TOWARDS THE IDENTIFICATION OF
NOVEL INTERFERON-ALPHA
INDUCED ANTI-HEPATITIS C VIRUS
EFFECTORS
by
Filip BEBEK
Submitted for the degree of Doctor of Philosophy (Ph.D.)
School of Biotechnology and Biomolecular Sciences
UNSW, Australia
APRIL, 2012
ii
Author: Filip Bebek ([email protected], [email protected])
Supervisor: Associate Prof Laurent P. Rivory ([email protected])
Co-supervisor: Associate Prof Peter A White ([email protected])
Submitted for the degree of Doctor of Philosophy (PhD), April, 2012
The School of Biotechnology and Biomolecular Sciences (BABS) The University of New South Wales (UNSW), Sydney, NSW, 2052, Australia
Previously in association with Johnson and Johnson Research Pty. Ltd. (JJR) Level 4, Biomedical Building, 1 Central Ave., Australian Technology Park, Eveleigh, NSW, 1430, Australia
iii
Originality Statement
‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at
UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’
Filip Bebek …………………………………….
Date 27-Nov-2012…………………….
iv
Copyright Statement
‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the
University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.
I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only).
I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'
Signed ......
Date 27-Nov-2012......
Authenticity Statement
‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’
Signed ......
Date 27-Nov-2012………......
v
Abstract
Hepatitis C virus (HCV) infection is primarily treated with regimens that contain pegylated interferon alpha (PEG-IFN-!). IFN induces antiviral effects through the up-regulation of many interferon-stimulated genes (ISGs). While many ISGs have previously been identified, limitations of screening approaches employed to date raise the possibility that other anti-HCV ISGs are yet to be discovered. In the present study, a novel screening strategy combined suppression subtractive hybridisation (SSH) and recombinant Dicer generated siRNA pools to screen for anti-HCV ISGs - utilising a replicon model of HCV which is sensitive to IFN-!, and in which the impact on HCV replication can be readily assessed through the incorporation of a bicistronic luciferase reporter gene. This approach does not require a priori gene sequence data, and thereby opens up the possibility of detecting the anti-HCV activity of novel genes, functional polymorphisms and splice variants. SSH and its related technique mirror orientation selection (MOS) were employed to isolate differentially expressed genes from IFN-! treated Huh-7 cells. The isolated SSH and MOS genes were cross-referenced with microarray data to identify likely mediators of the anti- HCV replicon effects of IFN-! treatment. Subsequently, SSH/MOS cDNA clones were used to produce complementary dsRNA, which was digested with recombinant Dicer to generate target-specific siRNA pools, that were then screened for their ability to suppress the effects of IFN (using luciferase activity as a measure of replicon RNA copy number) following transfection into the stable HCV-replicon cell line (Huh-7 Luc). The list of positive screen hits included ZC3HAV1 and IFIT1. Further validation experiments showed the long isoform of ZC3HAV1 to be a new bona fide anti-replicon ISG. Thus, this study demonstrates the utility of unbiased screening approaches in better understanding how IFN-! limits HCV replication.
vi
Acknowledgements
First and foremost, I would like to thank my supervisor A/Prof Laurent P. Rivory whose guidance, understanding, assistance and determination to stick with this project were always present and supplied in generous quantities. I would also like to sincerely thank all of my past colleagues at JJR for their moral and scientific support. Notably, I would like to acknowledge Dr Toby Passioura for his unwavering patience in answering my many questions, and for his assistance in editing this thesis. Additionally I would like to extend my gratitude to Dr Gaurav Gupta for his assistance in the editing this thesis. I would also like to thank A/Prof Peter White, and the remainder of EMI group at UNSW – Dr
Rowena Bull, J-S Eden, Sean Pham and Auda Eltahla – for both your acceptance and support.
To my family, I want to say thank you for the never ending support, understanding, care and prayers that have all contributed to help me realize my dreams. Additionally, I want to expresses my very sincere thanks to all of my extended family and friends who have been constant sources of encouragement and support throughout my PhD.
Finally, I would like to gratefully acknowledge the financial support received from both the Australian Postgraduate Award and from Johnson and Johnson
Research Pty Ltd throughout the duration of my postgraduate studies.
vii
Table of Contents
Originality Statement...... iii! Copyright Statement ...... iv! Authenticity Statement...... iv! Abstract...... v! Acknowledgements...... vi! Table of Contents...... vii! List of Tables...... xi! List of Figures and Illustrations ...... xii! List of Symbols, Abbreviations and Nomenclature ...... xiii!
CHAPTER 1 – GENERAL INTRODUCTION...... 1! Hepatitis C Virus ...... 1! Structure and Virology...... 1! HCV Therapy...... 2! (i) Interferon Alpha...... 2! (ii) Ribavirin ...... 3! (iii) Directly Acting Anti-virals – First Generation Protease Inhibitors ...... 3! (iv) Future Therapy Directions...... 4! HCV Molecular Biology ...... 4! In Vitro Models ...... 5! The Interferons...... 10! The Type I IFN Signalling Cascade...... 11! IFN-! and HCV Infection ...... 13! ISG Identification...... 14! RNA-Specific Adenosine Deaminase (ADAR) ...... 16! Eukaryotic Translation Initiation Factor 2-alpha Kinase 2 (EIF2AK2) ...... 16! Interferon-Inducible Guanylate Binding Protein 1 (GBP1)...... 17! Interferon-Induced Tetratricopeptide (IFIT) Family members – IFIT1 and IFITM1 ...... 18! Interferon-Induced Protein with Tetratricopeptide Repeats 1 (IFIT1) ....18! Interferon Induced Transmembrane Protein 1 (IFITM1)...... 19! The FAM14 Family Members – IFI6 and IFI27...... 20! Interferon Alpha-Inducible Protein 6 (IFI6) ...... 20! Interferon Alpha-Inducible Protein 27 (IFI27) ...... 21! Interferon Stimulated Exonuclease Gene 20kDa (ISG20)...... 21! The Oligoadenylate Synthetase (OAS) Family – OAS2 and OASL ...... 22! 2'-5'-Oligoadenylate Synthetase 2, 69/71kDa (OAS2) ...... 22! 2'-5'-Oligoadenylate Synthetase-like (OASL) ...... 23! Radical S-Adenosyl Methionine Domain Containing 2 (RSAD2) ...... 24! Anti-HCV ISGs – Is There More To The Story? ...... 25! Investigation of Intracellular Gene Changes ...... 27! Suppression Subtractive Hybridisation...... 28! SSH – An Introduction...... 28! SSH Methodology ...... 29! Limitations of the SSH approach...... 32! Mirror Orientation Selection...... 35!
viii
MOS Methodology...... 35! RNA Interference ...... 37! RNAi – An Introduction...... 37! Individual siRNAs ...... 38! Genome-Wide siRNA Libraries ...... 39! Dicer Generated siRNA (d-siRNAs) ...... 41! Project Aim and Study Design ...... 42!
CHAPTER 2: GENERAL MATERIALS AND METHODS...... 44! DNA Manipulations ...... 44! Restriction Enzyme Digestion ...... 44! Agarose Gel Electrophoresis...... 44! DNA Purification and Concentration...... 45! Vector Ligation ...... 45! Transformation of E. coli ...... 45! Colony Screening and Plasmid DNA Extraction...... 46! Cell Culture ...... 46! Cell Maintenance...... 47! Thawing of Cells...... 47! Freezing of Cells ...... 48! Cell Viability and Luciferase Activity...... 48! Statistical Analysis ...... 48! Buffers and Solutions ...... 49!
CHAPTER 3 – SUPPRESSION SUBTRACTIVE HYBRIDISATION ...... 50! Introduction ...... 50! Materials and Methods...... 52! Validation of IFN-! Mediated Induction of ISRE Activation...... 52! Subtracted Library Starting Material...... 53! cDNA Synthesis ...... 53! Suppression Subtractive Hybridisation – PCR-select cDNA Subtraction....54! RsaI Digestion and Purification ...... 55! Adapter Ligation ...... 55! Adapter Ligation Efficiency...... 56! Hybridisation of ‘Tester’ and ‘Driver’ Populations...... 56! PCR Amplification of Differentially Expressed Transcripts...... 57! PCR Analysis of Subtraction Efficiency...... 57! Subtracted Library Cloning and Purification ...... 58! Sequencing ...... 58! Results ...... 59! Validation of ISRE Activation by IFN-! Treatment of Huh-7 Cells ...... 59! Suppression Subtractive Hybridisation...... 60! Analysis of Adapter Ligation...... 60! Analysis of Subtraction Efficiency ...... 62! A Subtracted cDNA Library ...... 63! Subtracted Library Clone Identification ...... 65! Discussion...... 69!
CHAPTER 4 – MIRROR ORIENTATION SELECTION...... 74!
ix
Introduction ...... 74! Materials and Methods...... 76! Subtracted Library Starting Material...... 76! Mirror Orientation Selection...... 77! Primary PCR-1 and PCR-2 ...... 77! Secondary PCR and Purification...... 78! XmaI Digestion ...... 78! MOS Hybridisation ...... 79! MOS PCR Amplification ...... 79! Subtracted Library Cloning and Purification ...... 79! Sequencing ...... 80! Results ...... 80! Construction of the MOS Subtracted cDNA Library ...... 81! Generation of a MOS Subtracted Clone Library...... 81! A Combined SSH and MOS Subtracted Library...... 88! Discussion...... 88!
CHAPTER 5 – CONFIRMATION OF DIFFERENTIAL GENE ISOLATION...... 100! Introduction ...... 100! Materials and Methods...... 101! RNA Isolation ...... 101! Microarray Hybridization...... 102! Quantitative Real-time PCR Analysis...... 103! Microarray Data Accession Number...... 104! Results ...... 104! Microarray Analysis of IFN-! Treated Huh-7 Cells...... 105! RT-PCR of IFN-! Treated Huh-7 Cells ...... 105! Correlation Analysis ...... 105! Identification of ISGs Within the SSH and MOS Libraries...... 106! Discussion...... 107!
CHAPTER 6 – VALIDATION OF ANTI-HCV REPLICON ACTIVITY...... 114! Introduction ...... 114! Materials and Methods...... 116! d-siRNA Generation ...... 116! Cell Tansfection...... 118! Results ...... 118! Assay Development ...... 118! A.! Identification of Optimal Cell Density and IFN-!2b Dose...... 118! B.! Control Dicer d-siRNA Pool Development...... 119! C.! Identification of Optimal d-siRNA Transfection Conditions ...... 121! Screening of Dicer Generated ISG d-siRNAs ...... 123! Discussion...... 125!
CHAPTER 7 – ANTI-HCV REPLICON ACTIVITY OF ZC3HAV1...... 129! Introduction ...... 129! Materials & Methods ...... 131! Cell Transfection and Treatment ...... 131! Quantitative Real-Time PCR (qRT-PCR) ...... 132!
x
Synthetic siRNA Design and Generation ...... 133! Plasmid Construction ...... 133! Sequencing ...... 135! Western Blot Analysis ...... 136! Results ...... 137! Verification of ZC3HAV1 Induction Following IFN-! Treatment...... 137! Validation of ZC3HAV1 IFN-! Induced Anti-HCV Replicon Activity...... 138! Isoform Specific Action...... 138! Investigations of ZC3HAV1 Anti-HCV Replicon Activity...... 140! Discussion...... 144!
CHAPTER 8 – GENERAL CONCLUSION ...... 149! Results Summary...... 149! Project Limitations...... 150! Relevance to Previous Investigations ...... 152! Future Directions...... 155! Concluding Remarks...... 155!
REFERENCES...... 157!
xi
List of Tables
Table 3.1 Comparison of various techniques used for detecting differential gene expression...... 51!
Table 3.2 Genes represented by partial length clones identified within an IFN-! treated Huh-7 cell subtracted SSH library...... 66!
Table 4.1 Genes represented by partial length clones identified within an IFN-! treated Huh-7 cell subtracted MOS library...... 83!
Table 4.2 All genes represented by partial length clones identified within IFN-! treated Huh-7 cell subtracted SSH and MOS libraries...... 89!
Table 5.1 Differentially expressed genes represented within subtracted SSH and MOS clone libraries...... 108!
Table 7.1 Synthetic siRNAs used for validation of dicer generated d-siRNA results...... 134!
Table 7.2 Oligonucleotides used in sequencing reactions for verification of HA-tagged ZC3HAV1 long and short isoform over-expression constructs...... 136!
xii
List of Figures and Illustrations
Figure 1.1 Basic schematic representation of HCV and HCV replicon genome organisation...... 8!
Figure 1.2 Activation of classical JAK-STAT signalling by IFN-!...... 12!
Figure 1.3 Schematic representation of the Suppression Subtractive Hybridisation procedure...... 30!
Figure 1.4 Schematic representation of the Mirror Orientation Selection method...... 36!
Figure 1.5 A schematic representation of ‘dicer’ generated d-siRNA pools. .... 43!
Figure 3.1 Induction of ISRE activity following treatment with IFN-!...... 61!
Figure 3.2 Analysis of adapter ligation efficiency...... 61!
Figure 3.3 Analysis of SSH subtraction efficiency...... 63!
Figure 3.4 Construction of a subtracted cDNA library...... 64!
Figure 4.1 Construction of a MOS subtracted cDNA library...... 82!
Figure 5.1 Spearman correlation of RT-PCR and Microarray data...... 107!
Figure 6.1 Optimisation of cell seeding and treatment parameters for validation of ISG anti-replicon activity assay...... 120!
Figure 6.2 Optimisation of dicer generated siRNA transfection...... 122!
Figure 6.3 Identification of potential anti-HCV replicon ISGs from high priority clones identified within SSH and MOS subtracted libraries...... 124!
Figure 7.1 Validation of IFN-! induced anti-HCV replicon activity mediated by ZC3HAV1...... 139!
Figure 7.2 Identification of the contribution made by individual ZC3HAV1 isoforms in mediating the anti-HCV replicon activity of IFN-! treatment. 141!
Figure 7.3 Investigation of ZC3HAV1 isoform anti-HCV replicon activity...... 143!
xiii
List of Symbols, Abbreviations and Nomenclature
Symbol Definition ACTB Actin, Beta Ad1 SSH Adapter 1 AD2R SSH Adapter 2R ADAR RNA-specific Adenosine Deaminase ADP Adenosine Diphosphate AGRF Australian Genome Research Facility ALB Albumin ALB-uPA Albumin Urokinase Plasminogen Activator ANOVA Analysis of Variance APOBEC3G Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3G B2M Beta-2-macroglobulin BHK-21 Baby Hamster Kidney Cells BLAST Basic Local Alignment Tool BOC Boceprevir bp Base Pair BSA Bovine Serum Albumin BST2 Bone Marrow Stromal Cell Antigen 2 C HCV Core Protein cDNA Complementary DNA Con-1 Consensus Genome 1 cRNA Complementary RNA d-siRNA Double-Stranded siRNA DAA Directly Acting Antivirals DAZLE Differential Analysis of Library Expression DD Differential Display DHX30 DEAH (Asp-Glu-Ala-His) Box Polypeptide 30 DMEM Dulbecco's Modified Eagle Medium DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid dNTPs Deoxynucleotide Triphosphates ds cDNA Double-stranded cDNA dsRNA Double-stranded RNA dT (2'-deoxy) Thymidine E1 HCV envelope protein 1 E2 HCV envelope protein 2 EDS Enzymatic Degradation Subtraction EDTA Ethylenediaminetetraacetic Acid eIF2 Eukaryotic Initiation Factor 2 EIF2AK2 Eukaryotic Translation Initiation Factor 2-alpha Kinase 2 eIF3 Eukaryotic Initiation Factor 3 EMCV Encephalomyocarditis Virus EST Expressed Sequence Tag FBS Fetal Bovine Serum Ff-Luc Firefly Luciferase FGB Fibrinogen Beta Chain FGG Fibrinogen Gamma Chain FTL Ferritin, Light Polypeptide
xiv
GAPDH Glyceraldehyde-3-phosphate Dehydrogenase GBP1 Interferon-inducible Guanylate Binding Protein 1 GFP Green Fluorescent Protein GTPase Guanosine Triphosphatase
H2O Water HA Hemagglutinin HCV Hepatitis C Virus HCVcc Cell Culture Derived HCV HCVpp HCV Pseudo-Particles HEK-293 Human Embryonic Kidney 293 Cells HeLa cells Human Cervical Cancer Cells (taken from Henrietta Lacks) HEPES 4-(2-hydroxyethyl)-1-piperzineethanesulfonic Acid HG Human Genome HIV Human Immunodeficiency Virus HRP Horseradish Peroxidase Huh-7 Human Hepatocellular Carcinoma Cells HUH-7 cells Bearing a Genotype 1b HCV Subgenomic Replicon with Huh-7 Luc Firefly Luciferase Reporter Gene IFI27 Interferon Alpha-Inducible Protein 27 IFI6 Interferon Alpha-Inducible Protein 6 IFIT1 Interferon-induced Protein with Tetratricopeptide Repeats 1 IFITM1 Interferon Induced Transmembrane Protein 1 IFN Interferon IFN-! Interferon-alpha IFN-" Interferon-beta IFN-# Interferon-epsilon IFN-$ Interferon-kappa IFN-% Interferon-omega IFN-& Interferon-gamma IFN-' Interferon-lambda IFNAR1 Interferon (alpha, beta and omega) Receptor 1 IFNAR2 Interferon (alpha, beta and omega) Receptor 2 IgG Immunoglobulin G IL-28A Interleukin-28A IL-28B Interleukin-28B IL-29 Interleukin-29 IRES Internal Ribosome Entry Site IRF3 Interferon Regulatory Factor 3 IRF9 Interferon Regulatory Factor 9 ISG Interferon Stimulated Gene ISG15 ISG15 Ubiquitin-like Modifier ISG20 Interferon-Stimulated Gene 20kDa ISGF-3 Interferon-Stimulated Gene Factor-3 ISRE Interferon-Stimulated Response Element IU Intensity Units IVT In Vitro Transcription JAK Janus Activated Kinase JAK1 Janus activated kinase 1 kb Kilo Base kDa Kilo Dalton LB Luria-Bertani LCS Linker Capture Subtraction
xv
LD-PCR Long Distance PCR MCS Multiple Cloning Site MEF Mouse Embryonic Fibroblast miRNA Micro RNA MLV Murine Leukemia Virus MMLV Moloney Murine Leukemia Virus MOS Mirror Orientation Selection MOV10 Mov10, Moloney Leukemia Virus 10, Homolog (mouse) mRNA Messenger RNA NCBI National Center for Biotechnology Information NEO Neomycin Phosphotransferase NS HCV Non-structural Protein NS2 HCV Non-structural Protein 2 NS3 HCV Non-structural Protein 3 NS4A HCV Non-structural Protein 4A NS4B HCV Non-structural Protein 4B NS5A HCV Non-structural Protein 5A NS5B HCV Non-structural Protein 5B NTP Nucleotide Triphosphate OAS Oligoadenylate Synthetase OAS2 2'-5'-Oligoadenylate Synthetase 2, 69/71kDa OASL 2'-5'-Oligoadenylate Synthetase-like ORF Open Reading Frame p7 HCV Integral Membrane Protein PARP Poly(ADP-ribose) Polymerase PBS Phosphate Buffered Saline PBS-T PBS-Tween PCR Polymerase Chain Reaction
PEG-IFN-a2a Pegylated Interferon-alpha 2a
PEG-IFN-!2b Pegylated Interferon-alpha 2b PKR Protein Kinase R PLSCR1 Phospholipid Scramblase 1 qRT-PCR Quantitative RT-PCR RBV Ribavirin RDX Radixin RefSeq Reference Sequence RIG-I Retinoic Acid Inducible Gene 1 RISC RNA-Induced Silencing Complex RNA Ribonucleic Acid RNAi RNA Interference RNase Ribonuclease RNase L Ribonuclease L RPL13A Ribosomal Protein L13a rRNA Ribosomal RNA RSAD2 Radical S-Adenosyl Methionine Domain Containing 2 RT-PCR Real-Time PCR SAGE Serial Analysis of Gene Expression SCID Severe Combined Immunodeficiency Disorder SDS Sodium Dodecyl Sulfate SFV Semliki Forest Virus shRNA Short Hairpin RNA siCNT3 Irrelevant Control siRNA
xvi siIRF9 IRF9 Targeting siRNA SINV Sindbis Virus siRNA Small Interfering RNA SSH Suppression Subtractive Hybridization STAT Signal Transducer and Activator of Transcription STAT-C Specifically Targeted Anti-Viral Therapy for HCV STAT1 Signal Transducer and Activator of Transcription 1 STAT2 Signal Transducer and Activator of Transcription 2 SV40 Simian Virus 40 SVR Sustained Virological Response TPR Tetratricopeptide Repeat TPV Telaprevir TYK2 Tyrosine Kinase 2 UBI Ubiquitin USP18 Ubiquitin Specific Peptidase 18 UTR Untranslated Region VAP-A Vesicle-Associated Membrane Protein-Associated Protein, Subtype A VSV Vesicular Stomatitis Virus Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase Activation YWHAZ Protein, Zeta Polypeptide ZC3HAV1 Zinc Finger CCCH-type, Antiviral 1
1
CHAPTER 1 – GENERAL INTRODUCTION
Hepatitis C Virus
The Hepatitis C virus (HCV) first characterized in 1989, has become a significant worldwide health problem, with the World Health Organization estimating that approximately 130–170 million people worldwide are persistently infected with HCV (30, 48, 139). With no vaccine currently available that prevents HCV infection, the majority of infections are asymptomatic and as such diagnosis often occurs either by chance, or at a stage when chronic infection is already established (34, 101). Chronic HCV infection has significant morbidity and mortality as a result of liver failure, cirrhosis, hepatocellular carcinoma and other sequelae (138, 179, 198).
Structure and Virology
HCV is a hepatotropic Flavivirus, belonging to the Hepacivirus genus (191).
HCV exists as a single stranded, enveloped, positive-sense RNA virus of approximately 9.6Kb (9). The genome of HCV contains an open reading frame
(ORF) that encodes a polyprotein precursor of about 3010 amino acids, and contains conserved short untranslated regions (UTRs) at each end of the viral
RNA that are required for replication and translation (194). The HCV ORF is co- and post-translationally cleaved by both viral and host proteases into the structural proteins (core protein C, envelope glycoproteins E1 and E2), an integral membrane protein (p7), and the non-structural (NS) proteins (NS2,
NS3, NS4A, NS4B, NS5A and NS5B) (see Figure 1.1(A) below) (186).
2
Naturally occurring variants of HCV are classified into seven major genotypes, numbered 1 to 7 which differ in their nucleotide sequence by 31-33% (131).
Furthermore, within an HCV genotype, several subtypes (a, b, c, etc.) can be defined that differ in their nucleotide sequence by 20-25% (131). Despite the observed sequence diversity, HCV genome organization, replication cycle and an ability to establish persistent infection are common to all genotypes (191).
HCV Therapy
The current standard of care for patients suffering from chronic HCV infection relies on the antiviral activity of interferon alpha (IFN-!), that is either given alone or in combination with the nucleoside analogue ribavirin (RBV). This treatment regime has been shown to result in a sustained virological response
(SVR) and elimination of the virus in about 40% of patients persistently infected with the genotype 1 and 4 viruses (the most prevalent genotypes present in industrialized countries), whilst an SVR of approximately 80% can be achieved in patients persistently infected with genotype 2 or 3 viruses (9, 92, 97, 194,
223). The lack of IFN-! based treatment efficacy in a number of patients, and the frequent occurrence of side effects has primarily motivated innovations in the development of specifically targeted antiviral therapy for HCV (STAT-C), with two directly acting antivirals (DAA) having been approved for use in Europe and the United States (4).
(i) Interferon Alpha
IFN-! is a major component of the host innate immune response to viral infections (206). The biological activity of IFN-! therapy is mediated through the
3 induction of intracellular antiviral proteins, known as the interferon stimulated genes (ISGs) (55). IFN-! types in clinical use for HCV treatment include pegylated interferon-!2a (PEG-IFN-!2a) or -2b (PEG-IFN-!2b) (200).
(ii) Ribavirin
RBV is a guanosine analogue with broad antiviral activity, with multiple mechanisms proposed for its activity against HCV (229). Whilst RBV monotherapy has limited anti-HCV activity, SVR rates are significantly improved when it is combined with IFN-! (77).
(iii) Directly Acting Anti-virals – First Generation Protease Inhibitors
With HCV encoding at least four enzymes that are required for virus replication
(NS2/3 autoprotease; NS3 helicase; NS3/4A serine protease; NS5B RNA- dependent RNA polymerase), focus in the development of STAT-C inhibitors has been on these steps (36, 125, 230). Two NS3/4A protease inhibitors, telaprevir (TPV) and boceprevir (BOC), have recently been approved for use in combination with PEG-IFN-!2A/B and RBV for the treatment of genotype 1 chronic HCV (4). TPV and BOC work by directly and specifically inhibiting the
HCV N3/4A serine protease, thereby preventing cleavage of the HCV polyprotein and halting viral replication (180).
Whilst TPV and BOC have high anti-viral efficacy, producing potent antiviral effects when administered as a monotherapy, there exist several limitations in their use, with the primary concern arising from the selection of protease
4 inhibitor resistant HCV variants (a feature that arises from the error prone HCV
RNA-dependent RNA polymerase) (4, 77).
(iv) Future Therapy Directions
In addition to protease inhibitors, numerous other agents (nucleoside, non- nucleoside, and nucleotide RNA polymerase inhibitors, p7 inhibitors, entry inhibitors, and Toll-like receptor 7 agonists) targeting HCV are in the development stage (36). Additionally, preliminary results examining DAA combinations have shown increased antiviral efficacy, reduced resistance and a good safety profile, with some novel therapeutics demonstrating antiviral activity against a number of different HCV genotypes (4). Whilst there has been a concerted effort made to reduce the reliance of IFN-! based therapies in the treatment of HCV infection, the results of studies conducted using novel therapeutic compounds have so far indicated that PEG-IFN!2a/b and ribavirin will likely remain backbones of effective HCV treatment therapies (200).
HCV Molecular Biology
Although some information regarding HCV protein structure and function had been obtained by using of a variety of cell culture and in vitro expression systems, since its discovery in 1989, research on HCV had been, for many years, hampered by a restricted host range and the lack of appropriate cell culture (in vitro) and animal (in vivo) models (86, 223).
Initially, the only way to study HCV infection was through the experimental infection of chimpanzees, observation of infected patients and through
5 comparison to other related (Flaviviridae family member) viruses (194).
Chimpanzees, whilst being the only animals susceptible to HCV infection, do not respond to HCV infection in the same way as humans (194). More recently, the transplantation of normal human hepatocytes into severe combined immunodeficiency disorder (SCID) mice carrying an albumin urokinase plasminogen activator (Alb-uPA) resulted in the development of the only small animal model capable of supporting HCV infection (161, 162, 246). However, this model has proven to be difficult to generate, and permits investigations to be conducted only during a restricted time frame (86).
Conversely, the concerted effort of a number of laboratories enabled the development of models that permit the replication and growth of HCV in cell culture conditions – namely the HCV Replicon, HCVpp and HCVcc systems
(see below). The development of such models has provided valuable insights in the natural history of acute and chronic HCV infection, viral kinetics and host responses including innate, humoral, and adaptive immune responses (86).
Currently, HCV cell culture systems are primarily restricted to one cell type, the human hepatoma cell line, Huh-7, and its derived cell lines (86, 171).
In Vitro Models
(i) The HCV Replicon System
An important milestone in HCV research was the development of the HCV replicon system by Lohmann et al. (153). For the first time, researchers were able to examine HCV RNA replication in the human Huh-7 cell line (9, 86, 194,
223).
6
The HCV replicons are self-amplifying, genetically engineered HCV genomes, with the prototype subgenomic replicon based on the HCV genotype 1b of a consensus genome 1 (con-1) clone, that had been isolated from a patient with chronic HCV infection (153). The HCV replicons are typically composed of selectable, bicistronic RNA, with the first cistron containing the HCV 5’ nontranslated region (NTR) directing translation of the gene encoding neomycin phosphotransferase; and the second cistron containing the internal ribosome entry site (IRES) of the encephalomyocarditis virus, directing translation of HCV
NS3-NS5B proteins, and the HCV 3’ NTR (see Figure 1.1(B) below) (223).
Following the transfection of Huh-7 cells with RNA transcripts of the replicon construct, antibiotic G418-resistant cells could be obtained in which the subgenomic RNA replicated autonomously (153). Analysis of the replicons contained within these cells later identified the occurrence of adaptive mutations, giving rise to replicon systems with an increased replication efficiency (10, 11, 25, 129, 152, 260). It was also shown that the HCV replicons were extremely sensitive to IFN-! treatment thereby suggesting that intact IFN receptor mediated cellular responses exist within these cells (25, 74, 88, 111).
Since the initial development of the replicon system by Lohmann et al. (153), a panel of different replicon systems has been developed (16, 26, 107, 118). Of particular note with regards to this study, was the quantitative assay developed by Vrolijk et al. (243). As the direct determination of HCV RNA replication is time consuming (via RT-PCR or Northern hybridization), a subgenomic
7 selectable HCV replicon was devised carrying the firefly luciferase gene (243).
Firefly luciferase activity is a direct extension of HCV replicon RNA copy number, and thus permits the rapid and sensitive measurement of HCV RNA replication (see Figure 1.1(C) below) (224, 243).
The HCV replicon system has thus proven itself to be one of the most valuable tools in studying various structural aspects of the HCV replication complex, along with the intracellular localization of HCV proteins, virus–host interactions, and has also proven itself suitable for the testing of therapeutic compounds interfering with HCV replication (34, 86, 194).
(ii) Pseudo-Particles Expressing the HCV Envelope Proteins (HCVpp)
The HCVpp system, was developed by assembling the HCV E1 and E2 envelope glycoproteins on a retroviral core, with the presence of a packaged marker gene enabling the convenient detection of infection (13, 61, 102). The pseudo-particles mimic the HCV virions in terms of cell entry pathways, as the early steps of infection such as attachment, receptor binding and probably fusion are dependent on functional envelope HCV glycoproteins, thereby enabling the study of HCV entry events (86, 194).
8
Figure 1.1 Basic schematic representation of HCV and HCV replicon genome organisation. (A) The HCV genome consists of the structural proteins core to E2, the non-structural proteins NS2 to NS5B, and the nontranslated regions flanking the polyprotein. (B) The structure of the subgenomic HCV replicon as developed by Lohmann et al. (153). It contains the HCV 5’ nontranslated region directing translation of a fusion protein that is composed of the selectable marker neomycin phosphotransferase (NEO). The EMCV IRES mediates translation of NS3 to NS5B. (C) The structure of the HCV replicon used in this study, as developed by Vrolijk et al. (243). It contains the HCV 5’ nontranslated region directing translation of a fusion protein that is composed of the firefly luciferase (Ff-Luc), ubiquitin (UBI), and the selectable marker neomycin phosphotransferase (NEO). The EMCV IRES mediates translation of NS3 to NS5B.
Following transfection, HCVpp are secreted into the supernatant and can be used for infection assays. With HCVpp, robust infection could be achieved in
Huh-7 cells and in primary human hepatocytes leading to the identification of many key genes involved in HCV entry events (12).
(iii) Cell Culture Derived HCV (HCVcc) Full Viral Life Cycle Cell Culture
Systems
A. The JFH-1 Isolate
A major breakthrough in the development of an in vitro HCV system that resulted not only in RNA replication and HCV protein expression but also in
9 formation of viral particles, was the identification of a genotype 2a isolate, designated JFH-1, cloned from a patient with fulminant hepatitis (119).
In 2005, Wakita et al. (245) reported the development of the first HCV recombinant in vitro system that supported the full HCV viral life cycle. In this system, transfection of full-length JFH-1 was capable of forming cell culture derived infectious viral particles following the transfection of RNA transcripts from a cDNA clone into Huh-7, or derivative, cell lines with improved permissiveness (34, 86).
B. The J6/JFH-1 Cell Culture System
In parallel with the development of the original JFH-1 cell culture system,
Lindenbach et al. (147) constructed an intragenotypic recombinant genotype 2a variant; in which the structural genes (Core, E1, E2), p7 and NS2 of JFH-1 were replaced by the respective genes of strain J6 (genotype 2a) from another infectious clone pJ6CF (256). Following the transfection or infection of permissive Huh-7 cells, J6/JFH-1 viruses were found to exhibit accelerated kinetics, and demonstrated higher specific infectivities than non-adapted JFH-1 viruses (86).
The development of HCV in vitro systems have, and will continue to enable studies to be conducted to address the function of certain HCV genome regions and proteins. Furthermore, localization studies of HCV proteins as well as studies of HCV–host interactions can now be carried out in the context of the complete viral life cycle (86). The full viral life cycle JFH-1-based systems not
10 only allow confirmation of the relevance of results obtained in the replicon and HCVpp system, but also enable studies to be conducted on other poorly understood aspects of the viral life cycle. Despite JFH-1-based cell culture systems mimicking the full complexity of the viral life cycle, the HCV replicon, as well as the HCVpp system, continue to be valuable for studying various aspects of the viral life cycle, including the effect of various therapeutic interventions
(86).
The Interferons
Interferon (IFN), originally discovered more than 60 years ago, was initially identified as an agent that inhibited the replication of influenza virus (108). Over the following years, knowledge surrounding the IFN family of cytokines has been greatly expanded and today, IFNs are recognized as both potent cell growth inhibitors and key components of the innate immune response, mediating the first line of defence against viral infection (181, 196). This understanding has resulted in the wide spread use of IFNs in a therapeutic setting, with the most noteworthy example being in the treatment of HCV infection (92, 97). However, IFNs are also clinically administered to treat a number of various other disorders, including numerous malignancies and multiple sclerosis (reviewed in (29)). IFNs are naturally produced by cells in response to virus infection (84).
The IFN family includes three main classes of related cytokines: type I IFNs, type II IFN and the type III IFNs, each with individual properties, but all
11 exhibiting antiviral activity (226). The type I IFNs, which have considerable structural homology, include:
(i) Interferon-! (IFN-!): for which there exists 13 different human
subtypes.
(ii) Interferon-" (IFN-"): for which there is only one human gene.
(iii) Along with the additional family members: IFN-#, IFN-$, and IFN-%.
The second form of IFN; Type II IFN; is termed interferon-& (IFN-&), and is similarly encoded for by only one human gene (23, 76, 253). More recently, a third group IFNs has been described (the type III IFNs), which include three
IFN-' gene products (IFN-' 1-3 or IL-29, IL-28A and IL-29B respectively) that are structurally distinct from the type I IFNs and utilize their own specific receptor subunit (127, 211, 240).
The Type I IFN Signalling Cascade
The IFN-!/" subtypes all bind to, and activate a common type I IFN receptor which is composed of two distinct subunits (IFNAR1 and IFNAR2) and is present on virtually all host cells (see Figure 1.2) (199). Each of these receptor subunits interacts with a member of the Janus activated kinase (JAK) family. In the case of the type I IFN receptor, the IFNAR1 subunit is constitutively associated with tyrosine kinase 2 (TYK2), whilst IFNAR2 is associated with
JAK1 (51, 181). Following IFN-!/" binding, rearrangement and dimerisation of the IFNAR subunits occur, leading to conformational changes within the intracellular domains of the receptor, thereby activating the JAK-STAT signalling pathway (181, 253). The signal transducer and activator of transcription (STAT) proteins consequently undergo phosphorylation by JAK-1 and TYK-2 (141).
12
Figure 1.2 Activation of classical JAK-STAT signalling by IFN-!. IFN-! binds a common receptor at the surface of human cells, known as the type I IFN receptor, composed of two subunits IFNAR1 and IFNAR2, which are associated with the Janus Activated Kinases (JAKs) TYK2 and JAK1, respectively. Activation of the JAKs (occurring in response to IFN-! binding) results in the tyrosine phosphorylation of STAT2 and STAT1; leading to the formation of STAT1-STAT2-IRF9 complexes (known as ISGF-3) complexes. The ISGF-3 complexes translocate to the nucleus and bind IFN-stimulated response elements (ISRE) in DNA to initiate gene transcription, the protein products of which exhibit antiviral activities against HCV.
Phosphorylated STAT-1 and STAT-2 then recruit a third factor, IFN regulatory factor-9 (IRF9 - also called p48) to form a complex known as IFN-stimulated gene factor-3 (ISGF-3). ISGF-3 is able to translocate to the nucleus, and binds to IFN-stimulated response elements (ISRE) in the promoter/enhancer regions of IFN-stimulated genes (ISGs), thereby inducing the expression of ISGs (111,
199, 253).
13
It has been well established that IFN-! is able to induce the expression of hundreds of ISGs, which include various enzymes, transcription factors, cell surface glycoproteins, cytokines, chemokines and a large number of factors that need to be further characterized – all of which are understood to mediate the broad spectrum of biological responses to IFN (55, 181).
IFN-! and HCV Infection
As outlined above, the type I IFNs (IFN-! and -") induce the expression of hundreds of ISGs, many of which act to limit the replication of viruses such as poliovirus, dengue virus, influenza A virus and HCV (79, 106, 124, 214).
Although the activity of a select few ISGs is well-characterized, the complete spectrum of antiviral ISGs is still unknown (98, 206).
Boosting the innate immune system through treatment with recombinant IFN-! has saved the lives of many patients infected with HCV, and despite the emergence of newly discovered directly acting antivirals that specifically target
HCV, IFN-! is likely to remain a key part of approved therapies used to treat patients (200). Given the importance of IFN-! as a therapeutic agent with regards to HCV infection, it is important that a better understanding of the molecular mechanisms responsible for the IFN-! induced suppression of HCV replication be gained (9, 120, 196, 200).
14
ISG Identification
To date, a limited number of IFN-! induced antiviral proteins have been identified and characterized, thus the exact mechanisms by which endogenous and/or therapeutically administered IFN-! exerts its anti-HCV effects against
HCV remain poorly understood (200, 253).
Initial investigations seeking to identify ISGs responsible for the anti-HCV actions of IFN-! based treatment were hampered by the lack of HCV cell culture and small animal models (200). The chimpanzee remains the only suitable animal model for studying HCV infection in vivo. However, as chimpanzees do not respond to IFN-! based treatment in a manner similar to humans (133), and the fact that they are not widely accessible, mean that it is a difficult model to work with (200). Efficient HCV replication in cell culture has been available since 1999, and with this the possibility of exploring the role of individual ISGs against HCV (9). Similarly, the development of an in vitro model of the full HCV life cycle in 2005 (147, 245) represents yet another useful tool aiding in the investigation of the efficacy of IFN-! therapy and the identification of potential IFN-! induced effector ISG proteins that limit HCV replication (200).
These developments have thus resulted in numerous groups seeking to identify the genes responsible for mediating the anti-HCV effect of IFN-! treatment. In attempting to identify the genes responsible for the inhibition of HCV replication, a number of different molecular biological approaches have been utilised including proteomic-based analysis of both in vitro (255) and in vivo samples
15
(112); the implementation of an in vitro NS5A two-hybrid system (185); and the employment of suppression subtractive hybridization (SSH) approaches
(159, 178, 182, 210). However, by far the most popular system implemented by researchers to identify anti-HCV ISGs has been microarray analysis, which enables researchers to rapidly assess and detect changes in gene expression for thousands of genes (209). With regards to ISG identification, microarray analysis has been applied to in vivo samples arising from human subjects (32,
69, 99, 186, 201, 217, 221); the chimpanzee model of HCV infection (21, 22,
133); and the chimeric SCID-beige/Alb-uPA mouse model (246). Similarly, microarray analysis has also been utilised in identifying differentially expressed
IFN-! sensitive genes in samples arising from in vitro sources (53, 55, 96, 135,
158, 170, 183). Overwhelmingly, the results obtained from the investigations seeking to identify ISGs have found that the human genome encodes hundreds of IFN sensitive and functionally diverse genes (53, 79). By extension, a number of groups have set about identifying and validating the anti-HCV activity of some of the genes identified in the studies listed above – a summary of which is provided below (note: only those ISGs for which a direct anti-HCV activity has been documented are discussed). ISGs which negatively influence IFN-! mediated HCV clearance (such as USP18 (184)), and for which conjecture exists in the literature (such as for MxA (74, 111)) are not discussed; and neither are genes that have been found to limit HCV replication but are not ISGs
(e.g. TP53 (58, 225)).
16
RNA-Specific Adenosine Deaminase (ADAR)
ADAR has been one of the most widely studied antiviral ISGs (253). With regards to anti-HCV activity, Taylor et al. (227) were the first to demonstrate that ADAR played a role in mediating an IFN-!-induced antiviral pathway in
HCV replicon containing cells. By utilising an RNA interference (RNAi) assay to specifically knock down the expression of ADAR, it was shown that the IFN-! sensitivity of the HCV-replicon was partially mediated through ADAR, as elevated HCV-replicon levels were observed in HCV-replicon bearing cells following ADAR knockdown, both in the presence and absence of IFN-! (227).
It has been identified that ADAR leads to the decrease of viral RNA in infected cells through a dsRNA-specific editing of adenosine residues to yield inosine – a process that ultimately destabilises the secondary structure of the viral genome, thereby leading to the accumulation of mutations, and the consequential degradation of viral dsRNA (14, 249). Whilst the precise mechanism by which ADAR limits HCV replication has not yet been defined, it is believed that a similar mechanism of viral degradation to the one described above also takes place in IFN-! treated HCV-replicon bearing cells (199, 227).
Eukaryotic Translation Initiation Factor 2-alpha Kinase 2 (EIF2AK2)
EIF2AK2 (better known as PKR) is a well-studied component of the innate immune response to viral infections (8). The regulation of EIF2AK2 expression is stimulated following exposure to both IFN and dsRNA; with the activation of
EIF2AK2 during viral infection leading to the EIF2AK2-catalysed phosphorylation and inactivation of the translation factor eIF2. Inactivation of eIF2 in turn leads to the generalized suppression of protein synthesis and cell
17 death (39, 247), a situation that is believed to similarly occur within HCV infected cells (115). The anti-HCV role of EIF2AK2 was first demonstrated by
Chang et al. (41) who demonstrated that subgenomic genotype 2a HCV replicons experienced elevated replication levels in EIF2AK2 deficient mouse embryonic fibroblast (MEF) cells. Itsui et al. (111), who demonstrated that the over-expression of recombinant EIF2AK2 significantly decreased HCV-replicon levels in HCV-replicon bearing Huh-7 cells, subsequently validated this finding.
It has also been identified that EIF2AK2 noncytopathically inhibits the replication of HCV subgenomic replicons in HEK-293 cells (115). Whilst EIF2AK2 has well- documented anti-HCV activity, it has been shown that the HCV E2 and NS5A proteins act as EIF2AK2 inhibitors, antagonizing the effects of IFN-! treatment
(80, 228).
Interferon-Inducible Guanylate Binding Protein 1 (GBP1)
GBP1 is a member of the guanylate-binding protein family, which has been shown to contribute to IFN responses in a variety of organisms (239). In humans, GBP1 has been shown to possess modest antiviral activity against
Rhabdovirus, vesicular stomatitis virus (VSV), picornavirus and encephalomyocarditis virus in vitro (3). Consistent with its previously demonstrated antiviral activity, Itsui et al. (111) were able to identify GBP1 as an ISG whose RNA levels were reduced in Huh-7 cells bearing a genotype 1b subgenomic HCV replicon. The over-expression of recombinant GBP1 in these same HCV replicon cells resulted in the suppression of intracellular HCV replication (by approximately 40%); meanwhile the suppression of GBP1, via
RNAi, resulted in increased HCV replication levels (111). It has subsequently
18 been demonstrated that GBP1 exhibits a similar anti-HCV action against
HCV (JFH-1) infected Huh-7 cells, where GBP1 over-expression reduced the formation of HCV particles, and GBP1 knockdown resulted in an increased number of HCV particles and elevated HCV RNA replication levels (110). GBP1 has been identified as a GTPase (219), and has been shown to interact with the
HCV NS5B protein (110). Whilst little is known about the underlying mechanisms of GBP1 mediated anti-HCV RNA clearance, the best insight to date has been made by Itsui et al. (110) who demonstrated that a truncation of the GTPase-catalyzing domain in a GBP1 mutant resulted in the ablation of antiviral activity against HCV replication in cells expressing either the HCV subgenomic replicon, or replicating HCV (JFH-1). Such results suggest that the
GTPase activity of GBP1 is crucial for the effective clearance of HCV RNA in vitro.
Interferon-Induced Tetratricopeptide (IFIT) Family members – IFIT1 and
IFITM1
Both IFIT1 and IFITM1 genes belong to the same family of proteins, each of which contain one or more tetratricopeptide (TPR) motifs that are known to mediate protein-protein interactions (132).
Interferon-Induced Protein with Tetratricopeptide Repeats 1 (IFIT1)
IFIT1, and its gene product p56, are strongly induced by dsRNA, viruses and
IFN (82), with p56 having been identified as an eIF3 binding protein and a suppressor of translation (87, 132, 197, 206). P56 has been implicated in mediating the antiviral actions of IFNs against West Nile Virus and Lassia Virus
19
(244). Moreover, Wang et al. (247) demonstrated that p56 expression exhibited an anti-HCV action in response to IFN-! treatment through the suppression of HCV IRES translation. More recently, Raychoudhuri et al. (186) have provided additional support for the role played by IFIT1 in mediating the anti-HCV effects of IFN-! therapy, by demonstrating that the transient transfection of IFIT1 in Huh-7 cells, expressing both the HCV subgenomic and full life cycle JFH-1 virus, resulted in reduced HCV RNA replication and a decrease in the generation of viral particles – a finding that was shown to not be the result of IFIT1 interfering with HCV cell entry. Additionally, the knockdown of
IFIT1 expression was shown to increase HCV replication in vitro (186).
Interferon Induced Transmembrane Protein 1 (IFITM1)
Whilst it has previously been demonstrated that IFITM1 is able to exhibit antiviral activity against a number of viruses (31, 103, 154), Raychoudhuri et al.
(186) have been the first group to identify the role played by IFITM1 in mediating the antiviral effects of IFN-! therapy against both HCV subgenomic replicons and the full viral life cycle JFH-1 cell culture model. The transfection of a recombinant IFITM1 expression construct into HCV-infected human hepatocytes was shown to inhibit viral replication, whist the knockdown of endogenous IFITM1 expression resulted in enhanced viral replication (186).
Furthermore, investigations directed at characterizing the observed anti-HCV activity of IFITM1 demonstrated that the blockade of viral entry into cells was not the manner by which IFITM1 limited HCV replication, suggesting that
IFITM1 may instead interfere with the HCV replication complex (186).
20
The FAM14 Family Members – IFI6 and IFI27
The FAM14 gene family is composed of 46 different genes across 25 different organisms, all of which encode a small hydrophobic protein with at least one copy of the ~80 amino acid (ISG12) motif (176). Two members of this family,
IFI6 and IFI27, have been recognized as IFN responsive genes for quite some time, however their critical functions in innate immunity have not been thoroughly characterized, with their anti-HCV activity only recently described
(44, 111, 269).
Interferon Alpha-Inducible Protein 6 (IFI6)
IFI6 is encoded by a single gene, and contains two ISRE elements within its promoter, which results in the rapid induction of IFI6 expression following stimulation with IFN-!2b (44). Despite its long established status as an ISG
(75), the first indication of IFI6 playing a role in mediating the anti-HCV effects of IFN-! treatment was demonstrated by Zhu et al. (269) where the microarray analysis of IFN-! treated Huh-7 cells identified the increased expression on
IFI6. Subsequent investigations have revealed that IFI6 enhances the antiviral activity of IFN-! treatment in HCV-replicon bearing Huh-7 cells (269). This finding was later confirmed by Itsui et al. (111) who similarly demonstrated an enhancement of IFN-! antiviral activity in HCV-replicon bearing Huh-7 cells, along with an elevation of HCV replication levels following shRNA mediated knockdown of IFI6. These finding were similarly replicated using the full life cycle JFH-1 HCV model, in which IFI6 demonstrated antiviral activity against
HCV JFH-1 replication and suppressed the release of viral particles (110).
21
Interferon Alpha-Inducible Protein 27 (IFI27)
IFI27 has previously been identified as a potent ISG, whose expression can be regulated by a variety of innate immune stimuli – including members of the IFN family (44). The first indication of IFI27 anti-HCV activity arose when Itsui et al.
(111) identified its reduced expression in HCV-replicon bearing Huh-7 cells. The over-expression of recombinant IFI27 protein in a cell line expressing a HCV- replicon was shown to inhibit HCV replication and expression of viral proteins independently of HCV-IRES mediated translation, whilst the RNAi mediated knockdown of IFI27 resulted in elevated HCV replication levels (111).
Furthermore, similar results were obtained for IFI27 when its antiviral activity against the HCV JFH-1 full viral life cycle model was examined (110). However, further insights directed towards gaining a better understanding of the molecular mechanisms of the observed anti-HCV actions for IFI27 have not been reported.
Interferon Stimulated Exonuclease Gene 20kDa (ISG20)
ISG20 is a recently discovered IFN-regulated RNase, whose antiviral activity is dependent on its 3’-5’ exonuclease activity (54, 115, 267). It has been shown to limit the replication of a number of RNA viruses, including VSV and human immunodeficiency virus (HIV) (66, 67). However, it was the work of Jiang et al.
(115) who, for the first time, demonstrated that ISG20 was able to inhibit the replication of subgenomic, genotype 1b HCV RNA replicons in HEK-293 cells.
Furthermore, it has been shown that the transient over-expression of ISG20 is also capable of restricting genotype 2a HCV RNA replication and JFH-1 virus
22 propagation in Huh-7 based cells (267). Whilst it has been identified that the anti-HCV activity of ISG20 is dependent on functional exonuclease activity, the precise mechanism by which ISG20 limits HCV replication remains unclear, with the possibility that it exerts the observed antiviral effects by targeting cellular factor(s) required for viral replication (54, 267) – as ISG20 was found not to enhance the degradation of transfected HCV RNA, nor did ISG20 affect HCV
IRES-mediated translation (267). However, the use of an ISG20 mutant lacking the necessary 3’-5’ exonuclease activity of endogenous ISG20 suppressed the anti-HCV replicon effect of IFN-! treatment – highlighting the critical role played by ISG20 in mediating the antiviral effects of IFN-! treatment (267).
The Oligoadenylate Synthetase (OAS) Family – OAS2 and OASL
2'-5'-Oligoadenylate Synthetase 2, 69/71kDa (OAS2)
The 2’-5’-oligoadenylate synthetase (2-5 OAS)/ribonuclease L (RNase L) pathway is a well-studied and important antiviral pathway that is found in virtually every human cell (93). The transcriptional induction of OAS2 via IFN signalling leads to the expression of the 2-5 OAS protein which catalyses the synthesis of short 2’-5’ oligadenylates – which serve to activate the endoribonuclease RNase L (215). RNase L in turn, is capable of degrading both viral and cellular RNAs, resulting in the suppression of viral translation through the cleavage and subsequent inactivation of 28S rRNA (a basic component of all eukaryotic cells) (93, 215, 253). It is interesting to note that whilst IFN treatment increases the expression of OAS2, dsRNA is a necessary co-factor required for 2-5 OAS activation (93). Han et al. (93) were the first group to demonstrate that HCV mRNA was detected and destroyed by the antiviral 2’-5’
23
OAS/RNase L pathway. More recently, Itsui et al. (111) were able to independently confirm the anti-HCV activity of OAS2 through the use of transiently transfected OAS2 expression constructs that limited HCV-replicon
RNA replication levels.
2'-5'-Oligoadenylate Synthetase-like (OASL)
Despite OASL being a member of the OAS family, and it being closely related to
OAS2, its antiviral role has remained unclear as OASL lacks OAS enzyme activity due to an amino acid substitution within its N-terminal OAS homology domain (94). Nonetheless, a role for the involvement of OASL in mediating the antiviral response to IFN-!/RBV treatment in HCV infected patients was first realised by Brodsky et al. (32). However, it was Ishibashi et al. (109) who demonstrated that OASL can in fact limit HCV replication in HCV replicon cells.
Interestingly, investigation of the molecular mechanisms by which OASL suppresses HCV replication in vitro identified the presence of two separate
OASL domains that could be responsible. Indeed, Ishibashi et al. (109) were able to demonstrate that these two distinct OASL functional domains each have a separate HCV inhibitory activity – whilst the N-terminal OAS-homology domain is known not to possess OAS enzyme activity, it was however found to be restrictive of both cell growth, and HCV replication; meanwhile, the OASL C- terminal ubiquitin-like domain was found to be inhibitory only for HCV replication.
24
Radical S-Adenosyl Methionine Domain Containing 2 (RSAD2)
RSAD2 (better known as Viperin) is a known ISG (45), and has been shown to possess antiviral activity against a number of different viruses in vitro – namely the human cytomegalovirus, influenza, a number of alphaviruses, dengue virus,
HIV and HCV (72, 99, 115). Helbig et al. (99) were the first to identify the potential anti-HCV activity of RSAD2, where it was shown that the transient expression of RSAD2 lowered genotype 1b HCV genomic replicon levels in
Huh-7 cells by approximately 50%. This finding was later supported by an independent study that similarly identified RSAD2 as an IFN-induced cellular gene responsible for noncytopathically mediating the antiviral effects of IFN-! against subgenomic HCV replicons in HEK-293 cells (115). More recently, additional evidence for the anti-HCV action of RSAD2 has been presented, with the RNAi mediated knockdown of RSAD2 expression demonstrating the important, but not exclusive, role played by RSAD2 in mediating the anti-HCV effects of IFN-! therapy in the context of the complete HCV life cycle genotype
2a (JFH-1) model (98). Whilst the precise mechanism by which RSAD2 limits
HCV replication remains unknown, a number of recent insights have been gained in which it was identified that RSAD2 localises and interacts with the
HCV NS5A protein (via its C-terminal region) at the lipid droplet interface (which is used by HCV for replication); these findings in addition to the demonstrated interaction with the proviral cellular factor, human vesicle-associated membrane protein-associated protein subtype A (VAP-A) at the HCV replication complex, suggests that RSAD2 exerts its anti-HCV effect by altering efficient HCV RNA replication (98, 100).
25
Anti-HCV ISGs – Is There More To The Story?
Whilst researchers have had reasonable success in identifying a wide repertoire of differentially expressed ISGs in response to IFN-! treatment both in vitro and in vivo, it is somewhat surprising that only a relatively small subset of these genes have, to date, been verified as anti-HCV effector genes. One potential limitation of the identification of additional anti-HCV ISGs is the fact that, to date, the majority of ISGs selected for the further characterization of their potential anti-HCV activity have been selected on a case by case basis – be it through their indication as well known antiviral ISGs (as was the case for ADAR
(227), EIF2AK2 (41), IFIT1 (247) and OAS2 (93)); documented activity against other viruses (e.g. ISG20 (267), OASL (109) and RSAD2 (99)); or simply having been selected for further investigation based on recorded increases in expression following IFN-! stimulation (as was the case for GBP1 (111), IFI6
(269), IFI27 (111) and IFITM1 (186)). Whilst it should not be discounted that that such approaches have contributed to expanding the understanding of how
ISGs mediate of the effects of IFN on HCV replication, they are unlikely to identify all of the responsible anti-HCV ISGs. Thus, it would be advantageous if novel systematic screening strategies could be implemented with the capability of identifying the anti-HCV activity for a wide number of ISGs. Indeed, the recently published study of Schoggins et al. (204) describes one possible way of achieving exactly this.
Schoggins et al. (204) utilised a lentivirus-expressed ISG library to assess the antiviral potential of 389 genes that had been pooled together from the results of a number of previously conducted microarray experiments (where the
26 differential expression of genes had been measured in response to type I IFN stimulation – see references 1, 7-15 in (204)), ultimately resulting in the identification of multiple novel anti-HCV ISGs (see Supplementary tables 2 and
3 in (204) for complete list of anti-HCV genes identified). Whilst the work presented by Schoggins et al. (204) is certainly one of the most comprehensive
ISG examinations undertaken to date, the methodology employed is not without limitations. Whilst the use of microarrays to identify ISGs is an effective means of simultaneously identifying the differential expression of a large number of genes, there exists the possibility that some anti-HCV ISGs were not accounted for as microarrays are known to have limitations in their sensitivity towards transcripts of low abundance, and whilst small, there does exist the possibility that some ISGs are not represented on microarrays (38). Additionally, the ISG over-expression approach utilised by Schoggins et al. (204) may preclude the ability to effectively identify the anti-HCV activity of the ISGs examined, as attempting to over-express ISGs contained within a lentiviral vector raises the possibility that the expression of a number of these ISGs (many of which are anticipated to be antiviral) may well target the human immunodeficiency virus 1
(HCV-1)-based vector in which the ISGs are housed – a limitation that was actually highlighted by Schoggins et al. (204). Furthermore, it is possible that the anti-HCV activity for particular ISGs may only occur in the presence of an obligate partner, or within the context of a multi-protein complex. By failing to account for the concomitant expression of any such partners, the antiviral activity for the gene in question is unlikely to go undetected in preliminary antiviral ISG identification screens – especially as undertaking an approach whereby all possible ISG combinations are examined would be unfeasible.
27
Thus, despite a number of advances, the complete spectrum of ISGs responsible for controlling HCV replication in response to IFN-! (either endogenously or therapeutically given) remains undefined, and additional ISGs required for imparting control over HCV replication may remain unidentified (79,
98).
In an attempt to bypass the limitations of the approaches discussed above, the
PhD project presented here sought to identify novel anti-HCV IFN-! induced genes through the implementation of a novel screening strategy. By combining the techniques of suppression subtractive hybridisation (SSH) (and its related technique mirror orientation selection - MOS) with an RNA interference (RNAi) library screen (generated from SSH/MOS isolated clones using a recombinant dicer enzyme) the aim was to identify differentially expressed genes (both known and unknown) following the IFN-! treatment of Huh-7 cells that are responsible for mediating the anti-HCV effects of IFN-! treatment.
Investigation of Intracellular Gene Changes
As previously discussed, it is well established that IFNs induce the expression of hundreds of genes, which mediate various biological responses on its behalf
(55). The complexity and diversity of these induced genes requires further investigation, as they are likely to provide important clues with regards to better understanding the mechanisms underlying the antiviral actions of IFN-! treatment (182, 234). Thus, an important first step is the identification of genes that are differentially regulated at the transcriptional level in response to IFN-! treatment, for which several gene expression profiling methods have been
28 developed (78). These include differential analysis of library expression
(142), differential display (146, 218), representational difference analysis (148), enzymatic degradation subtraction (261), linker capture subtraction (258), serial analysis of gene expression (237), and DNA microarrays (202). Whilst each of these methods have proven themselves to be successful in the isolation of differentially expressed genes, each possess certain intrinsic limitations – with the common limitation for all being that the disproportion of concentrations of differentially expressed genes is maintained in the subtraction. This results in the above approaches proving themselves to be ineffective at isolating rare transcripts within the sample being examined (68, 167).
Suppression Subtractive Hybridisation
SSH – An Introduction
An additional transcript profiling approach that is widely applicable for molecular studies seeking the identification of a set of differentially expressed genes that are upregulated in one sample relative to another, is suppression subtractive hybridisation (SSH) (60, 78, 212). In contrast to the approaches listed above, the greatest advantage of the SSH approach is its ability to identify differentially expressed genes, irrespective of their level of expression, in the absence of sequence information (38, 60, 78). SSH has the ability to identify transcripts of low abundance due to the incorporation of normalization and subtraction steps within the SSH protocol. The normalization step serves to equalize the level of rare and abundant cDNAs within the ‘tester’ population, thereby providing access to poorly expressed sequences which also play an important role in establishing observed phenotypic changes (38, 59, 60, 78). The subtraction
29 step meanwhile is able to remove those genes that are expressed in both samples, and is mediated through the suppression PCR effect (59). The suppression PCR effect arises through the use of SSH specific adapters containing long inverted terminal repeats and ‘adapter specific’ primers which are shorter in length than their respective adapters. When the adapters are ligated onto the ends of cDNA fragments, the inverted repeats can form stable panhandle-like structures after each denaturation and annealing cycle, such that in a PCR reaction utilising primers derived from the sequences of the long inverted terminal repeats, the resultant panhandle-like structures do not undergo exponential amplification (60). This feature is brought about as the intramolecular annealing of the long inverted terminal repeats is more stable in comparison to the intermolecular annealing of the shorter PCR primer to the long inverted repeats; thus undesirable cDNA fragments are eliminated from a mixture of target sequences (60, 236). Additionally, SSH also has the ability to detect novel genes within the system being investigated as no a priori knowledge of clone sequences is required – a feature that has been highlighted in a number of previous SSH applications where differentially expressed transcripts were recovered from SSH libraries for which no matches with public databases existed (1, 7, 38, 59, 83, 105, 116, 126, 130, 137, 149, 151, 165,
167, 172, 188, 189, 203, 208, 210, 220, 231-233, 262).
SSH Methodology
There are six general steps in the SSH strategy (see Figure 1.3). The first step involves the isolation of RNA for the two samples being compared. The ‘tester’ pool contains the differentially expressed genes, while the ‘driver’ pool becomes
30
Figure 1.3 Schematic representation of the Suppression Subtractive Hybridisation procedure. Solid lines represent the RsaI digested ‘tester’ cDNA, dashed lines represent the RsaI digested ‘driver’ cDNA. Purple boxes represent the adapter Ad1, and orange boxes represent the adapter Ad2R.
the reference sample. Then, double-stranded cDNAs are independently synthesized from the ‘tester’ and ‘driver’ populations, all of which are then digested with a four base-cutting restriction enzyme that yields blunt ends.
Second, the tester cDNA fragments are divided into two samples (1 and 2) and ligated with two different adapters (Ad1 and Ad2R). In the third step, two separate primary hybridisation reactions are performed in which an excess
31 amount of driver cDNA, and a small amount of each tester cDNA population are mixed together, heat denatured, and allowed to anneal. It is during this first hybridization step that the single-stranded ‘tester’ fraction is normalized.
Normalization is able to occur as the annealing process is faster for more abundant molecules than is the annealing of the less abundant cDNA molecules, which go on to remain as single stranded cDNAs – this feature is due to the second order of hybridization kinetics (59). Furthermore, the single- stranded cDNAs are significantly enriched for those transcripts that are differentially expressed in the starting ‘tester’ sample, as the non-differentially expressed transcripts present in the starting ‘tester’ sample are able to form hybrids with ‘like’ molecules present in the ‘driver’ population. In the fourth step, the two primary hybridisation reactions are combined, and annealed with additional freshly denatured ‘driver’ cDNA. Under these conditions, a number of different cDNA hybrids are formed, but it is only the single-stranded ‘tester’ cDNAs which are able to reassociate and form new hybrids in which the two strands have different SSH adapters on their 5’ and 3’ ends that are of interest.
The fifth and sixth steps then involve the entire population of molecules being subjected to two rounds of PCR amplification. During the first cycle of the primary PCR the adapter ends are filled in, creating the complementary primer- binding sites needed for amplification, and as a result there are now several different types of molecules formed that contain different adapter combinations.
Those molecules which do not contain any adapters are not amplified; the hybrids formed with only one adapter can only be amplified linearly; whilst the hybrids that have identical adapters at both ends form panhandle-like structures due to the self-complementary nature of the adapters, and are not amplified;
32 leaving only those molecules that have different adapters at either end able to undergo exponential amplification. The second SSH PCR reaction, using nested PCR primers, generates a sample that is further enriched for the genes differentially expressed in the original ‘tester’ sample, with the fragments isolated providing the basis for subsequent cloning, gene identification and functional analysis investigations (59, 78, 182). Furthermore, the nucleotide sequence data obtained from SSH enables the detection of polymorphisms and splice variants, potentially accounting for sequence variations that may exist in genes found within the cell culture model utilised (210).
Limitations of the SSH approach
‘Background’ Clones
Typically following the SSH procedure, subsequent techniques need to be employed to verify that the clones isolated are indeed representative of genes that are differentially expressed between the ‘tester’ and ‘driver’ samples – this can be performed via the use of differential screening, Northern blot, or RT-PCR
(187). Rebrikov et al. (189) have identified that SSH may be limited by the presence of high-complexity cDNA samples in which only a small number of differentially expressed genes (targets) exist between the two samples being compared. In such a scenario, the number of background clones can exceed the number of target clones in subtracted libraries, as has indeed been witnessed by a number of groups (159, 172, 173, 187). In such instances, the
SSH cDNA libraries generated typically represent, in addition to clones of differentially expressed genes, clones that are representative of non-
33 differentially (‘redundant’) expressed genes – also known as ‘background clones’ (187).
Rebrikov et al. (187) have postulated that background clones found within SSH subtracted libraries arise primarily from two main sources:
i. Non-ligated SSH adapters are able to non-specifically anneal during SSH
to cDNA molecules with similar sequences. Following the DNA
elongation step, such molecules serve as templates for the primary
and secondary (nested) SSH PCR reactions. Additionally, it is
feasible that some background clones could arise through the non-
specific annealing of PCR primers.
ii. Some redundant cDNA molecules could, by chance, not be eliminated
during the hybridization step, and thereby take part in amplification in
subsequent PCR reactions.
Whilst it is believed that for any given background clone isolated, the second scenario is highly unlikely, it would be possible that a single molecule of a redundant cDNA species is present among the several thousand other cDNA molecules that are subjected to the PCR reactions following the hybridization step in SSH (187). However, was this to be the case for a sufficiently large number of redundant sequences, a high number of such background molecules could be isolated (187).
‘True’ Clone Identification
34
Whilst Northern blot hybridizations and RT-PCR are very accurate in validating the differential expression of clones identified via SSH, they are extremely labour intensive, and thus not particularly suitable to screening large numbers of clones. Differential screening on the other hand, can be used to screen a large number of SSH generated clones fairly rapidly. Briefly, differential screening is a process by which probes are prepared from two reciprocal (forward and reverse) subtracted samples and are then used to screen for SSH clones representing truly differentially expressed genes (for more information, refer to the PCR-Select Differential Screening Kit User
Manual (Clontech Laboratories Inc., Mountain View, CA)). However, the inclusion of so called ‘false positive’ clones, in amongst the ‘background clones’, is an especially challenging problem – as these ‘false positive’ clones when examined via the differential screening technique, typically produce signals that identifies them as being differentially expressed, however this finding is not typically confirmed in subsequent detailed analyses (e.g. via RT-PCR or
Northern blots) (187).
SSH isolated clones that represent clones arising from scenario (i) highlighted above, can be easily removed by differential screening (187). However, background molecules that arise from scenario (ii) would likely be identified as being differentially expressed if analysed using the differential screening technique (187). The only way to accurately demonstrate the equal abundance of such sequences in the initial ‘tester’ and ‘driver’ populations is through the subsequent use of either Northern blot or RT-PCR analysis. However, as previously mentioned, the elimination of ‘background clones’ in such a manner
35 is both difficult and time-consuming (187). Thus, when anticipated that a high number of background clones may be encountered within the SSH-generated library, mirror orientation subtraction (MOS) can instead be used to significantly reduce background (187).
Mirror Orientation Selection
The MOS technique, as developed by Rebrikov et al. (187), is based on the assumption that any type (ii) species of ‘background clone’ found within the
SSH generated library will have only one orientation relative to the SSH adaptors - a feature that arises from the orientation of the single progenitor cDNA molecule (relative to its SSH adapters) that managed to evade removal during hybridization (187). Contrary to this, cDNA fragments that are representative of truly differentially expressed genes will have many progenitor cDNA molecules and are thus represented by both sequence orientations relative to the SSH adapters – a feature that is attributable to the enrichment of
‘target’ cDNA molecules during the SSH hybridization step, and subsequent amplification in the SSH PCR reactions (187).
MOS Methodology
Briefly, the MOS procedure (see Figure 1.4) involves the removal of one of the
SSH adaptors (Ad1) via restriction endonuclease digestion of the final SSH
PCR product. Subsequent heat-denaturation and reannealing of the digested sample is then performed, a process which gives rise to newly formed hybrids from target cDNA molecules that bear the second SSH adapter (Ad2R) at both their 5’ and 3’ termini. These molecules can only arise as a result of
36
Figure 1.4 Schematic representation of the Mirror Orientation Selection method. Solid lines represent the RsaI digested transcripts arising from the end of the SSH protocol. Purple boxes represent Adapter Ad1, orange boxes represent Adapter Ad2R.
hybridization of target cDNA molecules that originally had a “mirror” orientation of adaptors Ad1 and Ad2R. Following the hybridization step, the 3' ends are filled in and a PCR using nested PCR primers corresponding to Ad2R is performed, the result of which is that only those newly formed hybrids bearing
Ad2R at both termini, undergo exponential amplification, thereby enriching the final PCR product with cDNA molecules that arise from differentially expressed genes (189). Indeed, the MOS approach has been used with a great deal of success by a number of previous groups that have sought to both minimize the
37 number of false-positive clones, and concurrently improve the isolation of
‘positive clones’ from SSH-generated libraries (27, 47, 104, 137, 175, 235).
RNA Interference
RNAi – An Introduction
RNA interference (RNAi), an ancient pathway for the protection of an organism’s genome against viruses (251), is a conserved cellular response to double-stranded RNA (dsRNA), and is the process by which dsRNA mediates the silencing of gene expression – via the induction of sequence-specific degradation of complementary mRNA, or through the inhibition of translation
(164). Sequence-specific knockdown of mRNA is a naturally occurring phenomenon present in many organisms, be it post-transcriptional gene silencing in plants (15), quelling in fungi (193), and RNAi in flies (65), nematodes (71), and mammals (63). Depending on the organism, RNAi is triggered by various types of molecules, including long dsRNAs, plasmid-based short hairpin RNAs (shRNAs) or endogenous hairpin micro RNAs (miRNAs)
(164). All of the above ‘RNAi triggers’ are processed by the ribonuclease-III activity of the evolutionarily conserved Dicer enzyme to generate 21–22- nucleotide small interfering RNA (siRNA) duplexes (19, 64). The resulting siRNAs are regarded as substrates of the RNA-induced silencing complex
(RISC), a large ribonucleoprotein complex that contains one strand of the siRNA molecule that is bound by an Argonaute protein and additional protein factors, which in turn utilise an ATP-dependent RNA-helicase activity to unwind the duplex siRNA into single-stranded siRNA (19). The antisense strand of the siRNA duplex serves as a guide to the RISC, and screens the cellular mRNAs
38 to find homologous mRNA strands, where upon the RISC-associated endoribonuclease cleaves the target mRNA at a single site in the centre, ultimately resulting in the cellular depletion and silencing of the target gene (5,
64, 164).
In principle, any gene can be silenced, therefore, by exploiting the RNAi pathway researchers are provided with a rapid means by which to assess the loss of gene function effects. Indeed, in mammalian systems, siRNA-based
RNAi has proven itself to be an effective gene-silencing tool (164).
Reverse genetic approaches enable gene function to be analysed in a high- throughput fashion, which in combination with a genome-wide expression profiling approach such as SSH/MOS, enables the silencing of a specific gene to be rapidly linked with a loss-of-function phenotype – thereby providing an effective means by which to validate critical components of a cellular pathway such as the IFN-! mediated suppression of HCV replication (164). The use of siRNAs for such investigations compares favorably to the generation of mutagenesis screens which require the laborious mapping of the induced mutation, and large over-expression screens which can be similarly difficult to generate (204).
Individual siRNAs
Typically, investigations seeking to exploit the RNAi pathway to identify the genes responsible for mediating the anti-HCV effects of IFN-! treatment have relied on the use of individual siRNAs that are synthetically designed and
39 generated to target a specifically chosen gene (43, 49, 58, 98, 99, 110, 111,
115, 184, 186, 227). Whilst the use of synthetically generated siRNAs has proven to be suitable in gene silencing experiments for the validation of anti-
HCV ISGs, such an approach possesses a number of limitations. Notably, the development of effective synthetic siRNAs can be expensive, especially when several different siRNAs need to be designed and evaluated before a particular gene is successfully silenced. Neither is such an approach easily scaled up for screening a large number of candidate antiviral ISGs, because for each member of a library, one or more oligonucleotides need to be individually designed and synthesized (169). Interestingly, broader knockdown strategies using RNAi have not been employed to screen ISGs involved in the anti-HCV activity of IFN-!.
Genome-Wide siRNA Libraries
One option that could be utilised to identify novel anti-HCV ISGs is the employment of a genome-wide synthetically generated siRNA library. Such an approach would likely be successful, as a number of groups have successfully implemented the use of siRNA libraries to screen for host genes that are required for Hepatitis C virus replication (18, 144, 174, 185, 222, 224).
With the discovery that the entire human genome is composed of approximately
25,000 protein coding genes (238), several commercially available siRNA and shRNA libraries having been generated for large-scale genome-wide functional studies (33). Such screens are typically constructed in a 384-well plate format with a single target gene targeted in each well (33). As an example
40
Dharmacon’s SMARTpool technology (Dharmacon, Inc., Lafayette, CO) is comprised of four individual multiplexed siRNA sequences in each well, targeting the one gene – thus, a whole genome collection is covered by approximately sixty 384-well plates (216). So, whilst a genome-wide siRNA library could be used to identify the ISGs that mediate the anti-HCV effects of
IFN-! treatment, it should be noted that such an approach is generally expensive to perform as it requires a high level of optimization, rigorous statistical interpretation and substantial robotic infrastructure (216). An additional problem faced when using genome-wide siRNA libraries is the consideration of possible sequence variation of the target transcript between different cell lines, different isoforms and splice variants – all of which may impact on resultant siRNA activity as some of the siRNA molecules would likely give rise to false negative screen hits, stemming in part from inefficient targeting or nonspecific toxicity (24, 144).
Collectively, off-target effects comprise all detectable phenotypic consequences arising from unintended interactions, whether dependent on nucleotide sequence or not, between the silencing molecules and various cellular components (e.g. proteins and non-targeted mRNAs) (62, 216). Whilst there has been a reduction of the occurrence of these effects with improvements in siRNA design, it is not possible to eliminate them altogether, and thus it is impossible to rule out off-target effects occurring for RNAi experiments through siRNA design (62).
41
Dicer Generated siRNA (d-siRNAs)
In contrast to the above approaches which rely on knowledge-based siRNA design, enzymatic methods using cDNA as the starting material can yield a large number of heterogeneous siRNA molecules that are capable of interacting with multiple sites on the target mRNA in the one step, thereby presenting researchers with an efficient and specific alternative to synthetically generated siRNA libraries (33).
It has been shown that by using pools with increasing numbers of chemically synthesized siRNAs the odds of attaining efficient gene silencing and a reduction of off-target effects can be gradually achieved (122). In vitro dicing pushes this siRNA-pooling concept a step further; as a diced pool of siRNAs typically contains hundreds of different oligonucleotides all targeting the same gene, all without any a priori need for the precise target sequence (168).
Enzymatically prepared siRNA libraries (through the use of recombinant dicer enzyme) generated from subtracted cDNA libraries (e.g. SSH/MOS) can be used to enrich a resultant siRNA library for triggers specific to a given cellular pathway whilst avoiding the overrepresentation of highly expressed genes (33).
Furthermore, such siRNA libraries are able to be more complex than synthetically prepared siRNA libraries, as a pool of siRNAs is generated targeting a specific gene with each siRNA being present at only a low concentration, reducing the likelihood of significant off-target effects whilst ensuring the combined coverage of large sections of the target transcript (33,
169). Additionally, diced siRNAs have proven themselves to be comparable in
42 potency, and superior with regards to non-specific toxicity, in comparison to synthetic siRNAs (169).
For the generation of dicer siRNA libraries, a cDNA fragment tagged with 5’ and
3’ T7 promoter sequences by PCR, is transcribed to produce dsRNA in vitro.
Through the use of a recombinant Dicer enzyme, the long dsRNA is then converted into siRNAs of approximately 22 bp in length, which are isolated by spin column purification (see Figure 1.5). This method enables the rapid generation of siRNAs with the major benefit that the need to design and test siRNAs for efficacy and potency is eliminated, thereby simplifying and decreasing the cost of gene silencing experiments (168).
Project Aim and Study Design
Having established that the complete spectrum of anti-hepatitis C ISG effectors remains unresolved, the primary aim of this project was to identify novel critical genes involved in mediating the antiviral effects of IFN-! therapy against HCV replication. This was achieved through the use of a novel screening approach.
Initially, SSH (Chapter 3) and its related technique MOS (Chapter 4) were implemented to isolate clones of differentially expressed genes following the
IFN-! treatment of Huh-7 cells. Validation of the differential expression of genes represented within the SSH and MOS clone libraries was conducted via a combination of RT-PCR and Microarray analysis (Chapter 5). Clones identified to represent genes of interest were then validated for anti-HCV replicon activity by combining the SSH/MOS approaches with Dicer-generated RNAi, which led to the identification of a number of ISGs on the basis that their
43
Figure 1.5 A schematic representation of ‘dicer’ generated d-siRNA pools. Red strands represent ‘sense’ DNA/RNA molecule, blue strands represent ‘anti- sense’ DNA/RNA molecules. Generation of PCR products representing the target DNA sequence flanked by dual T7 promoter sequences, permits the subsequent in vitro generation of multiple dsRNA complements. The use of recombinant human dicer enzyme results in the cleavage of in vitro transcribed dsRNA, generating a mixture of d-siRNAs that can subsequently take part in siRNA mediated gene silencing – targeting multiple regions of the target gene.
suppression impaired the anti-HCV replicon activity of IFN-! treatment
(Chapter 6). Subsequent analysis of these results (Chapter 7) focused on validating the role played by the ZC3HAV1 gene in the context of the IFN-!- mediated defence response against the HCV replicon. The identification of additional interferon effector genes is thus critical in furthering our understanding of the mechanisms responsible for the anti-HCV effect of IFN-! treatment.
44
CHAPTER 2: GENERAL MATERIALS AND METHODS
!
DNA Manipulations
!
Restriction Enzyme Digestion
Various restriction enzymes were used throughout and are indicated accordingly. Essentially, ~1 µg of DNA was digested in a final volume of 10 µL with 10 units of restriction enzyme (New England BioLabs, Ipswich, MA), 1x reaction buffer (New England BioLabs, Ipswich, MA) and if necessary, bovine serum albumin (BSA) (New England BioLabs, Ipswich, MA) at a final concentration of 100 µg/mL. The mixture was incubated for 1-2 hours at the recommended temperature.
Agarose Gel Electrophoresis
DNA products were separated and analysed on 0.8-2% agarose (Bio-Rad,
Hercules, CA) gels prepared with 0.5x TBE buffer containing 0.5 µg/mL
Ethidium Bromide. Samples were mixed with 0.2x volumes of Gel Loading
Buffer. HyperLadder 1 DNA Size Marker (BioLine, London, UK) was also loaded. Electrophoresis was carried out at 90 V in 0.5x TBE buffer. Gels were visualised and the image captured using a Gel Logic 200 Imaging System
(Kodak, Rochester, NY).
45
DNA Purification and Concentration
For gel extractions, DNA was purified using the QIAquick Gel Extraction Kit
(Qiagen, Hilden, Germany). If necessary, PCR products were purified using the
QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). Cleanup from enzymatic reactions was performed using the QIAquick PCR Purification Kit
(Qiagen, Hilden, Germany). DNA was also concentrated by ethanol precipitation. To the DNA solution, 0.1 volumes of 3M Sodium Acetate (Merck,
Whitehouse Station, NJ) and 2 volumes of 100% Ethanol (Merck, Whitehouse
Station, NJ) were added. This was incubated at -80°C for 20-30 min. The precipitated DNA was recovered by centrifugation at 12 000 rpm in a microcentrifuge for 10 min, after which the supernatant was removed and the resultant DNA pellet washed with 70% ethanol. After a second centrifugation for
10 min, the supernatant was discarded and the DNA pellet air-dried. The DNA was resuspended in TE buffer (Qiagen, Hilden, Germany).
Vector Ligation
Ligation reactions were performed by mixing linearised vector DNA, insert DNA
(equimolar or up to 3x molar concentration of vector), 1 µL T4 DNA Ligase
(New England BioLabs, Ipswich, MA), 1x T4 DNA Ligase Buffer (New England
BioLabs, Ipswich, MA) and H2O to a final volume of 10 µL. Reactions were incubated at 25°C for 2 hr.
Transformation of E. coli
Into chilled electroporation cuvettes, 1 µL from each ligation reaction was mixed with 50µL of ElectroMAX DH5!-E electrocompetent cells (Invitrogen, Carlsbad,
46
CA) cells. Electroporation was performed using a Electroporator 2510
(Eppendorf, Hamburg, Germany) at 2.5 kV, 10 µF and 600 &. Transformed cells were recovered in 950 µL of SOC medium (Invitrogen, Carlsbad, CA) for one hour at 37°C and then plated on Luria-Bertani (LB) agar with kanamycin (50
µg/mL – Sigma-Aldrich, Saint Louis, MO) and X-Gal (20 µg/cm2) (Promega,
Madison, WI). Plates were incubated overnight at 37°C.
Colony Screening and Plasmid DNA Extraction
Single colonies were picked and used to inoculate 2 mL of LB medium containing kanamycin (50 µg/mL). The cultures were incubated at 37°C overnight with shaking at 225 rpm. Plasmid DNA was extracted using the
QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). Restriction enzyme digestion was then used to ensure that the desired insert was present and in the correct orientation. Larger cultures (250mL LB medium containing kanamycin
(50 µg/mL)) were then inoculated and grown at 37°C overnight. For long-term storage, 750µL of overnight culture was added to 250µL of Glycerol (Merck,
Whitehouse Station, NJ) in sterile cryovials (Nunc, Penfield, NY). The vials were then mixed and placed at -80°C. From the remaining cultures, plasmid DNA was extracted using the HiSpeed Plasmid Maxi Kit (Qiagen, Hilden, Germany).
The integrity of all constructs was confirmed by DNA sequencing at The
Ramaciotti Center.
Cell Culture
!
47
Cell Maintenance
Cell lines were maintained at 37°C in a humidified atmosphere containing 5%
CO2. Huh-7, the parental human hepatoma cell line (171), was cultured in
Dulbecco’s modified Eagle’s Medium (DMEM) (Gibco, Carlsbad, CA) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (JRH
Biosciences, Leneva, KA), 4.5 g/L Glucose and 2 mM glutamax (Gibco,
Carlsbad, CA). Huh-7 Luc cells expressing a stably replicating subgenomic genotype 1b HCV RNA that carries a gene encoding the firefly luciferase (243), were cultured as above with the addition of 750 µg/mL G418 (Geneticin(:
Gibco, Carlsbad, CA). When cells reached a semi-confluent state, they were washed with phosphate buffered saline (PBS) (Gibco, Carlsbad, CA) and detached with TrypLE Express (Gibco, Carlsbad, CA). After the cells had detached, the Trypsin was inactivated by the addition of complete media containing serum and the cells were then diluted as appropriate.
Thawing of Cells
Frozen cells were revived by rapid thawing in a 37°C water bath. The cells were then transferred to a tissue culture flask containing pre-warmed DMEM supplemented with 10% (v/v) FBS, 4.5 g/L Glucose and 2 mM glutamax. Once the cells had adhered, the media was replaced with fresh growth medium.
Newly revived Huh-7 cells were passaged at least twice before being used in experiments, with Huh-7 Luc cells undergoing at least a further two passages in the presence of G418, before being used in experiments.
48
Freezing of Cells
Cells were harvested and centrifuged at 200 x g for five minutes at room temperature. The media was removed and the cells resuspended in DMEM containing 20% FBS and 10% dimethyl sulfoxide (DMSO) (Sigma-Aldrich, Saint
Louis, MO). Aliquots (1 mL) were then transferred into CryoTubes (Nunc,
Penfield, NY) and slowly cooled to -80°C using a Cryo freezing container
(Nalgene, Rochester, NY). The following day, the cells were transferred to liquid nitrogen for long-term storage.
Cell Viability and Luciferase Activity
Cell viability was assayed 48 h post transfection using the CellTiter-Blue® Cell
Viability Assay (Promega, Madison, WI), in accordance with the manufacturer’s instructions. For detection of luciferase activity, Huh-7 Luc cells were washed twice with PBS and then incubated with 50 µL ice-cold Passive Lysis buffer
(Promega, Madison, WI) for 10 min at room temperature and then assayed using the Luciferase Assay System kit (Promega, Madison, WI). Both assays were performed using a FLUOstar OPTIMA microplate reader (BMG Labtech
GmBH, Offenburg, Germany).
Statistical Analysis
All statistical analysis of data was performed by means of the statistical software package Prism (Version 5.0c; GraphPad Software, Inc., La Jolla, CA). !
!
49
Buffers and Solutions
Gel Loading Buffer - 50% glycerol (Merck, Whitehouse Station, NJ), 1mM EDTA
(Merck, Whitehouse Station, NJ), 0.4% bromophenol blue (Sigma-Aldrich, Saint
Louis, MO) and 0.4% xylene cyanol (Sigma-Aldrich, Saint Louis. MO).
LB Agar - 1% tryptone (BD Biosciences, Franklin Lakes, NJ), 0.5% yeast extract
(BD Biosciences, Franklin Lakes, NJ), 1% NaCl (Ajax Finechem, NSW,
Australia) and 1.5% agar (BD Biosciences, Franklin Lakes, NJ).
LB - 1% Tryptone (BD Biosciences, Franklin Lakes, NJ), 0.5% yeast extract (BD
Biosciences, Franklin Lakes, NJ) and 1% NaCl (Ajax Finechem, NSW,
Australia).
1x TBE buffer – 40 mM Tris Base (Promega, Madison WI), 0.11% glacial acetic acid (Merck, Whitehouse Station, NJ) and 1 mM EDTA (Merck, Whitehouse
Station, NJ).
50
CHAPTER 3 – SUPPRESSION SUBTRACTIVE
HYBRIDISATION
Introduction
Previous investigations that sought to understand the anti-HCV activity of IFN-! treatment (both in vivo and in vitro) have identified the induction of a large number (>300) of genes following IFN-! treatment, including some that have well described antiviral activity (55, 159, 206, 226). However, there are many additional downstream effectors of IFN-! mediated HCV clearance that remain unidentified or poorly understood (99).
The investigation of changes of gene expression within a biological system can be carried out using a variety of methods that enable the identification of differentially expressed transcripts between two populations, a number of such approaches are outlined in Table 3.1 below (126, 156, 167, 242). Whilst each of these methods in their own right are capable of the identification of differentially expressed genes, suppression subtractive hybridisation (SSH) is arguably the technique that is best suited for the effective isolation of both rare and novel differentially expressed transcripts (37, 126, 156, 167, 242).
The initial step in SSH is the reverse transcription of mRNA into cDNA (cDNA derived from cells that contain the differentially expressed genes is referred to as the ‘tester’ and the reference cDNA sample is referred to as the ‘driver’).
Both tester and driver cDNA populations are then subjected to digestion by a 4-
51 Table 3.1 Comparison of various techniques used for detecting differential gene expression. SSH = suppression subtraction hybridisation (189); DAZLE = differential analysis of library expression (142); DD = differential display (146, 192, 218); EDS = enzymatic degradation subtraction (252, 261); LCS = linker capture subtraction (258); SAGE = serial analysis of gene expression (237, 263); M/A = cDNA microarray technology (56).
A priori Isolation Potential for Requirement of knowledge of novel isolation of Technique supplemental methods for of sequence genes rare confirmation of results. required? possible? transcripts?
SSH ! " Good " DAZLE ! " Poor " DD ! " Poor " EDS ! " Poor " LCS ! " Poor " SAGE ! " Poor " M/A " ! N/A "
base cutter restriction enzyme resulting in the formation of short blunt-ended cDNA molecules. The tester cDNA sample is then subdivided into two portions, with each subpopulation ligated to a different adapter (Ad1 or Ad2R) at the 5’ end. Two rounds of hybridisation are then performed between the tester and driver cDNAs – a process that ultimately results in the formation of double stranded cDNA molecules that are flanked by the differing adapters on either 5’ end. Two rounds of suppression PCR, using the adapters as primer annealing sites is then performed enabling the concomitant exponential amplification of the differentially expressed genes and the suppression of non-differentially expressed genes (for a graphic representation of the above – see Figure 1.3 in
General Introduction) (17, 60, 189).
Within the context of the SSH protocol, the normalisation step (which serves to equalise the abundance between common and rare cDNA transcripts) enables the enrichment of differentially expressed cDNAs within the target sample, while
52 the subtraction step aims to exclude commonly expressed cDNAs between the target and non-target samples, enabling the detection of rare transcripts
(91). Combining subtraction and normalisation into the one approach enables
SSH to generate a target sample-specific cDNA library, with enriched differentially expressed mRNAs arising from the transcriptome of interest, and is not restricted to a defined clone set (57, 156, 167, 209, 210).
The aim of the work described in this chapter was to identify and isolate candidate anti-replicon IFN-! stimulated genes (ISGs) from IFN-! treated Huh-
7 cells using suppression subtractive hybridisation, as described by Diatchenko et al. (59). It is anticipated that the combination of SSH with subsequent downstream investigations of clones found to represent IFN-! induced differentially expressed genes, will lead to a better understanding of the key effector genes involved in mediating the clearance of the HCV replicon from
Huh-7 cells following IFN-! treatment.
Materials and Methods
Validation of IFN-! Mediated Induction of ISRE Activation
Huh-7 cells were seeded at 6000 cells per well of a 96-well plate. Following a
24 hr incubation, cells were transfected using Lipofectamine) 2000 transfection reagent (Invitrogen, Carlsbad, CA) at a ratio of 1 µL in 50 µL Opti-MEM* I
Reduced Serum Medium (Gibco, Carlsbad, CA) mixed with 0.5 ng per well of the transfection control plasmid – pGL4.73 (Promega, Madison, WI), and 100
53 ng per well of the reporter plasmid - pISRE-TA-Luc (Clontech Laboratories,
Mountain View, CA). The transfection medium was then removed twenty-four hours post-transfection and replaced with fresh growth medium containing recombinant Human Interferon Alpha 2b (IFN-!2b; PBL Biomedical
Laboratories, Piscataway, NJ) at a final concentration of 100 U/mL for 6 hrs.
Following this treatment period, the resulting Firefly and Renilla Luciferase levels were then assayed.
Subtracted Library Starting Material
Three subtractions were conducted as part of the SSH approach. The control subtraction utilised a Human placental total RNA sample (that was spiked with
HaeIII-digested bacteriophage 'X174 DNA) as ’tester’, and a non-spiked
Human placental total RNA sample as ‘driver’. The ‘reverse SSH subtraction’ utilised RNA from Huh-7 cells that had been cultured in the absence of IFN-! treatment as ‘tester’ material, whilst RNA isolated from Huh-7 cells cultured with recombinant human IFN-!2b served as with the ‘driver’ material. Meanwhile, the ‘forward SSH subtraction’ utilised Huh-7 cells cultured with recombinant human IFN-!2b as ‘tester’ material, with the ‘driver’ originating from Huh-7 cells that had been cultured in the absence of IFN-! treatment. Total cellular RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), in accordance with the manufacturer’s instructions.
cDNA Synthesis
Before undertaking the SSH approach, total RNA samples arising from both the untreated and IFN-! treated Huh-7 cells were translated to double stranded (ds)
54 cDNA, using the Super SMART PCR cDNA Synthesis Kit (Clontech
Laboratories, Mountain View, CA). First strand cDNA synthesis was conducted using 10 ng of total RNA from both the untreated and IFN-! treated Huh-7 cells, along with 10 ng of a control sample – total Human Placental RNA (Clontech
Laboratories, Mountain View, CA). These samples, in combination with the 3’
SMART CDS Primer II A, the SMART II A oligonucleotide and the PrimeScript
Reverse Transcriptase enzyme (Takara Bio Inc., Shiga, Japan), were used as set out in the Super SMART PCR cDNA Synthesis Kit (Clontech Laboratories,
Mountain View, CA) user manual. Resulting samples were purified via column chromatography using the NucleoSpin( Extract II columns (Clontech
Laboratories, Mountain View, CA). Generation of full-length ds cDNA was then performed via Long Distance (LD)-PCR, using a 2720 Thermal Cycler (Applied
Biosystems, Carlsbad, CA). The Human Placental control and isolated Huh-7 cell RNA samples were cycled for 21 and 17 cycles respectively. Following the generation of ds cDNA, samples were purified following the steps set out in the
Super SMART PCR cDNA Synthesis Kit (Clontech Laboratories, Mountain
View, CA) user manual using Butan-1-ol (Merck Pty Ltd, Vic, AUS), phenol:chloroform:isomyl alcohol (25:24:1) (Fluka BioChemika, Buchs, SUI), and the CHROMA SPIN-1000 DEPC-H2O Columns (Clontech Laboratories,
Mountain View, CA).
Suppression Subtractive Hybridisation – PCR-select cDNA Subtraction
SSH was performed between the above-described tester and driver Huh-7 cell
RNA preparations using a PCR-Select cDNA subtraction kit (Clontech
Laboratories, Mountain View, CA) so that clones representing genes that are
55 differentially expressed in Huh-7 cells following IFN-! treatment could be isolated – described in detail below.
RsaI Digestion and Purification
The SSH process begins with the production of short, blunt-ended ds cDNA fragments, which is achieved by conducting RsaI (New England Biolabs Inc,
Ipswich, MA) digestion of the purified ds cDNA Huh-7 cell samples from above.
The RsaI digested cDNA samples were purified using the QIAquick Gel
Extraction Kit (Qiagen, Hilden, Germany) following the manufacturers protocol.
A subsequent purification of the digested cDNA was performed using sodium acetate (Sigma, St. Louis, MO), glycogen (Boehringer Mannheim, Mannheim,
Germany) and ethanol (Merck KGaA, Darmstadt, Germany), with the resulting precipitated pellet being eluted in 6.7µL of 1x TNE buffer (Clontech
Laboratories, Mountain View, CA).
Adapter Ligation
The RsaI digested ‘tester’ sample was then divided into two separate groups, and each ligated to a different adapter; either adapter 1 (Ad1 - 5’-
CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3’) or adaptor 2R (Ad2R - 5’-
CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT-3’), using
T4 DNA Ligase (400 units/µL) (Clontech Laboratories, Mountain View, CA), with the reaction being performed at 16°C overnight. As recommended, an additional ‘tester’ sample is ligated to both adapters, becoming the unsubtracted tester control.
56
Adapter Ligation Efficiency
The ligation efficiency between the adapter and RsaI digested ‘tester’ molecules was estimated by PCR amplification (5 min at 75°C, followed by 25 cycles of 30 s at 94°C, 30 s at 65°C, and 2.5 min at 68°C) using glyceraldehyde-3- phosphate dehydrogenase (GAPDH) primers which amplify fragments spanning the adapter/cDNA junction (GAPDH 5’ primer 5’-
ACCACAGTCCATGCCATCAC-3’ and GAPDH 3’ primer 5’-
TCCACCACCCTGTTGCTGTA-3’), and was performed using a 2720 Thermal
Cycler (Applied Biosystems, Carlsbad, CA).
Hybridisation of ‘Tester’ and ‘Driver’ Populations
Following the adapter ligation step, two consecutive hybridisations were performed. In the primary hybridisation step, the two pools of IFN-! treated
‘tester’ cDNA (ligated to the different adapters) were heat denatured (98°C for
1.5 min) and then annealed to denatured (68°C for 8 hr) RsaI digested ‘driver’ cDNA - this removes the transcripts common to the two samples being examined (i.e. the genes found in both the IFN-! treated and untreated conditions) and enriches the differentially expressed genes found only in the
‘tester’ sample. A second hybridisation step was then performed where the two primary hybridised samples were mixed together without denaturing, once more in the presence of denatured ‘driver’ cDNA (16 hr at 68°C), resulting in the formation of hybrid molecules of differentially expressed genes flanked on either end by the two different adapters.
57
PCR Amplification of Differentially Expressed Transcripts
The resulting second hybridisation sample from above was then used as the template for two consecutive PCR amplifications that aim to exponentially amplify the differentially expressed transcripts. In the primary PCR reaction, the reaction was initially incubated with 50x Advantage cDNA polymerase mix
(Clontech Laboratories, Mountain View, CA) for 5 min at 75°C to extend the adapters (creating primer binding sites), after which a cycling program (27 cycles of 30 s at 94°C, 30 s at 66°C, and 1.5 min at 72°C) was performed utilising PCR Primer 1 (5’-CTAATACGACTCACTATAGGGC-3’) (Clontech
Laboratories, Mountain View, CA), and performed on a 2720 Thermal Cycler.
The secondary PCR reaction was then conducted to further enrich the differentially expressed transcripts, and to further reduce any background PCR products. This reaction utilised the nested NP1 (5’-
TCGAGCGGCCGCCCGGGCAGGT-3’) and NP2R (5’-
AGCGTGGTCGCGGCCGAGGT-3’) primers (30 s at 94°C, 30 s at 68°C, and
1.5 min at 72°C).
PCR Analysis of Subtraction Efficiency
Subtraction efficiency was estimated by PCR amplification (18-33 cycles of 30 s at 94°C, 30 s at 60°C, and 2 min at 68°C) which sought to compare the relative levels of the house-keeping gene GAPDH (GAPDH 5’ primer and GAPDH 3’ primer), and a known differentially expressed gene, Interferon stimulated gene
15 (ISG15 - ISG15 forward primer 5’-ACGAATTCCAGGTGTCCC-3’; ISG15 reverse primer 5’- CCTCACCAGGATGCTCAG-3’) from before and after the
SSH procedure.
58
Subtracted Library Cloning and Purification
Subtracted SSH cDNA library products (1µL) were immediately ligated into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA). Following a 30 min incubation of the ligation reaction at room temperature, ElectroMAX DH5!-E electrocompetent cells (Invitrogen, Carlsbad, CA) were electroporated (2.5 kV,
5 ms) (Electroporator 2510; Eppendorf AG, Hamburg, Germany) using one-third of the ligation mixture. Bacteria were allowed to recover for 1 hr at 37°C and plated onto kanamycin (50 µg/ml), selective X-Gal (20 µg/cm2) plates and incubated overnight at 37°C. Individual recombinant white colonies were grown in kanamycin selective Luria-Bertani (LB) medium in 96-well flat bottom blocks
(QIAGEN GmbH, Hilden, Germany) for 24 hours at 37°C. Cells were harvested by centrifugation and plasmid DNA was purified using the QIAprep 96 Turbo
BioRobot Kit (4) (Qiagen GmbH, Hilden, Germany) in conjunction with a
BioRobot 8000 (Qiagen GmbH, Hilden, Germany), following the manufacturer’s instructions. Purified plasmid preparations were analysed for concentration by spectrophotometry, using a Nanodrop 1000 (Nanodrop, Wilmington, DE).
Sequencing
Samples were supplied to the Australian Genome Research Facility (AGRF,
Melbourne, Australia) at ~450 ng of purified plasmid DNA, along with 10 pmol of sequencing primer (M13 Forward) in a total volume of 10 µL. Sequencing reactions and cleanup were performed by AGRF using the AB3730xl DNA analyzer platform (Applied Biosystems, Carlsbad, CA). Analysis was performed using CodonCode Aligner software (Version 3.7.1.1; CodonCode Corporation,
59
Deadham, MA) and resulting sequences aligned to the NCBI RefSeq RNA database using a BLAST algorithm.
Results
Validation of ISRE Activation by IFN-! Treatment of Huh-7 Cells
Prior to undertaking SSH, it was necessary to establish that both the IFN-! concentration being used and the duration of treatment, were able to elicit stimulation of the interferon-stimulated response element (ISRE), and by extension induce interferon stimulated gene (ISG) expression.
This was verified by transfecting Huh-7 cells with a reporter plasmid (pISRE-TA-
Luciferase), and a transfection control plasmid (pGL4.73). The pISRE-TA-
Luciferase plasmid contains five ISRE sites upstream of a Firefly luciferase reporter gene, such that when the transfected cells express an ISRE stimulatory transcription factor (such as Interferon-stimulated gene factor-3 (ISGF3) following IFN-! treatment) luciferase is produced. By contrast, the pGL4.73 plasmid contains a Renilla luciferase reporter gene, downstream of an SV40 promoter sequence, such that expression of the Renilla luciferase gene from this plasmid remains constant, irrespective of treatment conditions.
Following treatment with 100 units/mL of IFN-!, the resulting luciferase levels were assayed. From the results it was clear that this IFN-! treatment regime was sufficient to induce ISRE stimulation, since an approximately 30-fold
60 induction of luciferase activity was observed (see Figure 3.1). Given the strong response to IFN-! treatment, it was concluded that the treatment conditions described would be appropriate for use in generating samples that could be used in suppression subtractive hybridisation experiments seeking to isolate candidate anti-replicon ISGs.
Suppression Subtractive Hybridisation
Analysis of Adapter Ligation
Before conducting the hybridisation reactions, it was necessary to verify that at least 25% of the RsaI digested cDNA fragments had been successfully ligated to the SSH adapters, as this would ensure that the efficiency of the SSH protocol was high, and that the subtracted clone pool could represent a diverse number of differentially expressed transcripts (60). This was performed by assessing the ligation efficiency of each adaptor to the cDNA of a
“housekeeping” gene, in this case glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). PCR reactions that amplified either the adapter/cDNA junction or an amplicon contained completely within the GAPDH cDNA were performed using the IFN-! treated ‘tester’ samples as template. The relative intensities of each amplicon were then compared by agarose gel electrophoresis – see Figure 3.2.
The results demonstrated that PCR products formed using primer pairs extending across the adapter/cDNA junction, were of approximately the same intensity as the PCR products formed when using the two gene-specific GAPDH primers. This suggested that a high percentage of cDNA molecules within the tester sample had adapters ligated, and thus the ligation of adapters had been
61
Figure 3.1 Induction of ISRE activity following treatment with IFN-!. Huh-7 cells seeded at a density of 6000 cells/well, were transfected with the pISRE- TA-Luciferase and pGL4.73 plasmids. Treatment with 100 U/mL IFN-! was performed, with the resulting luciferase levels quantified 6 hrs later. Each bar represents the mean of triplicate experiments. Error bars indicate standard deviation. * denotes p < 0.0001 as compared to the untreated condition. Statistical significance was determined by two-tailed paired t-test.
Figure 3.2 Analysis of adapter ligation efficiency. Lane M: HyperLadder I DNA size marker (BioLine, London, UK). Lanes 1-4: control human placental DNA spiked with HaeIII-digested bacteriophage 'X174 DNA used as template. Lanes 5-8: Huh-7 untreated cDNA used as template. Lanes 9-12: IFN-! treated (100 U/mL for 6 hr) cDNA used as template. Lanes 1, 2, 5, 6, 9 and 10: template DNA ligated to Adapter 1. Lanes 3, 4, 7, 8, 11 and 12: template DNA ligated to Adapter 2. Odd numbered lanes represent PCR products formed when using the G3PDH 3’ Primer and PCR Primer 1 (that is primers spanning the adapter template junction) (750 bp product). Even numbered lanes represent PCR products formed when using the G3PDH 3’ and 5‘ primers (452 bp product). PCR reactions were conducted by cycling the reactions for 5 min at 75°C, followed by 25 cycles of 30 s at 94°C, 30 s at 65°C, and 2.5 min at 68°C, with products shown above being electrophoresed on a 0.8% agarose/EtBr gel.
62 efficiently conducted in order to be able to proceed with the remainder of the
SSH protocol.
Analysis of Subtraction Efficiency
Following the completion of SSH, examination of the relative abundance of specific transcripts (including known “housekeeping” genes, and known up- regulated genes) between the unsubtracted and subtracted samples enables the evaluation of the subtraction efficiency of the SSH protocol. If the subtraction has been efficient, transcripts of a “housekeeping” gene should be reduced, whilst differentially expressed gene transcripts should be enriched.
Thus, semi-quantitative PCR amplification for a housekeeping gene, GAPDH, and a known differentially expressed gene, ISG15, was conducted. Figure
3.3(A) shows that the GAPDH fragment was detectable after 28 cycles of amplification in the subtracted sample, while it was clearly detectable in the unsubtracted sample after only 18 cycles. To examine the enrichment of differentially expressed genes via SSH, ISG15 was chosen as a target for analysis (as IFN-! treatment is well known to increase ISG15 expression (50)).
ISG15 showed strong amplification in the subtracted sample after 23 cycles, whereas in the unsubtracted samples the PCR product was seen only after an additional 5 cycles (Figure 3.3(B)). Using the number of PCR cycles required to observe an equal amplification of the corresponding PCR products from the subtracted and unsubtracted cDNA samples, it is estimated that there was an approximate 40-fold enrichment of differentially expressed genes in the SSH
‘forward’ subtracted sample.
63
Figure 3.3 Analysis of SSH subtraction efficiency. (A) Lane M: HyperLadder I DNA size marker (BioLine, London, UK). Lanes 1 & 5: 18 cycles; Lanes 2 & 6: 23 cycles; Lanes 3 & 7: 28 cycles; Lanes 4 & 8: 33 cycles. PCR was performed on the subtracted (Lanes 1–4) or unsubtracted (Lanes 5–8) secondary SSH PCR product (IFN-! treated Huh-7 RNA as ‘tester) with the GAPDH 5' and 3' primers. PCR reactions were performed by cycling the reactions for 18-33 cycles of 30 s at 94°C, 30 s at 60°C, and 2 min at 68°C. (B) Lane M: HyperLadder I DNA size marker (BioLine, London, UK). Lanes 1 & 5: 18 cycles; Lanes 2 & 6: 23 cycles; Lanes 3 & 7: 28 cycles; Lanes 4 & 8: 33 cycles. PCR was performed on the subtracted (Lanes 1–4) or unsubtracted (Lanes 5–8) secondary SSH PCR product (IFN-! treated Huh-7 RNA as ‘tester) with the ISG15 forward and ISG15 reverse primers. PCR reactions were performed by cycling the reactions for 18-33 cycles of 30 s at 94°C, 30 s at 60°C, and 2 min at 68°C. The products shown above were electrophoresed on a 0.8% agarose/EtBr gel.
A Subtracted cDNA Library
Following the hybridisation steps, cDNA fragments were subjected to two separate PCR amplifications that sought to suppress amplification of background molecules, whilst exponentially amplifying the double-stranded molecules containing the two different adapters, Ad1 and Ad2R, at either end
(representing the differentially expressed transcripts). The results of the SSH
PCR for a control reaction (human placental DNA spiked with HaeIII-digested bacteriophage 'X174 DNA as ’tester’) and the ‘forward’ subtracted library produced using IFN-! treated Huh-7 cells as ‘tester’ are shown in Figure 3.4. It can be seen that PCR amplification of the control sample produced five, well defined, bands corresponding to the HaeIII-digested bacteriophage 'X174 DNA
64
Figure 3.4 Construction of a subtracted cDNA library. (A) Lane M: HyperLadder I DNA size marker (BioLine, London, UK). Lane 1: Secondary PCR products of subtracted human placental tester cDNA with 0.2% 'X174/Hae III-digested DNA. Lane 2: Secondary PCR products of unsubtracted human placental tester cDNA ligated with both Adaptors 1 and 2R and containing 0.2% 'X174/Hae III-digested DNA. (B) Lane M: HyperLadder I DNA size marker (BioLine, London, UK). Lane 1: Secondary PCR products of subtracted IFN-! treated (100 U/mL for 6 hr) Huh-7 tester cDNA. Lane 2: Secondary PCR products of unsubtracted IFN-! treated (100 U/mL for 6 hr) Huh-7 tester cDNA ligated with both Adaptors 1 and 2R. Samples are electrophoresed on a 0.8% agarose/EtBr gel.
fragments (see bands at 1353bp, 1078bp, 872bp and 603bp in Figure 3.4(A)).
Similarly, the results of the SSH PCR conducted using IFN-! treated Huh-7 cells as ‘tester’ resulted in a different banding pattern compared to the IFN-! treated unsubtracted control (although due to the greater complexity of the sample, discrete bands were not as clearly visible as in the control SSH sample) see Figure 3.4(B). Taken together these findings indicate that the SSH
PCR were able to decrease the abundance of common transcripts within the final subtracted cDNA library.
65
Subtracted Library Clone Identification
To identify the gene of origin for the DNA insert found within a particular SSH clone, 74 individual clones from the SSH subtracted library were randomly selected and submitted to the Australian Genome Research Facility (AGRF) for sequencing analysis. In principle, sequences isolated by SSH can be divided into three different categories according to the result of a BLAST search against the NCBI Human RefSeq RNA database: a match with a known gene, a match with an expressed sequence tag (ESTs) only or no database match. The 74 clones screened from the IFN-! treated (100 U/mL for 6 hr) Huh-7 cell subtracted library, were all found to correspond to known database entries
(>95% sequence similarity). With several of the clones representing different fragments of the same gene, the number of individual genes identified via SSH was 60; with 52 genes (87%) appearing only once, and 8 genes (13%) appearing on multiple occasions (see Table 3.2). Additionally, clones representing two different ESTs, and one clone representing a partial mitochondrial genome were identified within the SSH clone library.
Preliminary examination of the genes represented within the SSH clone library revealed the isolation of a number of known IFN-! stimulated anti-viral genes, namely: 2’-5’-oligoadenylate synthetase (OAS2), phospholipid scramblase
(PLSCR1), and interferon-induced protein with tetratricopeptide repeats 1
(IFIT1) (109, 120, 196, 199, 200, 269). However, a significant number of genes that seem unlikely to be ISGs (such as ALB, FGB, FGG, FTL, RDX, YWHAZ
66
Table 3.2 Genes represented by partial length clones identified within an IFN-! treated Huh-7 cell subtracted SSH library. Genea Gene Description RefSeq Number Appearanceb
AFP alpha-fetoprotein NM_001134.1 4 FTL ferritin, light polypeptide NM_000146.3 3 ENO1 enolase 1, (alpha) NM_001428.2 2 FDFT1 farnesyl-diphosphate farnesyltransferase 1 NM_004462.3 2 FGB fibrinogen beta chain, transcript variant 2 NM_001184741.1 2 IFIT1 interferon-induced protein with tetratricopeptide repeats 1, transcript variant 2 NM_001548.3 2 MRPL37 mitochondrial ribosomal protein L37 NM_016491.3 2 PAPOLA poly(A) polymerase alpha NM_032632.3 2 A2M alpha-2-macroglobulin NM_000014.4 1 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 NM_005502.2 1 ACAT2 acetyl-CoA acetyltransferase 2 NM_005891.2 1 ALB albumin NM_000477.5 1 ANGEL2 angel homolog 2 (Drosophila) NM_144567.3 1 APOA2 apolipoprotein A-II NM_001643.1 1 APOC2 apolipoprotein C-II NM_000483.3 1 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 NM_015161.1 1 C2orf49 chromosome 2 open reading frame 49 NM_024093.1 1 CCNB1 cyclin B1 NM_031966.2 1 CENPL centromere protein L, transcript variant 3 NM_001171182.1 1 CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa NM_001903.2 1 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase NM_005216.4 1 FAM60A family with sequence similarity 60, member A, transcript variant 3 NM_001135812.1 1 FDPS farnesyl diphosphate synthase, transcript variant 1 NM_002004.3 1 FGG fibrinogen gamma chain, transcript variant gamma-A NM_000509.4 1 ILF2 interleukin enhancer binding factor 2, 45kDa NM_004515.2 1 LIN28B lin-28 homolog B (C. elegans) NM_001004317.2 1 LMAN1 lectin, mannose-binding, 1 NM_005570.3 1 MAN2A1 mannosidase, alpha, class 2A, member 1 NM_002372.2 1
67
MON2 MON2 homolog (S. cerevisiae) NM_015026.2 1 MTTP microsomal triglyceride transfer protein NM_000253.2 1 NUSAP1 nucleolar and spindle associated protein 1, transcript variant 1 NM_016359.3 1 NUSAP1 nucleolar and spindle associated protein 1, transcript variant 3 NM_001129897.1 1 OAS2 2'-5'-oligoadenylate synthetase 2, 69/71kDa, transcript variant 3 NM_001032731.1 1 PAH phenylalanine hydroxylase NM_000277.1 1 PARK7 Parkinson disease (autosomal recessive, early onset) 7, transcript variant 2 NM_001123377.1 1 PBX1 pre-B-cell leukemia homeobox 1 NM_002585.2 1 PCBP1 poly(rC) binding protein 1 NM_006196.3 1 PLSCR1 phospholipid scramblase 1 NM_021105.2 1 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 NM_002787.4 1 PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4, transcript variant 1 NM_006503.2 1 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 NM_005805.4 1 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 NM_001099666.1 1 RDX Radixin NM_002906.3 1 RN28S1 RNA, 28S ribosomal 1 NR_003287.2 1 RPLP0 ribosomal protein, large, P0, transcript variant 1 NM_001002.3 1 SBNO1 strawberry notch homolog 1 (Drosophila), transcript variant 1 NM_001167856.1 1 SF3B5 splicing factor 3b, subunit 5, 10kDa NM_031287.2 1 SMYD4 SET and MYND domain containing 4 NM_052928.2 1 SOX6 SRY (sex determining region Y)-box 6, transcript variant 4 NM_001145819.1 1 SYAP1 synapse associated protein 1, transcript variant 1 NM_032796.3 1 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor), TFPI NM_001032281.2 1 transcript variant 2 TM9SF3 transmembrane 9 superfamily member 3 NM_020123.3 1 TMEM106C transmembrane protein 106C, transcript variant 3 NM_001143843.1 1 TPI1 triosephosphate isomerase 1, transcript variant 2 NM_001159287.1 1 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1, transcript variant 4 NM_001032288.1 1 UTP14C UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) NM_021645.5 1 UTP18 UTP18, small subunit (SSU) processome component, homolog (yeast) NM_016001.2 1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta YWHAZ NM_001135702.1 1 polypeptide, transcript variant 6 ZNF131 zinc finger protein 131 NM_003432.1 1
68
ZRANB2 zinc finger, RAN-binding domain containing 2, transcript variant 1 NM_203350.2 1
DKFZp686L16108_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone - AL698446.1 1 DKFZp686L16108 5', mRNA sequence - in73d03.y1 HR85 islet Homo sapiens cDNA clone IMAGE:6127900 5' BU952081.1 1
- mitochondrion, complete genome NC_012920.1 1
aGenes with which maximum homology is obtained using a megaBLAST search of the Human RefSeq database for each clone sequenced bThe number of clones found within the sequenced SSH library that were representative of the gene indicated
69 were also identified, suggesting the presence of non-differentially expressed genes in the subtracted sample.
Discussion
Despite its widespread use and proven success as a valid HCV treatment, it is still not entirely clear how IFN-! treatment leads to the elimination of HCV from infected cells. The aim of the work described in this chapter was to perform the initial steps required to isolate cDNA clones of anti-replicon genes that are differentially expressed in Huh-7 cells following IFN-! treatment.
Having demonstrated the stimulatory effect of IFN-! treatment on ISRE activation, focus moved onto the isolation of differentially expressed genes in
Huh-7 cells following IFN-! treatment via suppression subtractive hybridisation
– with cDNA isolated from Huh-7 cells that had been treated with IFN-!, or remained untreated, forming the SSH ‘tester’ and ‘driver’ populations respectively. While HCV replicon bearing (Huh-7 Luc) cells will be used in downstream verification experiments of ISG anti-HCV replicon activity, SSH libraries had been generated using Huh-7 cell RNA as start material since it is the parental cell line for the HCV replicon bearing Huh-7 Luc cells (243), and do not contain any HCV replicon RNA that could possibly interfere with the successful application of the SSH methodology. A six hour IFN-! treatment time point was selected primarily on the basis that many ISGs are induced in Huh-7 cells after only a few hours of IFN-! treatment (55, 158, 160). Furthermore, the antiviral effect of IFN-! treatment against the HCV replicon is driven relatively
70 quickly (74, 134, 247), and it is the characterization of the genes that act directly on the replicon that is sought within this PhD project.
The results of the control reactions conducted as part of the SSH protocol demonstrated a high efficiency of adapter ligation to the RsaI digested cDNA transcripts (see Figure 3.2), a decreased abundance of the housekeeping gene
GAPDH (see Figure 3.3(A)) and an increased abundance of the IFN-! induced gene ISG15 within the subtracted ‘tester’ sample (see Figure 3.3(B)); results which taken together, indicate the successful application of the SSH methodology in isolating what should be a pool of transcripts representing the differentially expressed genes found in Huh-7 cells following IFN-! treatment.
It should be noted that the average size of the cDNA insert found in the SSH clones was 515bp, which is substantially larger than the average 256bp fragment expected from digestion with RsaI. Vall!e et al. (233) have previously reported a similar finding, with the result attributed to the suppression PCR effect being more efficient for shorter molecules of less than 200 nucleotides
(59). The observed preferential enrichment of longer molecules however is balanced by the tendency of the subtraction procedure to favour shorter cDNA fragments which are more efficiently hybridized, amplified and cloned than longer fragments (105).
A preliminary examination of the genes represented within the SSH clone library revealed the presence of ISGs with documented antiviral activity, namely: 2’-5’- oligoadenylate synthetase 2 (OAS2), phospholipid scramblase 1 (PLSRC1),
71 and interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) (109,
120, 196, 199, 200, 269). However, with 61 individual genes being identified following sequencing analysis of the SSH clones, the presence of only 3 known
ISGs raised questions as to whether the majority of genes that had been isolated experience expression level changes in response to IFN-! treatment, thereby justifying their inclusion in the subtracted library. Indeed, a number of previously published studies have identified that there are a number of limitations inherent to the SSH methodology. Whilst the sensitivity and discrimination of SSH is capable of discriminating between transcripts with different degrees of up-regulation, there exists the possibility that the subtracted
SSH library will fail to include all differentially expressed cDNAs (114).
Additionally, it has been shown by a number of groups that the ratio of false- to true-positive clones obtained from a SSH library can be somewhat higher than expected; despite a good subtraction efficiency having been demonstrated through decreases in GAPDH abundance before and after subtraction (27, 46,
52, 78, 150, 172, 173). This generation of false-positive (or ‘background’) clones within SSH libraries is thought to arise primarily from two main sources. In the first instance, non-ligated suppression adapters are able to non-specifically anneal to cDNA molecules with similar sequences. These molecules can then serve as templates for both the SSH primary and secondary PCR. Secondly, cDNA molecules representing non-differentially expressed genes, can by chance evade elimination during the hybridisation step, and as a result undergo amplification in subsequent PCRs (187).
72
It is the presence of the ‘background’ clones that makes the interpretation of
SSH libraries difficult, thereby necessitating the use of additional methods to evaluate whether the sequences recovered from the final SSH library are indeed representative of differentially expressed transcripts, and not simply randomly amplified (‘background’) sequences (78, 114). Thus, the results presented within this chapter would indicate that although SSH can lead to the isolation of clones representing a number of differentially expressed transcripts,
SSH is not sufficiently capable of removing all ‘background’ gene sequences
(38, 46, 130, 172, 189, 268). The exact reason that some redundant sequences are not excluded by the normalization step in SSH however, remains unexplained (35, 114, 136).
To overcome the presence of ‘background’ clones within the final SSH subtracted library, a relatively simple procedure, known as Mirror Orientation
Solution (MOS) can be used. MOS aims to substantially decreases the number of false-positive clones in the libraries generated by SSH; whilst at the same time, potentially increasing the number of true differential clones obtained within a subtracted library (189).
In conclusion, the current chapter focused on the isolation, via SSH, of interferon stimulated genes that may potentially play key roles in mediating the anti-replicon effects of IFN-! treatment in HCV replicon bearing Huh-7 cells. By applying the SSH methodology to isolate clones representative of IFN-! induced differentially expressed genes, it was possible to isolate 3 known anti- viral ISGs (IFIT1, OAS2 and PLSCR1), however the implementation of a
73 subsequent technique that aims to decrease the number of background clones; namely mirror orientation selection (MOS), appears indicated, and is described in detail in the following chapter.
74
CHAPTER 4 – MIRROR ORIENTATION SELECTION
Introduction
As discussed in Chapter 3, a preliminary examination of genes represented in the SSH clone library derived from IFN-! treated Huh-7 cells revealed the isolation of clones representing three known anti-viral ISGs – OAS2, PLSRC1, and IFIT1 (109, 120, 196, 199, 200, 269). This discovery, coupled with the observed high subtraction efficiency, indicates the successful application of the
SSH methodology as a first step towards identifying key anti-replicon effector
ISGs in Huh-7 cells.
Whilst the SSH technique is suitable for the detection of differentially expressed transcripts (59), SSH may prove itself to be problematic when using high- complexity cDNA samples, where there are only a small number of differentially expressed genes between the samples being compared (187). This can lead to the presence of ‘background’ clones, representing non-differentially expressed
(redundant) cDNA species within the final subtracted library (27, 187).
These ‘background’ clones can be particularly difficult to discount if they arise due to redundant cDNA fragments not having undergone effective subtraction during the two hybridization steps (187). The invalidation of differential expression for these clones can be particularly troublesome to confirm via subsequent independent techniques (27, 137). In light of the difficulties often encountered with the SSH approach, mirror orientation selection (MOS) was
75 developed to decrease the presence of the non-differentially expressed sequences within an SSH subtracted library (187).
The MOS approach exploits the primary difference that exists between target and background molecules present in SSH libraries; namely that the background molecules described above are likely to only have a single orientation relative to the two different flanking SSH adapter sequences, whilst transcripts representing differentially expressed sequences are flanked by the
SSH adapters in both orientations (27, 46). This is based on the assumption that only a single redundant cDNA molecule is present amongst the many other cDNA molecules that are amplified by the final SSH PCR reaction, thus resulting in the directionality of the redundant clone in the final SSH PCR product (187). By contrast, target (differentially expressed) cDNA molecules are present in the final PCR product in both orientations relative to the two adapters, due to the presence of many progenitor molecules due to the efficient enrichment of target molecules that occurs during the SSH hybridisation steps
(187).
Mirror orientation selection begins with the removal of adapter Ad2R via XmaI digestion of the final SSH PCR products. All molecules are then subjected to a heat-denaturation and re-annealing cycle, resulting in the formation of some hybrids bearing adapter Ad1 at both ends – this result is only possible when molecules in the final SSH cDNA pool exist in mirror orientations relative to the
Ad1 and Ad2R adapters (i.e. arise from the target cDNA molecules). The missing 3’-ends are then filled in and a PCR reaction using a primer
76 corresponding to adapter 1 is conducted. In this reaction, only those molecules bearing adapter 1 at both termini are amplified exponentially – thereby enriching the final PCR product for target sequences (for a graphic representation of the above protocol, refer to Figure 1.4 in the General
Introduction) (187). The MOS technique has been employed successfully by a number of different studies to remove background sequences from a subtracted
SSH library, thereby improving the isolation of clones representing differentially expressed genes (46, 104, 137, 235).
Following on from the SSH approach used in Chapter 3, the aim of the work described in this chapter is to further identify and isolate clones representing differentially expressed genes in IFN-! treated Huh-7 cells using the method of mirror orientation selection as described by Rebrikov et al. (189). As with the
SSH results, the genes identified through the MOS technique, when combined with subsequent functional investigation of their potential anti-replicon activity, will ultimately lead to a better understanding of the key interferon induced anti- replicon effector genes in Huh-7 cells.
Materials and Methods
Subtracted Library Starting Material
Three subtractions were conducted as part of the MOS approach. The control subtraction utilised a Human placental total RNA sample (that was spiked with
HaeIII-digested bacteriophage "X174 DNA) as ’tester’, and a non-spiked
Human placental total RNA sample as ‘driver’. The ‘reverse MOS subtraction’
77 utilised RNA from Huh-7 cells that had been cultured in the absence of IFN-! treatment as ‘tester’ material, whilst RNA isolated from Huh-7 cells cultured with recombinant human IFN-!2b served as with the ‘driver’ material. Meanwhile, the ‘forward MOS subtraction’ utilised Huh-7 cells cultured with recombinant human IFN-!2b as ‘tester’ material, with the ‘driver’ originating from Huh-7 cells that had been cultured in the absence of IFN-! treatment.
Mirror Orientation Selection
Primary PCR-1 and PCR-2
Utilising the second hybridisation samples from the end of the SSH protocol, the first step of the MOS approach was initiated by conducting five separate PCR reactions per sample, each of which used only PCR Primer 1 (5’-
CTAATACGACTCACTATAGGGC-3’) in the master mix. A 5 min incubation was performed at 75°C to extend the missing strand of the adapters (creating primer binding sites for the PCR primer), after which a cycling program (10 s at 95°C,
10 s at 66°C, 1.5 min at 72°C) was performed using the 2720 Thermal Cycler
(Applied Biosystems, CA, USA). The Human Placental control and Huh-7 cell
RNA samples (both ‘forward’ and ‘reverse’ subtractions) were cycled for 21 and
26 cycles respectively. Once the primary PCR-1 cycling regime had been completed, the 5 independent amplifications were pooled together, and diluted
(1 in 40) with water.
A subsequent primary PCR-2 reaction was then performed, serving to further selectively amplify the differentially expressed sequences. This PCR reaction
78 was performed using the diluted Primary PCR-1 products (10 cycles of 30 s at 95°C, 30 s at 66°C, 1.5 min at 72°C).
Secondary PCR and Purification
Following the completion of the two primary PCR reactions, a secondary PCR reaction was performed. This step involved diluting the resultant PCR-2 sample
(1 in 40 with water), and subjecting them to a secondary PCR cycling protocol
(12 cycles of 10 s at 95°C, 10 s at 68°C and 1.5 min at 72°C). The PCR master mix in this instance contained the Nested primer 1 (NP1 – 5’-
TCGAGCGGCCGCCCGGGCAGGT-3’) and the Nested Primer 2R (NP2R – 5’-
AGCGTGGTCGCGGCCGAGGT-3’) (Clontech Laboratories, Mountain View,
CA) which work to enrich the differentially expressed transcripts (that have the two different adapters present on either end, permitting the binding of these primers), and further reducing background PCR products.
Following the completion of the secondary PCR reaction, the products underwent a phenol/chloroform extraction and ethanol precipitation step, with the resulting DNA pellets being dissolved to a final concentration of 20 ng/µL in
NTE Buffer (10mM NaCl, 10mM Tris-HCl and 0.1mM EDTA).
XmaI Digestion
An XmaI digestion was performed to remove adapter Ad1. 5 µL of the purified
PCR products from above were mixed with 2 µL of the 10x XmaI restriction buffer, 12 µL of water and 1 µL of XmaI enzyme (10 U/µL). The reaction was
79 allowed to proceed for 2 hr at 37°C, with the XmaI enzyme inactivated through the addition of 2 µL of EDTA (200 mM) followed by a 5 min incubation at 70°C.
MOS Hybridisation
The digested cDNA samples, bearing only adapter 2, were then subjected to a single round of MOS hybridization by heat-denaturing the XmaI digested cDNA sample at 98°C for 1.5 min, followed by a re-annealing step that incorporates a
68°C incubation for 3 hr. Following the MOS hybridization step, the sample was mixed with 200 µL of dilution buffer (50 mM NaCl, 20 mM HEPES pH 8.3, 0.2 mM EDTA) and incubated for 7 min at 70°C.
MOS PCR Amplification
Following the MOS Hybridisation reaction, differentially expressed genes are represented as cDNA hybrids flanked on either end by adapter Ad2R only. The final MOS step thus involved utilising the diluted MOS hybridisation samples, and subjecting them to the following PCR protocol (2 min at 72°C and 19 cycles of 30 s at 95°C, 30 s at 62°C and 1.5 min at 72°C) using the MOS PCR primer
NP2Rs only – (5’-GGTCGCGGCCGAGGT-3’).
Subtracted Library Cloning and Purification
Subtracted MOS cDNA library products (1 µL) were immediately ligated into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA). Following a 30 min incubation of the ligation reaction at room temperature, ElectroMAX DH5!-E
80 electrocompetent cells (Invitrogen, Carlsbad, CA) were electroporated (2.5 kV, 5 ms) (Electroporator 2510; Eppendorf AG, Hamburg, Germany) using one- third of the ligation mixture. Bacteria were allowed to recover for 1 hr at 37°C and plated onto kanamycin (50 µg/ml), selective X-Gal (20 µg/cm2) plates and incubated overnight at 37°C. Individual recombinant white colonies were grown in kanamycin selective LB medium in 96-well flat bottom blocks (QIAGEN
GmbH, Hilden, Germany) for 24 hrs at 37°C. Cells were harvested by centrifugation and plasmid DNA was purified using the QIAprep 96 Turbo
BioRobot Kit (4) (Qiagen GmbH, Hilden, Germany) in conjunction with a
BioRobot 8000 (Qiagen GmbH, Hilden, Germany), following the manufacturer’s instructions. Purified plasmid preparations were analysed for concentration by spectrophotometry, using a Nanodrop 1000 (Nanodrop, Wilmington, DE).
Sequencing
Samples were supplied to the Australian Genome Research Facility (AGRF,
Melbourne, Australia) at ~450 ng of purified plasmid DNA, along with 10 pmol of sequencing primer (M13 Forward) in a total volume of 10 µL. Sequencing reactions and cleanup were performed by AGRF using the AB3730xl DNA analyzer platform (Applied Biosystems, Carlsbad, CA). Analysis was performed using CodonCode Aligner software (Version 3.7.1.1; CodonCode Corporation,
Deadham, MA) and resulting sequences aligned to the NCBI RefSeq RNA database using a BLAST algorithm.
Results
81
Construction of the MOS Subtracted cDNA Library
In order to decrease the number of clones representing non-differentially expressed transcripts within the final subtracted library, mirror orientation selection was performed using the second hybridisation samples from the end of the SSH protocol. As shown in Figure 4.1 below, the application of MOS PCR for the control reaction (human placental DNA spiked with HaeIII-digested bacteriophage "X174 DNA as ‘tester’) produced additional bands to those expected and observed when employing SSH (refer to Figure 3.4(A) in Results section, Chapter 3). With respect to the MOS subtracted library produced using
IFN-! treated Huh-7 cells as ‘tester’, the application of MOS resulted in a reduction of smearing, leading to the increased appearance of recognisable distinct bands when compared to both the banding pattern observed for the
MOS PCR result using undigested IFN-! treated Huh-7 cDNA as ‘tester’ (Lane
6, Figure 4.1), and to the SSH subtraction (refer to Lane 1 Figure 3.4(B) in
Chapter 3), indicating that the application of MOS had reduced the presence of background cDNA molecules within the subtracted sample.
Generation of a MOS Subtracted Clone Library
Implementing the approach adopted for generating and identifying genes represented within a subtracted SSH library (Chapter 3), 363 clones from the
MOS subtracted library were submitted to the Australian Genome Research
Facility (AGRF; Melbourne, Australia) for sequencing analysis using the
AB3730xl DNA analyzer platform.
82
Figure 4.1 Construction of a MOS subtracted cDNA library. Lane M: HyperLadder I DNA size marker (BioLine, London, UK). Lane 1: MOS PCR product of subtracted human placental tester cDNA spiked with 0.2% "X174/HaeIII-digested DNA. Lane 2: MOS PCR product of undigested human placental tester cDNA (containing 0.2% "X174/HaeIII-digested DNA). Lane 3: MOS PCR product of subtracted untreated Huh-7 tester cDNA. Lane 4: MOS PCR product of undigested untreated Huh-7 tester cDNA. Lane 5: MOS PCR product of subtracted IFN-! treated (100 U/mL for 6 hr) Huh-7 tester cDNA. Lane 6: MOS PCR product of undigested IFN-! treated (100 U/mL for 6 hr) Huh-7 tester cDNA. Samples are electrophoresed on a 0.8% agarose/EtBr gel.
All 363 clones examined were found to correspond to known database entries
(>95% sequence similarity); with 71 clones (20%) representing genes that appeared only once, whilst 292 clones (80%) represented entries that appeared in the MOS subtracted library on more than one occasion. With several of the isolated MOS clones representing different fragments of the same gene, the total number of individual genes isolated from the MOS clone library was 122, along with two clones that mapped to two different genomic DNA representations, and one clone that represented a known EST (see Table 4.1).
Preliminary examination of the genes represented within the MOS clone library revealed the isolation of six known IFN-! stimulated anti-viral genes, namely: signal transducer and activator of transcription 1 (STAT1); adenosine
83
Table 4.1 Genes represented by partial length clones identified within an IFN-! treated Huh-7 cell subtracted MOS library. Genea Gene Description RefSeq Number Appearanceb
FTH1 ferritin, heavy polypeptide 1 NM_002032.2 52 LOC100008588 H18S ribosomal RNA NR_003286.1 25 AFP alpha-fetoprotein NM_001134.1 22 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 NM_001402.5 18 IFIT1 interferon-induced protein with tetratricopeptide repeats 1, transcript variant 2 NM_001548.3 11 signal transducer and activator of transcription 1, 91kDa, transcript variant STAT1 NM_007315.3 10 alpha ADAR adenosine deaminase, RNA-specific, transcript variant 4 NM_001025107.2 6 ALB albumin NM_000477.5 6 LOC100508018 PREDICTED: myosin light polypeptide 6-like XM_003120894.1 6 RPL7A ribosomal protein L7a NM_000972.2 6 RPLP0 ribosomal protein, large, P0, transcript variant 1 NM_001002.3 6 LOC100129857 PREDICTED: similar to KIAA1620 protein XM_001721903.1 5 ACTB actin, beta NM_001101.3 4 AZIN1 antizyme inhibitor 1, transcript variant 2 NM_148174.2 4 GINS2 GINS complex subunit 2 (Psf2 homolog) NM_016095.2 4 LRRC47 leucine rich repeat containing 47 NM_020710.2 4 PAH phenylalanine hydroxylase NM_000277.1 4 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 NM_005805.4 4 PTMA prothymosin, alpha, transcript variant 2 NM_002823.4 4 RPA1 replication protein A1, 70kDa NM_002945.3 4 RPS25 ribosomal protein S25 NM_001028.2 4 USP13 ubiquitin specific peptidase 13 (isopeptidase T-3) NM_003940.2 4 C17orf62 chromosome 17 open reading frame 62, transcript variant 11 NR_036518.1 3 CCT5 chaperonin containing TCP1, subunit 5 (epsilon) NM_012073.3 3 EIF4B eukaryotic translation initiation factor 4B NM_001417.4 3 GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 NM_006098.4 3 H2AFZ H2A histone family, member Z NM_002106.3 3
84
KRT18 keratin 18, transcript variant 2 NM_199187.1 3 myosin, light chain 6, alkali, smooth muscle and non-muscle, transcript MYL6 NM_079423.2 3 variant 2 OS9 osteosarcoma amplified 9, endoplasmic reticulum lectin, transcript variant 4 NM_001017958.2 3 RPS4X ribosomal protein S4, X-linked NM_001007.4 3 RPS7 ribosomal protein S7 NM_001011.3 3 SEL1L sel-1 suppressor of lin-12-like (C. elegans) NM_005065.4 3 survival of motor neuron protein interacting protein 1, transcript variant SIP1 NM_001009183.1 3 gamma TMEM209 transmembrane protein 209 NM_032842.3 3 USP18 ubiquitin specific peptidase 18 NM_017414.3 3 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, YWHAB NM_139323.2 3 beta polypeptide, transcript variant 2 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) NM_003689.2 2 APOC2 apolipoprotein C-II NM_000483.3 2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2, ATP5J2 NM_001003713.2 2 transcript variant 2 B2M beta-2-microglobulin NM_004048.2 2 coiled-coil-helix-coiled-coil-helix domain containing 2, nuclear gene encoding CHCHD2 NM_016139.2 2 mitochondrial protein LOC653879 PREDICTED: similar to complement component 3 XM_001724144.1 2 MARCKS myristoylated alanine-rich protein kinase C substrate NM_002356.5 2 mitochondrial antiviral signaling protein, nuclear gene encoding mitochondrial MAVS NM_020746.3 2 protein METTL7A methyltransferase like 7A NM_014033.3 2 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme, transcript variant 3 NM_001008709.1 2 PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 NM_002793.3 2 PSMB7 proteasome (prosome, macropain) subunit, beta type, 7 NM_002799.2 2 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 NM_002808.3 2 RPS21 ribosomal protein S21 NM_001024.3 2 SOX4 SRY (sex determining region Y)-box 4 NM_003107.2 2 signal transducer and activator of transcription 3 (acute-phase response STAT3 NM_003150.3 2 factor), transcript variant 2 TOMM20 translocase of outer mitochondrial membrane 20 homolog (yeast), nuclear NM_014765.2 2
85
gene encoding mitochondrial protein A2M alpha-2-macroglobulin NM_000014.4 1 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1, transcript variant 1 NM_001025091.1 1 AMBP alpha-1-microglobulin/bikunin precursor NM_001633.3 1 ANXA7 annexin A7, transcript variant 2 NM_004034.2 1 ATE1 arginyltransferase 1, transcript variant 1 NM_001001976.1 1 AURKA aurora kinase A, transcript variant 2 NM_003600.2 1 CCDC101 coiled-coil domain containing 101 NM_138414.2 1 CCNI cyclin I NM_006835.2 1 CCT7 chaperonin containing TCP1, subunit 7 (eta), transcript variant 1 NM_006429.3 1 CKS1B CDC28 protein kinase regulatory subunit 1B, transcript variant 1 NM_001826.2 1 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family), transcript variant 2 NM_001168499.1 1 CORO1C coronin, actin binding protein, 1C, transcript variant 1 NM_014325.2 1 cytochrome c oxidase subunit IV isoform 1, nuclear gene encoding COX4I1 NM_001861.2 1 mitochondrial protein cytochrome c oxidase subunit VIa polypeptide 1, nuclear gene encoding COX6A1 NM_004373.2 1 mitochondrial protein cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous), nuclear gene COX6B1 NM_001863.4 1 encoding mitochondrial protein DCAF7 DDB1 and CUL4 associated factor 7 NM_005828.3 1 FAM36A family with sequence similarity 36, member A NM_198076.4 1 FGA fibrinogen alpha chain, transcript variant alpha NM_021871.2 1 FTL ferritin, light polypeptide NM_000146.3 1 GLB1 galactosidase, beta 1, transcript variant 2 NM_001079811.1 1 GMPPA GDP-mannose pyrophosphorylase A, transcript variant 1 NM_013335.3 1 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) NM_002079.2 1 HIST1H4C histone cluster 1, H4c NM_003542.3 1 LOC100294202 hypothetical LOC100294202, transcript variant 1 XR_110976.1 1 MAP1LC3B microtubule-associated protein 1 light chain 3 beta NM_022818.4 1 MARS methionyl-tRNA synthetase NM_004990.2 1 mitochondrial ribosomal protein S15, nuclear gene encoding mitochondrial MRPS15 NM_031280.3 1 protein mitochondrial GTPase 1 homolog (S. cerevisiae), nuclear gene encoding MTG1 NM_138384.2 1 mitochondrial protein
86
MTRNR2L2 MT-RNR2-like 2 NM_001190470.1 1 NAT13 N-acetyltransferase 13 (GCN5-related) NM_025146.1 1 NCAPD2 non-SMC condensin I complex, subunit D2 NM_014865.3 1 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa, transcript variant NDUFS2 NM_001166159.1 1 2 NME1 non-metastatic cells 1, protein (NM23A) expressed in, transcript variant 1 NM_198175.1 1 NOL5A nucleolar protein 5A (56kDa with KKE/D repeat) NM_006392.2 1 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin), transcript variant 3 NM_001037738.2 1 PA2G4 proliferation-associated 2G4, 38kDa NM_006191.2 1 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1, transcript PDHA1 NM_001173456.1 1 variant 4 PLSCR1 phospholipid scramblase 1 NM_021105.2 1 POMP proteasome maturation protein NM_015932.5 1 PPIA peptidylprolyl isomerase A (cyclophilin A) NM_021130.3 1 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme, transcript variant 3 NM_206876.1 1 PRDX1 peroxiredoxin 1, transcript variant 2 NM_181696.1 1 PSMA6 proteasome (prosome, macropain) subunit, alpha type, 6 NM_002791.1 1 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5, transcript variant 2 NM_001130725.1 1 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5, transcript variant 3 NM_001144932.1 1 PTDSS1 phosphatidylserine synthase 1 NM_014754.1 1 RAC1 ras-related C3 botulinum toxin substrate 1, transcript variant Rac1 NM_006908.4 1 RAD51C RAD51 homolog C (S. cerevisiae), transcript variant 1 NM_058216.1 1 RPL10A ribosomal protein L10a NM_007104.4 1 RPL13 ribosomal protein L13, transcript variant 1 NM_000977.2 1 RPN2 ribophorin II, transcript variant 2 NM_001135771.1 1 RPS12 ribosomal protein S12 NM_001016.3 1 RPS6 ribosomal protein S6 NM_001010.2 1 RRM2 ribonucleotide reductase M2, transcript variant 1 NM_001165931.1 1 RUVBL1 RuvB-like 1 (E. coli) NM_003707.2 1 SC4MOL sterol-C4-methyl oxidase-like, transcript variant 2 NM_001017369.1 1 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial), transcript variant 8 NR_029417.1 1 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4, SLC1A4 NM_001193493.1 1 transcript variant 2
87
SLC26A6 solute carrier family 26, member 6, transcript variant 2 NM_134263.2 1 SLC38A1 solute carrier family 38, member 1, transcript variant 2 NM_001077484.1 1 SOD1 superoxide dismutase 1, soluble NM_000454.4 1 SPATA20 spermatogenesis associated 20 NM_022827.2 1 SPTBN1 spectrin, beta, non-erythrocytic 1, transcript variant 2 NM_178313.2 1 STAT2 signal transducer and activator of transcription 2, 113kDa, transcript variant 2 NM_198332.1 1 TMEM11 transmembrane protein 11, transcript variant 1 NM_003876.2 1 VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) NM_032353.2 1 ZC3HAV1 zinc finger CCCH-type, antiviral 1, transcript variant 1 NM_020119.3 1 ZNF24 zinc finger protein 24 NM_006965.2 1
- BY794947 Homo sapiens eye Homo sapiens cDNA clone HE0006.seq 5' BY794947.2 1
- chromosome 4 genomic contig, alternate assembly NW_001838902.1 1 - chromosome 12 genomic contig, GRCh37.p2 reference primary assembly NT_009775.17 1
aGene with which maximum homology is obtained using a megaBLAST search of the Human RefSeq database for each clone sequenced bThe number of clones found within the sequenced MOS library that were representative of the gene indicated
88 deaminase, RNA-specific (ADAR); zinc finger CCCH-type, antiviral 1
(ZC3HAV1); ubiquitin specific peptidase 18 (USP18); phospholipid scramblase
(PLSCR1); and interferon-induced protein with tetratricopeptide repeats 1
(IFIT1) (55, 96, 177, 265, 269).
A Combined SSH and MOS Subtracted Library
The full list of genes isolated from the SSH and MOS subtracted libraries is presented in Table 4.2. In combining the two subtracted libraries, 10 genes were found to be common to both approaches, leaving the final tally of identified sequences at 172 individual genes, three different ESTs, two genomic contigs, and one mitochondrial gene.
Discussion
As described in Chapter 3, SSH was employed to obtain partial length cDNA clones of differentially expressed genes following the IFN-! treatment of Huh-7 cells. Despite SSH being a widely used and highly effective system, it has a number of shortcomings, the main one being the inclusion of false-positive clones in the final subtracted SSH library (27, 114, 173, 187).
In order to minimize the presence of false-positives clones, it is recommended that preliminary independent screening techniques, such as differential screening be employed to highlight true gene expression differences within subtracted SSH libraries. However, the application of the differential screening approach is deemed sufficient for determining the differential signal of a particular clone when that particular clone arises as the result of a redundant
89
Table 4.2 All genes represented by partial length clones identified within IFN-! treated Huh-7 cell subtracted SSH and MOS libraries. Genea Gene Description RefSeq Number Appearanceb
FTH1 ferritin, heavy polypeptide 1 NM_002032.2 52 AFP alpha-fetoprotein NM_001134.1 26 LOC100008588 H18S ribosomal RNA NR_003286.1 25 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 NM_001402.5 18 IFIT1 interferon-induced protein with tetratricopeptide repeats 1, transcript variant 2 NM_001548.3 13 signal transducer and activator of transcription 1, 91kDa, transcript variant STAT1 NM_007315.3 10 alpha ALB albumin NM_000477.5 7 RPLP0 ribosomal protein, large, P0, transcript variant 1 NM_001002.3 7 ADAR adenosine deaminase, RNA-specific, transcript variant 4 NM_001025107.2 6 LOC100508018 PREDICTED: myosin light polypeptide 6-like XM_003120894.1 6 RPL7A ribosomal protein L7a NM_000972.2 6 LOC100129857 PREDICTED: similar to KIAA1620 protein XM_001721903.1 5 PAH phenylalanine hydroxylase NM_000277.1 5 PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 NM_005805.4 5 ACTB actin, beta NM_001101.3 4 AZIN1 antizyme inhibitor 1, transcript variant 2 NM_148174.2 4 FTL ferritin, light polypeptide NM_000146.3 4 GINS2 GINS complex subunit 2 (Psf2 homolog) NM_016095.2 4 LRRC47 leucine rich repeat containing 47 NM_020710.2 4 PTMA prothymosin, alpha, transcript variant 2 NM_002823.4 4 RPA1 replication protein A1, 70kDa NM_002945.3 4 RPS25 ribosomal protein S25 NM_001028.2 4 USP13 ubiquitin specific peptidase 13 (isopeptidase T-3) NM_003940.2 4 APOC2 apolipoprotein C-II NM_000483.3 3 C17orf62 chromosome 17 open reading frame 62, transcript variant 11 NR_036518.1 3 CCT5 chaperonin containing TCP1, subunit 5 (epsilon) NM_012073.3 3 EIF4B eukaryotic translation initiation factor 4B NM_001417.4 3
90
GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 NM_006098.4 3 H2AFZ H2A histone family, member Z NM_002106.3 3 KRT18 keratin 18, transcript variant 2 NM_199187.1 3 myosin, light chain 6, alkali, smooth muscle and non-muscle, transcript MYL6 NM_079423.2 3 variant 2 OS9 osteosarcoma amplified 9, endoplasmic reticulum lectin, transcript variant 4 NM_001017958.2 3 RPS4X ribosomal protein S4, X-linked NM_001007.4 3 RPS7 ribosomal protein S7 NM_001011.3 3 SEL1L sel-1 suppressor of lin-12-like (C. elegans) NM_005065.4 3 survival of motor neuron protein interacting protein 1, transcript variant SIP1 NM_001009183.1 3 gamma TMEM209 transmembrane protein 209 NM_032842.3 3 USP18 ubiquitin specific peptidase 18 NM_017414.3 3 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, YWHAB NM_139323.2 3 beta polypeptide, transcript variant 2 A2M alpha-2-macroglobulin NM_000014.4 2 AKR7A2 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) NM_003689.2 2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2, ATP5J2 NM_001003713.2 2 transcript variant 2 B2M beta-2-microglobulin NM_004048.2 2 coiled-coil-helix-coiled-coil-helix domain containing 2, nuclear gene encoding CHCHD2 NM_016139.2 2 mitochondrial protein ENO1 enolase 1, (alpha) NM_001428.2 2 FDFT1 farnesyl-diphosphate farnesyltransferase 1 NM_004462.3 2 FGB fibrinogen beta chain, transcript variant 2 NM_001184741.1 2 LOC653879 PREDICTED: similar to complement component 3 XM_001724144.1 2 MARCKS myristoylated alanine-rich protein kinase C substrate NM_002356.5 2 mitochondrial antiviral signaling protein, nuclear gene encoding mitochondrial MAVS NM_020746.3 2 protein METTL7A methyltransferase like 7A NM_014033.3 2 MRPL37 mitochondrial ribosomal protein L37 NM_016491.3 2 PAPOLA poly(A) polymerase alpha NM_032632.3 2 PLSCR1 phospholipid scramblase 1 NM_021105.2 2 PPP1CA protein phosphatase 1, catalytic subunit, alpha isozyme, transcript variant 3 NM_001008709.1 2
91
PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 NM_002793.3 2 PSMB7 proteasome (prosome, macropain) subunit, beta type, 7 NM_002799.2 2 PSMD2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 NM_002808.3 2 RPS21 ribosomal protein S21 NM_001024.3 2 SOX4 SRY (sex determining region Y)-box 4 NM_003107.2 2 signal transducer and activator of transcription 3 (acute-phase response STAT3 NM_003150.3 2 factor), transcript variant 2 translocase of outer mitochondrial membrane 20 homolog (yeast), nuclear TOMM20 NM_014765.2 2 gene encoding mitochondrial protein ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 NM_005502.2 1 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1, transcript variant 1 NM_001025091.1 1 ACAT2 acetyl-CoA acetyltransferase 2 NM_005891.2 1 AMBP alpha-1-microglobulin/bikunin precursor NM_001633.3 1 ANGEL2 angel homolog 2 (Drosophila) NM_144567.3 1 ANXA7 annexin A7, transcript variant 2 NM_004034.2 1 APOA2 apolipoprotein A-II NM_001643.1 1 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 NM_015161.1 1 ATE1 arginyltransferase 1, transcript variant 1 NM_001001976.1 1 AURKA aurora kinase A, transcript variant 2 NM_003600.2 1 C2orf49 chromosome 2 open reading frame 49 NM_024093.1 1 CCDC101 coiled-coil domain containing 101 NM_138414.2 1 CCNB1 cyclin B1 NM_031966.2 1 CCNI cyclin I NM_006835.2 1 CCT7 chaperonin containing TCP1, subunit 7 (eta), transcript variant 1 NM_006429.3 1 CENPL centromere protein L, transcript variant 3 NM_001171182.1 1 CKS1B CDC28 protein kinase regulatory subunit 1B, transcript variant 1 NM_001826.2 1 CNDP2 CNDP dipeptidase 2 (metallopeptidase M20 family), transcript variant 2 NM_001168499.1 1 CORO1C coronin, actin binding protein, 1C, transcript variant 1 NM_014325.2 1 cytochrome c oxidase subunit IV isoform 1, nuclear gene encoding COX4I1 NM_001861.2 1 mitochondrial protein cytochrome c oxidase subunit VIa polypeptide 1, nuclear gene encoding COX6A1 NM_004373.2 1 mitochondrial protein cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous), nuclear gene COX6B1 NM_001863.4 1 encoding mitochondrial protein
92
CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa NM_001903.2 1 DCAF7 DDB1 and CUL4 associated factor 7 NM_005828.3 1 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase NM_005216.4 1 FAM36A family with sequence similarity 36, member A NM_198076.4 1 FAM60A family with sequence similarity 60, member A, transcript variant 3 NM_001135812.1 1 FDPS farnesyl diphosphate synthase, transcript variant 1 NM_002004.3 1 FGA fibrinogen alpha chain, transcript variant alpha NM_021871.2 1 FGG fibrinogen gamma chain, transcript variant gamma-A NM_000509.4 1 GLB1 galactosidase, beta 1, transcript variant 2 NM_001079811.1 1 GMPPA GDP-mannose pyrophosphorylase A, transcript variant 1 NM_013335.3 1 GOT1 glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) NM_002079.2 1 HIST1H4C histone cluster 1, H4c NM_003542.3 1 ILF2 interleukin enhancer binding factor 2, 45kDa NM_004515.2 1 LIN28B lin-28 homolog B (C. elegans) NM_001004317.2 1 LMAN1 lectin, mannose-binding, 1 NM_005570.3 1 LOC100294202 hypothetical LOC100294202, transcript variant 1 XR_110976.1 1 MAN2A1 mannosidase, alpha, class 2A, member 1 NM_002372.2 1 MAP1LC3B microtubule-associated protein 1 light chain 3 beta NM_022818.4 1 MARS methionyl-tRNA synthetase NM_004990.2 1 MON2 MON2 homolog (S. cerevisiae) NM_015026.2 1 mitochondrial ribosomal protein S15, nuclear gene encoding mitochondrial MRPS15 NM_031280.3 1 protein mitochondrial GTPase 1 homolog (S. cerevisiae), nuclear gene encoding MTG1 NM_138384.2 1 mitochondrial protein MTRNR2L2 MT-RNR2-like 2 NM_001190470.1 1 MTTP microsomal triglyceride transfer protein NM_000253.2 1 NAT13 N-acetyltransferase 13 (GCN5-related) NM_025146.1 1 NCAPD2 non-SMC condensin I complex, subunit D2 NM_014865.3 1 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa, transcript variant NDUFS2 NM_001166159.1 1 2 NME1 non-metastatic cells 1, protein (NM23A) expressed in, transcript variant 1 NM_198175.1 1 NOL5A nucleolar protein 5A (56kDa with KKE/D repeat) NM_006392.2 1 NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin), transcript variant 3 NM_001037738.2 1
93
NUSAP1 nucleolar and spindle associated protein 1, transcript variant 1 NM_016359.3 1 NUSAP1 nucleolar and spindle associated protein 1, transcript variant 3 NM_001129897.1 1 OAS2 2'-5'-oligoadenylate synthetase 2, 69/71kDa, transcript variant 3 NM_001032731.1 1 PA2G4 proliferation-associated 2G4, 38kDa NM_006191.2 1 PARK7 Parkinson disease (autosomal recessive, early onset) 7, transcript variant 2 NM_001123377.1 1 PBX1 pre-B-cell leukemia homeobox 1 NM_002585.2 1 PCBP1 poly(rC) binding protein 1 NM_006196.3 1 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1, transcript PDHA1 NM_001173456.1 1 variant 4 POMP proteasome maturation protein NM_015932.5 1 PPIA peptidylprolyl isomerase A (cyclophilin A) NM_021130.3 1 PPP1CB protein phosphatase 1, catalytic subunit, beta isozyme, transcript variant 3 NM_206876.1 1 PRDX1 peroxiredoxin 1, transcript variant 2 NM_181696.1 1 PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 NM_002787.4 1 PSMA6 proteasome (prosome, macropain) subunit, alpha type, 6 NM_002791.1 1 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5, transcript variant 2 NM_001130725.1 1 PSMB5 proteasome (prosome, macropain) subunit, beta type, 5, transcript variant 3 NM_001144932.1 1 proteasome (prosome, macropain) 26S subunit, ATPase, 4, transcript variant PSMC4 NM_006503.2 1 1 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 NM_001099666.1 1 PTDSS1 phosphatidylserine synthase 1 NM_014754.1 1 RAC1 ras-related C3 botulinum toxin substrate 1, transcript variant Rac1 NM_006908.4 1 RAD51C RAD51 homolog C (S. cerevisiae), transcript variant 1 NM_058216.1 1 RDX Radixin NM_002906.3 1 RN28S1 RNA, 28S ribosomal 1 NR_003287.2 1 RPL10A ribosomal protein L10a NM_007104.4 1 RPL13 ribosomal protein L13, transcript variant 1 NM_000977.2 1 RPN2 ribophorin II, transcript variant 2 NM_001135771.1 1 RPS12 ribosomal protein S12 NM_001016.3 1 RPS6 ribosomal protein S6 NM_001010.2 1 RRM2 ribonucleotide reductase M2, transcript variant 1 NM_001165931.1 1 RUVBL1 RuvB-like 1 (E. coli) NM_003707.2 1 SBNO1 strawberry notch homolog 1 (Drosophila), transcript variant 1 NM_001167856.1 1
94
SC4MOL sterol-C4-methyl oxidase-like, transcript variant 2 NM_001017369.1 1 SF3B5 splicing factor 3b, subunit 5, 10kDa NM_031287.2 1 SHMT2 serine hydroxymethyltransferase 2 (mitochondrial), transcript variant 8 NR_029417.1 1 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4, SLC1A4 NM_001193493.1 1 transcript variant 2 SLC26A6 solute carrier family 26, member 6, transcript variant 2 NM_134263.2 1 SLC38A1 solute carrier family 38, member 1, transcript variant 2 NM_001077484.1 1 SMYD4 SET and MYND domain containing 4 NM_052928.2 1 SOD1 superoxide dismutase 1, soluble NM_000454.4 1 SOX6 SRY (sex determining region Y)-box 6, transcript variant 4 NM_001145819.1 1 SPATA20 spermatogenesis associated 20 NM_022827.2 1 SPTBN1 spectrin, beta, non-erythrocytic 1, transcript variant 2 NM_178313.2 1 STAT2 signal transducer and activator of transcription 2, 113kDa, transcript variant 2 NM_198332.1 1 SYAP1 synapse associated protein 1, transcript variant 1 NM_032796.3 1 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor), TFPI NM_001032281.2 1 transcript variant 2 TM9SF3 transmembrane 9 superfamily member 3 NM_020123.3 1 TMEM106C transmembrane protein 106C, transcript variant 3 NM_001143843.1 1 TMEM11 transmembrane protein 11, transcript variant 1 NM_003876.2 1 TPI1 triosephosphate isomerase 1, transcript variant 2 NM_001159287.1 1 UBE2V1 ubiquitin-conjugating enzyme E2 variant 1, transcript variant 4 NM_001032288.1 1 UTP14C UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) NM_021645.5 1 UTP18 UTP18, small subunit (SSU) processome component, homolog (yeast) NM_016001.2 1 VPS25 vacuolar protein sorting 25 homolog (S. cerevisiae) NM_032353.2 1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, YWHAZ NM_001135702.1 1 zeta polypeptide, transcript variant 6 ZC3HAV1 zinc finger CCCH-type, antiviral 1, transcript variant 1 NM_020119.3 1 ZNF131 zinc finger protein 131 NM_003432.1 1 ZNF24 zinc finger protein 24 NM_006965.2 1 ZRANB2 zinc finger, RAN-binding domain containing 2, transcript variant 1 NM_203350.2 1
DKFZp686L16108_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone - AL698446.1 1 DKFZp686L16108 5', mRNA sequence - in73d03.y1 HR85 islet Homo sapiens cDNA clone IMAGE:6127900 5' BU952081.1 1
95
- BY794947 Homo sapiens eye Homo sapiens cDNA clone HE0006.seq 5' BY794947.2 1
- chromosome 4 genomic contig, alternate assembly NW_001838902.1 1 - chromosome 12 genomic contig, GRCh37.p2 reference primary assembly NT_009775.17 1
- mitochondrion, complete genome NC_012920.1 1
aGene with which maximum homology is obtained using a megaBLAST search of the Human RefSeq database for each clone sequenced bThe number of clones found within the sequenced MOS library that were representative of the gene indicated
96 cDNA molecule evading elimination during the hybridization step in SSH.
Whilst the differential expression of such clones can be detected via Northern blot or RT-PCR, such an approach is extremely time consuming for subtracted libraries of considerable size (7, 59, 105, 130, 145, 149, 165, 173, 189, 210,
254). Thus, in an effort to reduce the presence of background clones within a subtracted library, Mirror Orientation Selection was employed (187).
Similar to the approach undertaken with the SSH library, the screening of 363 clones permitted the formation of a subtracted MOS library, with each clone undergoing sequencing analysis to identify the gene of origin. Once again the number of clones screened was chosen arbitrarily. Examination of the genes represented within the MOS clone library, which had been formed in order to identify over-expressed genes in IFN-! treated Huh-7 cells, revealed the isolation of a number of known IFN-! stimulated genes including: STAT1,
ADAR, ZC3HAV1, USP18, PLSCR1, IFIT1 (55, 96, 177, 265, 269). However, as the MOS clone library was found to represent 122 individual genes, the presence of 5 known differentially expressed genes (or ISGs) again raised the question as to whether the majority of genes isolated via MOS could justify their inclusion in a subtracted library that is meant to be representative of gene changes occurring in Huh-7 cells following IFN-! treatment. Conversely, the final subtracted MOS library retains a high level of complexity, maintaining one of the main advantages of the SSH method; the simultaneous isolation of many different sequences (59). It is interesting to note that no previously unidentified sequences (i.e. potential novel genes) were discovered through utilising the
SSH and MOS approaches. However, just because a novel gene may be
97 discovered through SSH or MOS, there is no reason to assume that it is likely to play a more important role in mediating the anti-replicon effects of IFN-! treatment than are known genes (137).
Closer examination of the clones isolated by MOS in this chapter highlights a number of interesting findings. Whilst the efficiency of the initial SSH subtractions was shown to be successful (fold decreases in background, and fold increases in target gene levels were obtained within the subtracted library – see Results section, Chapter 3) and all of the subtracted cDNA clones sequenced contain the predicted adaptor for MOS (NP2Rs), there were a number of indicators that MOS had failed to isolate only those genes differentially expressed in IFN-! treated Huh-7 cells.
i. The result of the MOS PCR reaction for the Human placental control
(spiked with HaeIII-digested bacteriophage !X174 DNA) displays
additional bands to those expected (see Figure 4.1). Rebrikov et al. (187)
have previously highlighted such a result, and demonstrated that a
reduction in the amount of HaeIII-digested bacteriophage !X174 DNA
used to spike the control ‘tester’ sample resulted in obtaining the binding
pattern expected when bacteriophage !X174 DNA is digested with
HaeIII enzyme. Whilst such an approach for improving the efficiency of
MOS subtractions is possible for control reactions, reducing the ‘level’ of
differentially expressed genes within the IFN-! treated Huh-7 ‘tester’
sample is not.
98
ii. There was no improvement in the enrichment of differentially
expressed genes (i.e. known ISGs) in the MOS subtracted library, in
comparison to that obtained when employing the SSH technique.
iii. Furthermore, as with SSH (Chapter 3), certain genes were found to be
overrepresented within the subtracted MOS library, a finding that has
previously been noted and identified as problematic by Lathia et al.
(136).
Interestingly, these observations have been identified to potentially arise from the addition of excess driver cDNA to the second hybridisation sample
(performed at the end of the SSH protocol). Rebrikov et al. (187) suggest that excess driver cDNA not be added during the second hybridisation step in order to reduce the appearance of background bands in the final MOS PCR product.
However, this modification to the SSH protocol is not highlighted in the later published protocol (189), nor was it incorporated in by Huang et al. (104).
Whilst the SSH and MOS approaches were successful in isolating a number of known ISGs, it should be noted that other known antiviral ISGs were not isolated using the SSH and MOS approaches presented here - for example the known ISGs RSAD2 (or Viperin), ISG15, ISG20 and EIF2AK2 are notably absent (45, 50, 66, 163). These genes may not have been uncovered by the
MOS approach simply because the total number of subtracted MOS clones screened was insufficient; however, it seems far more likely that the MOS technique failed to exclude false-positive clones from the final subtracted library less efficiently than anticipated (73).
99
To summarise, given that the ratio of known ISGs to other genes in the MOS subtracted library was not improved following the implementation of mirror orientation selection, it is not possible to conclude that the MOS approach has succeeded over SSH in either reducing the number of background clones, or increasing the number of true positive clones. As a result, the differential expressions of the SSH and MOS isolated clones will need to be verified by other means. Whilst the screening of clones isolated by the SSH and MOS techniques can be conducted using Northern blot hybridisation, such an approach is known to be labour-intensive and at times inefficient procedure, and not to mention impractical when dealing with a library of 172 individual genes.
Thus, the next step will be to utilise a cDNA microarray approach (in combination with RT-PCR) to identify the SSH and MOS isolated genes that are truly differentially expressed following the IFN-! treatment of Huh-7 cells, outlined in further detail in the next chapter.
100
CHAPTER 5 – CONFIRMATION OF DIFFERENTIAL GENE
ISOLATION
Introduction
As discussed in Chapter 3, suppression subtractive hybridisation (SSH) was employed to identify differentially expressed genes following the IFN-! treatment of Huh-7 cells because of its ability to identify both rare and novel genes (59, 91, 189). Whilst SSH is a powerful technique for comparing cDNA sequences from two separate populations, some of the clones produced by
SSH can arise from non-differentially expressed sequences, thereby giving rise to the isolation of false positive clones from the subtracted library (114, 173).
As discussed in Chapter 4, the current study employed mirror orientation selection (MOS) (187) subsequent to SSH to decrease the presence of false positives in the SSH subtracted library. However, it has been shown that at times, not all MOS subtracted libraries are themselves free from background clones (73, 213).
Thus, further refinement of genes isolated from the SSH and MOS approaches was required in order to better identify the differentially expressed genes following the IFN-! treatment of Huh-7 cells. Identification of differentially expressed clones from subtracted SSH and MOS libraries typically relies on the use of Northern blot analysis, however such an approach does not necessarily guarantee the removal of all false-positive clones, and is labour-intensive when
101 used to screen large numbers of genes (7, 59, 105, 130, 145, 149, 165,
173, 189, 210, 254, 257). Since microarrays enable the parallel, high- throughput detection and quantification of gene expression, the technology lends itself to the screening of clones identified through SSH and MOS (6).
Indeed SSH and microarray analysis have previously been successfully paired together to study gene expression profiles in various systems (6, 70, 83, 116,
157, 167, 190, 203, 208, 231, 233, 234, 257).
The aim of the present Chapter was to use microarray analysis to optimise the selection of ISG candidates from the cDNA clones isolated as part of the SSH and MOS approaches. RT-PCR was used to confirm the general validity of the microarray results before the microarray data was used as a filter to exclude candidate ISGs that were not truly differentially expressed (i.e false positives) from the SSH and MOS subtracted libraries.
Materials and Methods
RNA Isolation
Huh-7 cells were seeded in 225 cm2 tissue culture flasks (Corning Inc., Corning,
NY) at a density of 1x107 cells/flask. Following a 24 hr incubation period, cells in the ‘treated’ flask had the existing growth medium removed and replaced with fresh growth medium containing recombinant human IFN-alpha 2b (PBL
Biomedical Laboratories, Piscataway, NJ) at a final concentration of 100 U/mL.
The cells in the ‘untreated’ flask simply had the growth media exchanged. Six hours after IFN-! treatment, Huh-7 cells were trypsinised, re-suspended in
102 culture medium and harvested by centrifugation (200 " g for 5 min). Cell pellets were washed twice with sterile PBS (Gibco, Carlsbad, CA), frozen in liquid-Nitrogen and stored at -80°C. Total cellular RNA was extracted from frozen cell pellets using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, and included DNase I treatment on column (15 min at RT).
Microarray Hybridization
Total cellular RNA (15 µg) isolated from IFN-! treated (100 u/mL for 6 hr) and untreated Huh-7 cells was provided for microarray analysis, performed at the
Australian Genome Research Facility (AGRF, Melbourne, Australia). RNA quality and quantity was confirmed using the Agilent Bioanalyser 2100 (Agilent
Technologies Inc., Santa Clara, CA). Gene expression profiles for each sample were determined using an Affymetrix® Human Genome (HG) U133 Plus 2.0
GeneChip® (Affymetrix, Santa Clara, CA). Sample preparation, hybridisation to
Affymetrix® GeneChip®, scanning and data acquisition were performed by
AGRF according to the procedures detailed in the GeneChip® Expression
Analysis Technical Manual (Affymetrix, 2005). Briefly, 7 µg of the total RNA provided to AGRF was reverse-transcribed to double-stranded cDNA by first and second-strand DNA synthesis performed with the Affymetrix One-Cycle cDNA Synthesis kit (Affymetrix, Santa Clara, CA). The cDNA was purified using the Affymetrix Sample Cleanup kit (Affymetrix, Santa Clara, CA) and then subjected to an in vitro transcription reaction using the Affymetrix IVT Labelling kit (Affymetrix, Santa Clara, CA) to produce biotinylated cRNA, which was subsequently fragmented (50 – 200 bp size range) by metal-induced hydrolysis.
103
The fragmented labelled cRNA was purified with the Affymetrix Sample
Cleanup kit and hybridised to the GeneChip® probe array during a 16 hr incubation (45°C). Following hybridisation, each probe array underwent automated washing and staining steps, before being scanned with the
Affymetrix® GeneChip® Scanner 3000.
The image obtained from scanned probe arrays was acquired using the
Affymetrix® GeneChip® Operating Software (GCOS), converting the signal derived from each probe set into a raw intensity value. Probe set values were quantile normalised with the aid of RMAexpress software (28). Probe sets with raw intensity values below 50 intensity units following IFN-! treatment were called ‘absent’ and disregarded from further analysis. The normalised data was then log2 transformed as a ratio of ‘Treated’ (IFN-! treated Huh-7 cells) to
‘Untreated’ (Non-IFN-! treated Huh-7 cells). To identify the probe sets representing the gene of interest, each Affymetrix probe set was mapped to its corresponding gene symbol by using the GeneAnnot search engine, Version
2.0 (http://genecards.weizmann.ac.il/geneannot/index.shtml) (40).
Quantitative Real-time PCR Analysis
The expression level of 84 genes whose expression is controlled by or involved in cell signalling mediated by interferon ligands and receptors, was profiled using the Human Interferons and Receptors RT" Profiler™ PCR Array
(SABiosciences, Frederick, MD). Total RNA isolated from IFN-! treated (100
U/mL for 6 hr) and untreated Huh-7 cells, was used for first strand synthesis and RT-PCR reactions as described in the manufacturers instructions. Briefly, 1
104
µg of total RNA of each Huh-7 sample was mixed with 5X RT Buffer 3, P2
Primer and RT Enzyme Mix 3. Water was added to a final volume of 20 µL – after which the first strand cDNA synthesis reaction was incubated at 42°C for
15 min, followed by an incubation at 95°C for 5 minutes. Each sample was then diluted with an additional 91 µL of H2O.
An experimental cocktail was then prepared in which the diluted first strand cDNA synthesis reaction was added to 2X SABiosciences RT2 qPCR Master
Mix and water. Following this, 25 µL of the experimental cocktail was added to each of the appropriate wells of a Human Interferons and Receptors RT"
Profiler™ PCR Array plate, which was run on a Stratagene Mx3000p (Agilent
Technologies, Inc., Santa Clara, CA) under the following cycling conditions: 10 min at 95°C, and 40 cycles of 15 s at 95°C, and 1 min at60°C. Data analysis of the RT-PCR run was then performed using the RT" Profiler PCR Array Data
Analysis Template v2.0 (SABiosciences, Frederick, MD).
Microarray Data Accession Number
Microarray data has been deposited with the Gene Expression Omnibus (GEO) database repository (http://www.ncbi.nlm.nih.gov/geo), and can be accessed using the GEO accession number GSE34022.
Results
105
Microarray Analysis of IFN-! Treated Huh-7 Cells
Microarray analysis was performed to identify which genes isolated through the
SSH and MOS approaches, underwent increases in expression following IFN-! treatment. Total RNA isolated from IFN-! treated and untreated Huh-7 cells was used to probe an Affymetrix® Human Genome (HG) U133 Plus 2.0
GeneChip®.
RT-PCR of IFN-! Treated Huh-7 Cells
Before the microarray data was used to filter the SSH and MOS gene lists, an
RT-PCR array examining 84 genes involved in IFN mediated cell signalling pathways was performed. Control RT-PCR reactions performed as part of the
Human Interferons and Receptors RT" Profiler™ PCR Array plate, showed that first strand synthesis had been conducted successfully, with no genomic DNA contamination detectable in the RNA samples used. Additionally, the RT-PCR reactions examined a number of house keeping genes (B2M, RPL13A, G3PDH and ACTB), which recorded unchanged gene expression levels following the
IFN-! treatment of Huh-7 cells (results not shown).
Correlation Analysis
A non-parametric (or Spearman correlation) analysis was then performed to compare fold changes for 47* genes present on the Human Interferons and
* Of the original 84 genes present on the Human Interferons and Receptors RT" Profiler™ PCR Array plate, 33 genes were omitted from the correlation analysis performed above as the probe intensity values recorded were ‘absent’ for both the untreated and IFN-! treated Huh-7 cell samples, whilst an additional 4 genes were without representation on the Affymetrix® HG U133 Plus 2.0 GeneChip®.
106
Receptors RT" Profiler™ PCR Array plate with fold-changes measured through microarray analysis (see Figure 5.1). A significant positive correlation was found to exist between the two data sets, indicating that the expression levels changes detected as a result of the IFN-! treatment of Huh-7 cells, as measured by microarray analysis, was confirmed via the more sensitive RT-
PCR technique. Additionally, there was one gene, interferon (alpha, beta and omega) receptor 1 (IFNAR1 – highlighted in green in Figure 5.1), within this set that was found to be up-regulated via RT-PCR analysis, but for which a fold decrease was recorded when observed using the microarray data.
Identification of ISGs Within the SSH and MOS Libraries
Having verified that the microarray results were indicative of the changes that occur in Huh-7 cells following IFN-! treatment, the genes identified in the SSH and MOS subtracted libraries were then cross-referenced with the results of the microarray analysis. It should be noted that all of the SSH and MOS genes were represented, and detectable via microarray analysis. Thus, with no change in gene expression being measured via microarray analysis following IFN-# treatment, it was possible exclude ~95% of the SSH and MOS genes (171 out of 178) from further analysis on the basis that they were not differentially expressed and thus likely to represent false-positive or ‘background’ clones.
Conversely, 12 clones were identified to represent genes that experienced changes in expression levels following the IFN-# treatment of Huh-7 cells. After accounting for multiple clones representing different fragments of the same
107
Figure 5.1 Spearman correlation of RT-PCR and Microarray data. Microarray and RT-PCR reactions were conducted using total cellular RNA extracts arising from differing aliquots of the same RNA samples from either IFN-! treated (100 U/mL of IFN-! for 6 hrs) or untreated Huh-7 cells. Each data point in the above graph represent fold changes for the same gene. The green data point above indicates the result obtained for the IFNAR1 gene. Statistical significance was determined using a two-tailed t-test.
transcript, seven genes retrieved from the SSH and MOS subtracted libraries, were identified as candidate anti-HCV replicon ISGs (see Table 5.1).
Discussion
Having initially employed SSH and MOS to identify differentially expressed genes in IFN-! treated Huh-7 cells, the work presented in this chapter was undertaken to further refine the gene lists, ultimately leading to the identification
108
Table 5.1 Differentially expressed genes represented within subtracted SSH and MOS clone libraries.
Region Size c Change Gene a b % Complementarity d Covered (bp) (Log2)
153 - 865 713 99 IFIT1 862 - 1523 662 100 6.9 1521 - 1876 356 99
ZC3HAV1 3993 - 4777 785 99 2
175 - 463 289 100 PLSCR1 3 723 - 860 138 99
484 - 1934 1451 98 STAT1 2.8 3343 - 3760 418 99
ADAR 4671 - 5575 905 99 1
780 - 1160 381 99 USP18 2.6 1384 - 2037 654 99
OAS2 1043 - 1437 395 99 1.4
a Region of gene from which the SSH/MOS clone arises b Size of gene fragment recovered from SSH/MOS clone c Percentage of complementarity between the SSH/MOS clone sequence and the corresponding gene sequence as provided by NCBI d Data is derived from the average intensities of microarray probe set(s) representing each gene, and is presented as a Log2 transformed ratio of ‘IFN-# treated’ relative to ‘untreated’ cells
of 7 genes from the subtracted SSH/MOS libraries that were differentially expressed following the IFN-! treatment of Huh-7 cells.
Prior to using microarray analysis to filter out ‘background’ clones from the SSH and MOS libraries, it was necessary to validate the microarray data. Whilst microarray analysis is primarily useful as a screening tool, the data obtained from RT-PCR is more accurate (203). In comparing the microarray and RT-PCR data generated for the same set of genes a non-parametric, or Spearman, correlation analysis was employed as it does not assume that the data being
109 correlated is normally distributed. Spearman correlation analysis is equivalent to ranking the expression levels of genes and then finding the
Pearson correlation of these ranks (128). Comparing the microarray and RT-
PCR approaches in this manner revealed that those genes demonstrating increased expression following IFN-! treatment as measured by microarray analysis were largely confirmed to also experience IFN-! mediated up- regulation through the use of the more sensitive RT-PCR technique (except in the case of IFNAR1). Thus, it was possible to use the results of the microarray analysis to identify which genes in the SSH/MOS subtracted library experienced changes in expression following IFN-! treatment.
The approach described above is slightly different to that undertaken by other researchers, who typically couple SSH and microarray analysis directly, whereby clones isolated from the SSH approach are processed to generate probes that are spotted onto an array slide. This subtracted array is then hybridized to RNA samples identifying the clones representative of genes that experience changes in expression between the two samples being compared
(70, 83, 157, 167, 190, 203, 208, 233, 234, 241, 257). Such an approach is postulated to have a number of advantages over the use of the SSH/MOS and microarray techniques separately. In particular it is argued that by arraying the subtracted clones, rapid screening of the SSH and MOS libraries, with the elimination of many false positives, is possible. Additionally, with the SSH and
MOS approaches there is always the possibility for the identification of novel transcripts, which are not represented on commercially available microarrays
(83). Conversely, it can be argued that when SSH and MOS subtracted clones
110 are used to generate microarray probes, the cDNA size and mRNA abundance of these subtracted clones can affect the reliability of identifying differentially expressed genes (257). With the sequencing analysis of SSH and
MOS clones isolated as part of this PhD project not identifying the presence of any clones representing novel transcripts, and since all of the genes identified in the subtracted library were represented on the HG-U133 plus 2.0 Affymetrix array chip, it was deemed unlikely to be advantageous to proceed with a combinatorial approach, rather than to perform the SSH/MOS and microarray techniques separately.
By applying a cut-off of a two-fold increase in gene expression following IFN-! treatment (as measured by microarray), seven genes represented in the
SSH/MOS library were identified to be differentially expressed, and by extending the hypothesis, potential anti-replicon effectors of IFN-! treatment.
The genes identified included: adenosine deaminase, RNA-specific (ADAR); interferon-induced protein with tetratricopeptide repeats 1 (IFIT1); 2’-5’- oligoadenylate synthetase 2, 69/71 kDa (OAS2); Phospholipid scramblase 1
(PLSCR1); signal transducer and activator of transcription 1 (STAT1); ubiquitin specific peptidase 18 (USP18); zinc finger CCCH-type, antiviral 1 (ZC3HAV1).
Similar to the observations made by Schreiter et al. (205), a number of the above genes were represented by several different clones. This is understood to be a direct result of using the four-base cutter, RsaI, at the start of the SSH protocol and results in clones containing different fragments of the same gene.
The genes ADAR, IFIT1, OAS2, PLSCR1, USP18 and ZC3HAV1 have all
111 previously been shown to increase in expression following IFN-! stimulation
(29, 158, 206). Additionally, each of these genes has also been demonstrated to contribute to producing an anti-viral state within an IFN-! treated cell, albeit by different means and against different types of viruses (29, 81, 121, 158,
196). By contrast, STAT1, which has been shown to exhibit elevated expression following IFN-! treatment, is a key molecule within the Interferon signalling cascade but with no evidence of direct antiviral activity (196).
By comparing the RT-PCR and microarray data, a number of potential limitations of the chosen ISG screening strategy were revealed. First, microarrays are not always able to detect the differential expression of genes correctly. Thus, there exists the potential for some anti-replicon genes, present in the SSH and MOS lists to be excluded form further analysis based on the screening system employed. This is evident in Figure 5.1, which shows that the gene IFNAR1 (see single green data point in lower right quadrant) was found to exhibit increased expression following IFN-! treatment when examined by RT-
PCR, but was found to exhibit a slight decrease in its expression level following
IFN-! treatment by microarray analysis. However, as this has occurred for just the one gene out of 47 analysed, it was deemed unlikely that using a microarray screening approach would overly restrict the final list of candidate genes.
The second potential limitation of the approach employed is that relying on microarray data can result in too many genes being taken through to the next stage of analysis (i.e. false positive genes may still not be completely omitted).
This can be seen in Figure 5.1 (upper left quadrant), where there are a number
112 of genes that were found by microarray to have increased in expression following IFN-! treatment, but were shown to actually decrease in expression when analysed by RT-PCR. This problem is unlikely to be significant however, as the aim was to simply narrow down the options from the SSH and MOS screens to filter out as many ‘background’ clones as possible, in order to end up with a workable number of genes to assess for anti-replicon activity in subsequent experiments.
Similar to the work presented here, Klebig et al. (123) utilised the approach of screening SSH clones via microarray analysis to identify differentially expressed genes. However, they argue that using the SSH and microarray techniques independently is not suitable, since such an approach resulted in the identification of two sets of non-overlapping genes, with only 2 out of 263 genes being identified as common to both approaches. This low rate of convergence between the two techniques, in their hands, was attributed to some of the SSH isolated genes being novel, in addition to other ‘known’ isolated genes not being represented on the microarray chip. Additionally, they identified that a significant number of SSH genes were not identified as being differentially expressed via microarray analysis despite the presence of probe sets for these genes on the microarray – a result similar to that witnessed also by Cao et al. (38). This latter finding is indeed another disadvantage when employing microarray analysis, and is primarily related to the insensitivity of arrays to identify genes expressed at low levels, among other technical issues (38, 123). In contrast to the findings of Klebig et al. (123) however, no SSH/MOS clones were identified to be unrepresented on the HG-U133 Plus 2.0 array chip, and analysis of the
113 microarray data revealed that for each of the SSH and MOS subtracted genes examined, the probe signal intensities were above the Affymetrix cut-off of 50 intensity units (data not shown). These findings, in addition to the positive correlation shown to exist between the microarray and RT-PCR data sets, would therefore suggest that the independent combination of the SSH/MOS and microarray techniques is suitable for the purpose of identifying genes within
Huh-7 cells that are differentially expressed following IFN-! treatment.
In conclusion, the current chapter has shown that coupling SSH/MOS and microarray analysis is a viable approach to isolating and identifying differentially expressed genes following the IFN-! treatment of Huh-7 cells. The strategy used resulted in the identification of ADAR, IFIT1, OAS2, PLSCR1, STAT1,
USP18 and ZC3HAV1 as genes that are differentially expressed in Huh-7 cells following IFN-! treatment. This list of genes (whilst obviously not a comprehensive list of ISGs) may well represent a number of the key factors responsible for mediating the anti-replicon effects of IFN-! treatment. However, it should be remembered that changes in mRNA expression do not necessarily correlate with changes in the corresponding protein expression (209), thus the examination of mRNA expression is best combined with studies of resulting phenotypic changes in order to identify anti-replicon IFN-! stimulated genes; this functional screening is to be conducted in a novel manner, by linking the end products of the SSH and MOS approaches with the RNA interference
(RNAi) pathway, and is discussed in the following chapter.
114
CHAPTER 6 – VALIDATION OF ANTI-HCV REPLICON
ACTIVITY
Introduction
As described in Chapters 3 and 4, the techniques of SSH and MOS were used to identify a large number of partial length clones representing genes with differential expression in IFN-! treated and untreated Huh-7 cells. As SSH and
MOS both require validation of the genes identified (i.e. the removal of so called
‘background clones’ representing genes that are not truly differentially expressed), microarray analysis and RT-PCR were combined to enable the identification of only those SSH and MOS isolated genes that were genuinely differentially expressed following the IFN-! treatment of Huh-7 cells (as discussed in Chapter 5). This lead to the identification of seven interferon stimulated genes (ISGs) as candidates for testing the hypothesis that differentially expressed genes identified through the SSH and MOS approaches, play key roles in mediating the anti-replicon effects of IFN-! treatment in Huh-7 Luc cells.
RNA interference (RNAi) is a gene-specific technology that can be used to decrease the abundance of target RNA transcripts in the cells of many different organisms (207). A key advantage of the RNAi screening of ISGs for anti-viral activity is that any requisite protein should be revealed as a screen hit, regardless of whether it acts alone, or as an obligate partner in a multi-protein complex – a feature that is in direct contrast to “knock-up” studies, where any
115 such proteins could be missed when over-expressed in isolation. However, the generation of small interfering RNA (siRNA) libraries for investigation of gene function, requires careful consideration of possible sequence variations in the target transcripts between cell lines, which could adversely affect gene silencing. Furthermore, siRNA molecules can generate ‘off-target’ effects through microRNA-like suppression of protein translation (24). One strategy with the potential to overcome both of these limitations is to generate siRNA pools by Dicer digestion of long dsRNA generated from the target transcript, especially when the template is cloned from the target cells themselves (see
Figure 1.5 in General Introduction). The presence of a pool of siRNA molecules, with each siRNA at a very low concentration, ensures combined coverage of large sections of the target transcript and reduced likelihood of significant off-target effects (169).
The development of the subgenomic replicon system in 1999 by Lohman et al.
(153), and the subsequent development by Vrolijk et al. (243) of a sensitive bioassay in which Huh-7 cells stably express a sub-genomic HCV replicon that carries a firefly luciferase reporter gene (Huh-7 Luc cells), provides access to a rapid quantitative assay that permits the measurement of luciferase reporter gene activity, and by extension a direct correlation to HCV replicon RNA replication levels within the Huh-7 Luc cells. Additionally, transfection of dsRNA into these cells has been shown not to elicit a stress response and IFN production (85), which is a major possible confounder in many other cell-based systems (117).
116
The aim of the present chapter was to identify whether the SSH/MOS subtracted genes identified as ISGs, were required for the anti-replicon effects observed following IFN-! treatment of Huh-7 Luc cells. This was conducted through the implementation of a novel functional genomic screen, whereby the end products of SSH and MOS were linked together with the RNAi pathway.
The generation of multiple siRNAs for each partial length ISG clone isolated was conducted via recombinant Dicer digestion of in vitro transcribed dsRNA, to produce siRNA pools. Following this, the generated siRNAs were transfected into replicon bearing Huh-7 Luc cells, and following IFN-! treatment, the resultant luciferase levels were quantified. Genes that play crucial roles in mediating the anti-replicon effects of IFN-! treatment were considered to be those for which siRNA knock-down resulted in an increased ability of the replicon to survive the effects of IFN-! treatment.
Materials and Methods
d-siRNA Generation
Generation of dual-stranded siRNAs (d-siRNA) was performed using the Dicer siRNA Generation Kit (Genlantis, CA, USA), utilising clones representing ISGs isolated from the SSH and MOS libraries (which were given numerical identifiers and tested in a blinded manner) along with two controls: Green fluorescent protein (GFP; an irrelevant control; supplied as part of the Dicer siRNA Generation Kit), and firefly luciferase (positive control; extracted from the
Huh-7 Luc cells). Briefly, primers were generated that contained T7 RNA polymerase promoter sites (in bold) and were complementary to the pCR2.1-
117
TOPO vector over 20 bases (underlined). These primers were then used to amplify and add dual T7 promoter elements at the 5’ and 3’ ends of each clone outlined above: T7-TOPO2.1_Forward primer 5’-
GCGTAATACGACTCACTATAGGGAGAGCTCGGATCCACTAGTAACG-3’; and T7-TOPO2.1_Reverse primer 5’-
GCGTAATACGACTCACTATAGGGAGAAGTGTGATGGATATCTGCAG-3’.
The PCR reaction used to generate the dual-T7 ISG transcripts (along with controls described above) consisted of: 10 min at 95°C, and 25 cycles of 30 s at
95°C, 30 s at 65°C, 1 min at 65°C. Each PCR product was then purified via ethanol precipitation as outlined in the Dicer siRNA Generation Kit User Manual.
Double-stranded RNA was generated by combining 1 µg of the purified dual-T7 tagged PCR product, along with NTP mix (Genlantis, San Diego, CA), the T7
Reaction buffer (Genlantis, San Diego, CA), T7 Enzyme Mix (Genlantis, San
Diego, CA) and Nuclease-free water (Genlantis, San Diego, CA); incubated for
4 hrs at 37°C. Recombinant Dicer Enzyme (1 unit) (Genlantis, San Diego, CA) was used to digest the purified dsRNA in a reaction that contained 1 µg dsRNA,
400 µM ATP, 1 mM MgCl2, the Dicer reaction buffer and Nuclease-free water.
This reaction was incubated over night at 37°C and stopped the following day by adding the Dicer stop solution. Removal of remaining template DNA was achieved through the addition of 1 µL of DNase I (Genlantis, San Diego, CA) and incubated for 15 min at 37°C. Generation of dicer siRNAs was confirmed by agarose gel electrophoresis. Samples were purified by column chromatography using columns supplied as part of the Dicer siRNA Generation Kit (Genlantis,
San Diego, CA) and resultant d-siRNA pools quantified by UV spectrophotometry.
118
Cell Tansfection
Dicer generated d-siRNA transfections were performed using Lipofectamine#
2000 transfection reagent (Invitrogen, Carlsbad, CA) at a ratio of 1 µL in 150 µL
Opti-MEM$ I Reduced Serum Medium (Gibco, Carlsbad, CA) mixed with 400
nM of dicer d-siRNA per well of a 96 well microplate. For dicer d-siRNA
transfection experiments, transfection medium was removed twenty-four hours
after transfection and replaced with fresh growth medium containing
recombinant Human IFN-!2b (PBL Biomedical Laboratories, Piscataway, NJ) at
a final concentration of 2 U/mL. All experiments were conducted in triplicate.
Results
Assay Development
A. Identification of Optimal Cell Density and IFN-!2b Dose
Prior to validating the potential anti-HCV replicon activity of the ISGs identified
in Chapter 5 (ADAR, IFIT1, OAS2, PLSCR1, STAT1, USP18 and ZC3HAV1), it
was necessary to determine optimal assay conditions. Notably, there were two
key requirements that need to be considered:
I. The identification of a cell seeding density that provides a sufficiently robust
luciferase activity reading; and
II. The identification of a minimal IFN-! treatment level that would suppress
replicon expression by ~90% in Huh-7 Luc cells.
119
To determine the appropriate seeding density and IFN-! treatment conditions, Huh-7 Luc cells were seeded at varying densities, and following treatment with IFN-! at varying concentrations (2 U/mL, 1 U/mL, 0.6 U/mL, 0.4
U/mL and 0.2 U/mL). No impact on cell viability (as measured via the CellTiter-
Blue assay) was detected for the different treatment conditions examined
(Figure 6.1(A)). As expected, the assessment of resultant luciferase activity under the same IFN-! treatment conditions showed a negative correlation between IFN-! concentration and luminescence – a finding indicative of increased replicon survival at lower IFN-a concentrations (Figure 6.1(B)).
!
From these results it was clear that using a 2 U/mL IFN-! dose resulted in the desired ~90% suppression of luciferase signalling (a cut-off chosen to keep the resulting luminescence above the minimum detectable level). Furthermore, an examination of the raw luciferase read signals (data not shown), identified that seeding the Huh-7 Luc cells at 7500 cells per well, provided the optimal conditions under which robust luciferase signals were obtained amongst the different cell seeding densities examined.
!
B. Control Dicer d-siRNA Pool Development
A recombinant dicer generated ‘positive control’ siRNA pool was developed to identify a suitable concentration at which dicer generated d-siRNAs should be transfected into Huh-7 Luc cells, before screening of the SSH/MOS ISGs could take place. Additionally, a positive control d-siRNA pool would enable the
120
Figure 6.1 Optimisation of cell seeding and treatment parameters for validation of ISG anti-replicon activity assay. Huh-7 Luc cells were seeded at varying densities (as indicated) in 96-well plates, and 24 hrs post seeding the
121 cells were treated with varying concentrations of recombinant Human Interferon Alpha 2. (A - D) Results of cell viability assay as measured 24 hrs post Interferon treatment. (E - H) Luciferase activity measured 24 hrs post Interferon treatment. Each data point represents the mean of triplicate experiments. Error bars indicate standard deviation.
evaluation of target gene silencing in the Huh-7 Luc cells by dicer generated d- siRNAs.
To develop the ‘positive control’, the first step was to clone the firefly luciferase gene, as found within the Huh-7 Luc replicon cells (243), into a plasmid vector.
Following isolation of a clone containing the Huh-7 Luc cell luciferase reporter gene, a dual-T7 promoter PCR amplification was performed. The resultant PCR product was then used to generate double-stranded luciferase RNA, which was subsequently digested with recombinant Dicer enzyme to produce a pool of siRNAs (~22bp) specific for the firefly luciferase reporter gene in Huh-7 Luc cells.
C. Identification of Optimal d-siRNA Transfection Conditions
Following transfection of the control dicer generated luciferase d-siRNAs into
Huh-7 Luc cells at varying concentrations (5 nM, 10 nM, 20 nM, 30 nM and
40nM) the resultant data identified that the dicer generated luciferase d-siRNA pools were capable of ablating luciferase gene expression, thereby decreasing luminescence (see Figure 6.2(A)). No decrease in cell viability was observed
(see Figure 6.2(B)). It was determined that 40 nM of dicer generated d-siRNA was to be used in future experiments, as this was the maximal siRNA dose
122
Figure 6.2 Optimisation of dicer generated siRNA transfection. Huh-7 Luc cells were transfected with differing concentrations of positive (siT7_huh-7_Luc) and negative (siT7_GFP) control dicer generated siRNAs. (A) Luciferase activity measured 24 hrs post siRNA transfection. (B) Results of cell viability assay as measured 24 hours post siRNA transfection. Each data point represents the mean of triplicate experiments. Error bars indicate standard deviation.
examined that delivered an approximate 90% knockdown of the luciferase signal, whilst exhibiting minimal cytotoxicity.
123
Screening of Dicer Generated ISG d-siRNAs
Having identified and optimised the required assay parameters, analysis of the seven ISGs isolated through the SSH and MOS approaches was conducted to assess whether any of these genes were critical mediators of the anti-HCV replicon effects of IFN-! treatment. The 12 partial length clones (Table 5.1 in
Chapter 5), representing seven different ISGs, were used as templates in the generation of recombinant dicer digested d-siRNA pools. To assess whether down regulation of these seven ISGs would diminish the ability of IFN-! treatment to successfully eliminate the HCV replicon, Huh-7 Luc cells were transfected with each d-siRNA pool and treated with 2U/mL IFN-!. Increased replicon levels (as assessed by luciferase readout) were recorded for two genes
(IFIT1 and ZC3HAV1) implicating them as significant mediators of the anti-HCV replicon activity of IFN-! treatment in the model employed (ANOVA, p < 0.05;
Figure 6.3). That is, by silencing IFIT1 and ZC3HAV1 there was a resultant decrease in the ability of IFN-! treatment to efficiently eliminate the HCV replicon in Huh-7 Luc cells.
It should be noted that the d-siRNA pools targeting the same gene but arising from different clones (IFIT1, PLSCR, and USP18) were not always consistent in their ability to abrogate the effectiveness of IFN-! treatment in transfected Huh-
7 Luc cells – this is particularly evident amongst the results seen in the case of the three different IFIT1 siRNA pools. This is a somewhat expected result, as differences in the suppression efficacy of different d-siRNA pools would lead to variations in gene knockdown.
124
Figure 6.3 Identification of potential anti-HCV replicon ISGs from high priority clones identified within SSH and MOS subtracted libraries. Huh-7 Luc cells were transfected with the indicated d-siRNA. 24 hours post transfection, cells were treated with 2 U/mL recombinant Human Interferon Alpha 2. (A) Cell viability measured 24 hours post Interferon treatment. (B) Luciferase activity measured 24 hours post Interferon treatment. Values are expressed as a ratio of luciferase activity for each d-siRNA compared the ‘negative’ (d-siGFP) control (* denotes p < 0.05 as compared to GFP). Each data point represents the mean of triplicate experiments. Error bars indicate standard deviation. Statistical significance was determined by two-way ANOVA using a Dunnett’s Multiple Comparison post-test.
125
Discussion
By undertaking the novel approach of linking the SSH and MOS techniques with the production of siRNAs via recombinant dicer digestion, it was possible to exploit the SSH and MOS screens for more than just their ability to identify both known and novel differentially expressed genes following IFN-! treatment. As the end products of the SSH/MOS approaches were partial length clones representing differentially expressed genes, it was reasoned that these products could be used as molecular biological tools for subsequent functional validation concerning the potential anti-replicon activity of the genes identified. Whilst the
SSH and MOS approaches did not prove to be as robust and sensitive as had been initially hoped, a number of genes were identified for further analysis. The partial length SSH and MOS clones were used as templates to generate siRNA pools, to be transfected into HCV replicon bearing Huh-7 Luc cells to mediate targeted gene knockdown, and thus identify critical mediators of the anti-HCV effects of IFN-! treatment.
Using the above approach, the genes ADAR, IFIT1, OAS2, PLSCR1, STAT1,
USP18 and ZC3HAV1 were all examined for their role in mediating the anti-
HCV replicon effects of IFN-! treatment. Conversion of the representative clones for the above seven genes to d-siRNA pools through the use of recombinant Dicer enzyme, followed by their subsequent transfection into Huh-
7 Luc cells, resulted in the identification of IFIT1 and ZC3HAV1 siRNAs as significantly decreasing the effectiveness of IFN-! treatment – implying that these two genes are key mediators of the anti-replicon effects of IFN-! treatment in vitro.
126
IFIT1, and its gene product p56, are strongly induced by dsRNA, viruses and
IFN (82). IFIT1 belongs to a family of genes that contain one or more tetratricopeptide (TPR) motifs which allow binding of p56 to protein complexes, with the best-studied partner being the translation initiation factor eIF3 – in particular the “e” subunit, an event that has been shown to result in the inhibition of translation initiation (132, 197). p56 has been implicated in mediating the antiviral actions of IFNs against a number of different viruses including West Nile Virus, Lassa Virus and HCV (186, 244, 247).
To the best of my knowledge, ZC3HAV1 has not previously been implicated in mediating the anti-HCV effects of IFN-! treatment. Interestingly, whilst
ZC3HAV1 has previously been described as an antiviral ISG, little is known about the role, if any, it plays in limiting the spread/replication of HCV infection
(158). Gao et al. (81) were the first to identify the rat orthologue, the zinc-finger antiviral protein (Zc3hav1), and its antiviral activity against the Retrovirus,
Murine Leukemia Virus. Subsequent investigations have revealed that Zc3hav1 and ZC3HAV1 exert antiviral actions across a number of different virus families, including multiple members of the Alphaviral and Filoviral families (20, 121, 155,
166). However, antiviral actions against the Vesicular Stomatitis virus,
Poliovirus, Herpes Simplex virus type 1, Human Immunodeficiency virus and the Flavivirus Yellow Fever virus were not found, leading to the conclusion that
Zc3hav1/ZC3HAV1 acts in a virus specific manner, rather than exerting broad antiviral actions (20, 90, 121, 155, 166). Interestingly, a recently published retroviral over-expression screen seeking to identify anti-viral effector ISGs
127
(204) did not identify ZC3HAV1 as having a role in IFN-! mediated clearance of HCV.
STAT1 presents an interesting case as it is both an ISG and is also responsible for mediating the signalling of IFNs (29). Thus, STAT1 exists in a critical position whereby a reduction in its expression level, or activity, can have a significant effect in limiting ISG expression and hampering the anti-HCV effects of IFN-! treatment (29). As STAT1 was isolated from the SSH/MOS techniques and put through the dicer assay, initially it was anticipated that STAT1 would became an intra-assay positive control. However, as witnessed above in the screening of SSH/MOS isolated genes, STAT1 knockdown was found not to limit the anti-HCV replicon effects of IFN-! treatment. Interestingly, Adach-Kilon et al. (2) have previously highlighted the possibility that siRNAs targeting STAT1 expression likely suppress the unphosphorylated version of the STAT1 protein, leaving phosphorylated STAT1 proteins capable of participating in IFN- mediated signalling, a finding that would account for the lack of decreased IFN-
! effectiveness following STAT1 knockdown observed above.
In conclusion, the current chapter has described the culmination of a systematic approach that coupled SSH/MOS, microarray, RNAi and the use of a bicistronic luciferase HCV replicon system to lead to the identification of ISGs that represent a number of key mediators of the anti-replicon effects of IFN-! treatment. This work resulted in the finding that the genes IFIT1 and ZC3HAV1 both contribute to the anti-replicon activity of IFN-! following treatment of Huh-7
Luc cells. Since the role of IFIT1 in the IFN-! induced suppression of HCV
128 replication is relatively well established (186, 247), further functional studies were focused on ZC3HAV1, as described in the next chapter.
129
CHAPTER 7 – ANTI-HCV REPLICON ACTIVITY OF ZC3HAV1
Introduction
The type I Interferon response provides the body with a rapid and effective system by which to protect itself from viral attack (206). IFN signalling leads to the transcriptional induction of hundreds of ISGs, and it is the proteins encoded by the ISGs that are largely responsible for mediating the antiviral actions of
IFN-! treatment (80). Despite this many of these genes remain substantially uncharacterised, especially with respect to the mechanism by which IFN-! treatment is able to limit HCV replication.
In Chapter 6, through the implementation of a novel functional genomic screen that paired partial length SSH/MOS clones with the RNAi pathway, the contribution of each SSH/MOS isolated ISG to the anti-replicon effects of IFN-! was evaluated. In particular, the genes interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) and zinc finger CCCH-type, antiviral 1
(ZC3HAV1), were identified as potentially critical anti-replicon ISGs since their silencing limited the effectiveness of IFN-! treatment. IFIT1 had previously been identified to be involved in mediating HCV clearance following IFN-! treatment (186, 247). By contrast, despite having demonstrable antiviral activity against a number of different viruses, ZC3HAV1 has not, to date, been implicated in limiting replication of HCV infection following IFN-! treatment.
130
Previous investigations concerning the antiviral activity of ZC3HAV1 have, for the most part, focused on the antiviral actions of the rat homologue
(Zc3hav1). Zc3hav1 has been shown to limit the replication of several different viruses, however it has also been shown that Zc3hav1 does not induce a general antiviral state, but rather exhibits antiviral activity against specific viruses in a cell-type specific manner (20, 81, 89, 155, 166). The human
ZC3HAV1 gene encodes two alternatively spliced isoforms that either lack (in the case of the ‘short’ isoform), or contain a carboxyl-terminal poly(ADP-ribose) polymerase (PARP)-like domain (‘long’ isoform) (121). Indeed, Kearns et al.
(121) were the first to demonstrate that the presence of the PARP-like domain in the human ZC3HAV1 ‘long’ isoform significantly enhanced antiviral activity.
Interestingly, Zc3hav1 resembles the human ZC3HAV1 ‘short’ isoform, as neither protein contains the C-terminal PARP-like domain. Similar to its rat orthologue, ZC3HAV1 has demonstrated virus- and cell-specific antiviral activity, limiting replication of the retrovirus Murine Leukaemia Virus (MLV), and the alphavirus Semliki Forest Virus (SFV). However there was no indication of antiviral activity directed against the Human Immunodeficiency Virus (HIV)
(121).
Having demonstrated increased viral replication (increased luciferase expression) in HCV replicon expressing Huh-7 Luc cells following the d-siRNA mediated knock-down of ZC3HAV1, the present work suggested that ZC3HAV1 may be involved in mediating the anti-replicon effects of IFN-! treatment. Thus, the aim of the current chapter was to both validate the critical role of ZC3HAV1 in HCV clearance by IFN-!, and to conduct preliminary investigations seeking
131 to gain a better understanding of the mechanism of the anti-HCV replicon activity of ZC3HAV1. This was initially achieved through the use of qRT-PCR, and synthetically generated siRNAs; following which ZC3HAV1 over-expression constructs, and Western blot analysis were utilized in order to provide further evidence for the anti-replicon activity of ZC3HAV1.
Materials & Methods
Cell Transfection and Treatment
For synthetically generated siRNA and plasmid DNA transfections, Huh-7 Luc cells were transfected using Lipofectamine# 2000 at a ratio of 1 µL in 50 µL
Opti-MEM$ mixed with 40 nM duplexed siRNA or 100 ng plasmid DNA respectively, as per the manufacturer’s recommendations. For transfections of plasmid DNA for Western analysis, Huh-7 cells were transfected using
Lipofectamine# 2000 at a ratio of 1 µL in 50 µL Opti-MEM$ mixed with 3 µg of plasmid DNA per well of a 6 well microplate, as per the manufacturer’s recommendations. For synthetic siRNA transfection experiments, transfection medium was removed twenty-four hours post-transfection and replaced with fresh growth medium containing recombinant Human Interferon Alpha 2 (PBL
Biomedical Laboratories, Piscataway, NJ) at a final concentration of 2 U/mL.
For plasmid transfection experiments, no IFN-! treatment was performed and the transfection medium was removed from the cells 24 h post-transfection and replaced with fresh growth medium. All experiments were conducted in triplicate.
132
Quantitative Real-Time PCR (qRT-PCR)
To assess ZC3HAV1 isoform expression levels in Huh-7 cells, total RNA was extracted from Huh-7 cells +/- IFN-! treatment (from three independent experiments) using the PureLink RNA Mini Kit (Invitrogen, Carlsbad, CA) in accordance with the manufacturers recommendations. First strand cDNA samples were synthesized using 3 µg purified total RNA with Oligo(dT)20
Primers (Invitrogen, Carlsbad, CA) and the SuperScript% III First-Strand
Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). qRT-PCR experiments were performed using the IQ Thermal Cycler – iCycler platform
(BioRad Laboratories, CA, USA). Primers for the ZC3HAV1 isoforms (Long isoform forward primer 5’-TGCGACAAGCCGTGCCTATG-3’; Long isoform reverse primer 5’- ACTGTGGAGGAGGGCTCGTG-3’; Short isoform forward primer 5’- GTTTGCTGACAGATGCTTGAGATG-3’; Short isoform reverse primer 5- GCTCAGACTTCCCTTTCAGAAAGA-3’) were used, along with the primers for the reference gene &-Actin (Sense control primer 5’-
GCTCGTCGTCGACAACGGCTC-3’ and Antisense control primer 5’-
CAAACATGATCTGGGTCATCTTCTC-3’) provided as part of the SuperScript%
III First-Strand Synthesis System for RT-PCR kit. qRT-PCR was performed using a iQ SYBR Green Supermix (BioRad Laboratories, Hercules, CA) which contains dNTPs, iTaq DNA polymerase, 6 mM MgCl2, SYBR Green I, fluorescein, and stabilizers. The thermal cycling program included a preliminary enzyme activation for 1 min at 95 °C, followed by 40 cycles of 30 s at 95°C, 30 s at 55°C, and 1 min at 72°C, and a melt curve running from 76°C–96°C. Data
133 analyses were performed using the data software equipped with the MyiQ
Single-Color Real Time PCR Detection System (version 1.0; BioRad
Laboratories, Hercules, CA) according to the manufacturer’s instructions.
Synthetic siRNA Design and Generation
Synthetic siRNAs targeting the ZC3HAV1 gene were synthesised by Sigma-
Proligo (Singapore). They were provided as deprotected and desalted, annealed duplexed RNA oligonucleotides (siRNA), with each strand composed of 22 nucleotides that included two (2’-deoxy)thymidines (dTdT) on the 3’ end.
Sequences for the antisense (‘guide’) strand for all siRNAs used in this chapter are listed in Table 7.1. Synthetic siRNA design was performed using the
BLOCK-iT™ RNAi Designer (Invitrogen; https://rnaidesigner.invitrogen.com/rnaiexpress/design.do). An ‘irrelevant’ control siRNA (siCNT3) that lacked homology to all known human sequences was included as a negative control in assays, while the positive control, siIRF9, was employed to specifically target IRF9 mRNA (Genbank accession number
NM_006084).
Plasmid Construction
For investigation of ZC3HAV1 anti-replicon activity, the pcDNA3.1(+)/HA/hZC3HAV1_L and pcDNA3.1(+)/HA/hZC3HAV1_S plasmids, which expressed the 5’ hemagglutinin (HA) epitope (YPYDVPDYA) tagged full- length human ZC3HAV1 long isoform and short isoform respectively, were constructed by PCR amplification of cDNA (2 min at 94°C, and then 35 cycles of 30 s at 94°C, 30 s at 55°C, and 3 min at 68°C) generated from pooled first-
134
Table 7.1 Synthetic siRNAs used for validation of dicer generated d- siRNA results.
Targeted mRNA siRNA Guide-strand Sequence (5’-3’)b Positiona Region siCNT3 N/A N/A AUGUAUUGGCCUGUAUUAG[dT][dT]
siIRF9-1 1230 - 1248 3’ UTR AAUGAGUCUACUUCAAAGG[dT][dT]
siZC3HAV1-1 1001 - 1019 CODING AAGAGGUCCUCUUGACUGC[dT][dT] siZC3HAV1-2 1435 - 1453 CODING UUGGGUCAGCAUCAUCUGC[dT][dT] siZC3HAV1-3 1637 - 1655 CODING AUGUGCUCAAAGUCCGUCC[dT][dT]
siZC3HAV1_Long-1 2212 - 2230 CODING UUACUCUGACAUAUUCUGG[dT][dT] siZC3HAV1_Long-2 3742 - 3760 3’ UTR AUUAACUCCAGUUGGUUGC[dT][dT] siZC3HAV1_Long-3 4339 - 4357 3’ UTR UUAAGCCAAGGAGUUGUGG[dT][dT] siZC3HAV1_Short-1 2217 - 2235 3’ UTR UAAUGCAAAUGGUAACUGC[dT][dT] siZC3HAV1_Short-2 2334 - 2352 3’ UTR AAAGCCCAGAGUAUUUAGG[dT][dT] siZC3HAV1_Short-3 2384 - 2402 3’ UTR UAUUCCUUAGGUGUACUGC[dT][dT]
a Targeted positions for the siRNAs homologous to the desired gene, numbered relative to the transcription initiation site for the respective gene b Sequences for the antisense (‘guide’) strands of each siRNA are listed 5’ to 3’. All siRNA consist of duplexed 19-mer RNA oligomers, with two-nucleotide 3’ overhangs of 2’- deoxythymidine
strand cDNA Huh-7 cell samples, using the primer sets: ZC3HAV1 5’ Primer 5’-
CAGGCGAATTCGCCAACCATGTATCCATACGATGTTCCAGATTACGCTGCG
GACCCGGAGGTGTGC-3 and ZC3HAV1_L 3’ Primer 5’-
TTCAGGATATCCTAACTAATCACGCAGGC-3’ for the long isoform; and the
ZC3HAV1_S 3’ primer 5’- TTCAGGATATCCTACTCTGGCCCTCTCTTCAT-3’ for the short isoform. The PCR products then underwent purification using the
PureLinkTM PCR Micro Kit (Invitrogen, Carlsbad, CA), which was followed by cloning into EcoRI-HF (New England Biolabs Inc, Ipswich, MA) and EcoRV-HF
(New England Biolabs Inc, Ipswich, MA) digested pcDNA3.1(+) DNA vector
(Invitrogen, Carlsbad, CA), the product of which was electroporated (2.5 kV, 5 ms) (Electroporator 2510; Eppendorf AG, Hamburg, Germany) into ElectroMAX
DH5!-E electrocompetent cells (Invitrogen, Carlsbad, CA). Bacteria were
135 allowed to recover for 1 hr at 37°C and plated onto kanamycin (50 µg/ml), selective X-Gal (20 µg/cm2) plates and incubated overnight at 37°C. Individual recombinant white colonies were grown in kanamycin selective LB medium for
24 hours at 37°C. Cells were harvested by centrifugation and plasmid DNA was purified using the QIAprep Spin Miniprep Kit (50) (Qiagen GmbH, Hilden,
Germany), following the manufacturer’s instructions. Following confirmation of gene sequence, large-scale plasmid purification of the pcDNA3.1(+)/HA/hZC3HAV1_L and pcDNA3.1(+)/HA/hZC3HAV1_S plasmids was conducted using the HiSpeed Plasmid Maxi Kit (QIAGEN, Hilden,
Germany) in accordance with the manufacturer’s recommendations.
Sequencing
Samples were supplied to The Ramaciotti Center (UNSW, Australia) at ~250ng of purified plasmid DNA, along with 5 pmol of sequencing primer (Table 7.2).
Sequencing reactions and cleanup were conducted using the BigDye
Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA) as per the manufacturer’s recommendations, with samples run on an Applied
Biosystems 3730 DNA Analyzer platform (Life Technologies, Carlsbad, CA).
Sequence analysis was performed using CodonCode Aligner software (Version
3.7.1.1; CodonCode Corporation, Deadham, MA) and resulting sequences aligned to the RefSeq RNA database using a BLAST algorithm.
136
Table 7.2 Oligonucleotides used in sequencing reactions for verification of HA-tagged ZC3HAV1 long and short isoform over- expression constructs. Name Oligo Sequence (5' to 3') Referencea HA-ZC3_SeqF1 CACGAACTCTCTGGACTGAACA D/I HA-ZC3_SeqF2 GATCTCACCCGCAAGTTCACGTAT D/I HA-ZC3_SeqF3 AAAAGCACTAGCAGCGGTCACA D/I HA-ZC3_SeqF4 CTGGCACATGGATTCAGTATGGAG D/I HA-ZC3_SeqF5 TTTATGCGACAAGCCGTGCCTA D/I HA-ZC3_SeqR1 TGTTCAGTCCAGAGAGTTCGTG D/I HA-ZC3_SeqR2 TGCTTGCTGTTGCAGATGTCCT D/I T7-Forward TAATACGACTCACTATAGGG Invitrogen BGH Reverse TAGAAGGCACAGTCGAGG Invitrogen
a D/I = Designed in-house
Western Blot Analysis
Forty-eight hours after transfection, cells were washed twice with PBS, and lysed using RIPA Buffer 1x (Pierce Biotechnology, Rockford, IL) containing the
Halt Protease Inhibitor Single-use Cocktail (100x) (Thermo Fisher Scientific,
Waltham, MA) as described within the user manual. Cells were harvested with a cell-scraper and cellular debris removed by centrifugation at 13,000 x g for 15 min. Total protein was quantitated using a Pierce BCA Protein Assay Kit (Pierce
Biotechnology, Rockford, IL) according to the manufacturers instructions. Total protein samples (7.5 µg) were denatured by heating at 95°C for 5 min in 1x sample loading buffer (Invitrogen, Carlsbad, Ca) containing 1x Reducing Agent
(Invitrogen, Carlsbad, Ca), and separated by electrophoresis on a Mini-
PROTEAN TGX Precast Gel, 10% (Bio-Rad Laboratories, Hercules, CA) run in
1x Tris/Glycine/SDS Buffer (Bio-Rad Laboratories, Hercules, CA). Samples were transferred to Trans-Blot Transfer Medium, Pure Nitrocellulose Membrane
(0.2µm) (Bio-Rad Laboratories, Hercules, CA) in 1x Tris/Glycine Buffer (Bio-
Rad Laboratories, Hercules, CA) containing 20% (v/v) methanol at 200 V for 1
137 hr. Membranes were blocked with a 5% Skim Milk PBS-T (0.1%) buffer
(PBS, pH 7.4 (Invitrogen, Carlsbad, CA); Tween 20 (Bio-Rad Laboratories,
Hercules, CA) ) for 1 hr at room temperature. Membranes were incubated for 1 hr at room temperature with each specific primary antibody diluted in 5% Skim
PBS-T (0.1%) at 1/5,000. Membranes were washed at room temperature in
PBS-T (0.1%) and then incubated for an additional 1 hr at room temperature with each specific secondary antibody diluted 1/20,000 in 5% Skim PBS-T
(0.1%). Membranes were washed again at room temperature in PBS-T (0.1%), prior to detection, which was performed using Immobilon Western
Chemiluminescent HRP Substrate (Millipore Corporation, Billerica, MA) on
Amersham Hyperfilm ECL (GE Healthcare, Buckinghamshire, UK). The antibodies used were: Purified Mouse Antibody Mono HA.11 (16B12) (Covance,
Princeton, NJ), Rat Anti Alpha Tubulin (AbD Serotec, Oxford, UK), Anti-mouse
IgG, HRP-linked Antibody (Cell Signalling, Danvers, MA) and Goat Anti-rat IgG,
HRP-linked Antibody (Santa Cruz Biotechnology, Inc, Santa Cruz, CA).
Results
Verification of ZC3HAV1 Induction Following IFN-! Treatment
With no primer sets for ZC3HAV1 present on the Human Interferons and
Receptors RT" Profiler™ PCR Array (Chapter 5), verification of ZC3HAV1 expression induction in Huh-7 cells following IFN-! treatment was achieved via qRT-PCR analysis, using total RNA extracted from IFN-! treated Huh-7 cells
(100 U/mL IFN-alpha 2b for 6 hr). Relative to an untreated control, the IFN-! treated cells demonstrated that the ZC3HAV1 Long isoform underwent an ~7-
138 fold increase in expression; whilst the ZC3HAV1 Short isoform demonstrated an ~13-fold increase in expression (data not shown).
Validation of ZC3HAV1 IFN-! Induced Anti-HCV Replicon Activity
To validate the observed IFN-! mediated anti-replicon activity of ZC3HAV1, synthetically generated siRNAs (21bp) targeting ZC3HAV1 were utilised to confirm the results previously observed when using recombinant dicer generated d-siRNAs. Three synthetic siRNAs were designed targeting a region common to both isoforms of the ZC3HAV1 gene; along with a ‘positive control’ siRNA targeting the IRF9 gene (siIRF9); and an ‘irrelevant control’ siRNA
(siCNT3), that did not contain target sites within the human transcriptome.
Transfection of the synthetic siRNAs did not significantly affect viability of the
Huh-7 Luc replicon bearing cells (see Figure 7.1(A)), whilst assaying the transfected cells 24 hrs post IFN-! treatment for luciferase activity revealed that transfection of the synthetic ZC3HAV1 siRNAs significantly elevated HCV replicon levels following IFN-! treatment, as compared to the irrelevant ‘control siRNA’ (ANOVA, p<0.05; see Figure 7.1(B)). This result is consistent with the data generated previously, where the novel approach of combining SSH/MOS clones with recombinant Dicer digestion to produce siRNA pools was shown to inhibit IFN-! mediated clearance of the HCV replicon when targeting the
ZC3HAV1 gene with dicer generated d-siRNA pools.
Isoform Specific Action
Since ZC3HAV1 is expressed as two separate isoforms in humans (generating proteins which differ at their carboxyl ends) the identification of a specific IFN-!
139
Figure 7.1 Validation of IFN-! induced anti-HCV replicon activity mediated by ZC3HAV1. Huh-7 Luc cells were transfected with 40 nM duplexed siRNA. (A) 48 hrs after transfection, cell viability was measured in transfected but untreated cells. (B) 24 hrs after transfection cells were treated with 2 U/mL recombinant Human Interferon Alpha 2, with Luciferase activity measured a further 24 hours after treatment. Values are expressed as a ratio of luciferase activity compared to the ‘irrelevant’ siRNA (siCNT3) control (* denotes p < 0.05 as compared to siCNT3). Each data point represents the mean of triplicate experiments. Error bars indicate standard deviation. Statistical significance was determined by two-way ANOVA using a Dunnett’s Multiple Comparison post- test.
140 induced anti-HCV replicon activity for each ZC3HAV1 isoform in Huh-7 Luc cells was evaluated. Synthetically generated siRNAs were again utilized, with three siRNAs designed to selectively target each ZC3HAV1 isoform.
Transfection of the isoform specific siRNAs resulted in no significant reductions to cell viability (Figure 7.2(A)). siRNAs targeting the long ZC3HAV1 isoform elevated viral replication beyond that observed in the irrelevant ‘control siRNA’ condition (see Figure 7.2(B)). Whilst this result was not found to be significant via ANOVA analysis, given that a similar response was observed with each of the three unique siRNAs targeting different regions of the ZC3HAV1 long genome, it is believed this response represents a genuine biological effect. By contrast, Huh-7 Luc cells transfected with siRNAs targeting the ZC3HAV1 short isoform displayed no elevation of luciferase signal beyond that produced in the control condition (indicating that the anti-replicon activity of IFN-! treatment remained un-impaired in these cells).
Investigations of ZC3HAV1 Anti-HCV Replicon Activity
With knockdown experiments having identified that the ZC3HAV1 gene was a mediator of the anti-replicon effects of IFN-! treatment in Huh-7 Luc cells, focus was turned to investigating the anti-replicon activity of ZC3HAV1 through the use of recombinant over-expression constructs. It was reasoned that if
ZC3HAV1 (in particular the long isoform) was indeed an IFN-! induced anti- replicon gene, ZC3HAV1 isoform over-expression in HCV replicon bearing Huh-
7 Luc cells, might be expected to result in diminished luciferase activity following transfection.
141
Figure 7.2 Identification of the contribution made by individual ZC3HAV1 isoforms in mediating the anti-HCV replicon activity of IFN-! treatment. Huh-7 Luc cells were transfected with 40 nM duplexed s-siRNA. (A) 48 hrs after transfection, cell viability was measured in untreated cells. (B) 24 hrs after transfection cells were treated with 2 U/mL recombinant Human Interferon Alpha 2, with luciferase activity was measured a further 24 hrs after Interferon treatment. Values are expressed as a ratio of luciferase activity compared to the ‘irrelevant’ siRNA (siCNT3) control (* denotes p < 0.05 as compared to siCNT3). Each data point represents the mean of triplicate experiments. Error bars indicate standard deviation. Statistical significance was determined by two-way ANOVA using a Dunnett’s Multiple Comparison post-test.
142
Utilising a similar approach to that reported by Kerns et al. (121), separate expression constructs for both the long and short ZC3HAV1 isoforms were generated (121). With no commercial antibodies available for the protein product of the human ZC3HAV1 gene, the addition of an N-terminal hemagglutinin (HA)-tag was necessary for detection of recombinant ZC3HAV1 proteins following transfection of the expression construct.
Having successfully developed recombinant expression constructs for the two
ZC3HAV1 isoforms, validation of expression for each of the recombinant
ZC3HAV1 isoforms was conducted via Western blot analysis, using total protein extracted from Huh-7 cells that had been transiently transfected with 3 µg of each the recombinant constructs in repeated experiments (n=3 – Figure 7.3(A)).
Interestingly, analysis of lysates from comparable transfections seemed to indicate that expression of the recombinant short ZC3HAV1 isoform was higher than that of the recombinant ZC3HAV1 long isoform, despite equal amounts of the plasmids being transfected. This result is in agreement with that presented by Kerns et al. (121), however, this finding was not explored further.
To investigate the effect of ZC3HAV1 over-expression on HCV replicon levels,
Huh-7 Luc cells were transfected with each of the ZC3HAV1 expression plasmids. With cell viability remaining constant amongst the different transfection conditions (Figure 7.3(B)), a modest but statistically significant
(ANOVA, p < 0.05) inhibition of HCV replication was observed in response to the transfection of recombinant ZC3HAV1 long isoform construct, however no
143
Figure 7.3 Investigation of ZC3HAV1 isoform anti-HCV replicon activity. H_ZC3_L = pcDNA3.1(+)/HA/hZC3HAV1_L and H_ZC3_S = pcDNA3.1(+)/HA/hZC3HAV1_S (A) Western blot analysis of recombinant human ZC3HAV1 isoform expression in Huh-7 cells. Huh-7 cells were transfected with 3 µg of plasmid DNA. Transfections performed included an untransfected control (Lane 1), a ‘mock’ transfection control (Lane 2), ‘empty vector’ control (lane 3), pcDNA3.1(+)/HA/hZC3HAV1_S transfection (Lane 4) and pcDNA3.1(+)/HA/hZC3HAV1_L transfection (Lane 5). Recombinant ZC3HAV1 isoform proteins and &-actin expression were detected by Western blotting as described in Materials and Methods. The blots shown are representative of three independent experiments. (B) Huh-7 Luc cells were transfected with 100 ng of plasmid DNA. Cell viability was measured 48 hrs after transfection (C) Huh-7 Luc cells were transfected with 100 ng of plasmid DNA. Luciferase activity was measured 48 hrs after transfection (* denotes p < 0.05 as compared to pcDNA3.1(+)). Each data point represents the mean of triplicate experiments. Error bars indicate standard deviation. Statistical significance was determined by two-way ANOVA using a Dunnett’s Multiple Comparison post-test.
144 significant anti-replicon activity was observed for the recombinant short
ZC3HAV1 construct (Figure 7.3(C)).
Discussion
IFN-! treatment of cells has been demonstrated to induce expression of a large number of genes, however, for many of these genes the contribution made to the cellular antiviral state remains poorly understood (53, 55, 99, 155). It has been shown that ZC3HAV1 expression is primarily regulated by Interferon regulatory factor 3 (IRF3), with mutational analysis of the ZC3HAV1 promoter element confirming ZC3HAV1 as a bona fide ISG (248). In line with previous reports, the current work demonstrated that ZC3HAV1 expression was induced by IFN-! treatment of Huh-7 cells (155, 158, 195, 265). Since it has previously been demonstrated that Zc3hav1/ZC3HAV1 possesses antiviral activity against a number of different virus families, the work presented in this chapter focused on preliminary investigations regarding whether ZC3HAV1 exerted similar antiviral activity against the HCV replicon.
Attempting to confirm the results observed using dicer-generated siRNAs (in
Chapter 6), synthetically generated siRNAs targeting the ZC3HAV1 gene were used. Silencing ZC3HAV1 in Huh-7 Luc cells resulted in the ablation of effective
IFN-! treatment, as shown by increased Luciferase expression in transfected cells – a result that demonstrates the potential role played by ZC3HAV1 in mediating the anti-replicon effects of IFN-! treatment.
145
As discussed by Kerns et al. (121), the human ZC3HAV1 gene encodes two isoforms that result from alternative splicing of the carboxy-terminus of the gene, resulting in two protein products that, in their hands, were shown to exert differing degrees of antiviral activity. With this in mind, focus was turned towards investigating whether differing contributions were made by each of the two
ZC3HAV1 isoforms in the context of IFN-! mediated HCV replicon clearance in
Huh-7 Luc cells. Interestingly, the ZC3HAV1 partial length clone that was isolated as part of the MOS screen (Chapter 4), and thus used as the template for the dicer generated siRNAs that were subsequently screened (Chapter 6), represented the long isoform (or variant 1) of the human ZC3HAV1 gene. By silencing the long and short ZC3HAV1 isoforms independently, it was observed that silencing the long isoform resulted in a reduction in the anti-replicon efficacy of IFN-! treatment, a result that was not observed when using siRNAs targeting the short ZC3HAV1 isoform.
Following the ZC3HAV1 siRNAs experiments outlined above, human ZC3HAV1 long and short isoform over-expression constructs were generated in order to further examine the specific antiviral activity of each ZC3HAV1 isoform against the HCV replicon. Over-expression of the recombinant ZC3HAV1 constructs in
Huh-7 Luc cells demonstrated statistically significant, although modest, anti-
HCV replicon activity for the long isoform but not the short. Taken together with the siRNA data, these results suggest that the long ZC3HAV1 isoform is primarily responsible for the anti-HCV replicon effects of ZC3HAV1.
146
The apparent lack of anti-HCV replicon activity for the short ZC3HAV1 isoform, suggests that a functional domain missing from the short isoform is important in driving the activity of ZC3HAV1 against the HCV replicon. Such a domain might include the C-terminal PARP-like domain, however, it is not yet clear what role the PARP-like domain plays in ZC3HAV1 anti-viral function, and further experiments are required to investigate the above hypothesis (121).
Whilst the current study has highlighted the role played by the ZC3HAV1 long isoform in mediating anti-HCV replicon activity, the mechanism by which
ZC3HAV1 exerts the observed anti-HCV effect remains unknown. With regards to Zc3hav1 anti-viral activity, it has been shown that viral RNA recognition is mediated with high specificity by the 4 CCCH zinc finger motifs present in the N- terminal domain (89), and viral RNA degradation follows Zc3hav1 dependent recruitment of an RNA processing exosome in the cytoplasm (90).
Interestingly, MacDonald et al. (155) identified the requirement for an additional interferon induced factor that worked together with Zc3hav1 to mediate maximal antiviral activity. Indeed, the modest anti-replicon activity observed following over-expression of the long ZC3HAV1 isoform in this study, raises the possibility that an additional IFN-! induced partner is required for maximal
ZC3HAV1 anti-replicon activity in Huh-7 Luc cells. Whilst ultimately unsuccessful in their attempts to identify the IFN-induced partner(s) required for maximal Zc3hav1 anti Sindbis virus activity, MacDonald et al. (155) were able to enhance Zc3hav1 activity through the pre-treatment of baby hamster kidney
(BHK-21) cells with IFN-!. Whilst over-expression studies involving IFN-! pre-
147 treatment in an attempt to induce the expression of such a partner in Huh-7
Luc cells are theoretically possible, such an approach is likely be problematic, since it would require the use of a concentration of IFN-! that induces expression of the required co-factor without affecting HCV replicon levels and doesn’t up-regulate endogenous ZC3HAV1 isoforms.
Zhang et al. (265) have demonstrated that the anti-alphaviral activity of Zc3hav1 is increased when co-expressed with ISG20. However, the likelihood that ISG20 is the sole (or even main) required partner is lessened by the fact that Zc3hav1 has been shown to exhibit antiviral activity in the absence of ISG20 expression
(265). Furthermore, it is entirely possible that a different partner altogether may be required for maximal ZC3HAV1 antiviral activity against different viruses.
Indeed, a number of recent publications have further highlighted the involvement of alternate binding partners during viral clearance by ZC3HAV1. In particular, the p72 DEAD box RNA helicase and the DExH-Box protein DHX30 have both been identified as partners that are required for optimal ZC3HAV1 antiviral function (42, 259). Interestingly, the shorter ZC3HAV1 protein has recently been shown to interact with RIG-I (95), however the significance of this association in the system that I developed for this PhD project is mitigated by the fact that the RIG-I pathway is impaired in Huh-7 cells (143). Taken together, these findings suggest that other as yet unidentified factors may be required for, or at least contribute to, the antiviral activity of Zc3hav1/ZC3HAV1. Additionally, the possibility that IFN-! treatment reduces, or eliminates the expression of a factor that is inhibitory to ZC3HAV1’s antiviral activity needs to be considered.
Thus despite a number of insights, a clear understanding of how ZC3HAV1
148 exerts its antiviral actions remain the subject of continued enquiry (32, 113,
140, 250, 259, 264, 270).
In conclusion, the current chapter demonstrates validation of a role for
ZC3HAV1 in mediating the anti-HCV replicon effects of IFN-! treatment in Huh-
7 Luc cells. Through qRT-PCR it was demonstrated that ZC3HAV1 expression was stimulated by IFN-!, a finding, that when combined with the synthetic siRNA and over-expression data presented, implicates the ZC3HAV1 long isoform as an ISG that plays a significant role in mediating the anti-replicon effects of IFN-! treatment in Huh-7 Luc cells.
149
CHAPTER 8 – GENERAL CONCLUSION
HCV infection is a significant worldwide health problem, and despite recent advances in the development of specifically targeted antiviral therapies for
Hepatitis C, effective treatment regimens continue to utilise pegylated IFN-! as a backbone (92, 97). Despite its clear anti-HCV effect, the precise mechanism by which IFN-! treatment leads to the elimination of virus from infected cells remains unclear, with insights into identifying the downstream IFN effector mechanisms largely limited to a select group of interferon stimulated genes
(ISGs) (204). The aim of this thesis project was to attempt the identification of novel anti-HCV ISGs involved in mediating the anti-HCV replicon activity of IFN-
! treatment through the implementation of a novel functional genomic screen.
Results Summary
In order to identify and characterize ISGs that are involved in mediating HCV clearance upon IFN-! treatment, suppression subtractive hybridization (SSH) and its related technique mirror orientation (MOS) were implemented to identify
ISGs in IFN-! treated Huh-7 cells. 172 distinct genes were isolated as a result, along with three expressed tags (ESTs), two genomic contigs and one partial mitochondrial genome sequence. Subsequent refinement of the SSH and MOS subtracted gene lists by removal of background clones, narrowed down the list to 7 genes (represented by 12 individual SSH and MOS subtracted partial clones): ADAR, IFIT1, OAS2, PLSCR1, STAT1, USP18 and ZC3HAV1. The majority of the ISGs identified in this study have previously been identified in a
150 number of studies as ISGs (21, 22, 32, 55, 69, 158, 159, 178, 201, 246).
However, whilst ZC3HAV1 is a known ISG (248), to date, it had not been implicated in limiting HCV replication. To ascertain whether the isolated ISGs played significant roles in suppressing HCV replication upon IFN-! treatment, further verifications were performed utilising Huh-7 cells which stably expressed a sub-genomic HCV replicon (Huh-7 Luc cells). Dicer-generated siRNA pools were generated with the 12 selected SSH/MOS cDNA clones as template. The
Dicer-generated siRNA knockdown of IFIT1 and ZC3HAV1 was seen to significantly rescue HCV replicon replication following IFN-! treatment, indicating that a role is played by both IFIT1 and ZC3HAV1 in facilitating interferon-! mediated antiviral defence. Since the antiviral function of IFIT1 with regards to HCV clearance is relatively well established (186, 247), focus turned to the remaining candidate, ZC3HAV1. Subsequent preliminary investigations were thus conducted to examine the anti-HCV replicon potential of the two human ZC3HAV1 (long and short) isoforms. As a result of conducting these experiments, it was identified that the long ZC3HAV1 isoform may indeed play a role in facilitating interferon mediated antiviral defence against the HCV replicon.
Project Limitations
With the identification of a novel anti-HCV role for ZC3HAV1 being identified, this study suggests that the novel approach undertaken in combining SSH/MOS and dicer-generated siRNAs to screen for anti-replicon ISGs was successful, and could be extended and applied to other systems also seeking the identification of differentially expressed genes that are responsible for a
151 particular phenotypic change. However, it should be noted that employing a screening approach such as the one described here, does possess a number of intrinsic limitations, the majority of which are related to the use of suppression subtractive hybridization and mirror orientation selection. However, this does not diminish the fact that additional anti-HCV ISGs are likely to exist and that the current understanding of how IFN-!-based therapies limit HCV replication remains incomplete. Unbiased genomic screens, such as the one developed in this project, are likely to be key in the search for new ISGs.
In my hands, SSH and MOS proved themselves to be time consuming and complicated techniques, and despite the advantages that make SSH particularly suitable for the identification of differentially expressed genes (namely the combination of subtraction and normalisation that permit the isolation of novel and rarely transcribed genes), a significant drawback of SSH/MOS is the high number of background clones represented within the subtracted libraries, and/or the lack of representation of known differentially expressed mRNAs. These two findings are unlikely to be the result of experimental errors, and mostly attributable to the absence of significantly differentially expressed genes between the chosen driver and tester samples, as previously highlighted by Ji et al. (114). As a result, and despite its popularity, the interpretation of SSH results can be difficult and often leads to the abandoning of further investigation for many of the isolated clones. Thus, it is conceivable that the SSH results presented within this study are in agreement with previous investigations that similarly utilised SSH as a means of identifying differentially expressed genes in a HCV setting; where only a relatively small number of differentially expressed
152 genes were isolated despite many more subtracted clones having been analysed (159, 178, 182, 210).
Notwithstanding the above, the SSH and MOS approaches did enable the isolation of seven different ISGs for which the IFN-! induced antiviral activity could be examined, without a pre-selection bias where only specifically chosen genes are screened. By combining SSH/MOS with the generation of siRNAs through the use of recombinant dicer enzyme, a number of advantages (a reduced likelihood of significant off-target effects, and sequence homology between target and siRNAs) can be exploited that would otherwise not be the case had individual synthetic siRNAs been utilised.
Relevance to Previous Investigations
By systematically over-expressing hundreds of previously identified ISGs,
Schoggins et al. (204) have recently made one of the largest contributions to expanding the current understanding of antiviral ISG function, with the identification of novel antiviral action for multiple ISGs. However, there are a number of disadvantages in undertaking approaches such as described by
Schoggins et al. (204) that are not inherent within the PhD project presented.
Namely, by employing an over-expression screen to identify antiviral ISGs, the risk of not detecting the antiviral activity for any gene under examination is increased if:
i. The gene of interest functions in the presence of an obligate partner/multi-
protein complex. Without the concomitant over-expression of any such
additional partners, antiviral activity is unlikely to be detected.
153
ii. A lentiviral vector is utilised to drive expression of antiviral genes.
There is a possibility that some of the genes of interest may not be
expressed simply because they have the capacity to limit expression of
the retroviral vector.
iii. Over-expression of the target protein is difficult to control, too low and
ineffective, or conversely toxic. Also, in the interest of limiting the
number of clones that need to be expressed, isoforms and splice variants
are rarely investigated.
All of these limitations are particularly relevant with regards to the identification of ZC3HAV1 in this PhD project, as its anti-HCV activity was not detected in the screen performed by Schoggins et al. (204). A number of previous publications have highlighted the possible involvement of an additional IFN induced binding partner being required for maximal viral clearance mediated by ZC3HAV1 in vitro (155, 265). Thus, there exists the possibility that without the additional presence of this IFN induced factor Schoggins et al. (204) were unable to fully appreciate the potential anti-HCV role played by ZC3HAV1. More importantly,
Schoggins et al. (204) identified ZC3HAV1 as one of approximately 50 ISG lentiviral expression constructs that failed to successfully mediate the effective transduction of target cells, highlighting the possibility that a lack of transduction could be the result of direct antiviral activity against the human immunodeficiency virus 1 (HIV-1)-based vector, especially as other known anti- retroviral genes (EIF2AK2, APOBEC3G, BST2 and MOV10) exhibited a similar pattern. Indeed, the antiviral activity of the mouse homologue of ZC3HAV1 was originally discovered through its ability to limit the retrovirus MMLV (20, 81).
154
Interestingly, the clone for ZC3HAV1 used in the Schoggins et al. (204) study was not obtained from the ORFEXPRESS Gateway PLUS Shuttle Clones
(GeneCopoeia, Inc., Rockville, MD) collection that was used to generate the remaining ISG expression constructs. Instead, Schoggins et al. (204) generated, via PCR, an expression construct representing only the short form of
ZC3HAV1 (as deduced from the primers used). In light of the failure for efficient viral transduction of this clone, Schoggins et al. (204) also transiently transfected a plasmid expression construct for this clone. They did not observe any anti-HCV activity – a finding that is in agreement with the results witnessed in this study when examining the anti-HCV replicon activity of the short
ZC3HAV1 isoform over-expression construct (see Results section, Chapter 7).
Thus, the earlier assertion that particular screening strategies may be limited in their ability to identify anti-HCV ISGs if differences in antiviral activity between splice variants is not taken into account, has specific merit in the context of
ZC3HAV1.
Conversely, it could be argued that the anti-HCV replicon activity of ZC3HAV1 witnessed in this study could be a result specific to the model system employed.
Whilst finalizing this thesis, a new report outlining the implementation of a high throughput whole-genome RNAi screen that sought to identify host factors mediating the anti-HCV effects of IFN-! treatment was published (266). Zhao et al. (266) identified that silencing the expression of ZC3HAV1 rescued HCV replication in IFN-! treated Huh-7/Rep-Feo cells (which harboured a HCV 1b subgenomic replicon). They were able to confirm this result in OR6 cells that harboured a HCV genotype 1b full-length genomic replicon; with ZC3HAV1
155 being one of only 4 genes for which the targeted knockdown did not reduce
HCV replicon levels in the absence of IFN-! treatment. However, Zhao et al.
(266) did not investigate the contribution made by each of the two ZC3HAV1 isoforms in mediating this observed anti-HCV replicon activity.
Future Directions
In light of the findings of this PhD project, further examinations of the anti-HCV activity of ZC3HAV1 appear warranted in order to better demonstrate the possible in vitro role played by the long ZC3HAV1 isoform in mediating the antiviral effects of IFN-! treatment against HCV. Notably, to characterise fully the anti-HCV role played by the ISG ZC3HAV1, it would be necessary to confirm the above results in the infectious JFH-1 genotype 2a cell culture model. Such an approach, if successful would also possibly provide insights into the complex interplay between the targeted protein (in this case ZC3HAV1) and other HCV proteins and cellular factors. Furthermore, the exact mechanism by which ZC3HAV1 exerts its anti-HCV effect is currently unknown, and further studies are required to determine the exact molecular mechanisms associated – in particular, it would be interesting to identify whether ZC3HAV1 is able to limit transient HCV replication, and by extension which step of the HCV replication cycle (translation or RNA replication) is targeted by ZC3HAV1.
Concluding Remarks
In conclusion, this study describes a novel ISG screening approach that has coupled SSH/MOS, microarray analysis, Dicer-generated d-siRNA and the use of a HCV subgenomic replicon to screen for novel anti-HCV ISGs. Whilst the
156 implementation of SSH/MOS resulted in the isolation of a substantial number of ‘background clones’, the approach employed did however for the first time highlight the potential anti-HCV replicon activity of the long isoform of
ZC3HAV1 in vitro. Ultimately, the work presented here, and subsequent future investigations will add to expanding our understanding of the response to IFN-! treatment in the context of HCV infection.
157
REFERENCES
1. Acevedo, N., and G. D. Smith. 2005. Oocyte-specific gene signaling and its regulation of mammalian reproductive potential. Front Biosci 10:2335-45. 2. Adach-Kilon, A., K. Swiatek-Machado, B. Kaminska, and M. Dabrowski. 2011. Signal transducer and activator of transcription 1 (Stat1) maintains basal mRNA expression of pro-survival stat3-target genes in glioma C6 cells. J Cell Biochem 112:3685-94. 3. Anderson, S. L., J. M. Carton, J. Lou, L. Xing, and B. Y. Rubin. 1999. Interferon-induced guanylate binding protein-1 (GBP-1) mediates an antiviral effect against vesicular stomatitis virus and encephalomyocarditis virus. Virology 256:8-14. 4. Asselah, T., and P. Marcellin. 2012. Direct acting antivirals for the treatment of chronic hepatitis C: one pill a day for tomorrow. Liver Int 32 Suppl 1:88-102. 5. Azimzadeh Jamalkandi, S., and A. Masoudi-Nejad. 2011. RNAi pathway integration in Caenorhabditis elegans development. Funct Integr Genomics 11:389-405. 6. Bae, J.-W., S.-K. Rhee, Y.-D. Nam, and Y.-H. Park. 2005. Generation of subspecies level-specific microbial diagnostic microarrays using genes amplified from subtractive suppression hybridization as microarray probes. Nucleic Acids Res 33:e113. 7. Bahn, S. C., M. S. Bae, Y. B. Park, S. I. Oh, J. U. Jeung, J. M. Bae, Y. S. Chung, and J. S. Shin. 2001. Molecular cloning and characterization of a novel low temperature-induced gene, blti2, from barley (Hordeum vulgare L.). Biochim Biophys Acta 1522:134-7. 8. Barber, G. N. 2005. The dsRNA-dependent protein kinase, PKR and cell death. Cell Death Differ 12:563-70. 9. Bartenschlager, R., M. Frese, and T. Pietschmann. 2004. Novel insights into hepatitis C virus replication and persistence. Adv Virus Res 63:71-180. 10. Bartenschlager, R., A. Kaul, and S. Sparacio. 2003. Replication of the hepatitis C virus in cell culture. Antiviral Res 60:91-102. 11. Bartenschlager, R., and S. Sparacio. 2007. Hepatitis C virus molecular clones and their replication capacity in vivo and in cell culture. Virus Res 127:195-207. 12. Barth, H., T. J. Liang, and T. F. Baumert. 2006. Hepatitis C virus entry: molecular biology and clinical implications. Hepatology 44:527-35. 13. Bartosch, B., J. Dubuisson, and F.-L. Cosset. 2003. Infectious hepatitis C virus pseudo-particles containing functional E1-E2 envelope protein complexes. J Exp Med 197:633-42. 14. Bass, B. L. 1997. RNA editing and hypermutation by adenosine deamination. Trends Biochem Sci 22:157-62. 15. Baulcombe, D. C. 1999. Fast forward genetics based on virus-induced gene silencing. Curr Opin Plant Biol 2:109-13. 16. Beard, M. R., G. Abell, M. Honda, A. Carroll, M. Gartland, B. Clarke, K. Suzuki, R. Lanford, D. V. Sangar, and S. M. Lemon. 1999. An
158
infectious molecular clone of a Japanese genotype 1b hepatitis C virus. Hepatology 30:316-24. 17. Beck, M. T., L. Holle, and W. Y. Chen. 2001. Combination of PCR subtraction and cDNA microarray for differential gene expression profiling. BioTechniques 31:782-6. 18. Berger, K. L., J. D. Cooper, N. S. Heaton, R. Yoon, T. E. Oakland, T. X. Jordan, G. Mateu, A. Grakoui, and G. Randall. 2009. Roles for endocytic trafficking and phosphatidylinositol 4-kinase III alpha in hepatitis C virus replication. Proc Natl Acad Sci USA 106:7577-82. 19. Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon. 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-6. 20. Bick, M. J., J.-W. N. Carroll, G. Gao, S. P. Goff, C. M. Rice, and M. R. MacDonald. 2003. Expression of the zinc-finger antiviral protein inhibits alphavirus replication. J Virol 77:11555-62. 21. Bigger, C. B., K. M. Brasky, and R. E. Lanford. 2001. DNA microarray analysis of chimpanzee liver during acute resolving hepatitis C virus infection. J Virol 75:7059-66. 22. Bigger, C. B., B. Guerra, K. M. Brasky, G. Hubbard, M. R. Beard, B. A. Luxon, S. M. Lemon, and R. E. Lanford. 2004. Intrahepatic gene expression during chronic hepatitis C virus infection in chimpanzees. J Virol 78:13779-92. 23. Billiau, A. 2006. Interferon: the pathways of discovery I. Molecular and cellular aspects. Cytokine Growth Factor Rev 17:381-409. 24. Birmingham, A., E. M. Anderson, A. Reynolds, D. Ilsley-Tyree, D. Leake, Y. Fedorov, S. Baskerville, E. Maksimova, K. Robinson, J. Karpilow, W. S. Marshall, and A. Khvorova. 2006. 3' UTR seed matches, but not overall identity, are associated with RNAi off-targets. Nat Methods 3:199-204. 25. Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation of HCV RNA replication in cell culture. Science 290:1972-4. 26. Blight, K. J., J. A. McKeating, J. Marcotrigiano, and C. M. Rice. 2003. Efficient replication of hepatitis C virus genotype 1a RNAs in cell culture. J Virol 77:3181-90. 27. Boengler, K., F. Pipp, W. Schaper, and E. Deindl. 2003. Rapid identification of differentially expressed genes by combination of SSH and MOS. Lab Invest 83:759-61. 28. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19:185-93. 29. Borden, E. C., G. C. Sen, G. Uze, R. H. Silverman, R. M. Ransohoff, G. R. Foster, and G. R. Stark. 2007. Interferons at age 50: past, current and future impact on biomedicine. Nat Rev Drug Discov 6:975-90. 30. Bostan, N., and T. Mahmood. 2010. An overview about hepatitis C: a devastating virus. Crit Rev Microbiol 36:91-133. 31. Brass, A. L., I.-C. Huang, Y. Benita, S. P. John, M. N. Krishnan, E. M. Feeley, B. J. Ryan, J. L. Weyer, L. van der Weyden, E. Fikrig, D. J. Adams, R. J. Xavier, M. Farzan, and S. J. Elledge. 2009. The IFITM
159
proteins mediate cellular resistance to influenza A H1N1 virus, West Nile virus, and dengue virus. Cell 139:1243-54. 32. Brodsky, L. I., A. S. Wahed, J. Li, J. E. Tavis, T. Tsukahara, and M. W. Taylor. 2007. A novel unsupervised method to identify genes important in the anti-viral response: application to interferon/ribavirin in hepatitis C patients. PLoS ONE 2:e584. 33. Buchholz, F., R. Kittler, M. Slabicki, and M. Theis. 2006. Enzymatically prepared RNAi libraries. Nat Methods 3:696-700. 34. Bühler, S., and R. Bartenschlager. 2012. New targets for antiviral therapy of chronic hepatitis C. Liver Int 32 Suppl 1:9-16. 35. Bui, L. C., R. D. Léandri, J. P. Renard, and V. Duranthon. 2005. SSH adequacy to preimplantation mammalian development: scarce specific transcripts cloning despite irregular normalisation. BMC Genomics 6:155. 36. Butt, A. A., and F. Kanwal. 2012. Boceprevir and telaprevir in the management of hepatitis C virus-infected patients. Clin Infect Dis 54:96- 104. 37. Byers, R. J., J. A. Hoyland, J. Dixon, and A. J. Freemont. 2000. Subtractive hybridization--genetic takeaways and the search for meaning. Int J Exp Pathol 81:391-404. 38. Cao, W., C. Epstein, H. Liu, C. DeLoughery, N. Ge, J. Lin, R. Diao, H. Cao, F. Long, X. Zhang, Y. Chen, P. S. Wright, S. Busch, M. Wenck, K. Wong, A. G. Saltzman, Z. Tang, L. Liu, and A. Zilberstein. 2004. Comparing gene discovery from Affymetrix GeneChip microarrays and Clontech PCR-select cDNA subtraction: a case study. BMC Genomics 5:26. 39. Caplen, N. J., S. Parrish, F. Imani, A. Fire, and R. A. Morgan. 2001. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci USA 98:9742-7. 40. Chalifa-Caspi, V., I. Yanai, R. Ophir, N. Rosen, M. Shmoish, H. Benjamin-Rodrig, M. Shklar, T. I. Stein, O. Shmueli, M. Safran, and D. Lancet. 2004. GeneAnnot: comprehensive two-way linking between oligonucleotide array probesets and GeneCards genes. Bioinformatics 20:1457-8. 41. Chang, K.-S., Z. Cai, C. Zhang, G. C. Sen, B. R. G. Williams, and G. Luo. 2006. Replication of hepatitis C virus (HCV) RNA in mouse embryonic fibroblasts: protein kinase R (PKR)-dependent and PKR- independent mechanisms for controlling HCV RNA replication and mediating interferon activities. J Virol 80:7364-74. 42. Chen, G., X. Guo, F. Lv, Y. Xu, and G. Gao. 2008. p72 DEAD box RNA helicase is required for optimal function of the zinc-finger antiviral protein. Proc Natl Acad Sci USA 105:4352-7. 43. Chen, L., J. Sun, L. Meng, J. Heathcote, A. M. Edwards, and I. D. McGilvray. 2010. ISG15, a ubiquitin-like interferon-stimulated gene, promotes hepatitis C virus production in vitro: implications for chronic infection and response to treatment. J Gen Virol 91:382-8. 44. Cheriyath, V., D. W. Leaman, and E. C. Borden. 2011. Emerging roles of FAM14 family members (G1P3/ISG 6-16 and ISG12/IFI27) in innate immunity and cancer. J Interferon Cytokine Res 31:173-81.
160
45. Chin, K. C., and P. Cresswell. 2001. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus. Proc Natl Acad Sci USA 98:15125-30. 46. Cho, S. H., Q. Hoang, J. W. Phee, Y. Y. Kim, H. Y. Shin, and J. S. Shin. 2007. Modified suppression subtractive hybridization identifies an AP2-containing protein involved in metal responses in Physcomitrella patens. Mol Cells 23:100-7. 47. Cho, S. K., K. W. Jung, J. U. Jeung, K. H. Kang, K. S. Shim, M. K. You, K. S. Yoo, S. H. Ok, and J. S. Shin. 2005. Analysis of differentially expressed transcripts from planthopper-infested wild rice (Oryza minuta). Plant Cell Rep 24:59-67. 48. Choo, Q. L., G. Kuo, A. J. Weiner, L. R. Overby, D. W. Bradley, and M. Houghton. 1989. Isolation of a cDNA clone derived from a blood- borne non-A, non-B viral hepatitis genome. Science 244:359-62. 49. Chua, P. K., M. F. McCown, S. Rajyaguru, S. Kular, R. Varma, J. Symons, S. S. Chiu, N. Cammack, and I. Nájera. 2009. Modulation of alpha interferon anti-hepatitis C virus activity by ISG15. J Gen Virol 90:2929-39. 50. D'Cunha, J., S. Ramanujam, R. J. Wagner, P. L. Witt, E. Knight, and E. C. Borden. 1996. In vitro and in vivo secretion of human ISG15, an IFN-induced immunomodulatory cytokine. J Immunol 157:4100-8. 51. Darnell, J. E., I. M. Kerr, and G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415-21. 52. De Preter, K., F. Pattyn, G. Berx, K. Strumane, B. Menten, F. Van Roy, A. De Paepe, F. Speleman, and J. Vandesompele. 2004. Combined subtractive cDNA cloning and array CGH: an efficient approach for identification of overexpressed genes in DNA amplicons. BMC Genomics 5:11. 53. de Veer, M. J., M. Holko, M. Frevel, E. Walker, S. Der, J. M. Paranjape, R. H. Silverman, and B. R. Williams. 2001. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol 69:912-20. 54. Degols, G., P. Eldin, and N. Mechti. 2007. ISG20, an actor of the innate immune response. Biochimie 89:831-5. 55. Der, S. D., A. Zhou, B. R. Williams, and R. H. Silverman. 1998. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci USA 95:15623- 8. 56. DeRisi, J., L. Penland, P. O. Brown, M. L. Bittner, P. S. Meltzer, M. Ray, Y. Chen, Y. A. Su, and J. M. Trent. 1996. Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat Genet 14:457-60. 57. Dey, R., H. H. Son, and M. I. Cho. 2001. Isolation and partial sequencing of potentially odontoblast-specific/enriched rat cDNA clones obtained by suppression subtractive hybridization. Arch Oral Biol 46:249- 60. 58. Dharel, N., N. Kato, R. Muroyama, H. Taniguchi, M. Otsuka, Y. Wang, A. Jazag, R.-X. Shao, J.-H. Chang, M. K. Adler, T. Kawabe, and M.
161
Omata. 2008. Potential contribution of tumor suppressor p53 in the host defense against hepatitis C virus. Hepatology 47:1136-49. 59. Diatchenko, L., Y. F. Lau, A. P. Campbell, A. Chenchik, F. Moqadam, B. Huang, S. Lukyanov, K. Lukyanov, N. Gurskaya, E. D. Sverdlov, and P. D. Siebert. 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93:6025-30. 60. Diatchenko, L., S. Lukyanov, Y. F. Lau, and P. D. Siebert. 1999. Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Meth Enzymol 303:349-80. 61. Drummer, H. E., A. Maerz, and P. Poumbourios. 2003. Cell surface expression of functional hepatitis C virus E1 and E2 glycoproteins. FEBS Lett 546:385-90. 62. Echeverri, C. J., P. A. Beachy, B. Baum, M. Boutros, F. Buchholz, S. K. Chanda, J. Downward, J. Ellenberg, A. G. Fraser, N. Hacohen, W. C. Hahn, A. L. Jackson, A. Kiger, P. S. Linsley, L. Lum, Y. Ma, B. Mathey-Prévôt, D. E. Root, D. M. Sabatini, J. Taipale, N. Perrimon, and R. Bernards. 2006. Minimizing the risk of reporting false positives in large-scale RNAi screens. Nat Methods 3:777-9. 63. Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494-8. 64. Elbashir, S. M., W. Lendeckel, and T. Tuschl. 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15:188-200. 65. Elbashir, S. M., J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 20:6877-88. 66. Espert, L., G. Degols, C. Gongora, D. Blondel, B. R. Williams, R. H. Silverman, and N. Mechti. 2003. ISG20, a new interferon-induced RNase specific for single-stranded RNA, defines an alternative antiviral pathway against RNA genomic viruses. J Biol Chem 278:16151-8. 67. Espert, L., G. Degols, Y.-L. Lin, T. Vincent, M. Benkirane, and N. Mechti. 2005. Interferon-induced exonuclease ISG20 exhibits an antiviral activity against human immunodeficiency virus type 1. J Gen Virol 86:2221-9. 68. Evans, S. J., N. A. Datson, M. Kabbaj, R. C. Thompson, E. Vreugdenhil, E. R. De Kloet, S. J. Watson, and H. Akil. 2002. Evaluation of Affymetrix Gene Chip sensitivity in rat hippocampal tissue using SAGE analysis. Serial Analysis of Gene Expression. Eur J Neurosci 16:409-13. 69. Feld, J. J., S. Nanda, Y. Huang, W. Chen, M. Cam, S. N. Pusek, L. M. Schweigler, D. Theodore, S. L. Zacks, T. J. Liang, and M. W. Fried. 2007. Hepatic gene expression during treatment with peginterferon and ribavirin: Identifying molecular pathways for treatment response. Hepatology 46:1548-63. 70. Feng, H.-C., S.-W. Tsao, H. Y. S. Ngan, H. S. Kwan, S. M. Shih, W.-C. Xue, P.-M. Chiu, K. W. Chan, and A. N. Y. Cheung. 2006. Differential gene expression identified in complete hydatidiform mole by combining
162
suppression subtractive hybridization and cDNA microarray. Placenta 27:521-6. 71. Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. 1998. Potent and specific genetic interference by double- stranded RNA in Caenorhabditis elegans. Nature 391:806-11. 72. Fitzgerald, K. A. 2011. The interferon inducible gene: Viperin. J Interferon Cytokine Res 31:131-5. 73. Fonseca, V. G., V. Laizé, M. S. Valente, and M. L. Cancela. 2007. Identification of an osteopontin-like protein in fish associated with mineral formation. FEBS J 274:4428-39. 74. Frese, M., T. Pietschmann, D. Moradpour, O. Haller, and R. Bartenschlager. 2001. Interferon-alpha inhibits hepatitis C virus subgenomic RNA replication by an MxA-independent pathway. J Gen Virol 82:723-33. 75. Friedman, R. L., S. P. Manly, M. McMahon, I. M. Kerr, and G. R. Stark. 1984. Transcriptional and posttranscriptional regulation of interferon-induced gene expression in human cells. Cell 38:745-55. 76. Friedman, R. M. 2008. Clinical uses of interferons. Br J Clin Pharmacol 65:158-62. 77. Fusco, D. N., and R. T. Chung. 2012. Novel therapies for hepatitis C: insights from the structure of the virus. Annu Rev Med 63:373-87. 78. Gadgil, C., A. Rink, C. Beattie, and W.-S. Hu. 2002. A mathematical model for suppression subtractive hybridization. Comp Funct Genom 3:405-22. 79. Gale, M. 2003. Effector genes of interferon action against hepatitis C virus. Hepatology 37:975-8. 80. Gale, M. J., M. J. Korth, and M. G. Katze. 1998. Repression of the PKR protein kinase by the hepatitis C virus NS5A protein: a potential mechanism of interferon resistance. Clin Diagn Virol 10:157-62. 81. Gao, G., X. Guo, and S. P. Goff. 2002. Inhibition of retroviral RNA production by ZAP, a CCCH-type zinc finger protein. Science 297:1703- 6. 82. Geiss, G., G. Jin, J. Guo, R. Bumgarner, M. G. Katze, and G. C. Sen. 2001. A comprehensive view of regulation of gene expression by double- stranded RNA-mediated cell signaling. J Biol Chem 276:30178-82. 83. Ghorbel, M. T., G. Sharman, C. Hindmarch, K. G. Becker, T. Barrett, and D. Murphy. 2006. Microarray screening of suppression subtractive hybridization-PCR cDNA libraries identifies novel RNAs regulated by dehydration in the rat supraoptic nucleus. Physiol Genomics 24:163-72. 84. Goodbourn, S., L. Didcock, and R. E. Randall. 2000. Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures. J Gen Virol 81:2341-64. 85. Goodchild, A., N. Nopper, A. King, T. Doan, M. Tanudji, G. M. Arndt, M. Poidinger, L. P. Rivory, and T. Passioura. 2009. Sequence determinants of innate immune activation by short interfering RNAs. BMC Immunol 10:40. 86. Gottwein, J. M., and J. Bukh. 2008. Cutting the gordian knot- development and biological relevance of hepatitis C virus cell culture systems. Adv Virus Res 71:51-133.
163
87. Guo, J., K. L. Peters, and G. C. Sen. 2000. Induction of the human protein P56 by interferon, double-stranded RNA, or virus infection. Virology 267:209-19. 88. Guo, J. T., V. V. Bichko, and C. Seeger. 2001. Effect of alpha interferon on the hepatitis C virus replicon. J Virol 75:8516-23. 89. Guo, X., J.-W. N. Carroll, M. R. MacDonald, S. P. Goff, and G. Gao. 2004. The zinc finger antiviral protein directly binds to specific viral mRNAs through the CCCH zinc finger motifs. J Virol 78:12781-7. 90. Guo, X., J. Ma, J. Sun, and G. Gao. 2007. The zinc-finger antiviral protein recruits the RNA processing exosome to degrade the target mRNA. Proc Natl Acad Sci USA 104:151-6. 91. Gurskaya, N. G., L. Diatchenko, A. Chenchik, P. D. Siebert, G. L. Khaspekov, K. A. Lukyanov, L. L. Vagner, O. D. Ermolaeva, S. A. Lukyanov, and E. D. Sverdlov. 1996. Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12- myristate 13-acetate. Anal Biochem 240:90-7. 92. Hadziyannis, S. J., H. Sette, T. R. Morgan, V. Balan, M. Diago, P. Marcellin, G. Ramadori, H. Bodenheimer, D. Bernstein, M. Rizzetto, S. Zeuzem, P. J. Pockros, A. Lin, A. M. Ackrill, and P. I. S. Group. 2004. Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 140:346-55. 93. Han, J.-Q., and D. J. Barton. 2002. Activation and evasion of the antiviral 2'-5' oligoadenylate synthetase/ribonuclease L pathway by hepatitis C virus mRNA. RNA 8:512-25. 94. Hartmann, R., H. S. Olsen, S. Widder, R. Jorgensen, and J. Justesen. 1998. p59OASL, a 2'-5' oligoadenylate synthetase like protein: a novel human gene related to the 2'-5' oligoadenylate synthetase family. Nucleic Acids Res 26:4121-8. 95. Hayakawa, S., S. Shiratori, H. Yamato, T. Kameyama, C. Kitatsuji, F. Kashigi, S. Goto, S. Kameoka, D. Fujikura, T. Yamada, T. Mizutani, M. Kazumata, M. Sato, J. Tanaka, M. Asaka, Y. Ohba, T. Miyazaki, M. Imamura, and A. Takaoka. 2011. ZAPS is a potent stimulator of signaling mediated by the RNA helicase RIG-I during antiviral responses. Nat Immunol 12:37-44. 96. Hayashi, J., R. Stoyanova, and C. Seeger. 2005. The transcriptome of HCV replicon expressing cell lines in the presence of alpha interferon. Virology 335:264-75. 97. Hayashi, N., and T. Takehara. 2006. Antiviral therapy for chronic hepatitis C: past, present, and future. J Gastroenterol 41:17-27. 98. Helbig, K. J., N. S. Eyre, E. Yip, S. Narayana, K. Li, G. Fiches, E. M. McCartney, R. K. Jangra, S. M. Lemon, and M. R. Beard. 2011. The antiviral protein viperin inhibits hepatitis C virus replication via interaction with nonstructural protein 5A. Hepatology 54:1506-17. 99. Helbig, K. J., D. T.-Y. Lau, L. Semendric, H. A. J. Harley, and M. R. Beard. 2005. Analysis of ISG expression in chronic hepatitis C identifies viperin as a potential antiviral effector. Hepatology 42:702-10.
164
100. Hinson, E. R., and P. Cresswell. 2009. The antiviral protein, viperin, localizes to lipid droplets via its N-terminal amphipathic alpha-helix. Proc Natl Acad Sci USA 106:20452-7. 101. Houghton, M., and S. Abrignani. 2005. Prospects for a vaccine against the hepatitis C virus. Nature 436:961-6. 102. Hsu, M., J. Zhang, M. Flint, C. Logvinoff, C. Cheng-Mayer, C. M. Rice, and J. A. McKeating. 2003. Hepatitis C virus glycoproteins mediate pH-dependent cell entry of pseudotyped retroviral particles. Proc Natl Acad Sci USA 100:7271-6. 103. Huang, I.-C., C. C. Bailey, J. L. Weyer, S. R. Radoshitzky, M. M. Becker, J. J. Chiang, A. L. Brass, A. A. Ahmed, X. Chi, L. Dong, L. E. Longobardi, D. Boltz, J. H. Kuhn, S. J. Elledge, S. Bavari, M. R. Denison, H. Choe, and M. Farzan. 2011. Distinct patterns of IFITM- mediated restriction of filoviruses, SARS coronavirus, and influenza A virus. PLoS Pathog 7:e1001258. 104. Huang, Q., L. Baum, J.-F. Huang, J.-P. You, F. Wang, J. Wang, J. Zheng, X.-C. Yan, H. Xia, Y.-H. Zhao, H. Kuang, and W.-L. Fu. 2007. Isolation and enrichment of human genomic CpG islands by methylation- sensitive mirror orientation selection. Anal Biochem 365:153-64. 105. Hufton, S. E., P. T. Moerkerk, R. Brandwijk, A. P. de Bruïne, J. W. Arends, and H. R. Hoogenboom. 1999. A profile of differentially expressed genes in primary colorectal cancer using suppression subtractive hybridization. FEBS Lett 463:77-82. 106. Ida-Hosonuma, M., T. Iwasaki, T. Yoshikawa, N. Nagata, Y. Sato, T. Sata, M. Yoneyama, T. Fujita, C. Taya, H. Yonekawa, and S. Koike. 2005. The alpha/beta interferon response controls tissue tropism and pathogenicity of poliovirus. J Virol 79:4460-9. 107. Ikeda, M., M. Yi, K. Li, and S. M. Lemon. 2002. Selectable subgenomic and genome-length dicistronic RNAs derived from an infectious molecular clone of the HCV-N strain of hepatitis C virus replicate efficiently in cultured Huh7 cells. J Virol 76:2997-3006. 108. Isaacs, A., and J. Lindenmann. 1957. Virus interference. I. The interferon. Proc R Soc Lond, B, Biol Sci 147:258-67. 109. Ishibashi, M., T. Wakita, and M. Esumi. 2010. 2',5'-Oligoadenylate synthetase-like gene highly induced by hepatitis C virus infection in human liver is inhibitory to viral replication in vitro. Biochem Biophys Res Commun 392:397-402. 110. Itsui, Y., N. Sakamoto, S. Kakinuma, M. Nakagawa, Y. Sekine- Osajima, M. Tasaka-Fujita, Y. Nishimura-Sakurai, G. Suda, Y. Karakama, K. Mishima, M. Yamamoto, T. Watanabe, M. Ueyama, Y. Funaoka, S. Azuma, and M. Watanabe. 2009. Antiviral effects of the interferon-induced protein guanylate binding protein 1 and its interaction with the hepatitis C virus NS5B protein. Hepatology 50:1727-37. 111. Itsui, Y., N. Sakamoto, M. Kurosaki, N. Kanazawa, Y. Tanabe, T. Koyama, Y. Takeda, M. Nakagawa, S. Kakinuma, Y. Sekine, S. Maekawa, N. Enomoto, and M. Watanabe. 2006. Expressional screening of interferon-stimulated genes for antiviral activity against hepatitis C virus replication. J Viral Hepat 13:690-700.
165
112. Jacobs, J. M., D. L. Diamond, E. Y. Chan, M. A. Gritsenko, W. Qian, M. Stastna, T. Baas, D. G. Camp, R. L. Carithers, R. D. Smith, and M. G. Katze. 2005. Proteome analysis of liver cells expressing a full- length hepatitis C virus (HCV) replicon and biopsy specimens of posttransplantation liver from HCV-infected patients. Journal of Virology 79:7558-69. 113. Jeong, M. S., E. J. Kim, and S. B. Jang. 2010. Expression and RNA- binding of human zinc-finger antiviral protein. Biochem Biophys Res Commun 396:696-702. 114. Ji, W., M. B. Wright, L. Cai, A. Flament, and K. Lindpaintner. 2002. Efficacy of SSH PCR in isolating differentially expressed genes. BMC Genomics 3:12. 115. Jiang, D., H. Guo, C. Xu, J. Chang, B. Gu, L. Wang, T. M. Block, and J.-T. Guo. 2008. Identification of three interferon-inducible cellular enzymes that inhibit the replication of hepatitis C virus. J Virol 82:1665- 78. 116. Jiang, Y., S. L. Harlocker, D. A. Molesh, D. C. Dillon, J. A. Stolk, R. L. Houghton, E. A. Repasky, R. Badaro, S. G. Reed, and J. Xu. 2002. Discovery of differentially expressed genes in human breast cancer using subtracted cDNA libraries and cDNA microarrays. Oncogene 21:2270- 82. 117. Karikó, K., P. Bhuyan, J. Capodici, and D. Weissman. 2004. Small interfering RNAs mediate sequence-independent gene suppression and induce immune activation by signaling through toll-like receptor 3. J Immunol 172:6545-9. 118. Kato, T., T. Date, M. Miyamoto, A. Furusaka, K. Tokushige, M. Mizokami, and T. Wakita. 2003. Efficient replication of the genotype 2a hepatitis C virus subgenomic replicon. Gastroenterology 125:1808-17. 119. Kato, T., A. Furusaka, M. Miyamoto, T. Date, K. Yasui, J. Hiramoto, K. Nagayama, T. Tanaka, and T. Wakita. 2001. Sequence analysis of hepatitis C virus isolated from a fulminant hepatitis patient. J Med Virol 64:334-9. 120. Katze, M. G., Y. He, and M. Gale. 2002. Viruses and interferon: a fight for supremacy. Nat Rev Immunol 2:675-87. 121. Kerns, J. A., M. Emerman, and H. S. Malik. 2008. Positive selection and increased antiviral activity associated with the PARP-containing isoform of human zinc-finger antiviral protein. PLoS Genet 4:e21. 122. Kittler, R., V. Surendranath, A.-K. Heninger, M. Slabicki, M. Theis, G. Putz, K. Franke, A. Caldarelli, H. Grabner, K. Kozak, J. Wagner, E. Rees, B. Korn, C. Frenzel, C. Sachse, B. Sönnichsen, J. Guo, J. Schelter, J. Burchard, P. S. Linsley, A. L. Jackson, B. Habermann, and F. Buchholz. 2007. Genome-wide resources of endoribonuclease- prepared short interfering RNAs for specific loss-of-function studies. Nat Methods 4:337-44. 123. Klebig, C., S. Seitz, E. Korsching, G. Kristiansen, D. Gustavus, S. Scherneck, and I. Petersen. 2005. Profile of differentially expressed genes after transfer of chromosome 17 into the breast cancer cell line CAL51. Genes Chromosomes Cancer 44:233-46.
166
124. Koerner, I., G. Kochs, U. Kalinke, S. Weiss, and P. Staeheli. 2007. Protective role of beta interferon in host defense against influenza A virus. J Virol 81:2025-30. 125. Kolykhalov, A. A., K. Mihalik, S. M. Feinstone, and C. M. Rice. 2000. Hepatitis C virus-encoded enzymatic activities and conserved RNA elements in the 3' nontranslated region are essential for virus replication in vivo. J Virol 74:2046-51. 126. Kotaka, M., G. G. Chen, P. B. S. Lai, W. Y. Lau, P. K. S. Chan, T. W. T. Leung, and A. K. C. Li. 2002. Analysis of differentially expressed genes in hepatocellular carcinoma with hepatitis C virus by suppression subtractive hybridization. Oncol Res 13:161-7. 127. Kotenko, S. V., G. Gallagher, V. V. Baurin, A. Lewis-Antes, M. Shen, N. K. Shah, J. A. Langer, F. Sheikh, H. Dickensheets, and R. P. Donnelly. 2003. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol 4:69-77. 128. Kotlyar, M., S. Fuhrman, A. Ableson, and R. Somogyi. 2002. Spearman correlation identifies statistically significant gene expression clusters in spinal cord development and injury. Neurochem Res 27:1133- 40. 129. Krieger, N., V. Lohmann, and R. Bartenschlager. 2001. Enhancement of hepatitis C virus RNA replication by cell culture-adaptive mutations. J Virol 75:4614-24. 130. Kuang, W. W., D. A. Thompson, R. V. Hoch, and R. J. Weigel. 1998. Differential screening and suppression subtractive hybridization identified genes differentially expressed in an estrogen receptor-positive breast carcinoma cell line. Nucleic Acids Res 26:1116-23. 131. Kuiken, C., and P. Simmonds. 2009. Nomenclature and numbering of the hepatitis C virus. Methods Mol Biol 510:33-53. 132. Lamb, J. R., S. Tugendreich, and P. Hieter. 1995. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci 20:257- 9. 133. Lanford, R. E., B. Guerra, C. B. Bigger, H. Lee, D. Chavez, and K. M. Brasky. 2007. Lack of response to exogenous interferon-alpha in the liver of chimpanzees chronically infected with hepatitis C virus. Hepatology 46:999-1008. 134. Lanford, R. E., B. Guerra, H. Lee, D. R. Averett, B. Pfeiffer, D. Chavez, L. Notvall, and C. Bigger. 2003. Antiviral effect and virus-host interactions in response to alpha interferon, gamma interferon, poly(i)- poly(c), tumor necrosis factor alpha, and ribavirin in hepatitis C virus subgenomic replicons. Journal of Virology 77:1092-104. 135. Lanford, R. E., B. Guerra, H. Lee, D. Chavez, K. M. Brasky, and C. B. Bigger. 2006. Genomic response to interferon-alpha in chimpanzees: implications of rapid downregulation for hepatitis C kinetics. Hepatology 43:961-72. 136. Lathia, K. B., Z. Yan, and P. A. Clapshaw. 2009. Role of normalization in the elimination of abundant myelin sequences in spinal cord cDNA libraries produced by suppression subtractive hybridization. Cell Mol Neurobiol 29:1153-9.
167
137. Lathia, K. B., Z. Yan, and P. A. Clapshaw. 2006. Spinal cord transcriptome analysis using suppression subtractive hybridization and mirror orientation selection. Cell Mol Neurobiol 26:259-75. 138. Lauer, G. M., and B. D. Walker. 2001. Hepatitis C virus infection. N Engl J Med 345:41-52. 139. Lavanchy, D. 2009. The global burden of hepatitis C. Liver Int 29 Suppl 1:74-81. 140. Law, L. M. J., O. R. Albin, J.-W. N. Carroll, C. T. Jones, C. M. Rice, and M. R. MacDonald. 2010. Identification of a dominant negative inhibitor of human zinc finger antiviral protein reveals a functional endogenous pool and critical homotypic interactions. J Virol 84:4504-12. 141. Levy, D. E., and J. E. Darnell. 2002. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3:651-62. 142. Li, H., X. Gu, V. L. Dawson, and T. M. Dawson. 2004. Identification of calcium- and nitric oxide-regulated genes by differential analysis of library expression (DAzLE). Proc Natl Acad Sci USA 101:647-52. 143. Li, K., Z. Chen, N. Kato, M. Gale, and S. M. Lemon. 2005. Distinct poly(I-C) and virus-activated signaling pathways leading to interferon- beta production in hepatocytes. J Biol Chem 280:16739-47. 144. Li, Q., A. L. Brass, A. Ng, Z. Hu, R. J. Xavier, T. J. Liang, and S. J. Elledge. 2009. A genome-wide genetic screen for host factors required for hepatitis C virus propagation. Proc Natl Acad Sci USA 106:16410-5. 145. Li, Y., L. Chen, L. Juan, Y. Li, and F. Chen. 2002. Suppression subtractive hybridization cloning of cDNAs of differentially expressed genes in dovetree (Davidia involucrata) bracts. Plant Mol Biol Rep 20:231-8. 146. Liang, P., and A. B. Pardee. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257:967-71. 147. Lindenbach, B. D., M. J. Evans, A. J. Syder, B. Wölk, T. L. Tellinghuisen, C. C. Liu, T. Maruyama, R. O. Hynes, D. R. Burton, J. A. McKeating, and C. M. Rice. 2005. Complete replication of hepatitis C virus in cell culture. Science 309:623-6. 148. Lisitsyn, N., N. Lisitsyn, and M. Wigler. 1993. Cloning the differences between two complex genomes. Science 259:946-51. 149. Liu, C., L. Zhang, Z.-M. Shao, P. Beatty, M. Sartippour, T. F. Lane, S. H. Barsky, E. Livingston, and M. Nguyen. 2002. Identification of a novel endothelial-derived gene EG-1. Biochem Biophys Res Commun 290:602-12. 150. Liu, Q. Y., R. R. Sooknanan, L. T. Malek, M. Ribecco-Lutkiewicz, J. X. Lei, H. Shen, B. Lach, P. R. Walker, J. Martin, and M. Sikorska. 2006. Novel subtractive transcription-based amplification of mRNA (STAR) method and its application in search of rare and differentially expressed genes in AD brains. BMC Genomics 7:286. 151. Liu, X., M. Zhang, J. Duan, and K. Wu. 2008. Gene expression analysis of germinating rice seeds responding to high hydrostatic pressure. J Plant Physiol 165:1855-64.
168
152. Lohmann, V., F. Körner, A. Dobierzewska, and R. Bartenschlager. 2001. Mutations in hepatitis C virus RNAs conferring cell culture adaptation. J Virol 75:1437-49. 153. Lohmann, V., F. Körner, J. Koch, U. Herian, L. Theilmann, and R. Bartenschlager. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-3. 154. Lu, J., Q. Pan, L. Rong, W. He, S.-L. Liu, and C. Liang. 2011. The IFITM proteins inhibit HIV-1 infection. J Virol 85:2126-37. 155. MacDonald, M. R., E. S. Machlin, O. R. Albin, and D. E. Levy. 2007. The zinc finger antiviral protein acts synergistically with an interferon- induced factor for maximal activity against alphaviruses. J Virol 81:13509-18. 156. Mahalingam, R., A. Gomez-Buitrago, N. Eckardt, N. Shah, A. Guevara-Garcia, P. Day, R. Raina, and N. V. Fedoroff. 2003. Characterizing the stress/defense transcriptome of Arabidopsis. Genome Biol 4:R20. 157. Malyala, A., P. Pattee, S. R. Nagalla, M. J. Kelly, and O. K. Rønnekleiv. 2004. Suppression subtractive hybridization and microarray identification of estrogen-regulated hypothalamic genes. Neurochem Res 29:1189-200. 158. Marcello, T., A. Grakoui, G. Barba-Spaeth, E. S. Machlin, S. V. Kotenko, M. R. MacDonald, and C. M. Rice. 2006. Interferons alpha and lambda inhibit hepatitis C virus replication with distinct signal transduction and gene regulation kinetics. YGAST 131:1887-98. 159. Meier, V., S. Mihm, and G. Ramadori. 2008. Interferon-alpha therapy does not modulate hepatic expression of classical type I interferon inducible genes. J Med Virol 80:1912-8. 160. Melén, K., P. Keskinen, A. Lehtonen, and I. Julkunen. 2000. Interferon-induced gene expression and signaling in human hepatoma cell lines. J Hepatol 33:764-72. 161. Mercer, D. F., D. E. Schiller, J. F. Elliott, D. N. Douglas, C. Hao, A. Rinfret, W. R. Addison, K. P. Fischer, T. A. Churchill, J. R. Lakey, D. L. Tyrrell, and N. M. Kneteman. 2001. Hepatitis C virus replication in mice with chimeric human livers. Nat Med 7:927-33. 162. Meuleman, P., L. Libbrecht, R. De Vos, B. de Hemptinne, K. Gevaert, J. Vandekerckhove, T. Roskams, and G. Leroux-Roels. 2005. Morphological and biochemical characterization of a human liver in a uPA-SCID mouse chimera. Hepatology 41:847-56. 163. Meurs, E., K. Chong, J. Galabru, N. S. Thomas, I. M. Kerr, B. R. Williams, and A. G. Hovanessian. 1990. Molecular cloning and characterization of the human double-stranded RNA-activated protein kinase induced by interferon. Cell 62:379-90. 164. Mittal, V. 2004. Improving the efficiency of RNA interference in mammals. Nat Rev Genet 5:355-65. 165. Morales, P., and C. F. Thurston. 2003. Efficient isolation of genes differentially expressed on cellulose by suppression subtractive hybridization in Agaricus bisporus. Mycol Res 107:401-7.
169
166. Müller, S., P. Möller, M. J. Bick, S. Wurr, S. Becker, S. Günther, and B. M. Kümmerer. 2007. Inhibition of filovirus replication by the zinc finger antiviral protein. J Virol 81:2391-400. 167. Munir, S., S. Singh, K. Kaur, and V. Kapur. 2004. Suppression subtractive hybridization coupled with microarray analysis to examine differential expression of genes in virus infected cells. Biol Proced Online 6:94-104. 168. Myers, J. W., and J. E. Ferrell. 2005. Silencing gene expression with Dicer-generated siRNA pools. Methods Mol Biol 309:93-196. 169. Myers, J. W., J. T. Jones, T. Meyer, and J. E. Ferrell. 2003. Recombinant Dicer efficiently converts large dsRNAs into siRNAs suitable for gene silencing. Nat Biotechnol 21:324-8. 170. Naka, K., K. Takemoto, K.-i. Abe, H. Dansako, M. Ikeda, K. Shimotohno, and N. Kato. 2005. Interferon resistance of hepatitis C virus replicon-harbouring cells is caused by functional disruption of type I interferon receptors. J Gen Virol 86:2787-92. 171. Nakabayashi, H., K. Taketa, K. Miyano, T. Yamane, and J. Sato. 1982. Growth of human hepatoma cells lines with differentiated functions in chemically defined medium. Cancer Res 42:3858-63. 172. Nemeth, E., L. K. Millar, and G. Bryant-Greenwood. 2000. Fetal membrane distention: II. Differentially expressed genes regulated by acute distention in vitro. Am J Obstet Gynecol 182:60-7. 173. Nemeth, E., L. S. Tashima, Z. Yu, and G. D. Bryant-Greenwood. 2000. Fetal membrane distention: I. Differentially expressed genes regulated by acute distention in amniotic epithelial (WISH) cells. Am J Obstet Gynecol 182:50-9. 174. Ng, T. I., H. Mo, T. Pilot-Matias, Y. He, G. Koev, P. Krishnan, R. Mondal, R. Pithawalla, W. He, T. Dekhtyar, J. Packer, M. Schurdak, and A. Molla. 2007. Identification of host genes involved in hepatitis C virus replication by small interfering RNA technology. Hepatology 45:1413-21. 175. Ning, J., X.-B. Peng, L.-H. Qu, H.-P. Xin, T.-T. Yan, and M. Sun. 2006. Differential gene expression in egg cells and zygotes suggests that the transcriptome is restructed before the first zygotic division in tobacco. FEBS Lett 580:1747-52. 176. Parker, N., and A. C. G. Porter. 2004. Identification of a novel gene family that includes the interferon-inducible human genes 6-16 and ISG12. BMC Genomics 5:8. 177. Patterson, J. B., D. C. Thomis, S. L. Hans, and C. E. Samuel. 1995. Mechanism of interferon action: double-stranded RNA-specific adenosine deaminase from human cells is inducible by alpha and gamma interferons. Virology 210:508-11. 178. Patzwahl, R., V. Meier, G. Ramadori, and S. Mihm. 2001. Enhanced expression of interferon-regulated genes in the liver of patients with chronic hepatitis C virus infection: detection by suppression-subtractive hybridization. J Virol 75:1332-8. 179. Pawlotsky, J.-M. 2004. Pathophysiology of hepatitis C virus infection and related liver disease. Trends Microbiol 12:96-102.
170
180. Pawlotsky, J.-M., S. Chevaliez, and J. G. Mchutchison. 2007. The hepatitis C virus life cycle as a target for new antiviral therapies. Gastroenterology 132:1979-98. 181. Platanias, L. C. 2005. Mechanisms of type-I- and type-II-interferon- mediated signalling. Nat Rev Immunol 5:375-86. 182. Qu, J.-H., J. Cheng, L.-X. Zhang, L.-Y. Zhang, Y.-W. Zhong, Y. Liu, L. Wang, J.-Z. Dai, and D.-P. Xu. 2007. Identification of genes upregulated by recombinant interferon-alpha in HepG2 cells by suppressive subtractive hybridization analysis. HBPD INT 6:290-3. 183. Radaeva, S., B. Jaruga, F. Hong, W.-H. Kim, S. Fan, H. Cai, S. Strom, Y. Liu, O. El-Assal, and B. Gao. 2002. Interferon-alpha activates multiple STAT signals and down-regulates c-Met in primary human hepatocytes. Gastroenterology 122:1020-34. 184. Randall, G., L. Chen, M. Panis, A. K. Fischer, B. D. Lindenbach, J. Sun, J. Heathcote, C. M. Rice, A. M. Edwards, and I. D. McGilvray. 2006. Silencing of USP18 potentiates the antiviral activity of interferon against hepatitis C virus infection. Gastroenterology 131:1584-91. 185. Randall, G., M. Panis, J. D. Cooper, T. L. Tellinghuisen, K. E. Sukhodolets, S. Pfeffer, M. Landthaler, P. Landgraf, S. Kan, B. D. Lindenbach, M. Chien, D. B. Weir, J. J. Russo, J. Ju, M. J. Brownstein, R. Sheridan, C. Sander, M. Zavolan, T. Tuschl, and C. M. Rice. 2007. Cellular cofactors affecting hepatitis C virus infection and replication. Proc Natl Acad Sci USA 104:12884-9. 186. Raychoudhuri, A., S. Shrivastava, R. Steele, H. Kim, R. Ray, and R. B. Ray. 2011. ISG56 and IFITM1 proteins inhibit hepatitis C virus replication. J Virol 85:12881-9. 187. Rebrikov, D. V., O. V. Britanova, N. G. Gurskaya, K. A. Lukyanov, V. S. Tarabykin, and S. A. Lukyanov. 2000. Mirror orientation selection (MOS): a method for eliminating false positive clones from libraries generated by suppression subtractive hybridization. Nucleic Acids Res 28:E90. 188. Rebrikov, D. V., M. E. Bulina, E. A. Bogdanova, L. L. Vagner, and S. A. Lukyanov. 2002. Complete genome sequence of a novel extrachromosomal virus-like element identified in planarian Girardia tigrina. BMC Genomics 3:15. 189. Rebrikov, D. V., S. M. Desai, P. D. Siebert, and S. A. Lukyanov. 2004. Suppression subtractive hybridization. Methods Mol Biol 258:107-34. 190. Rho, J., C. R. Altmann, N. D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A. H. Brivanlou, and Y. Choi. 2002. Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis. DNA Cell Biol 21:541-9. 191. Robertson, B., G. Myers, C. Howard, T. Brettin, J. Bukh, B. Gaschen, T. Gojobori, G. Maertens, M. Mizokami, O. Nainan, S. Netesov, K. Nishioka, T. Shin i, P. Simmonds, D. Smith, L. Stuyver, and A. Weiner. 1998. Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses: proposals for standardization. International Committee on Virus Taxonomy. Arch Virol 143:2493-503.
171
192. Rockett, J. C., D. J. Esdaile, and G. G. Gibson. 1997. Molecular profiling of non-genotoxic hepatocarcinogenesis using differential display reverse transcription-polymerase chain reaction (ddRT-PCR). Eur J Drug Metab Pharmacokinet 22:329-33. 193. Romano, N., and G. Macino. 1992. Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol Microbiol 6:3343-53. 194. Rych!owska, M., and K. Bie"kowska-Szewczyk. 2007. Hepatitis C-- new developments in the studies of the viral life cycle. Acta Biochim Pol 54:703-15. 195. Ryman, K. D., K. C. Meier, E. M. Nangle, S. L. Ragsdale, N. L. Korneeva, R. E. Rhoads, M. R. MacDonald, and W. B. Klimstra. 2005. Sindbis virus translation is inhibited by a PKR/RNase L-independent effector induced by alpha/beta interferon priming of dendritic cells. J Virol 79:1487-99. 196. Sadler, A. J., and B. R. G. Williams. 2008. Interferon-inducible antiviral effectors. Nat Rev Immunol 8:559-68. 197. Saikia, P., V. Fensterl, and G. C. Sen. 2010. The inhibitory action of P56 on select functions of E1 mediates interferon's effect on human papillomavirus DNA replication. J Virol 84:13036-9. 198. Saito, I., T. Miyamura, A. Ohbayashi, H. Harada, T. Katayama, S. Kikuchi, Y. Watanabe, S. Koi, M. Onji, and Y. Ohta. 1990. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci USA 87:6547-9. 199. Samuel, C. E. 2001. Antiviral actions of interferons. Clin Microbiol Rev 14:778-809. 200. Sarasin-Filipowicz, M. 2010. Interferon therapy of hepatitis C: molecular insights into success and failure. Swiss Med Wkly 140:3-11. 201. Sarasin-Filipowicz, M., E. J. Oakeley, F. H. T. Duong, V. Christen, L. Terracciano, W. Filipowicz, and M. H. Heim. 2008. Interferon signaling and treatment outcome in chronic hepatitis C. Proc Natl Acad Sci USA 105:7034-9. 202. Schena, M., D. Shalon, R. W. Davis, and P. O. Brown. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270:467-70. 203. Schlingemann, J., J. Hess, G. Wrobel, U. Breitenbach, C. Gebhardt, P. Steinlein, H. Kramer, G. Fürstenberger, M. Hahn, P. Angel, and P. Lichter. 2003. Profile of gene expression induced by the tumour promotor TPA in murine epithelial cells. Int J Cancer 104:699-708. 204. Schoggins, J. W., S. J. Wilson, M. Panis, M. Y. Murphy, C. T. Jones, P. Bieniasz, and C. M. Rice. 2011. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature 472:481-5. 205. Schreiter, K., M. Hausmann, T. Spoettl, U. G. Strauch, F. Bataille, J. Schoelmerich, H. Herfarth, W. Falk, and G. Rogler. 2005. Glycoprotein (gp) 96 expression: induced during differentiation of intestinal macrophages but impaired in Crohn's disease. Gut 54:935-43. 206. Sen, G. C. 2001. Viruses and interferons. Annu Rev Microbiol 55:255-81. 207. Sen, G. L., and H. M. Blau. 2006. A brief history of RNAi: the silence of the genes. FASEB J 20:1293-9.
172
208. Seo, E.-Y., J.-H. Namkung, K.-M. Lee, W.-H. Lee, M. Im, S.-H. Kee, G. Tae Park, J.-M. Yang, Y.-J. Seo, J.-K. Park, C. Deok Kim, and J.-H. Lee. 2005. Analysis of calcium-inducible genes in keratinocytes using suppression subtractive hybridization and cDNA microarray. Genomics 86:528-38. 209. Shackel, N. A., M. D. Gorrell, and G. W. McCaughan. 2002. Gene array analysis and the liver. Hepatology 36:1313-25. 210. Shackel, N. A., P. H. McGuinness, C. A. Abbott, M. D. Gorrell, and G. W. McCaughan. 2003. Novel differential gene expression in human cirrhosis detected by suppression subtractive hybridization. Hepatology 38:577-88. 211. Sheppard, P., W. Kindsvogel, W. Xu, K. Henderson, S. Schlutsmeyer, T. E. Whitmore, R. Kuestner, U. Garrigues, C. Birks, J. Roraback, C. Ostrander, D. Dong, J. Shin, S. Presnell, B. Fox, B. Haldeman, E. Cooper, D. Taft, T. Gilbert, F. J. Grant, M. Tackett, W. Krivan, G. McKnight, C. Clegg, D. Foster, and K. M. Klucher. 2003. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol 4:63-8. 212. Shi, L., S.-L. Zhang, K. Li, Y. Hong, Q. Wang, Y. Li, J. Guo, W.-h. Fan, L. Zhang, and J. Cheng. 2008. NS5ATP9, a gene up-regulated by HCV NS5A protein. Cancer Lett 259:192-7. 213. Shim, K. S., S. K. Cho, J. U. Jeung, K. W. Jung, M. K. You, S. H. Ok, Y. S. Chung, K. H. Kang, H. G. Hwang, H. C. Choi, H. P. Moon, and J. S. Shin. 2004. Identification of fungal ( Magnaporthe grisea) stress- induced genes in wild rice ( Oryza minuta). Plant Cell Rep 22:599-607. 214. Shresta, S., J. L. Kyle, H. M. Snider, M. Basavapatna, P. R. Beatty, and E. Harris. 2004. Interferon-dependent immunity is essential for resistance to primary dengue virus infection in mice, whereas T- and B- cell-dependent immunity are less critical. J Virol 78:2701-10. 215. Silverman, R. H. 1994. Fascination with 2-5A-dependent RNase: a unique enzyme that functions in interferon action. J Interferon Res 14:101-4. 216. Simpson, K. J., G. M. Davis, and P. R. Boag. 2012. Comparative high- throughput RNAi screening methodologies in C. elegans and mammalian cells. New Biotechnol DOI: http://dx.doi.org/10.1016/j.ntb.2012.01.003. 217. Smith, M. W., Z. N. Yue, M. J. Korth, H. A. Do, L. Boix, N. Fausto, J. Bruix, R. L. Carithers, and M. G. Katze. 2003. Hepatitis C virus and liver disease: global transcriptional profiling and identification of potential markers. Hepatology 38:1458-67. 218. Sokolov, B. P., and D. J. Prockop. 1994. A rapid and simple PCR- based method for isolation of cDNAs from differentially expressed genes. Nucleic Acids Res 22:4009-15. 219. Stark, G. R., I. M. Kerr, B. R. Williams, R. H. Silverman, and R. D. Schreiber. 1998. How cells respond to interferons. Annu Rev Biochem 67:227-64. 220. Stassar, M. J., G. Devitt, M. Brosius, L. Rinnab, J. Prang, T. Schradin, J. Simon, S. Petersen, A. Kopp-Schneider, and M. Zöller. 2001. Identification of human renal cell carcinoma associated genes by suppression subtractive hybridization. Br J Cancer 85:1372-82.
173
221. Su, A. I., J. P. Pezacki, L. Wodicka, A. D. Brideau, L. Supekova, R. Thimme, S. Wieland, J. Bukh, R. H. Purcell, P. G. Schultz, and F. V. Chisari. 2002. Genomic analysis of the host response to hepatitis C virus infection. Proc Natl Acad Sci USA 99:15669-74. 222. Supekova, L., F. Supek, J. Lee, S. Chen, N. Gray, J. P. Pezacki, A. Schlapbach, and P. G. Schultz. 2008. Identification of human kinases involved in hepatitis C virus replication by small interference RNA library screening. J Biol Chem 283:29-36. 223. Suzuki, T., H. Aizaki, K. Murakami, I. Shoji, and T. Wakita. 2007. Molecular biology of hepatitis C virus. J Gastroenterol 42:411-23. 224. Tai, A. W., Y. Benita, L. F. Peng, S.-S. Kim, N. Sakamoto, R. J. Xavier, and R. T. Chung. 2009. A functional genomic screen identifies cellular cofactors of hepatitis C virus replication. Cell Host Microbe 5:298-307. 225. Takaoka, A., S. Hayakawa, H. Yanai, D. Stoiber, H. Negishi, H. Kikuchi, S. Sasaki, K. Imai, T. Shibue, K. Honda, and T. Taniguchi. 2003. Integration of interferon-alpha/beta signalling to p53 responses in tumour suppression and antiviral defence. Nature 424:516-23. 226. Takaoka, A., and H. Yanai. 2006. Interferon signalling network in innate defence. Cell Microbiol 8:907-22. 227. Taylor, D. R., M. Puig, M. E. R. Darnell, K. Mihalik, and S. M. Feinstone. 2005. New antiviral pathway that mediates hepatitis C virus replicon interferon sensitivity through ADAR1. J Virol 79:6291-8. 228. Taylor, D. R., S. T. Shi, P. R. Romano, G. N. Barber, and M. M. Lai. 1999. Inhibition of the interferon-inducible protein kinase PKR by HCV E2 protein. Science 285:107-10. 229. Thomas, E., J. J. Feld, Q. Li, Z. Hu, M. W. Fried, and T. J. Liang. 2011. Ribavirin potentiates interferon action by augmenting interferon- stimulated gene induction in hepatitis C virus cell culture models. Hepatology 53:32-41. 230. Tong, J., Y.-W. Wang, and Y.-A. Lu. 2012. New developments in small molecular compounds for anti-hepatitis C virus (HCV) therapy. J Zhejiang Univ Sci B 13:56-82. 231. Traina, G., S. Valleggi, R. Bernardi, M. Rizzo, M. Calvani, R. Nicolai, L. Mosconi, M. Durante, and M. Brunelli. 2004. Identification of differentially expressed genes induced in the rat brain by acetyl-L- carnitine as evidenced by suppression subtractive hybridisation. Brain Res Mol Brain Res 132:57-63. 232. Uchijima, M., E. Raz, D. A. Carson, T. Nagata, and Y. Koide. 2001. Identification of immunostimulatory DNA-induced genes by suppression subtractive hybridization. Biochem Biophys Res Commun 286:688-91. 233. Vallée, M., C. Gravel, M.-F. Palin, H. Reghenas, P. Stothard, D. S. Wishart, and M.-A. Sirard. 2005. Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species. Biol Reprod 73:63-71. 234. van den Berg, N., B. G. Crampton, I. Hein, P. R. J. Birch, and D. K. Berger. 2004. High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis. BioTechniques 37:818-24.
174
235. van Wijngaarden, J., K. de Rooij, E. van Beek, H. Bernsen, I. Que, V. W. M. van Hinsbergh, and C. Löwik. 2004. Identification of differentially expressed genes in a renal cell carcinoma tumor model after endostatin-treatment. Lab Invest 84:1472-83. 236. Vedoy, C. G., M. H. Bengtson, and M. C. Sogayar. 1999. Hunting for differentially expressed genes. Braz J Med Biol Res 32:877-84. 237. Velculescu, V. E., L. Zhang, B. Vogelstein, and K. W. Kinzler. 1995. Serial analysis of gene expression. Science 270:484-7. 238. Venter, J. C., M. D. Adams, E. W. Myers, P. W. Li, R. J. Mural, G. G. Sutton, H. O. Smith, M. Yandell, C. A. Evans, R. A. Holt, J. D. Gocayne, P. Amanatides, R. M. Ballew, D. H. Huson, J. R. Wortman, Q. Zhang, C. D. Kodira, X. H. Zheng, L. Chen, M. Skupski, G. Subramanian, P. D. Thomas, J. Zhang, G. L. Gabor Miklos, C. Nelson, S. Broder, A. G. Clark, J. Nadeau, V. A. McKusick, N. Zinder, A. J. Levine, R. J. Roberts, M. Simon, C. Slayman, M. Hunkapiller, R. Bolanos, A. Delcher, I. Dew, D. Fasulo, M. Flanigan, L. Florea, A. Halpern, S. Hannenhalli, S. Kravitz, S. Levy, C. Mobarry, K. Reinert, K. Remington, J. Abu-Threideh, E. Beasley, K. Biddick, V. Bonazzi, R. Brandon, M. Cargill, I. Chandramouliswaran, R. Charlab, K. Chaturvedi, Z. Deng, V. Di Francesco, P. Dunn, K. Eilbeck, C. Evangelista, A. E. Gabrielian, W. Gan, W. Ge, F. Gong, Z. Gu, P. Guan, T. J. Heiman, M. E. Higgins, R. R. Ji, Z. Ke, K. A. Ketchum, Z. Lai, Y. Lei, Z. Li, J. Li, Y. Liang, X. Lin, F. Lu, G. V. Merkulov, N. Milshina, H. M. Moore, A. K. Naik, V. A. Narayan, B. Neelam, D. Nusskern, D. B. Rusch, S. Salzberg, W. Shao, B. Shue, J. Sun, Z. Wang, A. Wang, X. Wang, J. Wang, M. Wei, R. Wides, C. Xiao, C. Yan, et al. 2001. The sequence of the human genome. Science 291:1304-51. 239. Vestal, D. J., and J. A. Jeyaratnam. 2011. The guanylate-binding proteins: emerging insights into the biochemical properties and functions of this family of large interferon-induced guanosine triphosphatase. J Interferon Cytokine Res 31:89-97. 240. Vilcek, J. 2003. Novel interferons. Nat Immunol 4:8-9. 241. Villaret, D. B., T. Wang, D. Dillon, J. Xu, D. Sivam, M. A. Cheever, and S. G. Reed. 2000. Identification of genes overexpressed in head and neck squamous cell carcinoma using a combination of complementary DNA subtraction and microarray analysis. Laryngoscope 110:374-81. 242. von Stein, O. D., W. G. Thies, and M. Hofmann. 1997. A high throughput screening for rarely transcribed differentially expressed genes. Nucleic Acids Res 25:2598-602. 243. Vrolijk, J. M., A. Kaul, B. E. Hansen, V. Lohmann, B. L. Haagmans, S. W. Schalm, and R. Bartenschlager. 2003. A replicon-based bioassay for the measurement of interferons in patients with chronic hepatitis C. J Virol Methods 110:201-9. 244. Wacher, C., M. Müller, M. J. Hofer, D. R. Getts, R. Zabaras, S. S. Ousman, F. Terenzi, G. C. Sen, N. J. C. King, and I. L. Campbell. 2007. Coordinated regulation and widespread cellular expression of interferon-stimulated genes (ISG) ISG-49, ISG-54, and ISG-56 in the
175
central nervous system after infection with distinct viruses. J Virol 81:860-71. 245. Wakita, T., T. Pietschmann, T. Kato, T. Date, M. Miyamoto, Z. Zhao, K. Murthy, A. Habermann, H.-G. Kräusslich, M. Mizokami, R. Bartenschlager, and T. J. Liang. 2005. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med 11:791-6. 246. Walters, K.-A., M. A. Joyce, J. C. Thompson, M. W. Smith, M. M. Yeh, S. Proll, L.-F. Zhu, T. J. Gao, N. M. Kneteman, D. L. Tyrrell, and M. G. Katze. 2006. Host-specific response to HCV infection in the chimeric SCID-beige/Alb-uPA mouse model: role of the innate antiviral immune response. PLoS Pathog 2:e59. 247. Wang, C., J. Pflugheber, R. Sumpter, D. L. Sodora, D. Hui, G. C. Sen, and M. Gale. 2003. Alpha interferon induces distinct translational control programs to suppress hepatitis C virus RNA replication. J Virol 77:3898- 912. 248. Wang, N., Q. Dong, J. Li, R. K. Jangra, M. Fan, A. R. Brasier, S. M. Lemon, L. M. Pfeffer, and K. Li. 2010. Viral induction of the zinc finger antiviral protein is IRF3-dependent but NF-kappaB-independent. J Biol Chem 285:6080-90. 249. Wang, Q., J. Khillan, P. Gadue, and K. Nishikura. 2000. Requirement of the RNA editing deaminase ADAR1 gene for embryonic erythropoiesis. Science 290:1765-8. 250. Wang, X., F. Lv, and G. Gao. 2010. Mutagenesis analysis of the zinc- finger antiviral protein. Retrovirology 7:19. 251. Wang, X.-H., R. Aliyari, W.-X. Li, H.-W. Li, K. Kim, R. Carthew, P. Atkinson, and S.-W. Ding. 2006. RNA interference directs innate immunity against viruses in adult Drosophila. Science 312:452-4. 252. Watson, J. B., and J. E. Margulies. 1993. Differential cDNA screening strategies to identify novel stage-specific proteins in the developing mammalian brain. Dev Neurosci 15:77-86. 253. Weber, F. 2007. Interaction of hepatitis C virus with the type I interferon system. World J Gastroenterol 13:4818-23. 254. Wu, W. X., Q. Zhang, X. H. Ma, N. Unno, and P. W. Nathanielsz. 1999. Suppression subtractive hybridization identified a marked increase in thrombospondin-1 associated with parturition in pregnant sheep myometrium. Endocrinology 140:2364-71. 255. Yan, W., H. Lee, E. C. Yi, D. Reiss, P. Shannon, B. K. Kwieciszewski, C. Coito, X.-j. Li, A. Keller, J. Eng, T. Galitski, D. R. Goodlett, R. Aebersold, and M. G. Katze. 2004. System-based proteomic analysis of the interferon response in human liver cells. Genome Biol 5:R54. 256. Yanagi, M., R. H. Purcell, S. U. Emerson, and J. Bukh. 1999. Hepatitis C virus: an infectious molecular clone of a second major genotype (2a) and lack of viability of intertypic 1a and 2a chimeras. Virology 262:250- 63. 257. Yang, G. P., D. T. Ross, W. W. Kuang, P. O. Brown, and R. J. Weigel. 1999. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes. Nucleic Acids Res 27:1517-23.
176
258. Yang, M., and A. J. Sytkowski. 1996. Cloning differentially expressed genes by linker capture subtraction. Anal Biochem 237:109- 14. 259. Ye, P., S. Liu, Y. Zhu, G. Chen, and G. Gao. 2010. DEXH-Box protein DHX30 is required for optimal function of the zinc-finger antiviral protein. Protein Cell 1:956-64. 260. Yi, M., and S. M. Lemon. 2004. Adaptive mutations producing efficient replication of genotype 1a hepatitis C virus RNA in normal Huh7 cells. J Virol 78:7904-15. 261. Zeng, J., R. A. Gorski, and D. Hamer. 1994. Differential cDNA cloning by enzymatic degrading subtraction (EDS). Nucleic Acids Res 22:4381- 5. 262. Zhang, J.-K., L.-F. Zhao, J. Cheng, J. Guo, D.-Q. Wang, Y. Hong, and Y. Mao. 2007. Screening and cloning for proteins transactivated by the PS1TP5 protein of hepatitis B virus: a suppression subtractive hybridization study. World J Gastroenterol 13:1602-7. 263. Zhang, L., W. Zhou, V. E. Velculescu, S. E. Kern, R. H. Hruban, S. R. Hamilton, B. Vogelstein, and K. W. Kinzler. 1997. Gene expression profiles in normal and cancer cells. Science 276:1268-72. 264. Zhang, X.-N., J.-X. Liu, Y.-W. Hu, H. Chen, and Z.-H. Yuan. 2006. Hyper-activated IRF-1 and STAT1 contribute to enhanced interferon stimulated gene (ISG) expression by interferon alpha and gamma co- treatment in human hepatoma cells. Biochim Biophys Acta 1759:417-25. 265. Zhang, Y., C. W. Burke, K. D. Ryman, and W. B. Klimstra. 2007. Identification and characterization of interferon-induced proteins that inhibit alphavirus replication. J Virol 81:11246-55. 266. Zhao, H., W. Lin, K. Kumthip, D. Cheng, D. N. Fusco, O. Hofmann, N. Jilg, A. W. Tai, K. Goto, L. Zhang, W. Hide, J. Y. Jang, L. F. Peng, and R. T. Chung. 2012. A functional genomic screen reveals novel host genes that mediate interferon-alpha's effects against hepatitis C virus. J Hepatol 56:326-33. 267. Zhou, Z., N. Wang, S. E. Woodson, Q. Dong, J. Wang, Y. Liang, R. Rijnbrand, L. Wei, J. E. Nichols, J.-T. Guo, M. R. Holbrook, S. M. Lemon, and K. Li. 2010. Antiviral activities of ISG20 in positive-strand RNA virus infections. Virology 409:175-88. 268. Zhu, F., W. Yan, Z. L. Zhao, Y. B. Chai, F. Lu, Q. Wang, W. D. Peng, A. G. Yang, and C. J. Wang. 2000. Improved PCR-based subtractive hybridization strategy for cloning differentially expressed genes. BioTechniques 29:310-3. 269. Zhu, H., H. Zhao, C. D. Collins, S. E. Eckenrode, Q. Run, R. A. McIndoe, J. M. Crawford, D. R. Nelson, J.-X. She, and C. Liu. 2003. Gene expression associated with interferon alfa antiviral activity in an HCV replicon cell line. Hepatology 37:1180-8. 270. Zhu, Y., and G. Gao. 2008. ZAP-mediated mRNA degradation. RNA Biol 5:65-7.