being slightly up-regulated in replicon-containing cells (Fig. 3.4). Both are upstream players in the apoptotic pathway. However, it is possible that their up-regulation would not lead to cell death if caspase-9 is not up-regulated. Caspase-9 function must be activated by cleavage (56). We will need to assess its activation.

The anti-apoptotic genes were slightly up-regulated in the replicon-containing cells, matching the up-regulation in RSV-infected cells, except for one anti- apoptotic gene, BIRC3 (Fig. 3.5). BIRC3 was up-regulated 9.5 fold in RSV- infected cells but slightly down-regulated in replicon-containing cells.

It is possible that replicon persistence and noncytotoxicity is due to suppression of apoptosis. One way to determine if replicon-containing cells are resistant to apoptosis is to treat them and uninfected parental cell line with drugs that induce

92 apoptosis, such as the drug staurosporine. If replicon-containing cells are more resistant to apoptosis they will survive treatment with higher concentrations of the drug.

The discovery of a unique pathway signature that allows RSV to persist in vivo would not only help to identify its persistence but also create new cellular targets for controlling RSV disease. If up-regulation of a particular gene is found to be critical for controlling the replicon, a drug that would stimulate its expression or function during an acute infection might control virus replication and disease. On the other hand, down-regulation of its expression or function might clear a persistent infection in immunosuppressed and COPD patients. One of the future experiments in the search of this “unique pathway signature” should be to compare gene expression in replicon-containing cells to gene expression in cell lines that are persistently infected with RSV.

Fig. 3.4. Expression of pro-apoptotic genes in RSV-infected and replicon- containing A549 cells. Yellow represents baseline expression of genes in the uninfected A549 control. Orange through red represent up-regulated genes, while green through blue represent down-regulated genes.

Fig. 3.5. Expression of anti-apoptotic genes in RSV-infected and replicon containing A549 cells. The color representations are the same as in Fig. 3.4.

There are many other genes that could contribute to persistence, suppression, and noncytotoxicity of the replicon. The best way to determine the significance of these genes is to compare and contrast the expression of these genes between the replicon- containing and RSV-infected A549 cells. A list of genes that are overexpressed in the replicon-containing but not RSV-infected cells is presented in Fig.3.6, and a list of genes that are overexpressed in the RSV-infected but not replicon-containing cells in Fig. 3.7.

Control RSV Replicon Genes 1.2 1.7 11.1 SPINK6 1.2 1.9 13.7 RAET1G 1.2 2.2 17.5 SNAI2 1.1 1.0 11.4 BCHE 1.1 2.2 14.7 CDH11 1.0 1.1 28.1 MAFB 0.9 5.4 28.3 ANPEP 1.0 5.0 12.6 DHRS2 1.2 4.8 35.3 SNAI2 1.1 1.0 25.9 IGFBP5 1.0 1.0 27.3 HLA-DPA1 0.9 0.8 128.3 SCG2 1.1 1.0 11.3 BCHE 1.0 1.0 15.2 AL136588 1.0 1.0 15.7 FPR1 1.1 1.2 20.2 CD74 1.0 1.1 13.6 HLA-DRB4 1.0 1.6 22.7 PCDH7 1.0 1.3 28.7 KIAA0367 1.0 1.0 57.4 HLA-DRA 1.0 1.0 15.4 DACH1 1.0 1.0 28.8 IGFBP5 1.0 1.0 54.5 HLA-DRA 1.1 0.9 18.2 ANGPT1 1.0 1.0 60.2 RGS4 1 1 12.1 HLA-DRB6

Fig.3.6. List of genes highly overexpressed in the replicon-containing A549 cells but not in RSV-infected cells. Highly overexpressed genes in the replicon-containing cells were defined as genes that are more than 10 fold up- regulated than genes in the uninfected control cells.

Control RSV Rep Genes Control RSV Rep Genes 1.0 68.2 3.6 IFIT3 1.1 50.5 4.6 HCP5 1.0 80.8 20.5 IFI6 1.0 68.9 7.7 IL6 0.8 46.3 3.6 IFIH1 1.1 63.9 1.0 CCL3L3 1.0 75.4 7.7 IFIT3 1.0 64.6 1.0 IL29 1.1 46.6 3.5 ATF3 1.0 213.9 20.5 IFI27 1.0 74.8 5.4 LAMC2 1.1 2150.7 10.6 CCL5 1.0 189.5 51.8 MX1 1.1 61.8 1.0 IL28A 1.2 87.5 13.8 GBP1 1.0 163.8 18.0 OAS2 1.0 122.1 1.6 OASL 1.0 57.0 1.0 CCL3L1 1.1 206.8 43.1 IFI44 1.0 102.8 17.9 IFIT1 1.0 47.5 2.7 LAMC2 1.0 244.1 7.0 IFIT2 0.9 55.7 3.6 DDX58 1.0 490.8 8.5 OASL 1.0 129.5 10.6 ISG15 1.0 3460.2 34.9 CCL5 1.0 33.3 0.5 KLF4 1.0 39.0 1.0 ZBTB32 1.0 30.4 1.0 MMP9 1.0 54.2 1.1 LINCR 0.9 91.1 1.4 NFS1 1.0 63.0 1.0 ISG20 0.9 202.6 14.7 IFIT3 1.0 256.4 1.0 CCL3L3 1.2 103.1 22.2 HLA-B 1.0 194.4 1.0 IL29 1.0 70.9 2.3 GBP4 1.0 44.7 1.9 UBD 1.0 32.0 13.8 IFI44L Fig.3.7. List of genes highly 1.0 34.2 1.6 CCL20 1.0 30.0 1.0 PLEKHA4 overexpressed in RSV-infected A549 1.1 62.1 5.0 C15orf48 cells but not replicon-containing 1.0 104.2 1.3 CXCL10 1.0 37.1 2.3 TNFAIP3 cells. Highly overexpressed genes in 1.0 34.6 4.4 FLJ20035 1.1 63.3 2.1 CFB RSV-infected cells were defined as 1.1 137.8 1.0 CCL3 1.0 77.3 13.1 GBP1 genes that are more than 60-fold up- 1.0 109.5 1.9 RSAD2 0.9 32.5 3.9 C15orf48 regulated than genes in uninfected 1.0 53.4 2.1 ZC3HAV1 control cells. 1.0 32.4 4.5 XAF1 1.0 104.8 1.8 IFNB1

Additionally, using the Ingenuity Pathway Analysis (IPA) we can display some of the genes as they relate to known cellular pathways or networks. IPA ranks the networks according to known relationship between genes, genes involved, and intensity of gene expression. The top two networks in replicon-containing and

RSV-infected A549 cells are presented in Fig.3.8, Fig.3.11. Fig.3.12, and

Fig.3.13. The top network of the replicon-containing A549 cells is compared to network 19 in Fig.3.9. of RSV-infected A549 cells because these two networks seem to both be driven by an interferon response, sharing some similarities in genes involved but also significant differences in pathways (Fig.3.10).

Fig. 3.8. Replicon Network 1. This is the top pathway in the replicon-containing

A549 cells. This pathway is associated with organismal injury and abnormalities, infection mechanism, dermatological diseases and conditions.

Fig. 3.9. RSV Network 19. This network in RSV-infected cells is 19th on the list of importance. It is similar to the top network in replicon-containing cells. It is associated with infection mechanism, antimicrobial response, and an inflammatory response.

100

Fig. 3.10. Side-by-side comparison of Replicon Network 1 with RSV

Network 19.

101

Fig. 3.11. Replicon Network 2. This is the second top pathway in the replicon- containing cells. It is associated with embryonic development, gene expression, tissue morphology.

102

Fig.3.12. RSV Network 1. This is the top pathway in RSV-infected cells. It is associated with RNA damage and repair, cell cycle, cell signaling.

103

Fig. 3.13. RSV Network 2. This is the second top pathway in RSV-infected cells.

This pathway is associated with amino acid metabolism, developmental disorders, and genetic disorders.

104

Replicon-Containing Cell Line for Drug Screening.

Replicon-containing cell lines also provide a good system for drug screening to identify lead compounds against the replication complex of RSV, particularly the polymerase. GFP or luciferase expression by the replicon can be used as a measure of the effectiveness of a drug in suppressing replication. Luciferase reporter assays, however, are more sensitive, convenient, and more accurate than GFP detection primarily because of the availability of luciferase detection kits.

We inserted a Renilla luciferase gene into the replicon cDNA as shown in Fig.

3.14, in the SacII/ApaI restriction sites between the RrFP (Renilla recombinant green fluorescent protein) and NS1 genes. The luciferase gene was flanked by the GS and GE sequences so that it would be expressed like any viral gene. This replicon construct was named MP395. We launched Rep395 in BHK-29-T7 cells and I mobilized it into HeLa and Vero cell lines and selected the replicon- containing cell lines with blasticidin, confirming by the actin sequencing assay that the cell lines were not contaminated with BHK cells. This technology has been jointly patented by the three groups that initially worked to create the RSV replicon, Apath, LLC, Rush University (my advisor is a co-inventor), and the NIH.

So far, it has been licensed to two biotech companies for use in screening chemical libraries to identify lead compounds that block RSV replication. The replicon has several benefits over infection of cells with the most used assay, infection with RSV or rgRSV, including the avoidance of an infectious agent in

105 the assay, avoidance of the variability that comes from adding aliquots of virus to each well of a 96- or 384-well dish, avoidance of compounds that non-specifically blocking viral entry, and targeting a known, specific target that has not been exploited yet.

106

BstEII BstBI Acc65I KpnI SacI AgeI EcoICRI SgrAI SacII EagI Bsu36I ApaI PspOMI

tet RrFP PciI hRLuc NS1 NS2 AhdI 18000 2000 16000 BlnI RsrII N BsiWI MP395 Replicon 14000 4000 P 18098 bps 6000 12000 M BssHII

10000 8000 bsd M2-2M2-1 PvuI L BlpI PspXI PmlI XhoI BbvCI

AarI

Fig. 3.14. Plasmid containing the RSV replicon cDNA with the Renilla green fluorescent protein (RrFP) gene and the humanized Renilla luciferase

(hRLuc) gene.

107

In an effort to further improve the Rep395(luc) replicon, we modified the replicon by replacing the GS used to drive expression of the luciferase gene with a temperature sensitive (ts)GS (MP393). The purpose of using this tsGS is to reduce the amount of luciferase in the cells at the start of the assay. If this tsGS functions in a temperature sensitive manner, cells grown at the non-permissive temperature (38°C) for 24-48 hr will have transcribed very little luciferase mRNA during that time and therefore will have produced very little luciferase protein.

Coupled with the relatively short half-life of the luciferase protein (4 h), these cells should contain very low background levels of luciferase protein when the test compounds are added and the cells are incubated at the permissive temperature

(33°C). A compound that inhibits the RSV polymerase would prevent luciferase mRNA production and therefore luciferase protein production. Because these cells would have lower luciferase background, the assay would be more sensitive and perhaps more rapid. We have launched this replicon (Rep-tsLuc) and are currently optimizing this system.

The tsGS, essentially a ts promoter, may be unique among conditional lethal mutations. It was identified in an RSV strain that was chemically mutagenized and selected for a virus that did not grow at 38°C (78). Surprisingly, this ts mutation was a nucleotide substitution in the gene start of the M2 gene.

Cells containing Rep-tsLuc were incubated at 38°C for 48 h to inhibit Luciferase mRNA transcription from the tsGS, thereby reducing the luciferase level, then shifted to 33°C for 12 h to allow its expression. Rep-tsLuc demonstrated a robust increase in luciferase expression an 800 fold increase over its Luciferase

108 expression at 38C. Rep-wtLuc produced a smaller, but still large, 140 fold increase (Fig. 3.15). Rep-tsLuc produced nearly a 6 fold larger increase in

Luciferase production.

To use Rep-tsLuc for screening compounds, a test compound would be added as the replicon-containing cells were shifted to the permissive temperature, 33°C.

A compound that successfully targets the ribonucleoprotein complex would be added before incubation at 33°C and would prevent luciferase production. Such a compound might be an effective antiviral lead compound.

109

Fig. 3.15. Luciferase expression driven by the ts or wt GS in RSV replicons incubated at 33°C or 38°C and shifted to 33°C. The Rep-wtLuc (MP395) and

Rep-tsLuc (MP393) replicons were incubated at the non-permissive (38°C) or permissive (33°C) temperature for 2 days in 100mm dishes. Both sets of cells were trypsinized and divided into two aliquots. One aliquot was pelleted, lysed and frozen. The second aliquot was plated into a 12 well in triplicate and incubated at 33°C for 12 h before lysing. The protein concentration in each sample was determined and equivalent amounts of protein were used in the luciferase assay. The results are plotted as a comparison of the amount of luciferase produced by each replicon following the shift divided by the amount of luciferase produced by the same cells before the shift.

110

REFERENCES

1. Agapov, E. V., I. Frolov, B. D. Lindenbach, B. M. Pragai, S. Schlesinger, and C. M. Rice. 1998. Noncytopathic Sindbis virus RNA vectors for heterologous gene expression [see comments]. Proc Natl Acad Sci U S A 95:12989-94. 2. Ahmadian, G., P. Chambers, and A. J. Easton. 1999. Detection and characterization of proteins encoded by the second ORF of the M2 gene of pneumoviruses. J Gen Virol 80 ( Pt 8):2011-6. 3. Alvarez, R., S. Elbashir, T. Borland, I. Toudjarska, P. Hadwiger, M. John, I. Roehl, S. S. Morskaya, R. Martinello, J. Kahn, M. Van Ranst, R. A. Tripp, J. P. DeVincenzo, R. Pandey, M. Maier, L. Nechev, M. Manoharan, V. Kotelianski, and R. Meyers. 2009. RNA interference- mediated silencing of the respiratory syncytial virus nucleocapsid defines a potent antiviral strategy. Antimicrob Agents Chemother 53:3952-62. 4. Asenjo, A., E. Calvo, and N. Villanueva. 2006. Phosphorylation of human respiratory syncytial virus P protein at threonine 108 controls its interaction with the M2-1 protein in the viral RNA polymerase complex. J Gen Virol 87:3637-42. 5. Atreya, P. L., M. E. Peeples, and P. L. Collins. 1998. The NS1 protein of human respiratory syncytial virus is a potent inhibitor of minigenome transcription and RNA replication. J Virol 72:1452-61. 6. Bachi, T. 1988. Direct observation of the budding and fusion of an enveloped virus by video microscopy of viable cells. J Cell Biol 107:1689- 95. 7. Bader, M. S., and D. S. McKinsey. 2005. Viral infections in the elderly. The challenges of managing herpes zoster, influenza, and RSV. Postgrad Med 118:45-8, 51-4. 8. Baldridge, P., and L. B. Senterfit. 1976. Persistent infection of cells in culture by respiratory syncytial virus. Proc Soc Exp Biol Med 151:684-8. 9. Ban, H., M. Inoue, U. Griesenbach, F. Munkonge, M. Chan, A. Iida, E. W. Alton, and M. Hasegawa. 2007. Expression and maturation of Sendai virus vector-derived CFTR protein: functional and biochemical evidence using a GFP-CFTR fusion protein. Gene Ther 14:1688-94. 10. Bangham, C. R., and A. J. McMichael. 1986. Specific human cytotoxic T cells recognize B-cell lines persistently infected with respiratory syncytial virus. Proc Natl Acad Sci U S A 83:9183-7. 11. Barik, S. 1993. The structure of the 5' terminal cap of the respiratory syncytial virus mRNA. J Gen Virol 74 ( Pt 3):485-90.

111

12. Barik, S. 1992. Transcription of human respiratory syncytial virus genome RNA in vitro: requirement of cellular factor(s). J Virol 66:6813-8. 13. Barik, S., T. McLean, and L. C. Dupuy. 1995. Phosphorylation of Ser232 directly regulates the transcriptional activity of the P protein of human respiratory syncytial virus: phosphorylation of Ser237 may play an accessory role. Virology 213:405-12. 14. Barretto, N., L. K. Hallak, and M. E. Peeples. 2003. Neuraminidase treatment of respiratory syncytial virus-infected cells or virions, but not target cells, enhances cell-cell fusion and infection. Virology 313:33-43. 15. Belshe, R. B., L. S. Richardson, W. T. London, D. L. Sly, J. H. Lorfeld, E. Camargo, D. A. Prevar, and R. M. Chanock. 1977. Experimental respiratory syncytial virus infection of four species of primates. J Med Virol 1:157-62. 16. Bermingham, A., and P. L. Collins. 1999. The M2-2 protein of human respiratory syncytial virus is a regulatory factor involved in the balance between RNA replication and transcription. Proc Natl Acad Sci U S A 96:11259-64. 17. Berthiaume, L., J. Joncas, and V. Pavilanis. 1974. Comparative structure, morphogenesis and biological characteristics of the respiratory syncytial (RS) virus and the pneumonia virus of mice (PVM). Arch Gesamte Virusforsch 45:39-51. 18. Bitko, V., A. Musiyenko, O. Shulyayeva, and S. Barik. 2005. Inhibition of respiratory viruses by nasally administered siRNA. Nat Med 11:50-5. 19. Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation of HCV RNA replication in cell culture. Science 290:1972-4. 20. Blight, K. J., J. A. McKeating, and C. M. Rice. 2002. Highly permissive cell lines for subgenomic and genomic hepatitis C virus RNA replication. J Virol 76:13001-14. 21. Bonfanti, J. F., and D. Roymans. 2009. Prospects for the development of fusion inhibitors to treat human respiratory syncytial virus infection. Curr Opin Drug Discov Devel 12:479-87. 22. Borg, I., G. Rohde, S. Loseke, J. Bittscheidt, G. Schultze- Werninghaus, V. Stephan, and A. Bufe. 2003. Evaluation of a quantitative real-time PCR for the detection of respiratory syncytial virus in pulmonary diseases. Eur Respir J 21:944-51. 23. Bossert, B., and K. K. Conzelmann. 2002. Respiratory syncytial virus (RSV) nonstructural (NS) proteins as host range determinants: a chimeric bovine RSV with NS genes from human RSV is attenuated in interferon- competent bovine cells. J Virol 76:4287-93. 24. Bossert, B., S. Marozin, and K. K. Conzelmann. 2003. Nonstructural proteins NS1 and NS2 of bovine respiratory syncytial virus block activation of interferon regulatory factor 3. J Virol 77:8661-8. 25. Bramley, A. M., T. Z. Vitalis, B. R. Wiggs, and R. G. Hegele. 1999. Effects of respiratory syncytial virus persistence on airway responsiveness and inflammation in guinea-pigs. Eur Respir J 14:1061-7.

112

26. Brown, G., C. E. Jeffree, T. McDonald, H. W. Rixon, J. D. Aitken, and R. J. Sugrue. 2004. Analysis of the interaction between respiratory syncytial virus and lipid-rafts in Hep2 cells during infection. Virology 327:175-85. 27. Bukreyev A, W. S., Murphy BR, et al. 1997. Recombinant respiratory syncytial virus from which the entire SH gene has been deleted grows efficiently in cell culture and exhibits site-specific attenuation in the respiratory tract of the mouse. J Virol 71. 28. Bukreyev, A., L. Yang, J. Fricke, L. Cheng, J. M. Ward, B. R. Murphy, and P. L. Collins. 2008. The secreted form of respiratory syncytial virus G glycoprotein helps the virus evade antibody-mediated restriction of replication by acting as an antigen decoy and through effects on Fc receptor-bearing leukocytes. J Virol 82:12191-204. 29. Burke, E., L. Dupuy, C. Wall, and S. Barik. 1998. Role of cellular actin in the gene expression and morphogenesis of human respiratory syncytial virus. Virology 252:137-48. 30. Byrappa, S., D. K. Gavin, and K. C. Gupta. 1995. A highly efficient procedure for site-specific mutagenesis of full- length plasmids using Vent DNA polymerase. Genome Res 5:404-7. 31. Byrd, L. G., and G. A. Prince. 1997. Animal models of respiratory syncytial virus infection. Clin Infect Dis 25:1363-8. 32. Cantell, K. 1961. Production and action of interferon in HeLa cells. Arch Gesamte Virusforsch 10:510-21. 33. Carbonell-Estrany, X., E. A. Simoes, R. Dagan, C. B. Hall, B. Harris, M. Hultquist, E. M. Connor, and G. A. Losonsky. 2010. Motavizumab for prophylaxis of respiratory syncytial virus in high-risk children: a noninferiority trial. Pediatrics 125:e35-51. 34. Carroll, A. R., and R. R. Wagner. 1979. Role of the membrane (M) protein in endogenous inhibition of in vitro transcription by vesicular stomatitis virus. J Virol 29:134-42. 35. Cartee, T. L., and G. W. Wertz. 2001. Respiratory syncytial virus M2-1 protein requires phosphorylation for efficient function and binds viral RNA during infection. J Virol 75:12188-97. 36. Cathomen, T., B. Mrkic, D. Spehner, R. Drillien, R. Naef, J. Pavlovic, A. Aguzzi, M. A. Billeter, and R. Cattaneo. 1998. A matrix-less measles virus is infectious and elicits extensive cell fusion: consequences for propagation in the brain. Embo J 17:3899-908. 37. Cattaneo, R., A. Schmid, P. Spielhofer, K. Kaelin, K. Baczko, V. ter Meulen, J. Pardowitz, S. Flanagan, B. K. Rima, S. A. Udem, and et al. 1989. Mutated and hypermutated genes of persistent measles viruses which caused lethal human brain diseases. Virology 173:415-25. 38. Chandrika, R., S. M. Horikami, S. Smallwood, and S. A. Moyer. 1995. Mutations in conserved domain I of the Sendai virus L polymerase protein uncouple transcription and replication. Virology 213:352-63. 39. Chaussabel, D., C. Quinn, J. Shen, P. Patel, C. Glaser, N. Baldwin, D. Stichweh, D. Blankenship, L. Li, I. Munagala, L. Bennett, F. Allantaz,

113

A. Mejias, M. Ardura, E. Kaizer, L. Monnet, W. Allman, H. Randall, D. Johnson, A. Lanier, M. Punaro, K. M. Wittkowski, P. White, J. Fay, G. Klintmalm, O. Ramilo, A. K. Palucka, J. Banchereau, and V. Pascual. 2008. A modular analysis framework for blood genomics studies: application to systemic lupus erythematosus. Immunity 29:150-64. 40. Cheng, X., H. Park, H. Zhou, and H. Jin. 2005. Overexpression of the M2-2 protein of respiratory syncytial virus inhibits viral replication. J Virol 79:13943-52. 41. Chidgey, S. M., and K. J. Broadley. 2005. Respiratory syncytial virus infections: characteristics and treatment. J Pharm Pharmacol 57:1371-81. 42. Chin, J., R. L. Magoffin, L. A. Shearer, J. H. Schieble, and E. H. Lennette. 1969. Field evaluation of a respiratory syncytial virus vaccine and a trivalent parainfluenza virus vaccine in a pediatric population. Am J Epidemiol 89:449-63. 43. Collins, P. L., E. Camargo, and M. G. Hill. 1999. Support plasmids and support proteins required for recovery of recombinant respiratory syncytial virus. Virology 259:251-5. 44. Collins PL, C. E., Hill MG. 1986. Nucleotide sequences for the gene junctions of human respiratory syncytial virus reveal distinctive features of intergenic structure and gene order. Proc Natl Acad Sci U S A 83. 45. Collins, P. L., and B. S. Graham. 2008. Viral and host factors in human respiratory syncytial virus pathogenesis. J Virol 82:2040-55. 46. Collins, P. L., M. G. Hill, E. Camargo, H. Grosfeld, R. M. Chanock, and B. R. Murphy. 1995. Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development. Proc Natl Acad Sci U S A 92:11563-7. 47. Collins, P. L., M. G. Hill, J. Cristina, and H. Grosfeld. 1996. Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus. Proc Natl Acad Sci U S A 93:81-5. 48. Collins, P. L., K. McIntosh, and R.M. Chanock 2001. Respiratory Syncytial Virus, 4th ed, vol. 1. Lippincott-Raven, Philadelphia. 49. Collins, P. L., M. A. Mink, and D. S. Stec. 1991. Rescue of synthetic analogs of respiratory syncytial virus genomic RNA and effect of truncations and mutations on the expression of a foreign reporter gene. Proc Natl Acad Sci U S A 88:9663-7. 50. Collins, P. L., and G. Mottet. 1993. Membrane orientation and oligomerization of the small hydrophobic protein of human respiratory syncytial virus. J Gen Virol 74 ( Pt 7):1445-50. 51. Collins PL, W., GW. 1983. cDNA cloning and transcriptional mapping of nine polyadenylated RNAs encoded by the genome of human respiratory syncytial virus. Proc Natl Acad Sci U S A 80.

114

52. Couch, R. B., J. A. Englund, and E. Whimbey. 1997. Respiratory viral infections in immunocompetent and immunocompromised persons. Am J Med 102:2-9; discussion 25-6. 53. Crowe, J. E., Jr., P. T. Bui, C. Y. Firestone, M. Connors, W. R. Elkins, R. M. Chanock, and B. R. Murphy. 1996. Live subgroup B respiratory syncytial virus vaccines that are attenuated, genetically stable, and immunogenic in rodents and nonhuman primates. J Infect Dis 173:829-39. 54. Cubie, H. A., L. A. Duncan, L. A. Marshall, and N. M. Smith. 1997. Detection of respiratory syncytial virus nucleic acid in archival postmortem tissue from infants. Pediatr Pathol Lab Med 17:927-38. 55. Cuesta, I., X. Geng, A. Asenjo, and N. Villanueva. 2000. Structural phosphoprotein M2-1 of the human respiratory syncytial virus is an RNA binding protein. J Virol 74:9858-67. 56. Danial, N. N., and S. J. Korsmeyer. 2004. Cell death: critical control points. Cell 116:205-19. 57. Delgado, M. F., S. Coviello, A. C. Monsalvo, G. A. Melendi, J. Z. Hernandez, J. P. Batalle, L. Diaz, A. Trento, H. Y. Chang, W. Mitzner, J. Ravetch, J. A. Melero, P. M. Irusta, and F. P. Polack. 2009. Lack of antibody affinity maturation due to poor Toll-like receptor stimulation leads to enhanced respiratory syncytial virus disease. Nat Med 15:34-41. 58. Domachowske, J. B., C. A. Bonville, and H. F. Rosenberg. 2004. Animal models for studying respiratory syncytial virus infection and its long term effects on lung function. Pediatr Infect Dis J 23:S228-34. 59. Douglas, J. L. 2004. In search of a small-molecule inhibitor for respiratory syncytial virus. Expert Rev Anti Infect Ther 2:625-39. 60. Dryga, S. A., O. A. Dryga, and S. Schlesinger. 1997. Identification of mutations in a Sindbis virus variant able to establish persistent infection in BHK cells: the importance of a mutation in the nsP2 gene. Virology 228:74-83. 61. Dupuy, L. C., S. Dobson, V. Bitko, and S. Barik. 1999. Casein kinase 2- mediated phosphorylation of respiratory syncytial virus phosphoprotein P is essential for the transcription elongation activity of the viral polymerase; phosphorylation by casein kinase 1 occurs mainly at Ser(215) and is without effect. J Virol 73:8384-92. 62. Eckardt-Michel, J., M. Lorek, D. Baxmann, T. Grunwald, G. M. Keil, and G. Zimmer. 2008. The fusion protein of respiratory syncytial virus triggers p53-dependent apoptosis. J Virol 82:3236-49. 63. Embleton, N. D., C. Harkensee, and M. C. McKean. 2005. Palivizumab for preterm infants. Is it worth it? Arch Dis Child Fetal Neonatal Ed 90:F286-9. 64. Emeny, J. M., and M. J. Morgan. 1979. Regulation of the interferon system: evidence that Vero cells have a genetic defect in interferon production. J Gen Virol 43:247-52. 65. Empey, K. M., R. S. Peebles, Jr., and J. K. Kolls. 2010. Pharmacologic advances in the treatment and prevention of respiratory syncytial virus. Clin Infect Dis 50:1258-67.

115

66. Evans, J. E., P. A. Cane, and C. R. Pringle. 1996. Expression and characterisation of the NS1 and NS2 proteins of respiratory syncytial virus. Virus Res 43:155-61. 67. Falsey, A. R., and E. E. Walsh. 2000. Respiratory Syncytial Virus infections in adults. Clin Microbiol Rev 13:371-84. 68. Falsey, A. R., and E. E. Walsh. 2005. Respiratory syncytial virus infection in elderly adults. Drugs Aging 22:577-87. 69. Fearns, R., and P. L. Collins. 1999. Model for polymerase access to the overlapped L gene of respiratory syncytial virus. J Virol 73:388-97. 70. Fearns, R., and P. L. Collins. 1999. Role of the M2-1 transcription antitermination protein of respiratory syncytial virus in sequential transcription. J Virol 73:5852-64. 71. Fearns, R., P. L. Collins, and M. E. Peeples. 2000. Functional analysis of the genomic and antigenomic promoters of human respiratory syncytial virus. J Virol 74:6006-14. 72. Fearns, R., M. E. Peeples, and P. L. Collins. 1997. Increased expression of the N protein of respiratory syncytial virus stimulates minigenome replication but does not alter the balance between the synthesis of mRNA and antigenome. Virology 236:188-201. 73. Feldman, S. A., R. M. Hendry, and J. A. Beeler. 1999. Identification of a linear heparin binding domain for human respiratory syncytial virus attachment glycoprotein G. J Virol 73:6610-7. 74. Fernie, B. F., E. C. Ford, and J. L. Gerin. 1981. The development of Balb/c cells persistently infected with respiratory syncytial virus: presence of ribonucleoprotein on the cell surface. Proc Soc Exp Biol Med 167:83-6. 75. Ferrari, S., U. Griesenbach, A. Iida, R. Farley, A. M. Wright, J. Zhu, F. M. Munkonge, S. N. Smith, J. You, H. Ban, M. Inoue, M. Chan, C. Singh, B. Verdon, B. E. Argent, B. Wainwright, P. K. Jeffery, D. M. Geddes, D. J. Porteous, S. C. Hyde, M. A. Gray, M. Hasegawa, and E. W. Alton. 2007. Sendai virus-mediated CFTR gene transfer to the airway epithelium. Gene Ther 14:1371-9. 76. Ferrari, S., U. Griesenbach, T. Shiraki-Iida, T. Shu, T. Hironaka, X. Hou, J. Williams, J. Zhu, P. K. Jeffery, D. M. Geddes, M. Hasegawa, and E. W. Alton. 2004. A defective nontransmissible recombinant Sendai virus mediates efficient gene transfer to airway epithelium in vivo. Gene Ther 11:1659-64. 77. Ferron, F., S. Longhi, B. Henrissat, and B. Canard. 2002. Viral RNA- polymerases -- a predicted 2'-O-ribose methyltransferase domain shared by all Mononegavirales. Trends Biochem Sci 27:222-4. 78. Firestone, C. Y., S. S. Whitehead, P. L. Collins, B. R. Murphy, and J. E. Crowe, Jr. 1996. Nucleotide sequence analysis of the respiratory syncytial virus subgroup A cold-passaged (cp) temperature sensitive (ts) cpts-248/404 live attenuated virus vaccine candidate. Virology 225:419- 22.

116

79. Fitzgerald, K. D., and B. L. Semler. 2009. Bridging IRES elements in mRNAs to the eukaryotic translation apparatus. Biochim Biophys Acta 1789:518-28. 80. Friedwald W., e. a. 1968. Low-temperature grown RS virus in adult volunteers. JAMA 204. 81. Frolov, I., E. Agapov, T. A. Hoffman, Jr., B. M. Pragai, M. Lippa, S. Schlesinger, and C. M. Rice. 1999. Selection of RNA replicons capable of persistent noncytopathic replication in mammalian cells. J Virol 73:3854-65. 82. Fuentes, S., K. C. Tran, P. Luthra, M. N. Teng, and B. He. 2007. Function of the respiratory syncytial virus small hydrophobic protein. J Virol 81:8361-6. 83. GA, P. 1986. Enhancement of respiratory syncytial virus pulmonary pathology in cotton rats by prior intramuscular inoculation of formalin- inactivated virus. J Virol 57. 84. Gan, S. W., L. Ng, X. Lin, X. Gong, and J. Torres. 2008. Structure and ion channel activity of the human respiratory syncytial virus (hRSV) small hydrophobic protein transmembrane domain. Protein Sci 17:813-20. 85. Garcia-Barreno, B., J. L. Jorcano, T. Aukenbauer, C. Lopez-Galindez, and J. A. Melero. 1988. Participation of cytoskeletal intermediate filaments in the infectious cycle of human respiratory syncytial virus (RSV). Virus Res 9:307-21. 86. Garcia-Barreno, B., A. Portela, T. Delgado, J. A. Lopez, and J. A. Melero. 1990. Frame shift mutations as a novel mechanism for the generation of neutralization resistant mutants of human respiratory syncytial virus. Embo J 9:4181-7. 87. Garcia, J., B. Garcia-Barreno, A. Vivo, and J. A. Melero. 1993. Cytoplasmic inclusions of respiratory syncytial virus-infected cells: formation of inclusion bodies in transfected cells that coexpress the nucleoprotein, the phosphoprotein, and the 22K protein. Virology 195:243- 7. 88. Garoff, H., R. Hewson, and D. J. Opstelten. 1998. Virus maturation by budding. Microbiol Mol Biol Rev 62:1171-90. 89. Ghildyal, R., C. Baulch-Brown, J. Mills, and J. Meanger. 2003. The matrix protein of Human respiratory syncytial virus localises to the nucleus of infected cells and inhibits transcription. Arch Virol 148:1419-29. 90. Ghildyal, R., A. Ho, M. Dias, L. Soegiyono, P. G. Bardin, K. C. Tran, M. N. Teng, and D. A. Jans. 2009. The respiratory syncytial virus matrix protein possesses a Crm1-mediated nuclear export mechanism. J Virol 83:5353-62. 91. Ghildyal, R., A. Ho, and D. A. Jans. 2006. Central role of the respiratory syncytial virus matrix protein in infection. FEMS Microbiol Rev 30:692-705. 92. Ghildyal, R., A. Ho, K. M. Wagstaff, M. M. Dias, C. L. Barton, P. Jans, P. Bardin, and D. A. Jans. 2005. Nuclear import of the respiratory syncytial virus matrix protein is mediated by importin beta1 independent of importin alpha. Biochemistry 44:12887-95.

117

93. Ghildyal, R., D. Li, I. Peroulis, B. Shields, P. G. Bardin, M. N. Teng, P. L. Collins, J. Meanger, and J. Mills. 2005. Interaction between the respiratory syncytial virus G glycoprotein cytoplasmic domain and the matrix protein. J Gen Virol 86:1879-84. 94. Ghildyal, R., J. Mills, M. Murray, N. Vardaxis, and J. Meanger. 2002. Respiratory syncytial virus matrix protein associates with nucleocapsids in infected cells. J Gen Virol 83:753-7. 95. Griesenbach, U., R. J. Boyton, L. Somerton, S. E. Garcia, S. Ferrari, T. Owaki, Z. Ya-Fen, D. M. Geddes, M. Hasegawa, D. M. Altmann, and E. W. Alton. 2006. Effect of tolerance induction to immunodominant T-cell epitopes of Sendai virus on gene expression following repeat administration to lung. Gene Ther 13:449-56. 96. Guerrero-Plata, A., E. Ortega, and B. Gomez. 2001. Persistence of respiratory syncytial virus in macrophages alters phagocytosis and proinflammatory cytokine production. Viral Immunol 14:19-30. 97. Gupta, A. K., M. Mathur, and A. K. Banerjee. 2002. Unique capping activity of the recombinant RNA polymerase (L) of vesicular stomatitis virus: association of cellular capping enzyme with the L protein. Biochem Biophys Res Commun 293:264-8. 98. Hall, C. B. 2010. Respiratory syncytial virus in young children. Lancet 375:1500-2. 99. Hallak, L. K., P. L. Collins, W. Knudson, and M. E. Peeples. 2000. Iduronic acid-containing glycosaminoglycans on target cells are required for efficient respiratory syncytial virus infection. Virology 271:264-75. 100. Hamaguchi, M., T. Yoshida, K. Nishikawa, H. Naruse, and Y. Nagai. 1983. Transcriptive complex of Newcastle disease virus. I. Both L and P proteins are required to constitute an active complex. Virology 128:105- 17. 101. Hancock, G. E., K. M. Heers, K. S. Pryharski, J. D. Smith, and L. Tiberio. 2003. Adjuvants recognized by toll-like receptors inhibit the induction of polarized type 2 T cell responses by natural attachment (G) protein of respiratory syncytial virus. Vaccine 21:4348-58. 102. Hanley, L. L., D. R. McGivern, M. N. Teng, R. Djang, P. L. Collins, and R. Fearns. 2010. Roles of the respiratory syncytial virus trailer region: effects of mutations on genome production and stress granule formation. Virology 406:241-52. 103. Harcourt, J., R. Alvarez, L. P. Jones, C. Henderson, L. J. Anderson, and R. A. Tripp. 2006. Respiratory syncytial virus G protein and G protein CX3C motif adversely affect CX3CR1+ T cell responses. J Immunol 176:1600-8. 104. Hardy, R. W., S. B. Harmon, and G. W. Wertz. 1999. Diverse gene junctions of respiratory syncytial virus modulate the efficiency of transcription termination and respond differently to M2-mediated antitermination. J Virol 73:170-6.

118

105. Hardy, R. W., and G. W. Wertz. 2000. The Cys(3)-His(1) motif of the respiratory syncytial virus M2-1 protein is essential for protein function. J Virol 74:5880-5. 106. Hardy, R. W., and G. W. Wertz. 1998. The product of the respiratory syncytial virus M2 gene ORF1 enhances readthrough of intergenic junctions during viral transcription. J Virol 72:520-6. 107. Hegele, R. G., S. Hayashi, A. M. Bramley, and J. C. Hogg. 1994. Persistence of respiratory syncytial virus genome and protein after acute bronchiolitis in guinea pigs. Chest 105:1848-54. 108. Heminway, B. R., Y. Yu, Y. Tanaka, K. G. Perrine, E. Gustafson, J. M. Bernstein, and M. S. Galinski. 1994. Analysis of respiratory syncytial virus F, G, and SH proteins in cell fusion. Virology 200:801-5. 109. Henderson, G., J. Murray, and R. P. Yeo. 2002. Sorting of the respiratory syncytial virus matrix protein into detergent-resistant structures is dependent on cell-surface expression of the glycoproteins. Virology 300:244-54. 110. Hendricks, D. A., K. McIntosh, and J. L. Patterson. 1988. Further characterization of the soluble form of the G glycoprotein of respiratory syncytial virus. J Virol 62:2228-33. 111. Hirata, T., A. Iida, T. Shiraki-Iida, K. Kitazato, A. Kato, Y. Nagai, and M. Hasegawa. 2002. An improved method for recovery of F-defective Sendai virus expressing foreign genes from cloned cDNA. J Virol Methods 104:125-33. 112. Hirsch, H. H., I. Steffen, P. Francioli, and A. F. Widmer. 2006. [Respiratory syncytial virus infections: measures in immunocompromised patients]. Schweiz Rundsch Med Prax 95:61-6. 113. Hobson, L., and M. L. Everard. 2008. Persistent of respiratory syncytial virus in human dendritic cells and influence of nitric oxide. Clin Exp Immunol 151:359-66. 114. Horikami, S. M., S. Smallwood, B. Bankamp, and S. A. Moyer. 1994. An amino-proximal domain of the L protein binds to the P protein in the measles virus RNA polymerase complex. Virology 205:540-5. 115. http://www.accessdata.fda.gov/drugsatfda_docs/label/2002/pal imed102302LB.pdf. 116. Hu, C., and K. C. Gupta. 2000. Functional significance of alternate phosphorylation in Sendai virus P protein. Virology 268:517-32. 117. Inoue, M., Y. Tokusumi, H. Ban, T. Kanaya, M. Shirakura, T. Tokusumi, T. Hirata, Y. Nagai, A. Iida, and M. Hasegawa. 2003. A New Sendai Virus Vector Deficient in the Matrix Gene Does Not Form Virus Particles and Shows Extensive Cell-to-Cell Spreading. J Virol 77:6419-29. 118. Inoue, M., Y. Tokusumi, H. Ban, T. Kanaya, T. Tokusumi, Y. Nagai, A. Iida, and M. Hasegawa. 2003. Nontransmissible virus-like particle formation by F-deficient sendai virus is temperature sensitive and reduced by mutations in M and HN proteins. J Virol 77:3238-46.

119

119. Inoue, M., Y. Tokusumi, H. Ban, M. Shirakura, T. Kanaya, M. Yoshizaki, T. Hironaka, Y. Nagai, A. Iida, and M. Hasegawa. 2004. Recombinant Sendai virus vectors deleted in both the matrix and the fusion genes: efficient gene transfer with preferable properties. J Gene Med 6:1069-81. 120. Jin, H., D. Clarke, H. Z. Zhou, X. Cheng, K. Coelingh, M. Bryant, and S. Li. 1998. Recombinant human respiratory syncytial virus (RSV) from cDNA and construction of subgroup A and B chimeric RSV. Virology 251:206-14. 121. Jin H, C. X., Zhou HZ, et al. 2000. Respiratory Syncytial Virus that lacks open reading frame 2 of the M2 gene (M2-2) has altered growth characteristics and is attenuated in rodents. J Virol 74. 122. Johnson PR, C. P. 1988. The A and B subgroups of human respiratory syncytial virus: Comparison of intergenic and gene-overlap sequences. J Gen Virol 69. 123. Kallewaard, N. L., A. L. Bowen, and J. E. Crowe, Jr. 2005. Cooperativity of actin and microtubule elements during replication of respiratory syncytial virus. Virology 331:73-81. 124. Kanzaki, S., A. Shiotani, M. Inoue, M. Hasegawa, and K. Ogawa. 2007. Sendai virus vector-mediated transgene expression in the cochlea in vivo. Audiol Neurootol 12:119-26. 125. Kapikian, A. Z., R. H. Mitchell, R. M. Chanock, R. A. Shvedoff, and C. E. Stewart. 1969. An epidemiologic study of altered clinical reactivity to respiratory syncytial (RS) virus infection in children previously vaccinated with an inactivated RS virus vaccine. Am J Epidemiol 89:405-21. 126. Karger, A., U. Schmidt, and U. J. Buchholz. 2001. Recombinant bovine respiratory syncytial virus with deletions of the G or SH genes: G and F proteins bind heparin. J Gen Virol 82:631-40. 127. Karron, R. A., D. A. Buonagurio, A. F. Georgiu, S. S. Whitehead, J. E. Adamus, M. L. Clements-Mann, D. O. Harris, V. B. Randolph, S. A. Udem, B. R. Murphy, and M. S. Sidhu. 1997. Respiratory syncytial virus (RSV) SH and G proteins are not essential for viral replication in vitro: clinical evaluation and molecular characterization of a cold-passaged, attenuated RSV subgroup B mutant. Proc Natl Acad Sci U S A 94:13961- 6. 128. Karron, R. A., P. F. Wright, R. B. Belshe, B. Thumar, R. Casey, F. Newman, F. P. Polack, V. B. Randolph, A. Deatly, J. Hackell, W. Gruber, B. R. Murphy, and P. L. Collins. 2005. Identification of a recombinant live attenuated respiratory syncytial virus vaccine candidate that is highly attenuated in infants. J Infect Dis 191:1093-104. 129. Kato, T., T. Date, M. Miyamoto, A. Furusaka, K. Tokushige, M. Mizokami, and T. Wakita. 2003. Efficient replication of the genotype 2a hepatitis C virus subgenomic replicon. Gastroenterology 125:1808-17. 130. Kim, H. W., J. G. Canchola, C. D. Brandt, G. Pyles, R. M. Chanock, K. Jensen, and R. H. Parrott. 1969. Respiratory syncytial virus disease in

120

infants despite prior administration of antigenic inactivated vaccine. Am J Epidemiol 89:422-34. 131. Kimura, K., S. Mori, K. Tomita, K. Ohno, K. Takahashi, S. Shigeta, and M. Terada. 2000. Antiviral activity of NMSO3 against respiratory syncytial virus infection in vitro and in vivo. Antiviral Res 47:41-51. 132. Knipe, D. M., Howley, Peter M. 2001. Paramyxoviridae: the viruses and their replication. Fields Virology 1:1305-1340. 133. Kochva, U., H. Leonov, and I. T. Arkin. 2003. Modeling the structure of the respiratory syncytial virus small hydrophobic protein by silent-mutation analysis of global searching molecular dynamics. Protein Sci 12:2668-74. 134. Krempl, C., B. R. Murphy, and P. L. Collins. 2002. Recombinant respiratory syncytial virus with the G and F genes shifted to the promoter- proximal positions. J Virol 76:11931-42. 135. Krilov, L. R. 2011. Respiratory syncytial virus disease: update on treatment and prevention. Expert Rev Anti Infect Ther 9:27-32. 136. Kuo, L., R. Fearns, and P. L. Collins. 1997. Analysis of the gene start and gene end signals of human respiratory syncytial virus: quasi- templated initiation at position 1 of the encoded mRNA. J Virol 71:4944- 53. 137. Kuo, L., R. Fearns, and P. L. Collins. 1996. The structurally diverse intergenic regions of respiratory syncytial virus do not modulate sequential transcription by a dicistronic minigenome. J Virol 70:6143-50. 138. Kuo, L., H. Grosfeld, J. Cristina, M. G. Hill, and P. L. Collins. 1996. Effects of mutations in the gene-start and gene-end sequence motifs on transcription of monocistronic and dicistronic minigenomes of respiratory syncytial virus. J Virol 70:6892-901. 139. Kwilas, A. R., M. A. Yednak, L. Zhang, R. Liesman, P. L. Collins, R. J. Pickles, and M. E. Peeples. 2010. Respiratory syncytial virus engineered to express the cystic fibrosis transmembrane conductance regulator corrects the bioelectric phenotype of human cystic fibrosis airway epithelium in vitro. J Virol 84:7770-81. 140. Kwilas, S., R. M. Liesman, L. Zhang, E. Walsh, R. J. Pickles, and M. E. Peeples. 2009. Respiratory syncytial virus grown in Vero cells contains a truncated attachment protein that alters its infectivity and dependence on glycosaminoglycans. J Virol 83:10710-8. 141. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. 142. Lambert, D. M., J. Hambor, M. Diebold, and B. Galinski. 1988. Kinetics of synthesis and phosphorylation of respiratory syncytial virus polypeptides. J Gen Virol 69 ( Pt 2):313-23. 143. Lampinen, M., M. Carlson, L. D. Hakansson, and P. Venge. 2004. Cytokine-regulated accumulation of eosinophils in inflammatory disease. Allergy 59:793-805. 144. Levine, S. 1977. Polypeptides of Respiratory Syncytial Virus. J Virol 21:427-431.

121

145. Levine S, e. a. 1987. Demonstration that glycoprotein G is the attachment protein of respiratory syncytial virus. J Gen Virol 68. 146. Levine, S., and R. Hamilton. 1969. Kinetics of the respiratory syncytial virus growth cycle in HeLa cells. Arch Gesamte Virusforsch 28:122-32. 147. Li, D., D. A. Jans, P. G. Bardin, J. Meanger, J. Mills, and R. Ghildyal. 2008. Association of respiratory syncytial virus M protein with viral nucleocapsids is mediated by the M2-1 protein. J Virol 82:8863-70. 148. Liuzzi, M., S. W. Mason, M. Cartier, C. Lawetz, R. S. McCollum, N. Dansereau, G. Bolger, N. Lapeyre, Y. Gaudette, L. Lagace, M. J. Massariol, F. Do, P. Whitehead, L. Lamarre, E. Scouten, J. Bordeleau, S. Landry, J. Rancourt, G. Fazal, and B. Simoneau. 2005. Inhibitors of respiratory syncytial virus replication target cotranscriptional mRNA guanylylation by viral RNA-dependent RNA polymerase. J Virol 79:13105- 15. 149. Lohmann, V., F. Korner, A. Dobierzewska, and R. Bartenschlager. 2001. Mutations in hepatitis C virus RNAs conferring cell culture adaptation. J Virol 75:1437-49. 150. Lohmann, V., Korner, F., Koch, O., Herian, U., Theilmann, L., and Bartenschlager, R. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-113. 151. Martinez, I., L. Lombardia, C. Herranz, B. Garcia-Barreno, O. Dominguez, and J. A. Melero. 2009. Cultures of HEp-2 cells persistently infected by human respiratory syncytial virus differ in chemokine expression and resistance to apoptosis as compared to lytic infections of the same cell type. Virology 388:31-41. 152. Marty, A., J. Meanger, J. Mills, B. Shields, and R. Ghildyal. 2004. Association of matrix protein of respiratory syncytial virus with the host cell membrane of infected cells. Arch Virol 149:199-210. 153. Marx, P. A., A. Portner, and D. W. Kingsbury. 1974. Sendai virion transcriptase complex: polyeptide composition and inhibition by virion envelope proteins. J Virol 13:107-12. 154. Mason, S. W., C. Lawetz, Y. Gaudette, F. Do, E. Scouten, L. Lagace, B. Simoneau, and M. Liuzzi. 2004. Polyadenylation-dependent screening assay for respiratory syncytial virus RNA transcriptase activity and identification of an inhibitor. Nucleic Acids Res 32:4758-67. 155. McDonald, T. P., A. R. Pitt, G. Brown, H. W. Rixon, and R. J. Sugrue. 2004. Evidence that the respiratory syncytial virus polymerase complex associates with lipid rafts in virus-infected cells: a proteomic analysis. Virology 330:147-57. 156. Mink, M. A., D. S. Stec, and P. L. Collins. 1991. Nucleotide sequences of the 3' leader and 5' trailer regions of human respiratory syncytial virus genomic RNA. Virology 185:615-24. 157. Monick, M. M., K. Cameron, J. Staber, L. S. Powers, T. O. Yarovinsky, J. G. Koland, and G. W. Hunninghake. 2005. Activation of the epidermal growth factor receptor by respiratory syncytial virus results in increased inflammation and delayed apoptosis. J Biol Chem 280:2147-58.

122

158. Morris JA, B. R., Savage RE. 1956. Recovery of cyopathic agent from chimpanzees with coryza. Proc Soc Exp Biol Med 92:544-550. 159. Murata, Y. 2009. Respiratory syncytial virus vaccine development. Clin Lab Med 29:725-39. 160. Murphy, B. R., G. A. Prince, L. A. Lawrence, K. D. Croen, and P. L. Collins. 1990. Detection of respiratory syncytial virus (RSV) infected cells by in situ hybridization in the lungs of cotton rats immunized with formalin- inactivated virus or purified RSV F and G glycoprotein subunit vaccine and challenged with RSV. Virus Res 16:153-62. 161. Murphy, B. R., A. V. Sotnikov, L. A. Lawrence, S. M. Banks, and G. A. Prince. 1990. Enhanced pulmonary histopathology is observed in cotton rats immunized with formalin-inactivated respiratory syncytial virus (RSV) or purified F glycoprotein and challenged with RSV 3-6 months after immunization. Vaccine 8:497-502. 162. Nakamura-Lopez, Y., N. Villegas-Sepulveda, R. E. Sarmiento-Silva, and B. Gomez. 2011. Intrinsic apoptotic pathway is subverted in mouse macrophages persistently infected by RSV. Virus Res. 163. Nicholson, K. G., T. McNally, M. Silverman, P. Simons, J. D. Stockton, and M. C. Zambon. 2006. Rates of hospitalisation for influenza, respiratory syncytial virus and human metapneumovirus among infants and young children. Vaccine 24:102-8. 164. Nishimura, K., H. Segawa, T. Goto, M. Morishita, A. Masago, H. Takahashi, Y. Ohmiya, T. Sakaguchi, M. Asada, T. Imamura, K. Shimotono, K. Takayama, T. Yoshida, and M. Nakanishi. 2007. Persistent and stable gene expression by a cytoplasmic RNA replicon based on a noncytopathic variant Sendai virus. J Biol Chem 282:27383- 91. 165. Null, D., Jr., B. Pollara, P. H. Dennehy, J. Steichen, P. J. Sanchez, L. B. Givner, D. Carlin, B. Landry, F. H. Top, Jr., and E. Connor. 2005. Safety and immunogenicity of palivizumab (Synagis) administered for two seasons. Pediatr Infect Dis J 24:1021-3. 166. Ogino, T., M. Kobayashi, M. Iwama, and K. Mizumoto. 2005. Sendai virus RNA-dependent RNA polymerase L protein catalyzes cap methylation of virus-specific mRNA. J Biol Chem 280:4429-35. 167. Olivo, P. D., P. L. Collins, M. E. Peeples, and S. Schlesinger. 1998. Detection and quantitation of human respiratory syncytial virus (RSV) using minigenome cDNA and a Sindbis virus replicon: a prototype assay for negative-strand RNA viruses. Virology 251:198-205. 168. Oomens, A. G., K. P. Bevis, and G. W. Wertz. 2006. The cytoplasmic tail of the human respiratory syncytial virus F protein plays critical roles in cellular localization of the F protein and infectious progeny production. J Virol 80:10465-77. 169. Oomens, A. G., A. G. Megaw, and G. W. Wertz. 2003. Infectivity of a human respiratory syncytial virus lacking the SH, G, and F proteins is efficiently mediated by the vesicular stomatitis virus G protein. J Virol 77:3785-98.

123

170. Oomens, A. G., and G. W. Wertz. 2004. The baculovirus GP64 protein mediates highly stable infectivity of a human respiratory syncytial virus lacking its homologous transmembrane glycoproteins. J Virol 78:124-35. 171. Oomens, A. G., and G. W. Wertz. 2004. trans-Complementation allows recovery of human respiratory syncytial viruses that are infectious but deficient in cell-to-cell transmission. J Virol 78:9064-72. 172. Openshaw, P. J., S. L. Clarke, and F. M. Record. 1992. Pulmonary eosinophilic response to respiratory syncytial virus infection in mice sensitized to the major surface glycoprotein G. Int Immunol 4:493-500. 173. P'Ringle C, R., P. V. Shirodaria, P. Cash, D. J. Chiswell, and P. Malloy. 1978. Initiation and maintenance of persistent infection by respiratory syncytial virus. J Virol 28:199-211. 174. Panuska, J. R., N. M. Cirino, F. Midulla, J. E. Despot, E. R. McFadden, Jr., and Y. T. Huang. 1990. Productive infection of isolated human alveolar macrophages by respiratory syncytial virus. J Clin Invest 86:113- 9. 175. Parks, G. D. 1994. Mapping of a region of the paramyxovirus L protein required for the formation of a stable complex with the viral phosphoprotein P. J Virol 68:4862-72. 176. Peeples, M., and S. Levine. 1981. Characteristics of a persistent respiratory syncytial virus infection in HeLa cells. Virology 113:141-9. 177. Perez, D. R., and R. O. Donis. 1998. The matrix 1 protein of influenza A virus inhibits the transcriptase activity of a model influenza reporter genome in vivo. Virology 249:52-61. 178. Perez, M., B. Garcia-Barreno, J. A. Melero, L. Carrasco, and R. Guinea. 1997. Membrane permeability changes induced in Escherichia coli by the SH protein of human respiratory syncytial virus. Virology 235:342-51. 179. Perrotta, A. T., and M. D. Been. 1991. A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature 350:434-6. 180. Piedra, P. A., S. G. Cron, A. Jewell, N. Hamblett, R. McBride, M. A. Palacio, R. Ginsberg, C. M. Oermann, and P. W. Hiatt. 2003. Immunogenicity of a new purified fusion protein vaccine to respiratory syncytial virus: a multi-center trial in children with cystic fibrosis. Vaccine 21:2448-60. 181. Poch, O., B. M. Blumberg, L. Bougueleret, and N. Tordo. 1990. Sequence comparison of five polymerases (L proteins) of unsegmented negative-strand RNA viruses: theoretical assignment of functional domains. J Gen Virol 71 ( Pt 5):1153-62. 182. Prince, G. A., F. Denamur, M. Deschamps, N. Garcon, J. P. Prieels, M. Slaoui, C. Thiriart, and D. D. Porter. 2001. Monophosphoryl lipid A adjuvant reverses a principal histologic parameter of formalin-inactivated respiratory syncytial virus vaccine-induced disease. Vaccine 19:2048-54.

124

183. Prince, G. A., V. G. Hemming, R. L. Horswood, and R. M. Chanock. 1985. Immunoprophylaxis and immunotherapy of respiratory syncytial virus infection in the cotton rat. Virus Res 3:193-206. 184. Prince, G. A., R. L. Horswood, and R. M. Chanock. 1985. Quantitative aspects of passive immunity to respiratory syncytial virus infection in infant cotton rats. J Virol 55:517-20. 185. Prince, G. A., A. B. Jenson, V. G. Hemming, B. R. Murphy, E. E. Walsh, R. L. Horswood, and R. M. Chanock. 1986. Enhancement of respiratory syncytial virus pulmonary pathology in cotton rats by prior intramuscular inoculation of formalin-inactiva ted virus. J Virol 57:721-8. 186. Pringle C, R., P. V. Shirodaria, P. Cash, D. J. Chiswell, and P. Malloy. 1978. Initiation and maintenance of persistent infection by respiratory syncytial virus. J Virol 28:199-211. 187. Pringle, C. R., A. H. Filipiuk, B. S. Robinson, P. J. Watt, P. Higgins, and D. A. Tyrrell. 1993. Immunogenicity and pathogenicity of a triple temperature-sensitive modified respiratory syncytial virus in adult volunteers. Vaccine 11:473-8. 188. Riedel, F., B. Oberdieck, H. J. Streckert, S. Philippou, T. Krusat, and W. Marek. 1997. Persistence of airway hyperresponsiveness and viral antigen following respiratory syncytial virus bronchiolitis in young guinea- pigs. Eur Respir J 10:639-45. 189. Rixon, H. W., G. Brown, J. Aitken, T. McDonald, S. Graham, and R. J. Sugrue. 2004. The small hydrophobic (SH) protein accumulates within lipid-raft structures of the Golgi complex during respiratory syncytial virus infection. J Gen Virol 85:1153-65. 190. Roberts, S. R., R. W. Compans, and G. W. Wertz. 1995. Respiratory syncytial virus matures at the apical surfaces of polarized epithelial cells. J Virol 69:2667-73. 191. Roberts, S. R., D. Lichtenstein, L. A. Ball, and G. W. Wertz. 1994. The membrane-associated and secreted forms of the respiratory syncytial virus attachment glycoprotein G are synthesized from alternative initiation codons. J Virol 68:4538-46. 192. Sarmiento, R. E., R. Tirado, and B. Gomez. 2002. Characteristics of a respiratory syncytial virus persistently infected macrophage-like culture. Virus Res 84:45-58. 193. Sastre, P., A. G. Oomens, and G. W. Wertz. 2007. The stability of human respiratory syncytial virus is enhanced by incorporation of the baculovirus GP64 protein. Vaccine 25. 194. Schmitt, A. P., G. P. Leser, D. L. Waning, and R. A. Lamb. 2002. Requirements for budding of paramyxovirus simian virus 5 virus-like particles. J Virol 76:3952-64. 195. Schwarze, J., D. R. O'Donnell, A. Rohwedder, and P. J. Openshaw. 2004. Latency and persistence of respiratory syncytial virus despite T cell immunity. Am J Respir Crit Care Med 169:801-5. 196. Seemungal, T., R. Harper-Owen, A. Bhowmik, I. Moric, G. Sanderson, S. Message, P. Maccallum, T. W. Meade, D. J. Jeffries, S. L. Johnston,

125

and J. A. Wedzicha. 2001. Respiratory viruses, symptoms, and inflammatory markers in acute exacerbations and stable chronic obstructive pulmonary disease. Am J Respir Crit Care Med 164:1618-23. 197. Shingai, M., M. Azuma, T. Ebihara, M. Sasai, K. Funami, M. Ayata, H. Ogura, H. Tsutsumi, M. Matsumoto, and T. Seya. 2008. Soluble G protein of respiratory syncytial virus inhibits Toll-like receptor 3/4-mediated IFN-beta induction. Int Immunol 20:1169-80. 198. Sidhu, M. S., J. P. Menonna, S. D. Cook, P. C. Dowling, and S. A. Udem. 1993. Canine distemper virus L gene: sequence and comparison with related viruses. Virology 193:50-65. 199. Sidwell, R. W., and D. L. Barnard. 2006. Respiratory syncytial virus infections: recent prospects for control. Antiviral Res 71:379-90. 200. Simonsen, L., and C. Viboud. 2005. Respiratory syncytial virus infection in elderly adults. N Engl J Med 353:422-3; author reply 422-3. 201. Smith, E. C., A. Popa, A. Chang, C. Masante, and R. E. Dutch. 2009. Viral entry mechanisms: the increasing diversity of paramyxovirus entry. FEBS J 276:7217-27. 202. Spann, K. M., K. C. Tran, B. Chi, R. L. Rabin, and P. L. Collins. 2004. Suppression of the induction of alpha, beta, and lambda interferons by the NS1 and NS2 proteins of human respiratory syncytial virus in human epithelial cells and macrophages [corrected]. J Virol 78:4363-9. 203. Spann, K. M., K. C. Tran, and P. L. Collins. 2005. Effects of nonstructural proteins NS1 and NS2 of human respiratory syncytial virus on interferon regulatory factor 3, NF-kappaB, and proinflammatory cytokines. J Virol 79:5353-62. 204. Stec, D. S., M. G. Hill, 3rd, and P. L. Collins. 1991. Sequence analysis of the polymerase L gene of human respiratory syncytial virus and predicted phylogeny of nonsegmented negative-strand viruses. Virology 183:273-87. 205. Stone, H. O., D. W. Kingsbury, and R. W. Darlington. 1972. Sendai virus-induced transcriptase from infected cells: polypeptides in the transcriptive complex. J Virol 10:1037-43. 206. Sudo, K., Y. Miyazaki, N. Kojima, M. Kobayashi, H. Suzuki, M. Shintani, and Y. Shimizu. 2005. YM-53403, a unique anti-respiratory syncytial virus agent with a novel mechanism of action. Antiviral Res 65:125-31. 207. Sumpter, R., Jr., Y. M. Loo, E. Foy, K. Li, M. Yoneyama, T. Fujita, S. M. Lemon, and M. Gale, Jr. 2005. Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J Virol 79:2689-99. 208. Suryanarayana, K., K. Baczko, V. ter Meulen, and R. R. Wagner. 1994. Transcription inhibition and other properties of matrix proteins expressed by M genes cloned from measles viruses and diseased human brain tissue. J Virol 68:1532-43.

126

209. Sutherland, K. A., P. L. Collins, and M. E. Peeples. 2001. Synergistic effects of gene-end signal mutations and the M2-1 protein on transcription termination by respiratory syncytial virus. Virology 288:295-307. 210. Swedan, S., A. Musiyenko, and S. Barik. 2009. Respiratory syncytial virus nonstructural proteins decrease levels of multiple members of the cellular interferon pathways. J Virol 83:9682-93. 211. Tanaka, S., Y. Yonemitsu, K. Yoshida, S. Okano, H. Kondo, M. Inoue, M. Hasegawa, K. Masumoto, S. Suita, T. Taguchi, and K. Sueishi. 2007. Impact of deletion of envelope-related genes of recombinant Sendai viruses on immune responses following pulmonary gene transfer of neonatal mice. Gene Ther 14:1017-28. 212. Tang, R. S., N. Nguyen, X. Cheng, and H. Jin. 2001. Requirement of cysteines and length of the human respiratory syncytial virus M2-1 protein for protein function and virus viability. J Virol 75:11328-35. 213. Tawar, R. G., S. Duquerroy, C. Vonrhein, P. F. Varela, L. Damier- Piolle, N. Castagne, K. MacLellan, H. Bedouelle, G. Bricogne, D. Bhella, J. F. Eleouet, and F. A. Rey. 2009. Crystal structure of a nucleocapsid-like nucleoprotein-RNA complex of respiratory syncytial virus. Science 326:1279-83. 214. Techaarpornkul, S., N. Barretto, and M. E. Peeples. 2001. Functional analysis of recombinant respiratory syncytial virus deletion mutants lacking the small hydrophobic and/or attachment glycoprotein gene. J Virol 75:6825-34. 215. Techaarpornkul, S., N. Barretto, and M. E. Peeples. 2001. Functional analysis of recombinant respiratory syncytial virus deletion mutants lacking the small hydrophobic and/or attachment glycoprotein gene. J Virol 75:6825-34. 216. Teng, M. N., and P. L. Collins. 1999. Altered growth characteristics of recombinant respiratory syncytial viruses which do not produce NS2 protein. J Virol 73:466-73. 217. Teng, M. N., and P. L. Collins. 1998. Identification of the respiratory syncytial virus proteins required for formation and passage of helper- dependent infectious particles. J Virol 72:5707-16. 218. Teng, M. N., S. S. Whitehead, A. Bermingham, M. St Claire, W. R. Elkins, B. R. Murphy, and P. L. Collins. 2000. Recombinant respiratory syncytial virus that does not express the NS1 or M2-2 protein is highly attenuated and immunogenic in chimpanzees. J Virol 74:9317-21. 219. Ternette, N., D. Stefanou, S. Kuate, K. Uberla, and T. Grunwald. 2007. Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps. Virol J 4:51. 220. Tirado, R., A. Ortega, R. E. Sarmiento, and B. Gomez. 2005. Interleukin-8 mRNA synthesis and protein secretion are continuously up- regulated by respiratory syncytial virus persistently infected cells. Cell Immunol 233:61-71.

127

221. Tripp, R. A., L. P. Jones, L. M. Haynes, H. Zheng, P. M. Murphy, and L. J. Anderson. 2001. CX3C chemokine mimicry by respiratory syncytial virus G glycoprotein. Nat Immunol 2:732-8. 222. Udem, S. A., and K. A. Cook. 1984. Isolation and characterization of measles virus intracellular nucleocapsid RNA. J Virol 49:57-65. 223. Ulloa, L., R. Serra, A. Asenjo, and N. Villanueva. 1998. Interactions between cellular actin and human respiratory syncytial virus (HRSV). Virus Res 53:13-25. 224. Valarcher, J. F., H. Bourhy, A. Lavenu, N. Bourges-Abella, M. Roth, O. Andreoletti, P. Ave, and F. Schelcher. 2001. Persistent infection of B lymphocytes by bovine respiratory syncytial virus. Virology 291:55-67. 225. Valdovinos, M. R., and B. Gomez. 2003. Establishment of respiratory syncytial virus persistence in cell lines: association with defective interfering particles. Intervirology 46:190-8. 226. Wagner, R. R., and Rose, J. K. . 1996. Rhabdoviridae: The viruses and their replication. . Fields Virology:1124-1135. 227. Walsh, E. E., and J. Hruska. 1983. Monoclonal antibodies to respiratory syncytial virus proteins: identification of the fusion protein. J Virol 47:171- 7. 228. Waris, M. E., C. Tsou, D. D. Erdman, S. R. Zaki, and L. J. Anderson. 1996. Respiratory synctial virus infection in BALB/c mice previously immunized with formalin-inactivated virus induces enhanced pulmonary inflammatory response with a predominant Th2-like cytokine pattern. J Virol 70:2852-60. 229. Whitehead, S. S., A. Bukreyev, M. N. Teng, C. Y. Firestone, M. St Claire, W. R. Elkins, P. L. Collins, and B. R. Murphy. 1999. Recombinant respiratory syncytial virus bearing a deletion of either the NS2 or SH gene is attenuated in chimpanzees. J Virol 73:3438-42. 230. Whitehead, S. S., K. Juhasz, C. Y. Firestone, P. L. Collins, and B. R. Murphy. 1998. Recombinant respiratory syncytial virus (RSV) bearing a set of mutations from cold-passaged RSV is attenuated in chimpanzees. J Virol 72:4467-71. 231. Wilkinson, T. M., G. C. Donaldson, S. L. Johnston, P. J. Openshaw, and J. A. Wedzicha. 2006. Respiratory syncytial virus, airway inflammation, and FEV1 decline in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 173:871-6. 232. Wright, P. F., R. A. Karron, R. B. Belshe, J. Thompson, J. E. Crowe, Jr., T. G. Boyce, L. L. Halburnt, G. W. Reed, S. S. Whitehead, E. L. Anderson, A. E. Wittek, R. Casey, M. Eichelberger, B. Thumar, V. B. Randolph, S. A. Udem, R. M. Chanock, and B. R. Murphy. 2000. Evaluation of a live, cold-passaged, temperature-sensitive, respiratory syncytial virus vaccine candidate in infancy. J Infect Dis 182:1331-42. 233. Wright, P. F., R. A. Karron, S. A. Madhi, J. J. Treanor, J. C. King, A. O'Shea, M. R. Ikizler, Y. Zhu, P. L. Collins, C. Cutland, V. B. Randolph, A. M. Deatly, J. G. Hackell, W. C. Gruber, and B. R. Murphy. 2006. The

128

interferon antagonist NS2 protein of respiratory syncytial virus is an important virulence determinant for humans. J Infect Dis 193:573-81. 234. Wu, H., D. S. Pfarr, S. Johnson, Y. A. Brewah, R. M. Woods, N. K. Patel, W. I. White, J. F. Young, and P. A. Kiener. 2007. Development of motavizumab, an ultra-potent antibody for the prevention of respiratory syncytial virus infection in the upper and lower respiratory tract. J Mol Biol 368:652-65. 235. Wyatt, L. S., B. Moss, and S. Rozenblatt. 1995. Replication-deficient vaccinia virus encoding bacteriophage T7 RNA polymerase for transient gene expression in mammalian cells. Virology 210:202-5. 236. Yoshida, T., M. Hamaguchi, H. Naruse, and Y. Nagai. 1982. Persistent infection by a temperature-sensitive mutant isolated from a Sendai virus (HVJ) carrier culture: its initiation and maintenance without aid of defective interfering particles. Virology 120:329-39. 237. Yoshizaki, M., T. Hironaka, H. Iwasaki, H. Ban, Y. Tokusumi, A. Iida, Y. Nagai, M. Hasegawa, and M. Inoue. 2006. Naked Sendai virus vector lacking all of the envelope-related genes: reduced cytopathogenicity and immunogenicity. J Gene Med 8:1151-9. 238. Zhang, L., A. Bukreyev, C. I. Thompson, B. Watson, M. E. Peeples, P. L. Collins, and R. J. Pickles. 2005. Infection of ciliated cells by human parainfluenza virus type 3 in an in vitro model of human airway epithelium. J Virol 79:1113-24. 239. Zhang, L., M. E. Peeples, R. C. Boucher, P. L. Collins, and R. J. Pickles. 2002. Respiratory syncytial virus infection of human airway epithelial cells is polarized, specific to ciliated cells, and without obvious cytopathology. J Virol 76:5654-66.

129