Single-Round Infectious Particle Production by DNA-Launched Infectious Clones of Bungowannah Pestivirus
Total Page：16
File Type：pdf, Size：1020Kb
viruses Brief Report Single-Round Infectious Particle Production by DNA-Launched Infectious Clones of Bungowannah Pestivirus Anja Dalmann 1, Kerstin Wernike 1 , Eric J. Snijder 2 , Nadia Oreshkova 2 , Ilona Reimann 1 and Martin Beer 1,* 1 Institute of Diagnostic Virology, Friedrich-Loeffler-Institut, 17493 Greifswald-Insel Riems, Germany; anja.dalmann@fli.de (A.D.); kerstin.wernike@fli.de (K.W.) 2 Molecular Virology Laboratory, Department of Medical Microbiology, Leiden University Medical Center, 2333 ZA Leiden, The Netherlands; [email protected] (E.J.S.); [email protected] (N.O.) * Correspondence: martin.beer@fli.de Received: 15 July 2020; Accepted: 31 July 2020; Published: 4 August 2020 Abstract: Reverse genetics systems are powerful tools for functional studies of viral genes or for vaccine development. Here, we established DNA-launched reverse genetics for the pestivirus Bungowannah virus (BuPV), where cDNA flanked by a hammerhead ribozyme sequence at the 50 end and the hepatitis delta ribozyme at the 30 end was placed under the control of the CMV RNA polymerase II promoter. Infectious recombinant BuPV could be rescued from pBuPV-DNA-transfected SK-6 cells and it had very similar growth characteristics to BuPV generated by conventional RNA-based reverse genetics and wild type BuPV. Subsequently, DNA-based ERNS deleted BuPV split genomes (pBuPVDERNS/ERNS)—co-expressing the ERNS protein from a separate synthetic CAG promoter—were constructed and characterized in vitro. Overall, DNA-launched BuPV genomes enable a rapid and cost-effective generation of recombinant BuPV and virus mutants, however, the protein expression efficiency of the DNA-launched systems after transfection is very low and needs further optimization in the future to allow the use e.g., as vaccine platform. Keywords: Bungowannah virus; flavivirus; reverse genetics; single round infectious particle 1. Introduction Bungowannah virus (BuPV) is an atypical pestivirus (species Pestivirus F) within the genus Pestivirus of the Flavivirdae family [1]. The virus was isolated for the first time in 2003 from a large Australian integrated pig farm during an outbreak of sudden death in young pigs, followed by an increase in stillbirth [2,3]. Although BuPV represents a potential threat to commercial pig farming, it has not yet been reported from any other region or country [4,5]. BuPV has a positive sense RNA genome that is approximately 12.6 kb in length. A single open reading frame, flanked by 50 and 30 non-translated regions, encodes a polyprotein, which is co- and post-translationally processed into structural proteins (C, ERNS, E1, E2) and non-structural proteins (NPRO, p7, NS2/NS3 (NS2, NS3), NS4A, NS4B, NS5A, NS5B) [2]. The envelope protein ERNS as well as the non-structural protein NPRO are unique to pestiviruses. Genomic and antigenic properties of BuPV, as well as its broad in vitro host cell tropism, indicate remarkable distance to previously described pestiviruses [6–9]. In general, pestiviruses infect host-specific cells of ruminant, porcine, or sheep origin. Classical swine fever virus (CSFV) can only infect porcine cells efficiently, while bovine viral diarrhea virus (BVDV) and border disease virus (BDV) have the potential to infect broader host spectra [10–14]. However, only BuPV could infect cell lines of African green monkey, bat, human, and mouse origin [9]. Viruses 2020, 12, 847; doi:10.3390/v12080847 www.mdpi.com/journal/viruses Viruses 2020, 12, 847 2 of 14 To study the special characteristics of BuPV in detail, a robust reverse genetics system (RGS) is essential. For other pestiviruses, such as CSFV or BVDV, many RGSs based on cDNA copies of the viral genome cloned into plasmid or bacterial artificial chromosome (BAC) vectors have already been reported [15–20]. Furthermore, recombinant pestiviruses were generated by full-length genome RT-PCR-based amplification and direct RNA generation from the amplicons without cloning steps [21]. All these techniques have in common the use of a bacteriophage T7 or SP6 RNA polymerase promoter for in vitro transcription to synthesize infectious positive strand RNA, which is subsequently transfected into cells to produce infectious virus progeny. Here, we report a first dual promoter DNA-launched BuPV RGS, which is based on a cDNA plasmid (pBuPV), with a cytomegalovirus (CMV) immediate-early promoter as well as the bacteriophage RNA polymerase T7 (T7) promoter upstream of the BuPV genome in a mammalian expression vector. For the generation of correct 50 and 30 ends, self-cleaving ribozyme sequences were inserted. This construct enables the transcription of the BuPV DNA by the CMV promoter in the nucleus and by the T7 promoter in the cytoplasm of polymerase expressing BSR cells (BSR-T7/5), where the latter serves as proof of principle to demonstrate that the modifications of the genome do not affect the transcription. This plasmid allows the rescue of infectious virus without in vitro RNA synthesis, and the virus can be passaged efficiently. We also established a split genome construct (pBuPVDERNS/ERNS) with a large deletion in the ERNS gene, preventing the efficient generation of virus progeny, and a synthetic CAG promoter followed by the genomic region encoding the BuPV-ERNS protein downstream the RNS T7 termination signal (T7term) for the expression of BuPV-E and the production of single-round infectious particles (SRIPs) via trans-complementation. The particles generated in this way should be able to pass through an additional replication cycle to infect surrounding cells, but are not expected to be capable of further propagation. 2. Materials and Methods 2.1. Cells and Viruses SK-6 cells (RIE262, Collection of Cell Lines in Veterinary Medicine (CCLV), Friedrich- Loeffler-Institut, Insel Riems, Germany) and BSR-T7/5 cells, constitutively expressing the T7 polymerase (RIE583, CCLV) [22], were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with RNA 10% fetal calf serum (FCS) at 37 ◦C and 5% CO2. rBuPV was generated after RNA transfection of SK-6 cells with in vitro transcribed RNA from the previously described synthetic cDNA clone pA/BV [9]. The virus was propagated in SK-6 cells and virus stocks were generated after three cell culture passages. 2.2. Plasmid Construction All plasmids were prepared by standard molecular biological methods and plasmid DNA was purified by the Qiagen Plasmid Midi kit (Qiagen, Hilden, Germany). The identity of the constructs was confirmed by Sanger sequencing using the Big Dye® Terminator v1.1 Cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and appropriate primers. Nucleotide sequences were read with an automatic sequencer (3130 Genetic Analyzer; Applied Biosystems, Foster City, CA, USA) and analyzed using Geneious software (version 10.2.3.). Primers used for cloning procedures are shown in Table1. Viruses 2020, 12, 847 3 of 14 Table 1. Primer sequences for plasmid construction. Construct Primer Sequence 50-30 pBV_opt Ph_Donor_C-Erns_F GCCTGCCTATTGGTCGTGCCCGTGGGCTCCACCAACGTGACACAATG Ph_Donor_Erns_R TCACCCCTAAGTCTGCATCGTATCTGCATGTGACTGCGCACTC Ph_Donor_Erns_F GTTGACGGTTACACCGAGGTGGTGGAGAAGGCCAGGTCAAGTGG Bungo_2534R CGCTAATGCGTACATGAATTC Bungo_Npro_Mut_Donor_F CTTTGTACAAACCAAGAGAGATGTGAGGGATCCAAGTGTGTA Bungo_1079R GTGGCATCTGGTGGTCTAG Bungo_Donor_IV_F GGCACTTGTATTGACAAAGAGGGTAGCGTGCAATGCTACATAGGGGA Bungo_Donor_IV_R_new TCTTTAGTTCCCTCTTCGGCGCGTACTAAACCGACGAAGTAGACCAC Bungo_Donor_V_F GCCTACACACACCCTGGAGGTGTAAGCAGTGTGATGCATGTCACCGC Bungo_6186_R CACCGAACCTATGTATTTTTGACATCACTGCCAACTGTTC Bungo_Donor_VI_F ATCACCAAATCCAACAAATTCTCGAGGGTGGGAAAGAATATGTCGGCCAAGCCTA Bungo_Donor_VI_R_new GGACCCCCCATAGACCGTATTTCTTGATGTCACCGGCATGCTCTTGCAAGTATTC Bungo_Donor_VII_F GGCCAGAAAAATTGCCAGTAGTAAGGGCCCAGACCAGTACCAAAG Bungo_Donor_VII_R CTGGTTGACCACTTCCCCTTTGTCCTTCTCTTATGTAGACGTTTC Bungo_Donor_VIII_F GTAGATGATTGGATGGAAGGAGATTATGTAGAAGAAAAAAGACC Bungo_Donor_VIII_R GGCCCCTTGATCGCAAAGGCTTCGCCAAAACTTTTCTCAGTTATC Bungo_Donor_IX_F GGTCAACCAGACACTAGCGCTGGAAATAGTATGTTGAATGTACT Bungo_Donor_IX_R GACAAGCAGGCATATTCTTCGTACGAGGGGGTTCCAAGAATAC pBuPV Bungo_LLHR_F CGTCGTTATACCTGATGAGTCCGTGAGGACGAAACCCGGAGTCCCGGGTCGTATAACGACAGTAGTTCAA Bungo_LLHR_R TTCGGATGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCAGGGCTTTTTGGAACTGTGC pHaHd_F TGGGTCGGCATGGCATCTCC pHaHd_R GACCCGGGACTCCGGGTTTCGTCCTCACGGACTCATCAGGTATAACGACGACTAGCCAGCTTG pBuPVDERNS Bungo_dERNS_F CATCTAGCAGCAGACTATGAAAGTAAGATTGAAAACACCAAGA Bungo_2164R CATCACGAAGTCCCTGTTGTC Viruses 2020, 12, 847 4 of 14 The infectious clone pBuPV, the basis for DNA-launched BuPV, was constructed by multiple cloning steps. In a first step, donor splice sites, that were detected in the BuPV genome with a confidence >0.65 using the NetGene2 Server (http://www.cbs.dtu.dk/services/NetGene2[ 23,24]; Table S1), were mutated in the full-length clone “pA/BV.” For this, fusion PCR was applied, which is a restriction-free cloning method [7], using the Phusion® High-Fidelity PCR kit (New England Biolabs, Ipswich, MA, USA) and the primers Ph_Donor_C-Erns_F, Ph_Donor_Erns_R, Ph_Donor_Erns_F, Bungo_2534R, Bungo_Npro_Mut_Donor_F, Bungo_1079R, Bungo_Donor_IV_F, Bungo_Donor_IV_R_new, Bungo_Donor_V_F, Bungo_6186_R, Bungo_Donor_VI_F, Bungo_Donor_VI_R_new, Bungo_Donor_VII_F, Bungo_Donor_VII_R, Bungo_Donor_VIII_F, Bungo_Donor_VIII_R, Bungo_Donor_IX_F, and Bungo_Donor_IX_R (biomers.net GmbH, Ulm Germany), resulting in plasmid “pBV_opt.” For pBuPV generation, the well characterized plasmid pHaHd was used, which contains in addition to the CMV and T7 promoters, ribozyme sequences for the generation of correct genome