Pathogenetic Mechanisms and Genotype–Phenotype Correlations in Nemaline Myopathies and Related Disorders Caused by Mutations in Tropomyosin Genes and Nebulin

Pathogenetic mechanisms and genotype–phenotype correlations in nemaline myopathies and related disorders caused by mutations in tropomyosin genes and nebulin

Minttu Marttila

University of Helsinki 2014

Pathogenetic mechanisms and genotype–phenotype correlations in nemaline myopathies and related disorders caused by mutations in tropomyosin genes and nebulin

Minttu Marttila

The department of Medical Genetics, University of Helsinki, Helsinki, Finland and The Folkhälsan Institute of Genetics

Academic Dissertation

To be presented, with the permission of the Faculty of Biological and Environmental Sciences of University of Helsinki, for public examination in the Lecture Hall 1, Biomedicum Helsinki, Haartmaninkatu 8, Helsinki on 7th of November at 12 o’clock

Helsinki 2014

Supervisors

Associate professor Carina Wallgren-Pettersson, DM The Folkhälsan Institute of Genetics and Department of Medical Genetics University of Helsinki Finland

Associate professor Mikaela Grönholm, PhD Division of Biochemistry Department of Biological and Environmental Sciences University of Helsinki Finland

Reviewers

Associate professor Pirta Hotulainen, PhD Neuroscience Center University of Helsinki Finland

Associate professor Jukka Moilanen, DM Department of Clinical Genetics Oulu University Hospital Finland

Opponent

Julien Ochala, PhD Centre of Human and Aerospace Physiological Sciences King's College London UK

ISBN 978-951-51-0287-4 (paperback) ISBN 978-951-51-0288-1 (PDF)

University of Helsinki Print Helsinki 2014

LIST OF ORIGINAL PUBLICATIONS

The thesis is based on the following publications.

I Marttila M, Lemola E, Wallefeld W, Memo M, Donner K, Laing NG, Marston S, Grönholm M, Wallgren-Pettersson C. Abnormal actin binding of aberrant β-tropomyosins is a molecular cause of muscle weakness in TPM2-related nemaline and cap myopathy. Biochem J 2012 15;442(1):231-9.

II Marttila M, Lehtokari VL, Marston S, Nyman TA, Barnerias C, Beggs AH, Bertini E, Ceyhan-Birsoy O, Cintas P, Gerard M, Gilbert-Dussardier B, Hogue JS, Longman C, Eymard B, Frydman M, Kang PB, Klinge L, Kolski H, Lochmüller H, Magy L, Manel V, Mayer M, Mercuri E, North KN, Peudenier-Robert S, Pihko H, Probst FJ, Reisin R, Stewart W, Taratuto AL, de Visser M, Wilichowski E, Winer J, Nowak K, Laing NG, Winder TL, Monnier N, Clarke NF, Pelin K, Grönholm M, Wallgren-Pettersson C. Mutation update and genotype- phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies. Hum Mutat 2014 35(7):779-90.

III Marttila M*, Hanif M*, Lemola E, Nowak KJ, Laitila J, Grönholm M, Wallgren-Pettersson C, Pelin K. Nebulin interactions with actin and tropomyosin are altered by disease-causing mutations. Skelet Muscle 2014 1(4)15.

*The authors contributed equally to the work. The articles are reprinted with the permission of the copyright owners.

Contents

List of original publications

Author contributions

Abbreviations

Abstract

Tiivistelmä

Introduction

Review of the literature 1

1 SKELETAL MUSCLE 1

1.1 Muscle fibre types 1

1.2 The Muscle sarcomere 2

2 Congenital myopathies 15

2.1 Nemaline myopathies 16

2.2 Disorders related to nemaline myopathy 24

2 Aims of the study 27

3 Materials and methods 27

3.1 Polymerase Chain Reaction (PCR) and sequencing 27

3.2 Constructs 27

3.3 Production of wild-type and aberrant β-tropomyosins 28

3.4 RNA isolation and reverse transcriptase polymerase chain reaction (RT-PCR) 28

3.5 In vitro mutagenesis and sequencing 29

3.6 Construction of vectors for the expression of nebulin super-repeats 31

3.7 Nebulin production in Escherichia coli 31

3.8 Three-dimensional models 32

4 RESULTS AND DISCUSSION 33

4.1 Novel mutations in TPM2 and TPM3 33

4.2 Clinical correlations 41

4.3 Genotype-phenotype correlations 43

4.4 Identification of novel phosphorylation sites in β-tropomyosin 49

4.5 Functional analysis by in vitro motility assay 50

4.6 Mass spectrometry and three-dimensional models 51

4.7 Circular dichroism spectra of β-tropomyosin 53

4.8 Nebulin interactions with actin and tropomyosin 55

4.9 Conclusions and future prospects 59

5 Acknowledgements 61

6 References 63

AUTHOR CONTRIBUTIONS

I CWP was responsible for planning the project, for clinical correlations and contributed to drafting the text. MM performed actin-binding experiments, three-dimensional models, mass- spectrometric analysis and contributed to writing the article. EL was responsible for protein production and actin-binding experiments. KD produced three tropomyosin constructs. MG, a senior protein expert, planned parts of the experimental work and wrote parts of the paper. NL and SM contributed to writing the paper. WW performed circular dichroism experiments and drafted parts of the text. MMemo performed in vitro motility experiments and contributed to writing the article.

II MM was responsible for coordinating the collection of mutations and writing the paper. VLL contributed to writing the article and performed the mutation detection using dHPLC and sequencing. TAN performed the mass-spectrometric analyses. KP performed the pathogenicity analysis and wrote parts of the paper. MG and SM contributed to writing the article. CWP reported the clinical correlations and coordinated the project. The remaining authors contributed to the article by donating mutations and clinical data discovered in their laboratories.

III MH performed cloning and site-directed mutagenesis. Nebulin protein fragments were produced by MH and MM. Tropomyosins were produced and purified by EL and KJN. MH performed the nebulin-actin binding experiments together with EL. MM studied wild type (wt) and mutant nebulin binding to wt tropomyosins. KP and JL produced the figure on nebulin super repeats. MM, MH, KP, MG and CWP planned the study and wrote the article.

ABBREVIATIONS

ACTA1 slow skeletal muscle -actin

ATP adenosine triphosphate bp base pair

BTB–BACK bric-a-brac, tram-track, broad-complex –BTB and C-terminal kelch

Ca2+ calsium ion

CD circular dicroism cDNA complimentary DNA

CFL2 gene encoding cofilin 2

CFTD congenital fibre-type disproportion

DA distal arthrogryposis

DHPR dihydropyridine receptor L-type Ca2+ channel

DNA deoxyribonucleic acid

EC excitation–contraction coupling e.g. exempli grafia

EMG electromyography

F-actin filamentous actin

FSD fibre size disproortion

GST glutathione-S-transferase

H&E Hematoxylin&eosin i.e. id est

IPTG isopropyl-β-D-thiogalactopyranoside kb kilobase

KBTBD13 a member of the BTB/kelch protein family kDa kiloDalton

KLHL40 and kelch-like family members 40 and 41 KLHL41

KO knock-out

LB Luria-Bertani media

LMOD3 gene encoding leiomodin-3

Mg2+ magnesium ion mM milli molaarinen

μM mikro molaarinen

µg mikro gramma

µl mikro litra

NEB gene encoding nebulin

NM nemaline myopathy

MDa MegaDalton

MYH gene encoding myosin heavy-chain pCa negative logarithm of the concentration of calcium ions in solution

PDB protein data bank

PBS phosphate buffered saline

RT-PCR reverse transcriptase polymerase chain reaction

RYR1 gene encoding ryanodine receptor 1

RyR1 the ryanodine receptor Ca2+ release channel

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

Sf9 Spodoptera frugiperda hyönteissolut

SR sarcoplasmic reticulum

Tm tropomyosin

TnC troponin C

TnI troponin I

TnT troponin T

TNNT1 gene encoding troponiini T

TPM2 gene encoding β-tropomyosin

TPM3 gene encoding slow α-tropomyosin

UTR untranslated region

VL vastus lateralis wt wild type

ABSTRACT This thesis project aimed to collect all mutations in TPM2 and TPM3 genes hitherto found to cause congenital myopathies, to perform genotype-phenotype correlations, and to increase our understanding of the pathogenetic mechanisms of congenital myopathies caused by mutations in the tropomyosin and nebulin genes. Nemaline myopathy (NM), a rare, genetic muscle disorder defined on the basis of muscle dysfunction and the presence of structural abnormalities in the muscle fibres (i.e. nemaline bodies), is caused by mutations in ten genes known to date: Nebulin (NEB), α-actin (ACTA1), α-tropomyosin (TPM3), β-tropomyosin (TPM2), troponin T (TNNT1), cofilin 2 (CFL2), KBTBD13, KLHL40, KLHL41 and leiomodin 3 (LMOD 3). This study concentrated on the investigation of β-tropomyosin and nebulin since both have been identified by our group as genes causative of NM. In addition, this study focused on α-tropomyosin because it forms dimers with β-tropomyosin. Tropomyosin controls muscle contraction by inhibiting the actin–myosin interaction in a calcium-sensitive manner. Mutations in tropomyosin genes may cause NM, cap myopathy, congenital fibre-type disproportion (CFTD), distal arthrogryposes (DA) and Escobar syndrome. We correlated the clinical picture of these diseases to novel and previously published mutations to the TPM2 and TPM3 genes, including 30 mutations causing amino acid changes in TPM2 and 20 mutations in TPM3. Most mutations were heterozygous changes associated with autosomal dominant disease including 19 novel and 31 previously reported mutations. Previous studies found that five mutations in TPM2 and one in TPM3 caused an increased Ca2+ sensitivity, resulting in a hypercontractile molecular phenotype. Patients with hypercontractile molecular phenotypes more often had contractures of the limb joints (18/19) and jaw (6/19) than those with non-hypercontractile molecular phenotypes (2/22 and 1/22). Our in silico predictions show that most tropomyosin mutations affect the tropomyosin– actin association or tropomyosin head-to-tail binding. We studied the pathogenetic mechanisms to which five disease-causing mutations in β-tropomyosin (p.Glu41Lys, p.Lys49del, p.Glu117Lys, p.Glu139del and p.Gln147Pro) lead. We showed that four of the mutations cause changes in the affinity for actin (p.Lys49del, p.Glu117Lys, p.Glu139del and p.Gln147Pro) leading to muscle weakness in patients, while two mutations show defective Ca2+ activation of contractility (p.Glu41Lys and p.Glu117Lys). We also mapped the amino acids altered by the mutations to regions important for actin binding and note that two of the mutations cause altered protein conformations accounting for an impaired actin affinity. Nebulin (NEB) is a giant 600–900-kDa filamentous protein that is a part of the skeletal muscle’s thin filament. Because of its large size and the difficulty of extracting nebulin in its native state from muscle, its functions remain partly unknown. To study nebulin in more detail, we produced four wild-type (wt) nebulin super-repeats (283–347-amino acids long) and five corresponding patient mutantion constructs. We included three missense mutations (p.Glu2431Lys, p.Ser4665Ile and p.Thr5681Pro) and two in-frame deletions (p.Arg2478_Asp2512del and p.Val3681_Asn3686del) in the study. The mutations were identified in patients with NM or distal myopathy. We performed F-actin and tropomyosin- binding experiments for the nebulin fragments using co-sedimentation and GST pull-down assays. We also tested wt nebulin fragment (super repeats 9, 14, 18 and 22) affinity to β–

tropomyosin wt and six mutants (Lys7del, Glu41Lys, Lys49del, Glu117Lys, Glu139del and Gln147Pro) using the GST-pull-down assay. Our results demonstrate actin–nebulin interactions and, for the first time, tropomyosin–nebulin interactions in vitro, and show that the interactions are altered by disease-causing mutations. These results indicate that mutations affecting both tropomyosin and nebulin lead to changes in protein interactions, suggesting that an abnormal interaction between aberrant thin filament proteins is a pathogenetic mechanism in NM and related disorders.

TIIVISTELMÄ Väitöskirjatyön tavoitteena oli kerätä kaikki tähän mennessä tunnetut mutaatiot TPM2 ja TPM3 geeneistä, jotka aiheuttavat synnynnäisiä myopatioita. Halusimme tehdä näistä genotyyppi-fenotyyppi-korrelaatioita sekä toiminnallista analyysiä proteiineilla selvittääksemme taudin patogeneesia. Nemaliinimyopatia (NM) on harvinainen geneettinen lihassairaus jonka oireita ovat lihaksen toiminnan häiriöt ja lihassyiden rakenteelliset poikkeavuudet, niin sanotut nemaliinikappaleet. NM:aa aiheuttavat mutaatiot kymmenessä geenissä: nebuliini (NEB), aktiini (ACTA1), α-tropomyosiini (TPM3), β-tropomyosiini (TPM2), troponiini T (TNNT1), kofiliini 2 (CFL2), KBTBD13, KLHL40, KLHL41 ja leiomodiini 3 (LMOD 3). Tutkimuksemme keskittyi β-tropomyosiiniin ja nebuliiniin, sillä ne on todettu NM:n aiheuttajageeneiksi ryhmämme aiemmissa tutkimuksissa. Myös α-tropomyosiinia tutkittiin, sillä se muodostaa dimeereitä β-tropomyosiinin kanssa. Tropomyosiini osallistuu lihassupistukseen säätelemällä aktiinin ja myosiinin sitoutumista toisiinsa. Solunsisäinen kalsiumin (Ca2+) määrä säätelee lihassupistusta. Mutaatiot tropomyosiinigeeneissä voivat aiheuttaa NM:aa, cap-myopatiaa, syy-tyyppi-epäsuhtaa (congenital fibre-type disproportion; CFTD), distaalista artrogrypoosia (DA) ja Escobarin oireyhtymää. Olemme verranneet sairauksien kliinistä kirjoa sekä uusia ja tunnettuja mutaatioita TPM2 ja TPM3 geeneissä. Mukana on 30 mutaatiota TPM2- ja 20 mutaatiota TPM3- geeneistä. Useimmat mutaatiot ovat heterotsygoottisia muutoksia, jotka aiheuttavat autosomaalisen dominantin taudin. Tutkimuksessa oli mukana 19 uutta ja 31 tunnettua mutaatiota TPM2 ja TPM3 geeneissä. Aiemmissa tutkimuksissa on näytetty että TPM2 ja TPM3 mutaatiot aiheuttavat kohonnutta Ca2+ herkkyyttä aiheuttaen hyperkontraktiilin molekulaarisen fenotyypin. Potilailla, joilla oli hyperkontraktiili molekulaarinen fenotyyppi oli useammin kontraktuuroja raajojen nivelissä (18/19) ja leuassa (6/19) kuin potilailla joilla ei ollut hyperkontraktiilia fenotyyppia (2/22 ja 1/22). In silico mallintaminen paljasti että useimmat tropomyosiini-mutaatiot vaikuttavat tropomyosiinin ja aktiinin sitoutumiseen toisiinsa tai tropomyosiinin päästä häntään (head-to- tail) sitoutumiseen. Tutkimme viiden β-tropomyosiini-mutaation (p.Glu41Lys, p.Lys49del, p.Glu117Lys, p.Glu139del ja p.Gln147Pro) aiheuttamaa patogeneesia. Näytimme, että neljä mutaatiota muuttaa tropomyosiinin sitoutumista aktiiniin (p.Lys49del, p.Glu117Lys, p.Glu139del ja p.Gln147Pro), joka on aiheuttanut näiden potilaiden lihasheikkouden. Mutaatiot p.Glu41Lys, p.Glu117Lys aiheuttavat häiriön Ca2+ aktivoimassa lihassupistuksessa. Olemme paikantaneet mutaatiot β-tropomyosiinissa alueille, jotka ovat tärkeitä aktiiniin sitoutumisessa. Kaksi mutaatiota (p.Lys49del ja p.Glu139del) muuttaa proteiinin konformaatiota aiheuttaen β-tropomyosiinin alentunutta affiniteettia aktiiniin. Nebuliini on noin 600-900 kDa jättiläisproteiini, joka on osa lihaksen ohutta filamenttia. Koska nebuliini on kooltaan suuri ja vaikeasti eristettävä, sitä on tutkittu vähän. Olemme tuottaneet villityypin (vt) nebuliinin toistoajaksoja (283-347 amino happoa) ja viisi vastaavaa mutanttia. Kolme missense mutaatiota (p.Glu2431Lys, p.Ser4665Ile ja p.Thr5681Pro) ja kaksi in-frame deleetiota (p.Arg2478_Asp2512del ja p.Val3681_Asn3686del) olivat mukana tutkimuksessa. Mutaatiot aiheuttavat NM:aa tai distaalistamyopatiaa. Olemme tehneet aktiinin

ja tropomyosiinin sitoutumiskokeita nebuliinifragmenteille käyttäen ko-sedimentaatio- ja GST-pull-down-menetelmiä. Testasimme myös vt nebuliinifragmenttien (toistoajaksot 9, 14, 18 and 22) sitoutumista vt β–tropomyosiiniin ja kuuteen mutanttiin (Lys7del, Glu41Lys, Lys49del, Glu117Lys, Glu139del and Gln147Pro) käyttäen GST-pull-down menetelmää. Teimme F-aktiini- nebuliini-interaktiokokeita ja ensimmäistä kertaa tropomyosiini-nebuliini sitoutumisen in vitro. Osoitimme että, vt ja tautimutaation sisältävien fragmenttien sitoutuminen eroavat toisistaan. Tulokset osoittavat, että mutaatiot sekä tropomyosiinissa että nebuliinissa muuttavat proteiinien sitoutumista toisiinsa. Sitoutumiserot muuntuneiden ohuen filamentin proteiinien välillä ovat patogeneettisia mekanismeja NM:ssa ja sen kaltaisissa myopatioissa.

INTRODUCTION Congenital myopathies are rare. Taken together, the estimated incidence for all congenital myopathies reaches approximately 0.06 per 1000 live births. Congenital myopathies are characterised by generalised muscle hypotonia and weakness of varying severity usually beginning at birth. Myopathies cannot be definitely distinguished from each other nor from other congenital muscle disorders on clinical grounds alone; diagnosis depends on characteristic muscle biopsy findings (Jungbluth and Wallgren-Pettersson 2013). Nemaline myopathy (NM), first described in 1963 in two independent reports (Shy et al. 1963, Conen, Murphy & Donohue 1963), is a rare genetic muscle disorder, but represents one of the most common congenital myopathies. The autosomal dominant forms (MIM 161800) and the more common autosomal recessive forms (MIM 256030) are usually histologically similar (Jungbluth and Wallgren-Pettersson 2013). Both display clinical and genetic heterogeneity. To date ten different causative genes have been identified for NM: nebulin (NEB), slow skeletal muscle -actin (ACTA1), -tropomyosin (TPM2), slow -tropomyosin (TPM3), troponin T (TNNT1), cofilin 2 (CFL2), a member of the BTB/kelch protein family (KBTBD13) and kelch-like family members 40 and 41 (KLHL40 and KLHL41) and leiomodin-3 (LMOD3) (Laing et al. 1995, Pelin et al. 1999, Nowak et al. 1999, Johnston et al. 2000, Donner et al. 2002, Agrawal et al. 2007, Sambuughin et al. 2010, Ravenscroft et al. 2013b, Gupta et al. 2013, Yuen et al. 2014). Wide variability in the clinical spectrum of NM exists ranging from severe to mild. The European Neuromuscular Centre International Consortium on NM determined six clinical categories for NM according to the severity of the disease and the presence or absence of unusual or associated features (Wallgren-Pettersson and Laing 2000, Wallgren-Pettersson et al. 2011). In addition, a wide overlap in the clinical and histological continuum of these diseases exists. We studied the mutational spectrum in the TPM2 and TPM3 genes in NM, cap myopathy, core-rod myopathy, congenital fibre-type disproportion, distal arthrogryposes and Escobar syndrome, and looked for genotype– phenotype correlations. NM was thought to be a disorder of thin filament proteins, but recent discoveries of mutations in non-thin filament genes challenged this model (Gupta et al. 2013). In order to understand the pathogenetic mechanisms underlying NM, it is necessary to understand the normal interactions of these proteins. Mutations in the genes which encode parts of the thin filament may disrupt the order and assembly of sarcomeric proteins. Our goal was to understand the pathogenetic mechanisms of the congenital myopathies caused by mutations in the tropomyosin and nebulin genes by investigating how these mutations affect protein function and protein interactions.

REVIEW OF THE LITERATURE

1 SKELETAL MUSCLE Muscle tissue generates a mechanical force enabling for example locomotion, breathing, cardiac activity and digestion. Three main classes of muscle exist: skeletal muscle, heart muscle and smooth muscle. Skeletal muscle and heart muscle are striated muscles, while smooth muscle is non-striated. Heart muscle and smooth muscle contract involuntarily and only striated muscles are under voluntary control (Dubowitz and Sewry 2007). Skeletal muscle makes up approximately 40% of the body mass in humans. Muscles are bound to bones by tendons forming bundles of muscle fibres surrounded by layers of connective tissue. The diameter of an individual muscle fibre varies depending on t person and the specific muscle. The diameter of an adult male quadricep muscle fibre diameter varies between 40 and 80 µm. Muscle fibres form through the fusion of single cells and are, thus, multinucleated and enveloped by sarcolemma with the nuclei situated under the sarcolemma. The basal lamina is the external layer of the muscle fibre secreted by muscles which is composed of many myofibrils separated by the intermyofibrillar spaces (Dubowitz and Sewry 2007, Alberts et al. 1994).

1.1 Muscle fibre types Most skeletal muscles contain a mixture of fibres which differ in their physiological and biochemical properties. Muscle pathology is concentrated on the identification of fibre types and the ways in which they are affected by pathological processes (Dubowitz and Sewry 2007). Two major fibre types can be identified by enzyme histochemistry: type 1 fibres have a high oxidative and low glycolytic activity, while type 2 fibres have a low oxidative and high glycolytic activity (Dubowitz and Pearse 1960). The most common nomenclature for fibre types is based on the appearance of the tissue after staining with adenosine triphosphatase (ATPase), both with and without preincubation at an acid pH (Brooke and Kaiser 1970). Three main fibre types are seen in normal muscle, including types type 1, 2A and 2B, as well as an additional immature subtype 2C (Dubowitz and Sewry 2007). For use in routine diagnostics, a newly developed immunohistochemical myosin double-staining method exists for the identification of fibre types, including highly atrophic fibres. With the double-staining method, distinguishing between type I (ATPase type 1), IIA (ATPase type 2A), IIX (ATPase type 2B) and remodeled ATPase type 2C fibres becomes possible, expressing both fast and slow myosins using a one-slide technique. Immunohistochemical double-staining of myosin heavy chain isoforms can be used as an alternative to the conventional ATPase staining method in routine histopathology (Raheem et al. 2010). The motor unit includes a nerve with a cell body and an axon innervating the muscle fibres. The muscle fibres from one motor unit are uniform in type and randomly scattered. Motor units are classified according to their speed of contraction and resistance to fatigue, and include three main types: fast twitch, fatigue sensitive (FF); fast twitch, fatigue resistant (FR); and slow twitch, fatigue resistant (S) (Schiaffino, Hanzlikova & Pierobon 1970). Fatigue resistance is related to oxidative capacity and mitochondrial content. Fibres are classified as

follows: slow twitch, oxidative (SO), which corresponds to histochemical type 1 fibres; fast twitch, glycolytic (FG), which correspond to 2B; and fast twitch, oxidative glycolytic (FOG), which, correspond to 2A (Burke et al. 1973). Classification studies have relied on animal studies, with evidence suggesting similarities in humans. In contrast to other species, all human striated muscles contain mixed fibre types and show light and dark fibres in the ATPase stain. Different muscles have a characteristic proportion of fibre types (Dubowitz and Sewry 2007).

1.2 The Muscle sarcomere Muscle fibres are composed mainly of myofibrils. Each myofibril contains a bundle of myofilaments regularly aligned to form repetitive structures known as sarcomeres. The ordered arrangement of different proteins in the sarcomere gives rise to the striated pattern of skeletal muscle. The sarcomere is composed of a dark anisotropic band (the A-band) flanked by light isotropic bands (I-bands). A narrow dense line (the M-band), which is flanked by the slightly paler H-zone, lies in the central region of the A-band. A narrow dense Z-disc marks the longitudinal borders of each sarcomere. The length of each sarcomere is around 2.0–3.0 µm at rest. During muscle contraction, the I-band filaments slide towards the centre of the A- band and the sarcomere becomes shorter (Dubowitz and Sewry 2007). The A-band consists of thick myosin filaments which are 15–18 nm in diameter and approximately 1.5 µm long. The myosin molecules are double-stranded helixes with rod- shaped tails and two heavy meromyosin heads joined by a flexible shaft of light meromyosin. The region where the light meromyosin tails overlap without myosin heads is known as the pale H-zone and is situated at the centre of the A-band. The M-lines are three to five lines across the thick filaments and are thought to play a role in connecting myosin filaments and stabilising the A-band. Myomesin, skelemin, M protein and a fraction of creatine kinase are located in the M-line. The I-band filaments are composed mainly of a double helix of filamentous actin and are 6–7 nm in diameter. The Z-disc anchors actin filaments at the one end and the other end interdigitates with myosin (Figure 1). Each myosin filament is surrounded by six actin filaments. In addition to their structural roles, and their roles in the motor function of the sarcomere, sarcomeric proteins are also involved in signalling pathways (Dubowitz and Sewry 2007). Tropomyosin resides in the actin helix grooves and has regular attachment sites to actin. Troponin complexes are attached to the tropomyosin dimer.

Figure 1. Structure of striated muscle sarcomere. Schematic presentation showing the main components of the sarcomere. The A-band comprises myosin filaments crosslinked at the centre by the M-band assembly. Thin actin-containing filaments are tethered at their barbed end to the Z-disc and interdigitate with the thick filaments in the A-band. Two giant proteins contribute to the structure of the Z-disc. Nebulin (800 kDa) runs along the thin filaments and overlaps in the Z-disc (Pappas et al. 2008). The 3-MDa, 1-μm-long protein titin runs between the M-line and the Z-disc (Young et al. 1998). Tropomyosin binds nebulin in the thin filament (Marttila et al. 2014b).

1.2.1 The Z-disc The Z-disc determines the borders to adjacent sarcomeres, allows force transmission in myofibrils during muscle contraction and plays a role in signalling and stretch sensing. The major components of Z-discs include α-actinin and actin. The actins of the adjacent sarcomers connect to form layers of the Z-discs (Figure 1). The thickness of the Z-disc depends on the fibre-type: in fast muscle fibres, the diameter is 30–50 nm, while in slow and cardiac muscle fibres it is 100–140 nm (Luther et al. 2003). Interest in the interacting partners of the Z-disc protein α-actinin, is increasing given that Z-disc abnormalities occur in a number of neuromuscular disorders (Dubowitz and Sewry 2007). Thus, the proteins studied include telethonin (cap protein), myozenin, zeugmentin, syncoilin, vinculin, γ-filamin, obscurin, myotilin, nebulin and titin (Stromer 1995, Takada et al. 2001, Selcen and Engel 2004, Chitose et al. 2010, Gregorio et al. 1998). Myopalladin, myotilin, nebulin and titin has been suggested to play a role in Z-disc assembly (Bang et al. 2001, Carlsson et al. 2007, Labeit, Ottenheijm & Granzier 2011, Ottenheijm, Granzier 2010, Gregorio et al. 1998). The giant proteins of the sarcomere, nebulin and titin, are also attached to the Z-disc. The C-terminus of nebulin is attached to the Z-disc and extends to the I-band. The titin molecule reaches from the Z-disc to the M-line. Furthermore, titin molecules overlap in the Z-disc and the M-line in adjacent sarcomeres (Dubowitz and Sewry 2007). Studies on nebulin knockout mice suggest that myofibrils are laterally linked at the level of the Z-disc by desmin filaments that bind to nebulin (Tonino et al. 2010).

1.2.2 The thick filament and its proteins The thick filament is formed by myosin and myosin-binding proteins. The myosin chains of opposing thick filaments are bound together by M-band proteins such as myomesin (Pinotsis et al. 2008). In total, 294 myosin molecules form the backbone of 1.59 µm long and 1 nm thick filament (Berg, Powell & Cheney 2001).

1.2.2.1 Myosin The first muscle proteins purified included myosin and actin. Modifying actomyosin solution from a high ionic strength into a solution with a lower ionic strength, produced threads which contracted when ATP was added (Szent-Györgyi 1943). Early electron microscopic images showed the asymmetric structure of rabbit skeletal muscle myosin: two polypeptide chains dimerise forming a C-terminal coiled-coil tail and the N-terminus of each chain forming a large globular head (Huxley 1963, Slayter and Lowey 1967). Myosin is a highly conserved protein found in all eukaryotic cells. It acts as a molecular motor converting the chemical energy of ATP hydrolysis into a mechanical force (Figure 2) for diverse cellular occurences such as cytokinesis, phagocytosis and muscle contraction (Ruppel and Spudich 1996b, Ruppel and Spudich 1996a). In humans, 40 genes encode myosins (Berg, Powell & Cheney 2001). Myosins form a diverse superfamily grouped into two classes: the unconventional and conventional class II two-headed myosins that form filaments in striated muscle, smooth muscle and non-muscle cells (Sellers 2000). The class II muscle myosin is a hexameric protein composed of two myosin heavy-chain (MyHC) subunits and two pairs of non- identical light-chain subunits. MyHCs associate into dimers through a coiled–coil interaction along its long tail (Schiaffino, Reggiani 1994). Several striated muscle MyHC isoforms exist, encoded by different genes and expressed in a tissue- and developmental-specific manner (Schiaffino and Reggiani 1994). Three major MyHC isoforms are found in adult human skeletal limb muscle. MyHC I (slow/ß-cardiac MyHC) is encoded by MYH7 and is expressed in slow, type 1 muscle fibres and in the ventricles of the heart. MyHC IIa (MYH2) is expressed in fast, type 2A muscle fibres, while MyHC IIX (MYH1) is expressed in fast, type 2B muscle fibres. The differing contractile and physiological properties of the three different muscle fibre types are partly determined by different MyHCs (Tajsharghi and Oldfors 2013). Myosin myopathies have variable clinical phenotypes depending on the mutated isoform and the type and location of the mutation. They include distal arthrogryposis syndromes (mutations in MYH3 and MYH8), autosomal dominant myopathy (mutations in MYH2), familial hypertrophic cardiomyopathy, myosin storage myopathy and Laing distal myopathy (mutations in MYH7) (Tajsharghi and Oldfors 2013, Oldfors A 2008).

Figure 2. Schematic diagram of thin and thick filament organisation and contraction process. The thin filament consists of actin, the troponin complex (TnT, TnC and TnI) and α- and β-tropomyosin dimer. The thick filament is composed of myosin heavy and light chains. The sarcomere produces muscle contraction by sliding of myofilaments: the myosin heads interact with actin and pull it towards the center of the sarcomere resulting in shortening of the sarcomere.

1.2.3 The thin filament and its proteins The globular protein actin, which is polymerised polymerized into elongated filaments of double helical strands is the main component of the thin filament. The fibrous protein tropomyosin is located in the groove formed between actin strands and is polymerised head- to-tail along the actin filament. Troponin, a globular complex consisting of three proteins (troponin C, troponin I and troponin T), is associated with each tropomyosin. Nebulin is a giant protein reaching across the entire length of the thin filament, while tropomodulin, a capping protein, stabilise the thin filament (Ochala 2008).

1.2.3.1 Actin At least six different structural genes for actin are expressed in skeletal muscle: α-actin, α- cardiac, α-smooth muscle, β-actin, γ-actin and γ-enteric actin (Vandekerckhove and Weber 1978). With the exception of those in inner-ear hair cells where only γ-actin is expressed, β- actin and γ-actin form the actin cytoskeleton in human non-muscle cells (Zhu et al. 2003). The main protein component of the skeletal muscle thin filament is α-actin; thus, a polymerised α- actin dimer forms the backbone of the thin filament. The interaction between α-actin and various myosin isoforms of the thick filament is ATP-driven and generates the force necessary for muscle contraction in the sliding filament model of muscle contraction (Huxley

and Niedergerke 1954). Actin has three binding sites for nebulin and binds tropomyosin, the troponin complex and several other proteins (Lukoyanova et al. 2002). The first disease-causing mutations in the human skeletal muscle α-actin gene (ACTA1) were associated with two different muscle diseases: ‘congenital myopathy with excess thin myofilaments’ (actin myopathy) and NM (Nowak et al. 1999). Subsequently, approximately 200 different ACTA1 mutations have been identified, with 90% resulting in dominant disease often arising de novo, and 10% resulting in recessive disease (Nowak, Ravenscroft & Laing 2013). ACTA1 mutations cause 20–25% of all NM, and 50% of severe NM. The gene is small and relatively easy to analyse. Most mutations (90%) are dominant missense changes. To date, no missense polymorphisms have been reported in ACTA1 (North et al. 2014). Many researchers have studied the normal actin function and the functional consequences of ACTA1 mutations in cell cultures, animal models and patient tissue samples, linking various ACTA1 mutations to have different functional effects. The pathophysiology of recessive ACTA1 disease is straightforward in that the disease is caused by genetic or functional null mutations. Biochemical studies demonstrated that some mutant actins failed to fold properly and were, therefore, non-functional proteins. The use of small molecules to sensitise the contractile apparatus to Ca2+ shows promise as therapeutic treatment for patients with various neuromuscular disorders, including ACTA1 disease (Nowak, Ravenscroft & Laing 2013).

1.2.3.2 Nebulin Nebulin is one of the largest genes in the human genome, with 183 exons encoding a 26 000- bp mRNA giving rise to a 600–900-kDa protein (Donner et al. 2004). The name nebulin is derived from ‘nebulous’ because the function of the gene was obscure for many years (Ottenheijm and Granzier 2010, Pappas et al. 2011). Nebulin is a muscle protein expressed in the thin filaments of striated muscle, and approximately 3% of myofibrillar mass is nebulin in the sarcomere (Wang and Wright 1988) and has a highly repetitive protein structure (Figure 3). Approximately 97% of the polypeptide consists of 30–35 amino acid–long modules arranged into simple repeats or super repeats (Donner et al. 2004). Seven small repeats are assembled to form a super-repeat, where the similarity between the super-repeats is stronger than between the single 35 amino acid– containing repeats (Pfuhl, Winder & Pastore 1994). The repeat modules contain conserved SDXXYK-actin-binding motifs (Jin and Wang 1991a, Jin and Wang 1991b) and proposed WLKGIGW-tropomyosin binding sites (Labeit et al. 1991, Labeit and Kolmerer 1995). The nebulin repeat regions have a transient α-helical conformation (Pfuhl, Winder & Pastore 1994). There is no heptad repeat of hydrophobic residues indicating that nebulin repeats are not dimerised into a coiled–coil (Labeit et al. 1991). The 8-kDa N-terminal and the 20-kDa C- terminal ends contain unique protein domains. The C-terminus is anchored to the Z-disc of the muscle sarcomere and contains a conserved src homology 3 (SH3) domain (Donner et al. 2004). The isolation of rabbit skeletal muscle nebulin was successful in a fully denatured form, which bound to actin, β-actinin and tropomodulin, indicating the preservation of some of its in vivo functions (Chitose et al. 2010). Nebulin size correlates with thin filament lengths in vertebrates, suggesting that nebulin functions as a molecular ruler to determine thin filament length (Wang and Wright 1988,

Labeit et al. 1991, Kruger, Wright & Wang 1991). This hypothesis was supported by data from nebulin knockout mice. Nebulin may guide and facilitate actin polymerisation (internal super-repeats), terminate polymerisation (end regions) and maintain the thin filament length (Bang et al. 2006, Witt et al. 2006, Pappas, Krieg & Gregorio 2010). Fluorescent microscopy suggests that nebulin specifies the minimum thin filament length and acts in concert with nebulin-independent mechanisms to generate thin filaments of varying lengths that are functionally optimised for the contractile properties of different muscles (Castillo et al. 2009). A mini-nebulin was created to reduce the size of nebulin for experimental purposes: 18 super- repeats were removed (SR 4–21), leaving the unique N- and C -termini and 4 remaining super-repeats intact (SR 1–3 and 22). This resulted in a shorter molecule that retained all of its known unique binding sites. Mini-nebulin studies combine previous models, suggesting that nebulin dictates the minimal length of the filaments by preventing actin depolymerisation and through stabilisation mechanisms. Replacement of nebulin with mini-nebulin in skeletal myocytes, thin filaments extended beyond the end of mini-nebulin. However, under conditions that promote actin filament depolymerization, filaments associated with mini- nebulin were maintained at lengths either matching or longer than mini-nebulin. This indicates that mini-nebulin is able to stabilise portions of the filament it has no contact with (Pappas, Krieg & Gregorio 2010). In addition, nebulin appears to possess functions beyond thin filament length control, such as contractility, specification of the Z-disc structure and maintaining inter-myofibrillar activity. During contraction, nebulin depresses the production of force by reducing the thin–thick filament overlap and enhances crossbridge cooperative binding in skeletal muscle (Lawlor et al. 2011, Bang et al. 2006, Witt et al. 2006, Bang et al. 2009). In vitro binding studies, in vivo data from knockdown mice and differential splicing studies support the important role of nebulin in the specification of the Z-disc structure. In the absence of nebulin, Z-discs are significantly wider than normal (Witt et al. 2006, Tonino et al. 2010, Buck et al. 2010). Nebulin isoform diversity is high in skeletal muscle and in the brain, and may have similar functions in the brain and in skeletal muscle, although patients with nebulin mutations usually exhibit normal cognition (Laitila et al. 2012). In a study of four patients, low levels of nebulin may explain their poor prognosis resulting from NM due to nebulin mutations. This finding may be clinically useful, but should be examined in a larger sample of patients (Lawlor et al. 2011). The size of the human nebulin gene is 249 kb containing 183 exons. The translation initiation codon is in exon 3, while the stop codon and 3' untranslated region (UTR) are located at exon 183. Nebulin has many different isoforms produced by alternative splicing of exons 63–66, 82–105, 143–144 and 166–177. Mouse exons 127 and 128 corresponding to human exons 143–144 show variable expressions during development (Donner et al. 2006). An 8.2-kb triplicate region where 8 exons repeat 3 times (exons 82–89, 90–97 and 98–105) is situated in the central region of the gene (Gunning, O'Neill & Hardeman 2008). Mouse nebulin contains 165 exons in a 202-kb segment of DNA and in addition to skeletal muscle, low levels of nebulin expression have been reported in the mouse heart muscle (Kazmierski et al. 2003). In the human heart, nebulin is replaced by a small nebulin-like protein called nebulette (Moncman and Wang 1995).

Figure 3. Schematic presentation of nebulin structure and the interacting proteins. Modified from Marttila et al. 2014 Skeletal Muscle 1;4:15.

No mutational hotspots have been found in nebulin, while normally compound heterozygous patients exhibit their own unique mutations. This makes routine mutation analysis of the complete gene difficult (Pelin et al. 1999, Lehtokari et al. 2006, Donner et al. 2004, Pelin et al. 2002). Mutations primarily include small deletions or point mutations (Pelin et al. 1999, Lehtokari et al. 2006, Pelin et al. 2002, Kiiski et al. 2013). The first large founder mutation found in nebulin was identified as the 2.5kb deletion of exon 55 common among the Ashkenazi Jewish population occurring globally (Anderson et al. 2004, Lehtokari et al. 2009). A comparative genomic hybridisation microarray designed for known NM genes identified two novel deletions. To date, the largest deletion characterised in nebulin (∼53kb) includes 24 exons, with a further one 1-kb deletion identified covering 2 exons (Kiiski et al. 2013).

1.2.3.3 Tropomyosins Tropomyosins (Tms) are a group of highly conserved actin-binding proteins, that together with troponins, regulate muscle contraction. The tropomyosins are α-helical coiled–coil proteins. They polymerise head-to-tail and overlap by eight or nine amino acids. Tropomyosin dimers are located in the grooves of actin filaments, providing structural stability and modulating filament function (Phillips et al. 1979, Matsumura, Yamashiro-Matsumura & Lin 1983, Holmes et al. 1990, Lin et al. 1997). Tropomyosins have a seven-fold repeated amino acid sequence motif, the heptad repeat (abcdefg). The a and d residues are hydrophobic and form the helix interface, while b, c, e, f and g are hydrophilic and form the solvent-exposed part of the coiled–coil (Perry 2001, Lupas 1996). Tropomyosin binds F-actin roughly in a 1:7 molar ratio (Eaton, Kominz & Eisenberg 1975). Each tropomyosin molecule is subdivided into α- and β-zones, whereby the actin-binding properties of the α-zones were identified over 30 years ago (McLachlan and Stewart 1976). In the relaxed state, tropomyosin forms contacts with actin through positively charged residues in the N-terminal part of the α-zone and through acidic residues on the C-terminal side of the α-zone (Brown et al. 2005). Recently, the exact structural model of the actin-binding residues in tropomyosin were discovered in the closed state (Barua et al. 2013, Holmes and Lehman 2008, Lehman et al. 2013, Li et al. 2011). Tropomyosins are encoded by four different genes TPM1, TPM2, TPM3 and TPM4 (Pittenger, Kazzaz & Helfman 1994). The tropomyosin genes TPM1, TPM2 and TPM3 are expressed in skeletal muscle-encoding isoforms Tm1 (Tmfast), Tm2 (Tm) and Tm3

(Tmslow). TPM1 is expressed in fast muscle fibres and in cardiac muscle (Gunning et al. 1990). TPM2 is expressed in both slow and, to a lesser extent, in fast muscle fibres. TPM3 is expressed mostly in slow muscle fibres (Perry 2001). More than 40 different tropomyosin

isoforms are generated due to the use of different promoters or variable intragenic splicing (Pittenger, Kazzaz & Helfman 1994, Dufour et al. 1998, Cooley and Bergtrom 2001). Tropomyosins can be divided into a group with a high molecular weight containing 284–281 amino acid residues and into a group with a low molecular weight group of tropomyosins containing 245–251 amino acid residues. All of the tropomyosin isoforms isolated consist of multiples of approximately 40 amino acids, each of which is thought to interact with an actin monomer subunit when complexed with F-actin (Perry 2001). When both - and - tropomyosins are expressed, -heterodimers are preferentially formed over -homodimers, while -homodimers are rare. The dimer preference can be affected by mutations (Perry 2001, Corbett et al. 2005). The first mutation characterised as the cause of NM in the - tropomyosin was p.Met9Arg (Laing et al. 1995). Conversely, the first mutations in the -tropomyosin gene were identified as rare causes of NM (Donner et al. 2002). Mutations in TPM2 were found to cause dominant distal arthrogryposis (Tajsharghi et al. 2007a, Sung et al. 2003a). The correct classification of congenital myopathies by molecular testing has proved challenging because of the size and heterogeneity of the genes involved. Because of this, the proportion of disease caused by different genes is largely unknown. Both TPM2 and TPM3 have been associated with 4.3% of disease (Citirak et al. 2014). When diagnosing patients, if nemaline rods are restricted to type 1 muscle fibres, TPM3 analysis is recommended. TPM2 analysis should be considered for mild dominant disease (North et al. 2014). .

1.2.3.4 The troponin complex Troponin C, I and T, encoded by TNNT1, TNNT2 and TNNT3, form a complex which, together with tropomyosin, regulates the actin–myosin interactions in muscle contraction in a calcium-sensitive manner. Troponin C binds Ca2+, troponin I binds to actin and inhibits the actomyosin ATPase and troponin T links the troponin complex to tropomyosin (Greaser and Gergely 1973). Troponin I and T exhibit separate isoforms for cardiac, type 1 and type 2 muscle fibres. Troponin C has two isoforms: one for cardiac and type 2 fibres and another for type 1 muscle fibres (Clarke 2008). Previous studies determined that the mutations in troponins cause familial hypertrophic cardiomyopathy (Bonne et al. 1998, Revera et al. 2008), NM among the Amish (Johnston et al. 2000, van der Pol et al. 2014) and DA type 2B (Sung et al. 2003b).

1.2.3.5 Tropomodulin Tropomodulin was first detected in the erythrocyte membrane as a tropomyosin-binding protein with a molecular mass of 40 kDa (Fowler 1987). It was localised in the sarcomere through immunofluorescence staining to a site at or near the pointed ends of the skeletal muscle thin filaments (Fowler et al. 1993). Tropomodulin is also found near the pointed ends of the thin filaments in cardiac muscle. In nanomolar concentrations, tropomodulin blocks elongation and depolymerisation at the pointed ends of tropomyosin-actin filaments. Pointed- end capping by tropomodulin helps to maintain constant lengths of tropomyosin-containing

actin filaments in skeletal muscle (Weber et al. 1994). Tropomodulin consists of two structurally distinct regions: the N-terminal and the C-terminal domains. The N-terminal domain contains two tropomyosin-binding sites and one tropomyosin-dependent actin-binding site. The C-terminal domain contains a tropomyosin-independent actin-binding site (Colpan, Moroz & Kostyukova 2013). Two sarcomeric tropomodulin isoforms, Tmod1 and Tmod4, cap the pointed ends of the thin filaments and bind to the terminal tropomyosin. X-ray diffraction patterns were used to investigate single-membrane, permeabilised skeletal muscle fibres taken from mice lacking Tmod1. The absence of Tmod1 and its replacement by Tmod3 and Tmod4 impairs initial tropomyosin movement over actin during thin-filament activation reducing both the fraction of actomyosin crossbridges in the strongly bound state and the fibre’s force-generating capacity. This shows that Tmods are novel regulators of actomyosin crossbridge formation and muscle contractility (Ochala et al. 2014). Tropomodulin proteolysis and the resulting thin filament length misspecification contribute to the pathology of Duchenne muscular dystrophy, affecting muscles in a way which is both use- and disease severity–dependent (Gokhin et al. 2014).

1.2.3.6 Leiomodin-3 Leiomodins form a subfamily closely related to the tropomodulins (Conley et al. 2001). LMOD3 encodes leiomodin-3 (LMOD3), a 65-kDa protein expressed in skeletal and cardiac muscle. Resently the combination of whole-exome sequencing (WES) and Sanger sequencing identified homozygous or compound heterozygous variants in LMOD3 in 21 patients from 14 families. They often had severe lethal form of NM. LMOD3 was expressed from early stages of muscle differentiation. It localized to actin thin filaments, with enrichment near the pointed ends and had strong actin filament-nucleating activity. Loss of LMOD3 in patient muscle resulted in shortening and disorganization of thin filaments. Knockdown of lmod3 in zebrafish replicated NM-associated functional and pathological phenotypes (Yuen et al. 2014).

1.2.3.7 The cofilins Two cofilins—cofilin 1 and cofilin 2—belong to the ADF/cofilin family that includes destrin, a closely related protein. The skeletal muscle isoform is encoded by the CFL-2 gene. ADF/cofilins and myosin-induced contractility are required in order to disassemble non- productive filaments for the development of cardiomyocytes. Excess actin filaments are produced during sarcomere assembly and contractility is applied in the recognition of non- productive filaments that are destined for depolymerisation. Thus, contractility-induced actin dynamics play an important role in sarcomere maturation (Skwarek-Maruszewska et al. 2009). Cofilin mutations have accompanied NM with minicores (Agrawal et al. 2007), including a combined case of NM and myofibrillar myopathy (Ockeloen et al. 2012).

1.2.4 Kelch domain– containing proteins In skeletal muscle development, kelch family members regulate the proliferation and differentiation processes resulting in the normal functioning of mature muscles. Many kelch proteins function as substrate-specific adaptors for Cullin E3 ubiquitin ligase, a core component of the ubiquitin-proteasome system which regulates protein turnover (Gupta and Beggs 2014).

1.2.4.1 KBTBD13 The protein KBTBD13 contains a BTB/POZ domain (BTB refers to Bric-a-brac, Tramtrack, Broad-complex; and POZ for Poxvirus and Zinc-finger) and five kelch- repeats and belongs to the superfamily of kelch-repeat–containing proteins. It is expressed primarily in skeletal and cardiac muscle. Previously identified BTB/POZ/kelch-domain–containing proteins have been implicated in a wide variety of biological processes, including cytoskeleton modulation, regulation of gene transcription, ubiquitination, and myofibril assembly (Sambuughin et al. 2010, Prag and Adams 2003). KBTBD13 on chromosome 15q22.31 when mutated causes NEM6. The clinical phenotype of patients includes poor exercise tolerance, characteristic but not consistent slow movements, an abnormal gait, and the development of slowly progressing muscle weakness of the neck and proximal limbs beginning in childhood. Dominant KBTBD13 mutations cause a histological picture of NM with cores and are located within conserved domains of kelch repeats. The mutations are predicted to disrupt the molecule's β-propeller blades (Sambuughin et al. 2010).

1.2.4.2 KLHL40 The sarcomeric protein KLHL40 belongs to the superfamily of kelch repeat–containing proteins. The kelch repeat is an evolutionarily widespread sequence motif of 44–56 amino acids. It occurs as five to seven repeats that form a β-propeller tertiary structure. The β- propeller motif is primarily involved in protein–protein interactions, but performs a wide variety of other functions (Prag and Adams 2003). To date, 71 kelch repeat–containing proteins have been identified in humans. Confocal microscopy suggests that KLHL40 may localise to the sarcomeric A-band, a sarcomeric region not previously linked to NM (Ravenscroft et al. 2013b). Mutations in KLHL40 causing a loss of function have been frequently associated with severe NM cases related to fetal akinesia sequence, a disease occurring globally. Functional studies revealed that KLHL40 is crucial to myogenesis and skeletal muscle maintenance (Ravenscroft et al. 2013b).

1.2.4.3 KLHL41 KLHL41 is a member of the BTB–kelch domain-containing family of proteins (Adams, Kelso & Cooley 2000). An exome-wide sequencing was performed, which identified small recessive deletions and missense changes in KLHL41 in four individuals from unrelated NM families. A clear genotype–phenotype correlation for the mutations was identified: frameshift mutations

resulted in severe phenotypes with neonatal death, whereas missense changes resulted in impaired motor functioning with patients living into late childhood and/or early adulthood. To evaluate the effects of the KLHL41 mutations on the protein structure, the mutations were mapped onto the crystal structures of the BTB–BACK domain of human KLHL11 protein and kelch domain rat KLHL41 protein analogous to those domains for human KLHL41 protein. Conservation of the mutated KLHL41 BTB–BACK and kelch domains and the potential role of the mutations in disrupting those structural domains support the likely pathogenicity of these mutations (Gupta et al. 2013). Analysis of transverse sections of myofibres revealed KLHL41 staining in a ring pattern around the myofibrils, colocalizing with the ryanodine receptors (RYR1). KLHL41 localises over (but not within) the I-bands, likely in association with the terminal cisternae of the sarcomplasmic reticulum (SR) and longitudinal vesicles of the SR present in the I-band area at the triadic regions (Gupta et al. 2013).

1.2.4 The third filament: titin Titin is a giant filamentous protein and forms a separate myofilament system with calpain 3, myotilin and telethonin in both skeletal and cardiac muscle. This third filament system supports the contractile filaments during development. In mature cells, it provides mechanical support and possesses regulatory signalling functions (Bang et al. 2001, Gautel, Mues & Young 1999, Udd 2008). Titin is the third most abundant muscle protein after myosin and actin, with a molecular mass of 4200 kDa, representing the largest known polypeptide (Bang et al. 2001, Granzier and Labeit 2006). Titin spans 1 μm, extending halfway across the sarcomere. Its N-terminus is embedded in the Z disc and interacts with other Z-disc proteins. The titin I-band region is composed primarily of immunoglobulin (Ig) domains, the unstructured N2A and N2B region and the PEVK region (Gautel, Mues & Young 1999). The I-band region of titin contains multiple elastic spring elements that are responsible for the elastic properties of the titin filament system. Titin’s elastic spring supports ventricular filling during diastole in the heart muscle. Various splicing isoform variants exist in the I-band, which explains the titin size range from 27 000 to 33 000 residues in different striated muscle tissues (Bang et al. 2001, Improta, Politou & Pastore 1996). The titin A-band region is composed primarily of fibronectin type III-like and Ig domains, and has extensive interactions with myosin, myosin-binding protein C and other thick filament-associated proteins. The C- terminus of titin is attached to the M-line and contains a kinase domain and Ig domains separated by unstructured M-insertions embedded in the M-line (Gautel, Mues & Young 1999). Titins overlap in N- and C-termini and form a continuous filament system along the full length of the myofibril (Bang et al. 2001). In vitro binding studies revealed that the PEVK element of N2B titin binds F-actin. This dynamic interaction retards filament sliding. These kinds of interactions contribute to the passive stiffness of the sarcomere (Granzier and Labeit 2002). Titin is encoded by a single gene located on the long arm of chromosome 2 in humans and mice. The genomic analysis of human titin revealed a 283-kb genomic segment that contains 363 titin exons. These 363 exons have a coding capacity of 114 414 bp (4200 kDa) (Bang et al. 2001). Tibial muscular dystrophy is an autosomal-dominant late-onset distal myopathy caused by mutations in C-terminal titin (Hackman et al. 2002). In a homozygous form, the

mutation causes a more severe, recessive limb-girdle muscular dystrophy (Udd 2008). Mutations in titin also result in cardiomyopathy and dilated cardiomyopathy (van Spaendonck-Zwarts et al. 2014). Novel findings are titinopathies caused by recessive titin truncating mutations that define novel forms of core myopathy with heart disease (Chauveau et al. 2014).

1.2.5 Muscle contraction The skeletal muscle contractile machinery is a system of interdigitating thick and thin filaments. The thick and thin filaments consist of a highly ordered assembly of proteins, with the thin filament acting as a major regulator of muscle contraction (Ochala 2008, Gordon, Homsher & Regnier 2000). The sliding filament theory, which was independently published in two articles in 1954 (Huxley and Niedergerke 1954, Huxley and Hanson 1954), describes a cycle of repetitive events that cause a thin filament to slide over a thick filament generating tension in a muscle. At rest, tropomyosin dimers lie along the actin filament in a potential myosin-binding site, sterically inhibiting myosin–actin interactions. When muscle is stimulated, intracellular calcium levels increase to a critical level. This releases the inhibitory effect of troponin so that tropomyosin moves into the groove between actin helices revealing the myosin-binding sites and triggering muscle contraction (Gordon, Homsher & Regnier 2000).

1.2.5.1 Protein interactions In a current model for contraction regulation, three states existing in equilibrium have been proposed: blocked, closed and open (McKillop and Geeves 1993, Tobacman 1996, Craig and Lehman 2001, Hai et al. 2002). Calcium and myosin control the transition between states. In the absence of Ca2+, contraction is blocked (blocked state). Tropomyosin sterically hinders interactions between actin and the myosin S1 fragment and the weak electrostatic binding of myosin to the actin binding sites is blocked at actin by troponin I. In the presence of Ca2+, the conformation of the troponins change. Ca2+ binds to troponin C and initiates changes in the troponin C–troponin I interactions. The inhibitory binding of troponin I to tropomyosin and actin is relieved. Tropomyosin moves across the surface of actin and can only bind myosin S1 relatively weakly (closed state) exposing myosin-binding sites on actin. Myosin S1 can both bind to actin, resulting in the release of ADP, and inorganic phosphate, and form crossbridges and undergo an isomerisation to a more strongly bound, rigor-like conformation. Weak to strong binding of myosin to actin causes a further movement of tropomyosin across the surface of actin (open state). New myosin-binding sites on actin are exposed, permitting the formation of further crossbridges allowing for the production of force and motion (Ochala 2008, Gordon, Homsher & Regnier 2000, McKillop and Geeves 1993). Nebulin contributes to the regulation of crossbridge cycling kinetics, increasing the force and efficiency of contraction, and plays a role in the calcium sensitivity of force generation (Chandra et al. 2009) (Figure 4).

Figure 4. Calcium binds to troponin C present on the actin-containing thin filaments of the myofibrils. Troponin then allosterically modulates tropomyosin. Under normal circumstances, tropomyosin sterically obstructs binding sites for myosin on the thin filament; once calcium binds to troponin C and causes an allosteric change in the troponin protein, troponin T allows tropomyosin to move, unblocking the binding sites.

1.2.5.2 Excitation–contraction coupling The term excitation–contraction coupling, coined in 1952, describes events occurring when a stimulus is applied to muscle. The response to a stimulus is indicated first by excitation, which is set up in the membrane of each reacting muscle fibre, and then by contraction, which is a function of the substance within the membrane (Sandow 1952). Excitation–contraction (EC) coupling in skeletal muscle is dependent on a physical interaction between the skeletal isoforms of the dihydropyridine receptor L-type Ca2+ channel (DHPR) and the ryanodine receptor Ca2+ release channel (RyR1). RyR1 channels release Ca2+ from the sarcoplasmic reticulum calcium stores into the cytoplasm to mediate muscle contraction in response to signals from voltage-sensitive surface membrane channels. An important part of EC includes the proper structure of the muscle membranes. The plasma membranes come into very close association with the membranes of the internal sarcoplasmic reticulum (SR) Ca2+ store. In functional coupling regions, the junctional gap between the surface and SR membranes is only ∼10-nm wide. This allows the cytoplasmic domains of proteins in the membrane on either side of the junction to come into such close contact that they can interact with each other. In adult skeletal muscle, the junctions, also known as triads, have terminal expansion of SR on either side of a central transverse t-tubule element (Rebbeck et al. 2014). The clusters of four αS1 voltage sensor particles, termed tetrads, are situated in the junctional regions of the surface membrane. The αS1 particles within the tetrad are positioned in such a way that they respond to the four subunits of RyR1 situated in the underlying SR membrane. The term couplon describes the generic surface/SR junction containing the functional groupings of proteins that facilitate EC coupling (Franzini-Armstrong 1999). DHPR works as a voltage sensor for EC coupling and sends a signal to RyR in response to surface membrane depolarisation and the signal results in the release of Ca2+ from SR. This interaction between DHPR and RyR in EC coupling enables all voluntary movement, respiration and cardiac contraction. Correct interactions between DHPR and RyR are, thus, essential for life. Defects in the expression or function of either protein result in poor development in utero and death at or before birth. Mutations in the proteins lead to a susceptibility to malignant hyperthermia, central core disease and cardiac arrhythmias (Dulhunty et al. 2002).

2 Congenital myopathies The term congenital myopathies designates a group of congenital muscle disorders defined on the basis of structural abnormalities of the muscle fibres which are visible after staining muscle biopsy sections using histochemical methods (Jungbluth and Wallgren-Pettersson 2013). Congenital myopathies include a spectrum of clinically, histologically and genetically variable neuromuscular disorders, many of which are caused by mutations in the genes for sarcomeric proteins (Wallgren-Pettersson et al. 2011). Classified mainly on the basis of their histopathology, they share many clinical features, including hypotonia and generalised often non-progressive muscle weakness which is often present at birth. The severity of weakness and disability varies widely: from neonates with a profound generalised weakness to patients with weakness that first manifests during childhood through delayed motorskill milestones or later in life through proximal weakness (Sewry 2008, Nance et al. 2012, North et al. 2014). In

congenital myopathies, electromyography (EMG) is typically normal or shows myopathic features. Occasionally changes that appear neurogenic are visible with severe neonatal weakness or in distal muscles as the disease progresses (Wallgren-Pettersson, Sainio & Salmi 1989). Serum creatine kinase levels are usually within normal limits, but may be mildly to moderately higher than normal. Genetically distinct congenital myopathies may overlap in their pathology, making the precise diagnosis challenging in individual cases and suggesting that shared pathogenetic mechanisms between congenital myopathies exist (Sewry 2008, Nance et al. 2012, North et al. 2014). Four main categories distinguish classical congenital myopathies based on the histology: nemaline myopathies, central core disease, multi-minicore disease and centronuclear myopathies (Nance et al. 2012). NM is the most common congenital myopathy occurring at a rate of 0.02/1000 live births (Wallgren-Pettersson et al. 2011). Findings suggest that the genes for classical congenital myopathies may also cause other myopathies, including cap myopathy (Fidzianska et al. 1981, Schröder 1982), congenital fibre-type disproportion (Brooke 1973), myotubular myopathy (Laporte et al. 1996), central core myopathy (Shy and Magee 1956) and multi-minicore myopathy (Ferreiro et al. 2002) which is often caused by defects in the thin filament proteins. Some forms of distal arthrogryposis (DA), which is also related to defects in the thin filaments (Daentl et al. 1974, Krakowiak et al. 1997), are characterised by congenital contractures. The clinical severity ranges from severe and fatal perinatal disease to forms that are milder and manifest later in childhood (Lawlor and Beggs 2013). The focus of the present study is nemaline myopathy and the genetically related disorders of cap myopathy, congenital fibre-type disproportion and distal arthrogryposis.

2.1 Nemaline myopathies

2.1.1 Nemaline myopathy A new congenital myopathy was first described in 1963 by two groups (Shy et al. 1963, Conen, Murphy & Donohue 1963), and was given the name NM by Shy et al. in 1963 since the rods of fibrous structures were found in the muscle biopsy of a 4-year-old child with non- progressive proximal muscle weakness (Greek nema, thread) (Shy et al. 1963). Conen and co- workers, carrying out microscopic studies in a child with hypotonia and muscle weakness, described the same disease (Conen, Murphy & Donohue 1963). NM is characterised by muscle weakness and the presence of nemaline (rod) bodies in the muscle fibres. These rods are composed of thin filament and Z-disc proteins (Jockusch et al. 1980, Schroder et al. 2003, Wallgren-Pettersson, Arjomaa & Holmberg 1990, Vainzof et al. 2002). Muscle weakness in NM is usually generalised, but a selective pattern of more pronounced weakness may also occur, including respiratory muscles weakness (Wallgren-Pettersson et al. 2004). The clinical spectrum of NM is wide, ranging from severe to mild. The term typical NM generally applies to the group of congenital nemaline myopathies that present with early hypotonia and muscle weakness. Reports also include adult-onset cases (Wallgren-Pettersson et al. 2011, Wallgren- Pettersson et al. 2004).

The European Neuromuscular Centre International Consortium on NM set the criteria for six clinical categories of NM: (1) the severe congenital form when patients lack spontaneous movement or respiration at birth or accompanied by fractures or severe contractures at birth (NM1); (2) the intermediate congenital form when patients move and breath at birth but are later unable to achieve ambulation or respiratory independence (NM2); (3) the typical congenital form accompanied by a typical distribution of muscle weakness, delayed milestones which are eventually reached and a slowly progressive or non-progressive course (NM3); (4) mild NM with childhood onset (NM4); (5) adult-onset NM (NM5); and (6) other forms of NM accompanied by unusual associated features (NM6) (Wallgren-Pettersson and Laing 2000, Wallgren-Pettersson et al. 2011). Related myopathies include cap myopathy (Fidzianska et al. 1981, Schröder 1982), distal myopathy without or with nemaline bodies (Wallgren-Pettersson et al. 2007, Lehtokari et al. 2011), core-rod myopathy with generalised or distal weakness (von der Hagen et al. 2008, Romero et al. 2009), intranuclear rod myopathy and congenital fibre-type disproportion (Brooke 1973). Myotubular myopathy (Laporte et al. 1996), central core myopathy (Shy and Magee 1956) and multi-minicore myopathy are regarded as distinct congenital myopathies (Ferreiro et al. 2002).

2.1.1.1 Molecular genetics of nemaline myopathy All molecularly characterised forms of NM are autosomal. Inheritance can be recessive or dominant with singleton cases arising from de novo dominant mutations (Wallgren-Pettersson et al. 2011). Nine different causative genes have been identified for NM: nebulin (NEB), slow skeletal muscle -actin (ACTA1), -tropomyosin (TPM2), slow -tropomyosin (TPM3), slow troponin T (TNNT), cofilin 2 (CFL2), a member of the BTB/kelch protein family (KBTBD13) and kelch-like family members 40 and 41 (KLHL40 and KLHL41) (Laing et al. 1995, Pelin et al. 1999, Nowak et al. 1999, Johnston et al. 2000, Donner et al. 2002, Agrawal et al. 2007, Sambuughin et al. 2010, Ravenscroft et al. 2013b, Gupta et al. 2013). All of the causative genes result in diseases that may have different characteristics, which is shown by the classification of NM into different categories from NEM1–NEM7. TPM3 causes NEM1, NEB NEM2, ACTA1 NEM3, TPM2 NEM4, TNNT1 NEM5, KBTBD13 NEM6 and CFL2 NEM7. The newly identified KLHL40 and KLHL41 have yet to be assigned NEM numbers. Mutations in nebulin and ACTA1 are the most common causes of NM (Wallgren- Pettersson et al. 2007). Nebulin mutations are thought to account for roughly 50% of cases (Lawlor et al. 2011). The most common causes of NM are recessive mutations in nebulin and de novo dominant mutations in ACTA1. At least one further gene remains unidentified based on analyses of linkage results (Wallgren-Pettersson et al. 2011). Six of the nine known genes encode proteins of, or closely associated with, the thin filaments of the sarcomere. The function of the protein product of KBTBD13 is not yet known (Sambuughin et al. 2010). Significant histopathological overlap with defects in the same gene resulting in different pathologies and defects in different genes resulting in the same pathology exist (Wallgren- Pettersson et al. 2011). In nebulin, 211 mutations have been identified to date. These mutations are recessive and patients are usually compound heterozygous. Most of the mutations are frameshift or

nonsense mutations, but missense mutations, point mutations and deletions also occur (Pelin et al. 1999, Lehtokari et al. 2006). An in-frame deletion of exon 55 was found in the Ashkenazi Jewish population (Anderson et al. 2004). Similarly, more than 200 different ACTA1 mutations have been identified, the majority of which cause NM or NM with associated features such as cores, actin aggregates or intranuclear rods. Most are dominant missense mutations and arising de novo, while about 10% of the mutations are recessive. Dominant inheritance is less common and only seen in families with a milder phenotype (Laing et al. 2009). In TPM2, two heterozygous, dominant missense mutations causing NM are known (Donner et al. 2002). Additionally, individual cases have included a homozygous null mutation in a patient with NM and Escobar syndrome (Monnier et al. 2009) as well as a dominant heterozygous mutation in a mother with NM and her cap myopathic daughter (Tajsharghi et al. 2007a). The mutations in TPM3 are most often dominant, missense mutations, while some recessive mutations have been described (Nowak et al. 2012). A recessive deletion occurs as a founder mutation in the Turkish population (Lehtokari et al. 2008). A TNNT1 recessive nonsense founder mutation is present in the Old Order Amish population producing characteristic progressive NM with tremors and contractures (Johnston et al. 2000). Recently, a patient who is compound heterozygous for a c.309+1G>A mutation and an exon 14 deletion in the TNNT1 gene was found outside the Old Order Amish (van der Pol et al. 2014). A few studies identified homozygous missense mutations and other variants in the CFL2 gene (Agrawal et al. 2007, Ockeloen et al. 2012, Ong et al. 2014). Three dominant missense mutations were found in KBTBD13, but not all mutation carriers in the families showed skeletal muscle weakness (Sambuughin et al. 2010). KLHL40 mutations resulting in a very severe autosomal-recessive NM were identified as the most common cause of this severe form of NM. KLHL40 plays a key role in muscle development and function. The clinical features of affected infants included fetal akinesia or hypokinesia and contractures, fractures, respiratory failure and difficulties swallowing at birth (Ravenscroft et al. 2013b). Mutations in KLHL41 were recently found to cause NM. Five mutations were identified, including missense changes, insertion, deletion and frameshift mutations. They showed clear phenotype–genotype correlations: frameshift mutations caused severe phenotypes with neonatal death, whereas missense changes resulted in impaired motor function and survival into late childhood and/or early adulthood (Gupta et al. 2013).

2.1.1.2 Clinical pictures of NM The spectrum of NM varies clinically from fetal akinesia to mild childhood-onset forms, as well as adult-onset cases which may not be genetic in origin (Wallgren-Pettersson et al. 2004). Patients with typical NEB-caused NM normally experience congenital generalised muscle weakness and hypotonia. In the typical form of NM, muscle weakness is usually generalised and symmetric with a predilection for neck flexors sparing the extraocular muscles. It is clinically important to note a greater weakness in the respiratory muscles than that of other muscle groups, which leads to often unsuspected slowly emerging hypoxia. Cardiac contractility is normal with rare exceptions. Distal forms and forms with weakness only in the lower limbs may also occur (Wallgren-Pettersson et al. 2004). Newborns experience frequent feeding and breathing problems. Facial and neck flexor weakness are

common features and mild contractures may be present. Early proximal weakness may be combined with distal weakness later in life. The severe form of NM may present before birth with polyhydramnios and weak fetal movement, which may be accompanied by congenital arthrogryposis and/or fractures. In mild forms of NM, patients present with delayed motorskill milestones or respiratory complications and a delayed onset of disease (Jungbluth and Wallgren-Pettersson 2013, Wallgren-Pettersson, Kalimo & Lammens 2013). A recessive form of NM is caused by a mutation to TNNT1 in children from the Old Order Amish community. This NM is characterised by a tremor and contractures, and runs a progressive course (Johnston et al. 2000). The sporadic late-onset form of NM includes subacute onset after the third decade of life and is often autoimmune in origin (Chahin, Selcen & Engel 2005).

2.1.1.2.1 NM caused by nebulin and tropomyosins NM caused by mutations in the nebulin gene NEM2 are known to cause severe, intermediate, mild, typical and other forms of NM. The typical form of NM occurs most frequently. All mutations identified in this gene have thus far been recessive (Wallgren-Pettersson et al. 2011). The typical form of NM is characterised by an initial predominantly proximal pattern of muscle weakness, more pronounced in the axial muscles and the limb girdles than in the proximal limb muscles. Distal involvement and proximal muscle weakness including foot drop is usually noted later (Wallgren-Pettersson et al. 2011). Dominant mutations in the slow α-tropomyosin gene TPM3 may cause the mild form of NM, NEM1, whereas the more rare recessive TPM3 mutations cause the intermediate form of NM, NEM2 (Tan et al. 1999). In patients with TPM3 mutations, fibre-type distribution is variable, but nemaline bodies are often only present in type-1 fibres which are small (Wallgren-Pettersson et al. 2011). A founder mutation has been identified in the Turkish population for TPM3 (Lehtokari et al. 2008). NM caused by mutations in the β-tropomyosin gene TPM2, NEM4, present with the mild or typical form of disease. Biopsies show marked hypotrophy or atrophy of type-1 fibres (Lawlor and Beggs 2013). A clinical and histological overlap between these disorders exists, such that they may form parts of a spectrum rather than distinct entities (Wallgren-Pettersson et al. 2011). . 2.1.2 Distal nemaline myopathy Distal myopathies are a clinically and genetically heterogeneous group of muscle disorders characterised by predominantly distal muscle weakness. Two families were identified with distal myopathy caused by mutations in nebulin and characterised by the early onset of predominantly distal muscle weakness and wasting combined with abundant nemaline bodies in the muscle fibres. The distal onset distinguished this from the typical form of NM, while the disease characteristics—the predominance of distal involvement later in the disease progression, the severe fatty replacement in the tibialis anterior and the preservation of the tibialis posterior muscles—are similar to typical NM caused by nebulin mutations. Thus, NM and distal myopathy caused by nebulin mutations form a clinical and histological continuum (Lehtokari et al. 2011).

2.1.3 Distal nebulin myopathy Distal nebulin myopathy with childhood- or adult-onset foot drop was caused by two homozygous missense mutations in nebulin in Finnish families (Wallgren-Pettersson et al. 2007). The ankle dorsiflexors, the finger extensors and the neck flexors are primarily affected. Distal nebulin myopathy differs histologically from NM in that no detectable nemaline bodies are seen under light microscopy and are absent or vague under electron microscopy. In contrast to most other distal myopathies, no rimmed vacuoles are present (Pelin and Wallgren-Pettersson 2008).

2.1.1.3 Muscle pathology of nemaline myopathy The most prominent histopathological feature in NM is the presence of nemaline bodies in the muscle fibres. Modified Gömöri trichrome staining (Lake, Wilson 1975) of frozen sections of muscle biopsies is routinely used to visualize nemaline bodies (Figure 5). They appear as red- coloured rods in clusters or sometimes individually in the centre or periphery of muscle fibres. In some cases, the staining of plastic sections with toluidine blue or electron microscopy is required to visualise the nemaline bodies if only a few are present or they are very small (Wallgren-Pettersson et al. 2011). Rods are often seen in all fibre types and type-1 fibre predominance is common. α-Actinin is the main component of the rods (Jockusch et al. 1980), but tropomyosin, actin, myotilin, nebulin and desmin are also present on the surface of the rods in smaller quantities (Schroder et al. 2003, Yamaguchi et al. 1982). Nemaline bodies appear under electron microscopy as electron-dense structures, which are rod-shaped or ovoid and resemble thickened or elongated Z-discs. Rods are often found in clusters but may also be isolated. The proportion of the affected fibres may vary greatly between different muscles and may change with age (Wallgren-Pettersson et al. 2011); no correlation has been found between muscle weakness and the quantity of nemaline bodies (Ilkovski et al. 2001, Ryan et al. 2003). NM caused by nebulin mutations may show fibre splitting, internal nuclei, fatty infiltration and fibrosis in later stages of disease (Wallgren- Pettersson, Rapola & Donner 1988).

Figure 5. Histology of NM, cap myopathy and congenital fibre-type disproportion (CFTD). The range of abnormalities in skeletal muscle that can arise with mutations in tropomyosin is shown in these images. A–C: Nemaline myopathy (NM). In TPM2 NM (A, p.K7del mutation), rods are often randomly scattered. In TPM3 NM (B, p.M9R), rods are confined to type-1 fibres, which are usually hypotrophic. C: Nemaline bodies under electron microscopy. D–F: CFTD due to mutations in TPM3. D–E: ATPase (4.3) showing a consistent difference in size between type-1 fibres (dark) and type-2 fibres (pale). Type-1 fibre predominance is common (D), but a range is observable (E). D: Increased internalised nuclei in large (type-2) fibres in an adult CFTD patient with the TPM3 p.L100M mutation. G–J: Cap myopathy due to the TPM2 p.Glu139del mutation. On light microscopy, caps are most commonly seen on ATPase stains (H), but may also be visible on H&E stains (G) or oxidative stains. I–J: Electron microscopy of a typical cap structure. Modified from Marttila et al. Hum Mutat. 2014 35(7):779–90 with permission from Wiley.

2.1.1.3 Pathogenesis of nemaline myopathy NM was thought of as a disorder of the thin filament proteins. The recently discovered mutations in genes that do not encode thin filament proteins, however, has challenged this model (Gupta et al. 2013). To understand the pathogenetic mechanisms underlying NM, it is necessary to unravel the normal interactions of the proteins involved in the disease. Mutations in the genes encoding parts of the thin filament may disrupt the ordered assembly of sarcomeric proteins. The interactions between the thin and thick filaments during muscle contraction may also be disturbed (Gupta et al. 2013, North and Ryan 1993–2014). The unifying pathogenetic mechanism in NM is thought to result in reduced force generation due to the impaired thin filament function (Ochala 2008).

2.1.1.3.1 Studies of individual genes and their mutations Studies of ACTA1 mutations in tissue cultures demonstrate that some mutant actins carry a dominant negative effect on thin filament assembly and function. The mutations in ACTA1 cause abnormal folding, altered polymerisation and aggregation of mutant actin isoforms. The effects are mutation-specific and may cause variations in the severity of muscle weakness seen in individuals (Ilkovski et al. 2004). ACTA1 mutation p.Asp286Gly studies on the mechanics of membrane-permeabilised single-muscle fibres and molecular energy-state computations demonstrated that, during contraction, the Asp286Gly acts as a ‘poison protein’ and modifies the actin–actin interface. This likely prevents proper myosin crossbridge binding, limiting the fraction of actomyosin interactions in the strong binding state, thus decreasing the force-generating capacity at the cell level, thereby inducing muscle weakness (Ochala et al. 2012a). The mechanisms underlying the impaired muscle function in patients with a TPM2 p.Arg133Trp mutation were investigated measuring the maximum force normalised to a fibre cross-sectional area, the maximum velocity of unloaded shortening, the apparent rate constant of force redevelopment and the force–pCa relationship. The results indicated a slower crossbridge attachment rate and a faster detachment rate caused by the TPM2 p.Arg133Trp mutation. The mutation induces an alteration in myosin–actin kinetics causing a reduced number of myosin molecules in the strong actin-binding state, resulting in overall muscle weakness (Ochala et al. 2007). The various tropomyosin mutations induce a thin filament dysfunction via distinct physiological mechanisms. Two divergent, mutation-specific pathophysiological mechanisms were found among three tropomyosin mutants. The TPM2- null and TPM3 p.Arg167His mutations both decreased cooperative thin filament activation and reduced the number of myosin crossbridges and the force production. The TPM3 p.Arg167His mutation also caused a reduction in the thin filament length. In contrast to other mutations, the TPM2 p.E181Lys mutation increased the thin filament activation, crossbridge binding and force generation (Ochala et al. 2012b). Studies of the contractile phenotypes of NM patients with nebulin mutations causing NM2 revealed markedly lower nebulin protein abundance in the muscle, but the levels of other thin filament–based proteins did not significantly alter. A reduced Ca2+ sensitivity in the force generation in NM muscle fibres existed compared to the control fibres and a slower rate constant of force redevelopment and an increased tension cost in NM was found compared to

the control fibres. Thus, in NM muscle, the rate of crossbridge attachment decreases and the rate of crossbridge detachment increases (Ottenheijm et al. 2010). Some mutations in nebulin caused abnormal NEB expression and impaired muscle force generation in severe NM (Lawlor et al. 2011). Molecular modelling of KLHL40 revealed that all of the substituted residues are involved in intramolecular interactions. The substitutions may destabilise the hydrophobic cores of the BTB–BACK domain. Modelling and free-energy calculations suggest that most KLHL40 missense mutations impair protein stability (Ravenscroft et al. 2013b). Functional studies in a zebrafish model revealed that the loss of KLHL41 results in extensive skeletal muscle disorganisation associated with sarcomeric abnormalities, which points towards a KLHL41 function in skeletal muscle development and maintenance (Gupta et al. 2013). Together, these effects contribute to the common pathologic hallmarks of NM, such as rod formation, the accumulation of thin filaments and myofibrillar disorganisation.

2.1.1.4 Animal models of nemaline myopathy Animal models, particularly those for mice and zebrafish, proved useful in elucidating the pathogenetic mechanisms associated with congenital myopathies, as well as providing models in which future therapeutic options may be investigated (Nance et al. 2012). To investigate the functional role of nebulin in vivo, nebulin-deficient mice were generated using a Cre knock-in strategy (Bang et al. 2006) and through targeted gene disruption (Witt et al. 2006). NEB-null mice were born in Mendelian ratios with a normal body weight compared with wt littermates (Bang et al. 2006, Witt et al. 2006). NEB-null mice barely increased in weight after birth, possessed little subcutaneous fat and died 8–11 days after birth (Bang et al. 2006). Nebulin knock-out mice created using targeted gene disruption in embryonic stemcells (ES) were viable up to day 20 postnatal (Witt et al. 2006). The diaphragm muscles of NEB-null mice featured well-aligned sarcomeres with the same appearance as wt muscles at embryonic day 18.5. At day 9 postnatal, NEB-null mice diaphragm muscles showed a severe disruption of the myofibrillar structure, including a lack of well-defined A- and I-bands (Bang et al. 2006). A third knock-out mouse model was created with nebulin exon 55 deleted in order to replicate a founder mutation seen frequently in patients with NM from the Ashkenazi Jewish community. These mice showed growth retardation after birth. Nemaline bodies and reduced nebulin levels were apparent in the muscle fibres and the thin filament length was significantly shorter than in wt mice (Ottenheijm et al. 2013). The muscles worked beyond their optimal length range, which caused an incomplete overlap of the thick and thin filaments, resulting in instability and damage to the filaments (Morgan and Allen 1999). NEB- null mice also showed shorter thin filament lengths (Bang et al. 2006, Witt et al. 2006, Ottenheijm et al. 2013). This resulted in impaired muscle contraction and force generation shown by marked changes in the crossbridge cycling kinetics and through a reduction in the calcium sensitivity of force generation, one of the pathogenetic mechanisms leading to muscle weakness in NM patients (Ottenheijm et al. 2013). Mouse models of NM exist which also contain TPM3 mutations (Corbett et al. 2001). Muscle weakness was evident in the mice at 5–6 months of age, mimicking the late onset of NM observed in humans with a p.Met9Arg mutation in TPM3 (Corbett et al. 2001). To

determine the mutant ACTA1 pathobiology, ACTA1(D286G) transgenic mice were engineered. The mice were less active than wt individuals, their skeletal muscles were significantly weaker by in vitro analyses and they showed various pathological lesions reminiscent of human patients; but, they had a normal lifespan. ACTA1D286G + / + mice presented with severe immobility between days 8 and 17 postnatal. The mutant protein load determined the severity of ACTA1 disease (Ravenscroft et al. 2011a). Cardiac α-actin can substitute for skeletal muscle α-actin, preventing early postnatal death of ACTA1 knock-out (KO) mice. In one model, investigation of the transgenic overexpression of cardiac α-actin in postnatal skeletal muscle showed that the lethality of ACTA1D286G in mice decreased from ∼59% to ∼12% before reaching 30 days old. In another model, ACTA1H40Y, for which ∼80% of male mice die by 5 months of age, the cardiac α-actin transgene did not significantly improve survival. Thus, cardiac α-actin overexpression is a likely therpy for at least some dominant ACTA1 mutations (Ravenscroft et al. 2013a). Mechanical and X-ray diffraction pattern analyses of single-membrane permeabilised myofibres show, at maximal Ca2+ activation and under rigorous conditions, less stiffness and disruption of actin-layer line reflections in ACTCCo/KO was found when compared with age-matched wt mice. These results show that, in ACTCCo/KO myofibres, the presence of cardiac α-actin instead of skeletal muscle α-actin alters the actin conformational changes upon activation, modulating individual actomyosin interactions and lessening the myofibre force production. This has influenced the design of gene therapies for ACTA1-based congenital myopathies (Ochala et al. 2013b). Similarly, a zebrafish model for NM was developed which harbours a recessive mutation in nebulin resulting in decreased NEB protein levels, a severe motor phenotype and premature lethality. In addition, many of the features associated with human NM were present, including impaired force generation, altered thin filament length and the formation of nemaline bodies (Telfer et al. 2012). Zebrafish models of NM KLHL40 isoforms a and b showed that their expression is largely confined to the myotome and skeletal muscle, and the knockdown of these isoforms results in the disruption of muscle structures and the loss of movement. Electron-microscopic analysis showed disarranged myofibrils with widened Z-discs (Ravenscroft et al. 2013b). Functional studies in a zebrafish model with the loss of the KLHL41 gene resulted in highly reduced motor function and myofibrillar disorganisation accompanied by nemaline body formation (Gupta et al. 2013).

2.2 Disorders related to nemaline myopathy

2.2.1 Cap myopathy Cap myopathy or cap disease was first described in 1981 by Fidzianska and co-workers (Fidzianska et al. 1981), while Schröder reported a case of ‘myopathy with subsarcolemmal- segmental myofibrillolysis’ in 1982 (Schröder 1982). The name derives from the cap-like structures located under the sarcolemma. Patients exhibit muscle hypotonia, weakness, skeletal dysmorphism and respiratory insufficiency beginning in childhood, and their muscles contain abnormally structured muscle fibres. The pathognomonic peripherally located cap 24

structures lack ATPase and fast myosin activity and are rich in desmin, tropomyosin and α- actinin, and consist of abnormally arranged myofibrils. The peripheral position of myofibrils and their abnormal sarcomere pattern point to an error in fusion and muscle protein synthesis (Fidzianska 2002).

2.2.1.1 Molecular genetics of cap myopathy The first genetic causes of cap disease were identified in 2007 in the gene coding for β- tropomyosin (TPM2), specifically a deletion of glutamic acid at position 139 (Lehtokari et al. 2007) and a change at position 41 of glutamate to lysine (Tajsharghi et al. 2007b). Since then, genetic analyses have revealed three causative genes for cap myopathy: ACTA1 encoding slow skeletal muscle α-actin (Hung et al. 2010), TPM2 encodes β-tropomyosin and TPM3 encodes α-tropomyosin in slow muscle fibres (De Paula et al. 2009). Cap myopathy is, in most cases, caused by de novo dominant mutations with no family history (Schreckenbach et al. 2014). The ACTA1, TPM2 and TPM3 genes encode the thin filament proteins that are components of the contractile apparatus. TPM2 is expressed in both slow, and, to a lesser extent, in fast muscle fibres. TPM3 is expressed exclusively in slow muscle fibres (Perry 2001).

2.2.1.2 Clinical picture of cap myopathy The clinical features of cap myopathy include onset in infancy or childhood, delayed motorskills milestones, primarily proximal and axial muscle weakness, a long myopathic face with a high-arched palate, skeletal deformities such as scoliosis, an elongated face, a high- arched palate and respiratory problems leaving some patients reliant upon ventilatory support. Severe cardiac involvement is not a common feature of cap myopathy, reported in only a few cases (Schreckenbach et al. 2014, Clarke et al. 2009). In most cap myopathy patients, the creatine kinase level in serum is normal and EMG usually displays a myopathic pattern (Schreckenbach et al. 2014), similar to the case for other NM-related disorders and congenital myopathies in general.

2.2.1.3 Muscle pathology of cap myopathy The caps are peripherally located, sharply demarcated inclusions located under the sarcolemma (Figure 4), appearing purple-bluish or greenish under modified Gömöri trichrome staining and eosinophilic under hematoxylin and eosin staining. In nicotinamide adenine dinucleotide-tetrazolium reductase (NADH-TR) staining, the caps show a dark-bluish reactivity, but the myosin ATPase reaction is weak. The caps contain disorganised thin filaments and Z-disc material. The caps are composed of α-actinin, actin, troponin T, sarcomeric tropomyosin and desmin as revealed by immunohistochemistry. In some cases, thickened Z-lines appearing as rod-like structures are observed within the caps. The proportion of caps ranges from 4% to nearly 100% of muscle fibres and correlates with the disease severity and the patient’s age (Schreckenbach et al. 2014). In the presense of cap structures, a lack of thick filaments is observed, while the preservation of thin filaments in the sarcomere and prominent Z-discs suggest a defect in myosin synthesis (Fidzianska 2002).

2.2.2 Congenital fibre-type disproportion The term CFTD was used for the first time by Brooke in 1973 for patients with a fibre-size disproportion (FSD) of 12% or more (Brooke 1973). The main histologic abnormality in this congenital myopathy is defined by type-1 fibres that are consistently smaller than type-2 fibres. Brooke (1973) suggested defining the group of patients with FSD but no other significant histologic abnormalities would be useful. Since then, minor degrees of FSD have been described in many conditions, including disorders of the central and peripheral nervous systems, metabolic disorders and muscular dystrophy. CFTD is a congenital myopathy that may be best viewed as a syndrome rather than as a formal diagnosis (Clarke 2011b). Diagnosis must be carefully made since this histologic abnormality may occur in other congenital myopathies and in other neuromuscular disorders (Clarke 2011a). Often, a second biopsy reveals pathognomonic findings for one of the more well-defined myopathies (Jungbluth and Wallgren-Pettersson 2013).

2.2.2.1 Molecular genetics of congenital fibre-type disproportion The causes of CFTD without specific histological features are mutations in the TPM3 (Clarke et al. 2008, Schessl et al. 2008), RYR1 (Clarke et al. 2010) and ACTA1 (Laing et al. 2004) genes, while all NM genes are known to cause FSD. Mutations in the MYH7 (Ortolano et al. 2011) or TPM2 genes (Brandis, Aronica & Goebel 2008) and the gene causing an X-linked form of (Clarke et al. 2005) CFTD appear to be rare. Mutations in TPM3 were first identified in patients with NM (Laing et al. 1995), but it now appears that CFTD without nemaline bodies is the histologic finding most often associated with mutations in TPM3. Most TPM3 mutations associated with CFTD are dominant missense changes. Patients generally present with mild to moderate muscle weakness and retain the ability to walk into adulthood (Clarke 2011a). The severity of disease caused by RYR1 mutations vary from death due to respiratory failure in the neonatal period to difficulties climbing stairs in the late teen years. Patients experienced hypotonia and weakness of the axial muscles, and when generalised weakness was marked, myopathic facies, respiratory failure and feeding difficulties were present (Clarke et al. 2010). NM is commonly associated with mutations in ACTA1 (Laing et al. 2009). As a cause of CFTD, mutations in ACTA1 appear to be uncommon, accounting for approximately 5% of patients (Laing et al. 2004). Normally, stable, generalised and often severe weakness follows the pattern described in other ACTA1 myopathies, sparing the extraocular muscles and the heart (Clarke 2011a).

2.2.2.2 Clinical picture of congenital fibre-type disproportion To make a diagnosis of CFTD, a disproportionate fibre size must present as the main diagnostic abnormality; furthermore, the diagnosis is only appropriate when other forms of congenital myopathy are excluded. Modest degrees of FSD may also occur in a wide range of other neuromuscular disorders, which must be considered and ruled out before diagnosing CFTD (Clarke 2011b, Clarke 2011a). Patients with CFTD may present with many of the clinical features of congenital myopathies: static or slowly progressing generalised weakness,

prominent axial or respiratory weakness, facial weakness, dysphagia and, in rare cases, ophthalmoplegia. No single clinical or histologic feature is specific to CFTD (Clarke 2011a).

2.2.2.3 Muscle pathology of congenital fibre-type disproportion The main histologic feature that defines CFTD is an abnormality in the muscle fibre size (Figure 4). Initially, a difference in fibre size of more than 12% was considered characteristic of CFTD (Brooke 1973). Recently, findings suggest that, in CFTD, type-1 (slow twitch) muscle fibres are smaller compared with type-2 (fast twitch) muscle fibres by at least 35–40% (Clarke 2011a).

2 Aims of the study This study aims to increase our understanding of the pathogenetic mechanisms of congenital myopathies caused by mutations in the tropomyosin and nebulin genes and to compile as many as possible of the known and novel mutations in the TPM2 and TPM3 genes causing congenital myopathies to determine any genotype–phenotype correlations.

3 Materials and methods

3.1 Polymerase Chain Reaction (PCR) and sequencing Genomic DNA was extracted from whole blood or other tissues using standard protocols. The protein coding regions and the intron–exon borders of TPM2 and TPM3 were amplified using standard procedures and the bi-directional sequence was determined using Sanger di-deoxy methods.

3.2 Constructs TPM2 cDNA (GenBank® accession number NM_009416) cloned into pGEX4-1 (GE Healthcare) was used as a template for PCR. Forward 5_- GATCCATGGACGCCATCAAGAAGAAG-3_ and reverse 5_- TCGAGTCAGAGGGAAGTGATGTCAT-TG-3_ primers were designed to copy the TPM2 sequence and to exclude the GST tag. Fusion DNA polymerase (Thermo Fisher Scientific) was used. Products were cloned into the Zero Blunt TOPO vector using a PCR cloning kit (Invitrogen). Plasmids were extracted using QIAprep Spin Miniprep kit (Qiagen). The mutations (Table 1) were introduced into mouse cDNA using the QuikChange® Site-Directed Mutagenesis kit (Stratagene). Plasmids were sequenced using BigDye version 3.1 sequencing chemistry and an ABI 3730 DNA Analyzer (Applied Biosystems). The sequences were analysed using the Sequencher 4.5 software.

Table 1. Mutations in TPM2 gene. Mutation Location Disease Reference E117K Exon3 NM Donner et al. 2002 Q147P Exon4 NM Donner et al. 2002 E139del Exon4 Cap myopathy Lehtokari et al. 2007 K49del Exon 2 Cap myopathy Ohlsson et al. 2007 E41K Exon 2 Cap myopathy Ohlsson et al. 2007

3.3 Production of wild-type and aberrant β-tropomyosins Recombinant β-Tms were produced using a Bac-to-Bac baculovirus expression system (Invitrogen; http://tools.lifetechnologies.com/content/sfs/manuals/bactobac_man.pdf) in Spodoptera frugiperda (Sf9) insect cells. The insect cells were grown in a supplemented Grace’s Insect Medium (Invitrogen) containing 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco) in 500 ml of medium at 27◦C (Figure 6).

Figure 6. β-tropomyosins produced in insect cells. SDS-PAGE of recombinant proteins stained with Coomassie Blue. The β-tropomyosin mutations p.K49del and p.E139del result in altered protein conformation and, thus, slower migration in the SDS-PAGE gel. Modified from Biochem J. 2012 15;442(1):231–9 with permission from the Biochemical Society.

3.3.1 Extraction of proteins Proteins were extracted from Sf9 cells using a modification of the method described by Akkari et al. (Akkari et al. 2002), which is described in detail elsewhere (Marttila et al. 2012).

3.4 RNA isolation and reverse transcriptase polymerase chain reaction (RT-PCR) Total RNA was isolated from human vastus lateralis (VL) muscles using the RNeasy Fibrous Tissue Mini Kit (Qiagen). cDNA was synthesised from 2 µg of total RNA using the High- Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Next, 2 µl of template were used per 20-µl PCR reaction. All PCR reagents were from Thermo Scientific. Amplifications were completed using Phusion High-Fidelity DNA polymerase and PCR products were

cloned into pCRBluntII-TOPO (Invitrogen). For all nebulin exon amplifications, after initial heating at 98oC for 1 min, 30 cycles of denaturation at 98oC for 10 s, annealing at 59oC for 30 s and extension at 72oC for 15 s were performed, followed by a final extension of 10 min at 72oC.

3.5 In vitro mutagenesis and sequencing The QuickChange site-directed mutagenesis kit (Stratagene) was used to introduce site- specific point mutations or deletions into NEB cDNA fragments (Table 3). PCR reactions were performed using DNA as a template with two synthetic oligonucleotide primers containing the chosen mutation (Table 2). The cycling conditions were completed as recommended in the manual and the primer details are given in Table 2. The purified products were sequenced using BigDye version 3.1 sequencing chemistry and an ABI 3730 DNA Analyser (Applied Biosystems, Foster City, USA). Sequences were analysed using the Sequencher 4.1 software. The primers used for nebulin exon amplifications and in vitro mutagenesis are summarised below (Table 3).

Table 2. NM-causing NEB mutations. The site of the mutations is reported according to the coding sequence of NEB cDNA GenBank ID NM_001164507.1 and its translation, NP_001157979.1. Fragment Mutations in Altered protein Disease Reference cDNA site Neb ex53-57 c.7291G>A p.Glu2431Lys NM mild form Lehtokari et (super-repeat 9) al. 2006 in figures ex54m Neb ex53-57 c.7432+1916_7535 p.Arg2478_Asp251 NM Lehtokari et (super-repeat 9) +372del 2del severe, al. 2006 in figures intermediate and ex55del typical forms Neb ex 77-81 c.11770_11787del p.Val3924_Asn392 NM mild form Lehtokari et (super-repeat 14) 9del al. 2006 in figures ex78del Neb ex 119-125 c.19097G>T p.Ser6366Ile NM typical Lehtokari et (super-repeat 18) form, distal al. 2006 in figures myopathy ex122m Neb ex 146-153 c.22144A>C p.Thr7382Pro NM typical Lehtokari et (super-repeat 22) form, distal al. 2006, in figures 151m myopathy Wallgren- Pettersson et al. 2007

Table 3. Oligonucleotide primers used for cloning nebulin super-repeats and for in vitro mutagenesis. Primer name 5’-3’ Sequence Experimental use 1 Ex 54-F CGC GAA TTC CAA GGC TAC CGA AAG CAA cDNA amplification 2 Ex 54-R CCG CTC GAG ATC GCT CTG GAG GTC ATA cDNA amplification GGC 3 Ex 78-F2 TAC GGA TCC AAG TAC AAG GAA GGC TAC cDNA amplification CG 4 Ex 78-R1 TTT CTC GAG TGC TTG GAT AAT GTC GTT cDNA amplification TTG 5 Ex 122-F1 GCG GGA TCC GAG AAG CAG AAA GGT CAC cDNA amplification TAC 6 Ex 122-R CCG CTC GAG GAT GTT AAG CTT GCC AAC cDNA amplification TCG 7 Ex 151-F CGC GAA TTC AAA TTG GAA TAC AAC AAG cDNA amplification GCC 8 Ex 151-R CCG CTC GAG TTT GGC TGC CTG TGT GGC cDNA amplification 9 Ex 54MUT- gatggagtcccttgggttctttaaaggcagaaaagaac In vitro mutagenesis F 10 Ex 54MUT- gttcttttctgcctttaaagaacccaagggactccatc In vitro mutagenesis R 11 Ex 78del-F cattaccgacactccggaaattgccctgacaatgAGCAAG In vitro mutagenesis 12 Ex 78del-R CTTGCTcattgtcagggcaatttccggagtgtcggtaatg In vitro mutagenesis 13 Ex actgctgttcagagtggcattaatgccattgaggtaaaatataa In vitro mutagenesis 122MUT-F 14 Ex 122MUT ttatattttacctcaatggcattaatgccactctgaacagcagt In vitro mutagenesis R 15 Ex ttcacgtcaaggaagtgcccaagcatgtcagtgat In vitro mutagenesis 151MUT-F 16 Ex 151MUT atcactgacatgcttgggcacttccttgacgtgaa In vitro mutagenesis R 17 Ex 78del-F cattaccgacactccggaaattgccctgacaatgAGCAAG In vitro mutagenesis 18 Ex 78del-R CTTGCTcattgtcagggcaatttccggagtgtcggtaatg In vitro mutagenesis

3.6 Construction of vectors for the expression of nebulin super-repeats Plasmid vectors for the expression of human NEB super repeats 14 and 18 for the analysis of exon 78 and exon 122 were constructed by cloning digested and purified PCR products into the BamHI/XhoI restriction sites of the pGEX4T-1 expression vector. Plasmid vectors for the expression of super-repeats 9 and 22 for the study of exon 54 and exon 151 were constructed by cloning digested and purified PCR products into the EcoRI/XhoI restriction sites of the pGEX4T-1 expression vector.

3.7 Nebulin production in Escherichia coli GST-NEB fusion proteins were expressed from the pGEX-4T vectors in Escherichia coli (E. coli) strain BL21 (DE3) (Invitrogen). Proteins were expressed by selecting a single colony and culturing in 5-mL LB supplemented with ampicillin (100 µg/ml). After growing the E. coli sample to A600 0.5–0.8, the cells were induced with 0.5-mM isopropyl-β-D- thiogalactopyranoside (IPTG) for 3 h at 250 rpm at 27.8°C. Harvesting of cells and batch- binding protein purifications were performed as described in the manufacturer’s manual (Protino® Glutathione Agarose 4B, Macherey-Nagel, MN, Germany) (Figure 7).

Figure 7. Purified GST (glutathione-S-transferase)-nebulin and tropomyosin. GST-nebulin domains were produced in Escherichia coli strain BL21, while α-tropomyosins (Tm3) and β-tropomyosins (Tm2) were produced in insect cells. The proteins were purified, run in a SDS-PAGE gel and stained with Coomassie Blue. Modified from Marttila et al. 2014 Skeletal Muscle 1;4:15.

3.7.1 Actin binding Actin-binding assays were performed using Cytoskeleton’s Actin-Binding Protein Biochem Kit (Cytoskeleton). Here, 10.35-μM β-tropomyosins and 23-μM F-actin were used to detect more actin-binding mutants. Tms were allowed to bind to F-actin for 30 min at room temperature. Samples were run in a Beckman Coulter OptimaMAXUltracentrifuge at 60 000 rpm for 1.5 h at 24◦C. Pellet and supernatant fractions were separated, analysed using 12% SDS-PAGE gels and stained with Coomassie Blue. Pellet and supernatant bands were quantified from four duplicated experiments using the ImageJ program (NIH). The significance was calculated using a one-tailed distribution and unpaired Student's t test.

3.7.2 GST-pulldown assays GST-containing wt and mutant NEB super-repeats (8 µg) bound to beads were mixed with baculovirally produced and purified wt α-tropomyosin, wt β-tropomyosin and mutant β- tropomyosins (40 µg) in 400-µl PBS in a shaker at +4°C for 45 min. Samples were centrifuged at 2000 rpm for 5 min. The supernatant was removed and 400-µl fresh 1xPBS was added. Samples were washed 5 times by centrifugation at 1500-2000 rpm for 5 min. The pellets were dissolved in a 20-µl Laemmli sample buffer, analysed in 12% SDS-PAGE gels and stained with Coomassie Blue. Bands of pelleted protein were quantitated from three duplicated experiments using the ImageJ program.

3.8 Three-dimensional models The mutations E41K, K49del and E139del were created in the amino acid sequence of Tm2 (GenBank® accession number P58775.1). The probable secondary structure of the mutants were assigned through homology modelling using the crystal structure corresponding to PDB codes 1C1GA and 2B9CA as templates following a standard method in Discovery Studio (Accelrys).

4 RESULTS AND DISCUSSION

4.1 Novel mutations in TPM2 and TPM3 Mutations in the tropomyosin genes have been generally uncommon. Altogether 14 mutations in TPM2 and 16 in TPM3 were known to be associated with congenital myopathies (Citirak et al. 2014) before our study. NM, cap myopathy, core-rod myopathy, CFTD, DA and Escobar syndrome are caused by mutations affecting skeletal muscle isoforms of the tropomyosin genes. Including previously published research, 94 families were included in our study of tropomyosin mutations (Marttila et al. 2014a). Of these, 53 had TPM2 mutations and 41 had TPM3 mutations. There were 30 different mutations in TPM2 and 20 different mutations in TPM3. Eleven of the TPM2 mutations and 5 of the TPM3 mutations were novel (Figures 8 and 9, Tables 4 and 5). No clinical details were available for 12 TPM2 families and 5 TPM3 families. None of the novel changes were found in the 1000 Genomes dataset (www.1000genomes.org) nor in the Exome Variant Server, NHLBI Exome Sequencing Project (ESP), Seattle, WA (http.//evs.gs.washington.edu/EVA/).

Figures 8 and 9. The Tm2 and Tm3 dimers presented in green with disease-causing mutations (shown in red and above the molecules), α-zones (purple) and overlapping regions (separated by green lines in N- and C-terminal ends of the molecules). Phosphorylation sites are shown below the molecules. Novel mutations/phosphorylation sites are shown in yellow. The figure was created using the PyMol software (http://www.pymol.org) and the Protein Databank structure 1C1GA. Modified from Marttila et al. Hum Mutat. 2014 35(7):779-90 with permission from Wiley.

Molecular testing for congenital myopathies is evolving rapidly with advances in next generation sequencing technologies. This will have an impact on the method of genetic testing for these diseases. A novel custom comparative genomic hybridization microarray, NM-CGH, was developed including the seven known genes causative for NM. Two novel deletions mutations were identified using this method in two different families (Kiiski et al. 2013). The whole-exome sequencing of six families and targeted gene sequencing of additional families identified 19 mutations in the KLHL40 (Ravenscroft et al. 2013b). The whole-exome sequencing identified recessive small deletions and missense changes in the KLHL41 in four individuals from unrelated NM families (Gupta et al. 2013). Exome sequencing revealed 88 heterozygous carriers of pathogenic nebulin mutations and disease incidence of approximately 1 in 18300 for recessively inherited myopathies caused by nebulin mutations (Lehtokari et al. 2007). The challenge will be to ensure that sequence changes identified are pathogenic and to distinguish these from polymorphisms. This may be done by using prediction programs or database searches. The Leiden Open Variation database (LOVD) is an open access database that provides a list of DNA sequence variants in specific genes and associated phenotypes to assist in the identification of pathogenic variants (http://www.lovd.nl/) (North et al. 2014). The novel TPM2 and TPM3 variants found in our study have been inserted in the LOVD database. Collecting all the data is essential for the researchers working in the field of rare diseases as well as for the diagnostic laboratories screening for mutations in these genes.

Figure 10. Sequence comparison of α-tropomyosin, β-tropomyosin and γ-tropomyosin (TPM1, TPM2 and TPM3). Mutations are indicated in the sequence by red dots. In the Tm3 protein amino-acid sequence (P06753) the initiation codons have been processed, thus the nomenclature is different compared with that in other figures. The tropomyosin head-to-tail overlapping regions are marked as black boxes at the end of the molecules. Stars below the sequences indicate conserved amino acids, and dots show the sites where sequences diverge. Modified from Marttila et al. Hum Mutat. 2014 35(7):779-90 with permission from Wiley.

4.1.1 Prediction of pathogenicity of mutations The prediction programs of functional effects of human non synonymous single nucleotide polymorphisms (SNPs) PolyPhen-2, and FATHMM were used to predict the pathogenicity of missense mutations in TPM2 and TPM3. Our analysis shows that both PolyPhen-2 and FATHMM were able to correctly predict more than 80% of the pathogenic Tm mutations (82.5% for PolyPhen-2 and 85% for FATHMM). Out of 22 TPM2 mutations 17 were predicted to be possibly or probably damaging (Table 4). The two programmes gave slightly different results in the predictions. PolyPhen-2 predicted three mutations (p.Asp2Val, p.Ala3Gly, p.Arg91Gly) to be benign, whereas FATHMM predicted the same three mutations to be damaging. FATHMM predicted the mutation p.Gln147Pro to be tolerated, whereas PolyPhen-2 predicted the same mutation to be probably damaging. Both programs predicted two mutations (p.Glu41Lys and p.Asn202Lys) to be benign or tolerated, but the functional studies have shown that p.Glu41Lys affects muscle contractility due to decreased calcium sensitivity (Marttila et al. 2012) and transfected human myotubes with the p.Glu41Lys mutant showed perinuclear aggregates (Abdul-Hussein et al. 2013). A range of contractile characteristics in skinned muscle fibres were investigated in patients with p.Glu41Lys mutation and healthy controls. Results showed decreases in speed of contraction at saturated Ca2+ concentration and in contraction sensitivity to Ca2+ concentration suggesting that the mutation has a negative effect on contractile function, contributing to the muscle weakness (Ochala et al. 2008). Using X-ray diffraction it was shown that p.Glu41Lys β-tropomyosin mutation does not change the myofilament lattice geometry and therefore may not have any detrimental influence on the contraction mechanisms or on the rate of force generation (Ochala, Iwamoto 2013a). The β-tropomyosin mutant p.Asn202Lys that has been hypothesized to affect Tm-Troponin T interactions, failed to integrate into thin filaments and formed accumulations in myotubes (Abdul-Hussein et al. 2013, Ohlsson et al. 2008). PolyPhen-2 predicted 16/18 missense mutations to be possibly or probably damaging in TPM3 and 17 were predicted to be damaging by FATHMM (Table 5).

Table 4. Novel and recurrent TPM2 mutations with functional significance. Nucleotide numbering according to the TPM2 cDNA sequence with +1 corresponding to the A of the ATG translation initiation codon in the reference sequence NM_003289.3. Amino acid coordinates are provided relative to NP_003280.2, the ATG translation initiation codon is codon 1. Abbreviations: NM, nemaline myopathy; Cap, cap myopathy; CFTD, congenital fibre type disproportion; DA, distal arthrogryposis; CRM, core-rod myopathy; CM, undefined congenital myopathy; spl, splice site mutation; # gain-of-function mutation resulting in hypercontractile phenotypes. TPM2 mutations with functional significance Family Patient Mutation(s) Altered Diagnosis Functional significance ID, in cDNA protein site Gender RefSeq and NM_003289. predicted 3 effect Fam 1 - c.5A>T p.Asp2Val - head-to-tail binding

Fam 2 2693 c.8C>G p.Ala3Gly NM head-to-tail binding M Fam 3 20-625 c.41A>T p.Asp14Val NM adjacent to On state F tropomyosin-actin contacts Fam 4 20-561 c.124G>A p.Glu41Lys NM decreased Ca2+ sensitivity F Fam 5 M c.144_146 p.Lys49del Cap decreased actin affinity, delGAA decreased α-helical content in circular dicroism Fam 6# F c.240+5G>A spl DA increased contractility

Fam 7 F c.349G>A p.Glu117Lys DA decreased Ca2+ sensitivity, increased actin affinity, increased α-helical content in circular dicroism Fam 8# 20-393 c.382A>G p.Lys128Glu CM increased contractility M Fam 9# 3603 c.397C> T p.Arg133Trp CFTD increased contractility F F c.440A>C p.Gln147Pro NM decreased actin affinity Cap Fam 3653 c.443T>C p.Leu148Pro CFTD increased contractility 10# F Fam 11 F c.541G>A p.Glu181Lys NM increased Ca2+ sensitivity and force production

Fam 12 - c.654_656del p.Glu218del - adjacent to On state tropomyosin-actin contacts Recurrent mutations with functional significance Fam 13# Fam A c.19_21delAAG p.Lys7del NM head-to-tail binding, increased F contractility Fam Fam B c.19_21delAA p.Lys7del NM head-to-tail binding, increased 14# M G contractility

Fam Fam C c.19_21delAA p.Lys7del NM head-to-tail binding, increased 15# F G contractility

Fam Fam D c.19_21delAA p.Lys7del NM head-to-tail binding, increased 16# M G contractility

Fam 17 Fam E c.19_21delAA p.Lys7del NM head-to-tail binding, increased 1653 F G contractility Fam 20-747 c.19_21delAA p.Lys7del NM head-to-tail binding, increased 18# F G contractility

Fam Fam 1 c.19_21delAA p.Lys7del CRM head-to-tail binding, increased 19# M G contractility Fam Fam 2 c.19_21delAA p.Lys7del DA type 7 head-to-tail binding, increased 20# F G contractility Fam Fam 3 c.19_21delAA p.Lys7del DA type 7 head-to-tail binding, increased 21# F G contractility Fam Fam 4 c.19_21delAA p.Lys7del DA type 7 head-to-tail binding, increased 22# F G contractility Fam 23 291-A, B c.415_417del p.Glu139del NM decreased actin affinity, decreased F, M GAG Cap α-helical content in circular dicroism, adjacent to On state tropomyosin-actin contacts Fam 24 F c.415_417del p.Glu139del CFTD decreased actin affinity, decreased GAG α-helical content in circular dicroism, adjacent to On state tropomyosin-actin contacts Fam 25 3073 c.415_417del p.Glu139del Cap decreased actin affinity, decreased M GAG CFTD α-helical content in circular dicroism, adjacent to On state tropomyosin-actin contacts Fam 26 F c.415_417del p.Glu139del Cap decreased actin affinity, decreased GAG α-helical content in circular

dicroism, adjacent to On state tropomyosin-actin contacts Fam 27 F c.415_417del p.Glu139del Cap decreased actin affinity, decreased GAG CFTD α-helical content in circular dicroism, adjacent to On state tropomyosin-actin contacts

Table 5. Novel and recurrent TPM3 mutations with functional significance. Nucleotide numbering according to the coding sequence of the TPM3 cDNA reference sequence NM_152263.3. The first 2 ATG codons in the primary cDNA were both included according to the Human Genome Variation Society recommendations. Amino acid coordinates are provided relative to NP_689476.2, the ATG translation initiation codon is codon 1. Abbreviations: NM, nemaline myopathy; Cap, cap myopathy; CFTD, congenital fibre type disproportion; CM, undefined congenital myopathy; spl, splice site mutation; # gain-of-function mutation resulting in hypercontractile phenotypes. TPM3 mutations with functional significance Family Patient Mutation(s) Altered protein Diagnosis Functional significance ID, incDNA site and Gender RefSeq predicted effect NM_152263.3 Fam 1 F, M c.11C>T (p.Ala3Val) CFTD head-to-tail binding p.Ala4Val Fam 2 F, M c.26T>G (p.Met8Arg) NM head-to-tail binding p.Met9Arg Fam 3 F c.298C>G (p.Leu99Val) CFTD adjacent to On state p.Leu100Val tropomyosin-actin contacts Fam 4 F c.298C>A (p.Leu99Met) CFTD adjacent to On state p.Leu100Met tropomyosin-actin contacts Fam 5 M c.733A>G (p.Arg244Gly) CFTD decreased Ca2+ sensitivity p.Arg245Gly Fam 6 F c.915A>C (p.Stop284Ser) NM head-to-tail binding int 9 splice p.Stop285Ser mutation Fam 7 F c.857A>C (p.Stop284Ser) CFTD head-to-tail binding p.Stop285Ser Fam 8 F, M c.913delA (p.Stop284Asn NM head-to-tail binding ) p.Stop285Asn extStop74

Recurrent mutations with functional significance Fam 9 F c.503G>A (p.Arg167His) CFTD decreased Ca2+ sensitivity, p.Arg168His decreased myosin cross-bridges bound to actin Fam 10 M c.503G>A (p.Arg167His) CFTD decreased Ca2+ sensitivity, p.Arg168His decreased myosin cross-bridges bound to actin Fam 11 F, M c.503G>A (p.Arg167His) NM decreased Ca2+ sensitivity, p.Arg168His CFTD decreased myosin cross-bridges bound to actin Fam 12 M c.503G>A (p.Arg167His) NM decreased Ca2+ sensitivity, p.Arg168His decreased myosin cross-bridges bound to actin Fam 13 M c.503G>A (p.Arg167His) Cap decreased Ca2+ sensitivity, p.Arg168His decreased myosin cross-bridges bound to actin Fam 14 BOS c.503G>A (p.Arg167His) CFTD decreased Ca2+ sensitivity, 247-4 p.Arg168His decreased myosin cross-bridges F bound to actin Fam 15 BOS c.503G>A (p.Arg167His) NM decreased Ca2+ sensitivity, 343-1 p.Arg168His decreased myosin cross-bridges M bound to actin Fam 16 F c.503G>A (p.Arg167His) CFTD decreased Ca2+ sensitivity, p.Arg168His decreased myosin cross-bridges (RYR bound to actin p.Arg3539His) Fam 17 F c.503G>A (p.Arg167His) CFTD decreased Ca2+ sensitivity, p.Arg168His decreased myosin cross-bridges bound to actin

4.1.2 Recurrent mutations in TPM2 and TPM3 Two recurrent mutations were found in TPM2. The first is p.Lys7del, which was found in 10 families (Davidson et al. 2013, Mokbel et al. 2013, Marttila et al. 2014a). The second one is p.Glu139del, which has been reported in 5 families (Lehtokari et al. 2007, Clarke et al. 2009, Marttila et al. 2014a, Tasca et al. 2013). The amino acid Arg133 in TPM2 is a mutational hotspot. In three unrelated families it is mutated to tryptophan (p.Arg133Trp), and another two unrelated families share the mutation p.Arg133Pro (Tajsharghi et al. 2007a, Marttila et al. 2014a). The p.Arg133Trp mutation caused distal arthrogryposis type 2B in two families, and NM with congenital arthrogryposis and CFTD in one family (Figures 10 and 11, Table 4) (Tajsharghi et al. 2007a, Marttila et al. 2014a). The p.Arg133Trp mutation has been shown to hinder both calcium- and myosin-induced tropomyosin movement over the thin filament, blocking actin conformational changes and consequently decreasing the number of cross- bridges and subsequent force production (Ochala et al. 2010). The p.Arg133Pro mutation has been reported to cause CFTD (Marttila et al. 2014a). The p.Arg168 residue was mutated in 21 families and is the one mutational hotspot in TPM3. The recurrent mutation p.Arg168His was present in 12 families and caused NM, cap myopathy and CFTD (Clarke et al. 2008, Marttila et al. 2014a, Durling et al. 2002, De Paula et al. 2009, Lawlor et al. 2010, Penisson-Besnier et al. 2007). Eight families had the p.Arg168Cys mutation also resulting in NM, cap myopathy and CFTD phenotypes (Clarke et al. 2008, Marttila et al. 2014a). One family had p.Arg168Gly mutation causing CFTD (Clarke et al. 2008, Marttila et al. 2014a)(Table 5). In the fusion process in normal human muscle primary myotubes fuse to form myoblasts fusion determining the length of the muscle fibre and newly created myoblasts fuse with the existing myotubes to generate proper muscle fibres. The p.Arg168Gly mutation in the TPM3 gene delayed and changed the process of fusion, resulting in the feature of hypotrophic Type 1 fibres. The cap structures peripherally located in hypotrophic Type 1 fibres are at the beginning of myoblasts which were not able to align and fuse properly with primary myotubes. The lack of normal TPM3 protein has been suggested to result in modified sarcomere architecture in cap structures (Fidzianska, Madej- Pilarczyk & Hausmanowa-Petrusewicz 2014).

Figure 11. Schematic presentation of β-tropomyosin (Tm2) dimer with disease-causing mutations (shown in red and above the molecules), α-zones (purple) and overlapping regions (separated by lines in N- and C-terminal ends of the molecules). Mutations in the TPM2 are marked in the structure. The green highlight residues interacting with actin Asp25 defined by Li et al (2010). Mutation hotspot Arg133 and recurrent mutations p.Lys7del and p.Glu139del are indicated by black arrows below the sequence. The figure was created using the PyMol software (http://www.pymol.org) and the Protein Databank structure 1C1GA.

4.2 Clinical correlations Congenital myopathy phenotypes can be classified into two types: those that are characterised by congenitally weak muscles and those with congenitally normal or hypercontractile muscles (e.g. DA). Contractility is the major factor altered by mutations in contractile proteins such as tropomyosin. A single mutation in an essential protein can cause a range of phenotypes making the classification of the disorders challenging. This was presented in two articles describing the Lys7del mutation in TPM2 (Davidson et al. 2013, Mokbel et al. 2013). The recognition of any clinical and histological genotype-phenotype correlation is difficult since there is great variability in phenotypes within the 10 families described. Wide phenotypic heterogeneity was also noted in patients with TPM2 (p.Glu139del) and TPM3 mutations (p.Arg168His and p.Arg168Cys) (Citirak et al. 2014). NM, cap myopathy and CFTD are related disease entities with largely overlapping clinical features. DA and Escobar syndrome may be seen as more distinct clinical entities with less overlap with other disorders in the group. Distal contractures may seen in all the disease groups. The disorders are usually relatively stable entities that do not overlap much with other diagnoses. CFTD does not fulfill either of the previous: its main diagnostic feature is present in most other congenital myopathies and the disease often evolves into another one with time. There has been discussion whether CFTD should be regarded as a separate disease entity, but many find it as a useful diagnostic category. The main reason is that it fulfills a clinical need. It provides a diagnosis for a group of patients who do not fall into any other diagnostic category. The concept of CFTD was created soon after the development of the first histolochemical staining methods to analyse the variation in myofibre sizes and proportions that can be associated with neuromuscular disorders. It was a time of rapid advancement in the classification of myopathies (Clarke 2011a). There was no difference in the age at presentation of the disease between patients with mutations in the TPM2 and TPM3. In both, the majority presented perinatally or in infancy, a smaller number in childhood, with delayed motor milestones, and few in adulthood. Nine out

of 53 patients with TPM2 mutations presented with distal arthrogryposis, while this was not present in patients with TPM3 mutations. Patients with recurrent deletion mutation Lys7del along the 5’ end of the gene presented with camptodactyly (2/10), core-rod myopathy (1/10), contractures (4/10) and difficulty opening their mouth (4/10) (Davidson et al. 2013, Mokbel et al. 2013). Nemaline bodies were also present in patients with a diagnosis of DA type 7 (3/3) showing the overlap between phenotypic characteristics of these disease entities. The congenital myopathies are due to mutations in more than one gene and the histological features on muscle biopsies can occur on a spectrum that crosses the boundaries of individual genetic entities (Nance et al. 2012, North et al. 2014). In most families the disease-causing mutations were heterozygous, and the mode of inheritance dominant (89 families). Of the heterozygous mutations, 43 had occured de novo. Few TPM3 mutations were homozygous and these were all found in the beginning or at the end of the gene. Most recessive mutations were nonsense mutations changing an amino acid to a stop codon, yielding a truncated protein or changing the stop codon to give rise to a longer protein. The dominant mutations were mostly missense mutations or in-frame deletions. Among patients with TPM2 mutations, only one was homozygous for a recessive mutation. There was one case of mosaicism associated with a heterozygous TPM2 mutation. In the TPM3 group, four families showed the recessive mode of inheritance, and there was one case of probable mosaicism. Family with autosomal dominant inheritance with cap myopathy in three generations, caused by a novel heterozygous p.Leu149Ile mutation in exon 4 of TPM3 have been recently reported (Schreckenbach et al. 2014). This is described to be the first dominant case of cap myopathy in TPM3. However, we report in our study 5 dominant cases of cap myopathy in TPM3. Most of the cases are due to de novo mutations. Patients included in the present study with various disease entities commonly had type 1 fibre predominance and hypotrophy except for the case of Escobar syndrome. Fibre size disproportion appeared to be consistent among all patients with TPM3 mutations and type 1 hypotrophy is to be expected in patients with TPM3 mutations because of the exclusive expression of Tm3 in type 1 fibres (Perry 2001). However, small type 1 fibres were common also in the group with TPM2 mutations. Caps were more commonly observed in patients with TPM2 mutations than in patients with TPM3 mutations (10/41 versus 5/35). The variable observations of caps and/or nemaline bodies in families and even in individual patients over time (Lehtokari et al. 2007, Tajsharghi et al. 2007b) indicates that cap myopathy is a subcategory of NM. It has also been stated in previous studies that these two disorders are phenotypic variants of the same genetic defect (North et al. 2014, Tajsharghi et al. 2007b, Ohlsson et al. 2006). Patients with hypercontractile molecular phenotypes more often have contractures of the limb joints (18/19) and jaw (6/19) than those who do not have this type of mutation (2/22 and 1/22). Patients with non-hypercontractile molecular phenotypes much more often (19/22) have axial contractures (scoliosis and rigid spine) than the hypercontractile group (7/19). One hypercontractile molecular phenotype was found in TPM3 (p.Lys169Glu). Three TPM3 mutations at the hypercontractile sites are known altogether (unpublished data).

4.3 Genotype-phenotype correlations

4.3.1 Actin affinity for wild type and mutant β-tropomyosins NM is most commonly a disorder of thin filament proteins. To understand the pathogenetic mechanisms underlying NM it is necessary to understand the normal interactions of these proteins. Mutations in the genes encoding various components of the thin filament likely disrupt the orderly assembly of sarcomeric proteins and the functional interaction between the thin and thick filaments during muscle contraction The wt and β-tropomyosins with human disease-causing mutations showed differences when tested for actin binding: p.Lys49del, p.Glu139del and p.Gln147Pro showed significantly weaker affinity for actin than wt and p.Glu117Lys bound actin more strongly. The aberrant β-tropomyosin harbouring mutation p.Glu41Lys did not show any significant change in actin binding (Figure 11).

Figure 11. F-actin co-sedimentation assay (A) with wt β-tropomyosin and β-tropomyosin mutants. The supernatants (S) and pellets (P) were separated, run on SDS/PAGE and Coomassie Blue stained. Molecular masses (in kDa) are given in the centre of each panel. (B) Quantification of actin–Tm co-sedimentation assay. Gels were quantified to determine the mean relative intensities of four independent actin co-sedimentation assays (P/Pwt:S/Swt). Results are means±S.D. of each sample. P values (WT compared with mutant) for the samples are 0.0007, 0.0392, 0.0001, 0.0029, 0.0013 and 0.2417, respectively, using one-tailed distribution and the unpaired Student's t test. *Significant difference from the wt.

The p.Lys7del β-tropomyosin bound filamentous actin with low affinity in vitro. The wt isoforms of β-tropomyosin, α-tropomyosinslow and α-tropomyosinfast, are also available for dimer formation for mutant p.Lys7del in patient muscle and this enables it to incorporate into the sarcomere (Mokbel et al. 2013). This is also probably the case with p.Lys49del, p.Glu139del and p.Gln147Pro mutants with highly reduced affinity for filamentous actin in vitro. Mutations in patients with chronic generalized muscle weakness have generally resulted in reduced affinity of the mutant β-tropomyosin for actin, reduced myofilament Ca2+ sensitivity or impaired cross-bridge cycling (Ochala et al. 2008, Mokbel et al. 2013).

4.3.2 Tropomyosin-actin contacts Since many of the tropomyosin mutants altered actin affinity in our previous study (Marttila et al. 2012), we wanted to correlate the actin-tropomyosin interphase of newly discovered actin residues with those proteins altered by known the disease mutations. Tropomyosin forms contacts with actin through positively charged basic residues in the N-terminal part of an α-zone and acidic residues on the C-terminal side of an α-zone in the relaxed Off state. Tropomyosin interaction sites with actin in the Off state were precisely mapped by Li and co- workers using electron microscopy and fibre diffraction studies of reconstituted F-actin- tropomyosin filaments (Li et al. 2011). All 7 tropomyosin actin-binding repeats are predicted to interact with actin p.Asp25. A TPM2 mutation, p.Lys128Glu, and TPM3 mutations p.Arg91Pro/Cys, the hot-spot p.Arg168Cys/Gly/His and p.Arg245Gly/Ile all reside at one of these tropomyosin interaction sites. Gain-of-function mutations that increase contractility are located in the amino acid next to the Tm actin binding site: p.Lys7del, p.Lys49del and p.Arg91Gly in TPM2 and p.Lys169Glu in TPM3 (Memo, Marston 2013). Two acidic amino acids in each actin-binding repeat of tropomyosin, separated by 2-3 amino acids at the end of an α-zone, interact with actin amino acids 147, 326 and 328. Disease-causing mutations are found affecting only the first acidic amino acid and both are gain-of-function mutations: TPM2 p.Glu139del and p.Glu181Lys (Li et al. 2011, Memo, Marston 2013). Tropomyosin- actin interaction sites in the Off state were also studied using mutagenesis (Barua, Pamula & Hitchcock-DeGregori 2011, Barua et al. 2012). The recently reported p.Leu149Ile mutation in TPM3 causing cap myopathy is next to the site of predicted actin contacts (Schreckenbach et al. 2014, Barua et al. 2012). The mutations in TPM2 and TPM3 resulting in congenital myopathies and their correlating actin contacts are summarised in tables 6 and 7 (unpublished data). It has been suggested that tropomyosin-actin binding, myosin cross-bridge formation and force production are the main pathogenetic mechanisms in tropomyosin-caused congenital myopathies (Ochala et al. 2012b). This is supported by our results since most mutations are found in regions important for tropomyosin-actin interaction.

Table 6. The mutations in TPM2 resulting in congenital myopathies and their correlating actin contacts. TPM2 mutation Reference Corresponding Reference actin/(TnT) binding residue K7del Mokbel et al. 2012 K6 Barua et al. 2011 D14V Marttila et al. 2014a K15N Behrmann et al. 2012 K49del Ohlsson et al. 2008 K48 Barua et al. 2011 S61P Clarke et al. 2012 E62 Barua et al. 2011 R91G Sung et al. 2003 R90 Barua et al. 2011 E117del Donner et al. 2002 K118 Barua et al. 2012 Brandis et al. 2008 E122K Tajsharghi et al. D121, E122 Barua et al. 2012 2012 K128E Marttila et al. 2014a K128 Barua et al. 2011 Li et al. 2011 R133W Tajsharghi et al. S132 Li et al. 2011 2007 R133P Marttila et al. 2014a S132 Li et al. 2011 E139del Lehtokari et al. 2007 E139 Barua et al. 2011 Marttila et al. 2012 Li et al. 2011 L148P Marttila et al. 2014a E150 Barua et al. 2012 A155T Marttila et al. 2014a E156 Barua et al. 2012 A155V Clarke et al. 2012 E156 Barua et al. 2012 E181K Jarraya et al. 2012 E181 Li et al. 2011 N202K Ohlsson et al. 2008 N202 Barua et al. 2011 Q210X Monnier et al. 2009 K213 Barua et al. 2011 E218del Marttila et al. 2014a D219 Barua et al. 2011 Y261C Marttila et al. 2014a A262 TnT Murakami et al. 2008

Table 7. The mutations in TPM3 resulting in congenital myopathies and their correlating actin contacts. TPM3 mutation Reference Corresponding Reference actin/(TnT) binging site M8R Laing et al. 1995 F86 TnT Murakami et al. 2008 R90P Lawlor et al. 2010 R90 Barua et al. 2011 R90C Marttila et al. 2014a R90 Barua et al. 2011 L99M (L100M) Clarke et al. 2008 E97 Barua et al. 2011 L99V Marttila et al. 2014a E97 Barua et al. 2011 A155T Kiphuth et al. 2010 E156 Barua et al. 2012 R167C (R168C) Clarke et al. 2008 R167 Barua et al. 2011 R167G (R168G) Clarke et al. 2008 R167 Barua et al. 2011 R167H (R168H) Clarke et al. 2008 R167 Barua et al. 2011 Durling et al. 2002 Penisson-Besnier et al. 2007 De Paula et al. 2009 Lawlor et al. 2010 Marttila et al. 2014a R168E (R169E) Clarke et al. 2008 R167 Barua et al. 2011 E240K (E241K) Lawlor et al. 2010 E240 Barua et al. 2011 R244G (R245G) Clarke et al. 2008 R244 Barua et al. 2011 R244I (R245I) Marttila et al. 2014a R244 Barua et al. 2011 T253K Marttila et al. 2014a D254 Barua et al. 2011

Tropomyosin moves relative to the actin filament and myosin contacts are formed in the ‘On’ state (Behrmann et al. 2012). The ‘On’ state tropomyosin-actin contacts are less well characterised and tropomyosin may simply be pushed into its position by strong myosin-actin binding. Only few disease-causing mutations are adjacent to the proposed ‘On’ state tropomyosin-actin binding sites: the TPM2 mutations p.Asp14Val, p.Glu139del, p.Glu218del and the TPM3 mutations p.Leu100Met/Val. Two highly conserved interface residues (Asp137 in a d position and Glu218 in an a position of the heptad repeat) that cause bends in the molecule (Brown et al. 2005) are in α-zones 4 and 6, respectively (Barua et al. 2013). The Asp137 is in close proximity of the recurrent mutation p.Glu139del in TPM2. The second one Glu218 is the site for deletion (p.Glu218del) in a patient with no clinical details available. In addition to actin contacts, these mutations affect the bending of the molecule which has been proven to be important for the function. They are likely involved in tropomyosin's interactions with F-actin (Brown et al. 2005). The other prime protein to interact with tropomyosin is

troponin T (TnT). TPM2 mutation p.Tyr261Cys and in TPM3 p.Met9Arg are involved in the interaction with TnT according to Murakami’s structure of TPM2 (Murakami et al. 2008). Tropomyosin head-to-tail polymerization is required for actin binding, and has a role in actin filament assembly, and for the regulation of actin-myosin contraction (Murakami et al. 2008). TPM2 mutations p.Ala3Gly, p.Lys7del and TPM3 mutations p.Ala4Val, p.Met9Arg and p.Stop285Ser/Asn are found at the overlapping region involved in head-to-tail polymerization. A similar function has been proposed for the p.K7del mutant in previous studies. The N-terminal lysine residues partisipate in the head-to-tail bond between adjacent tropomyosin molecules and thus the p.K7del mutation is predicted to affect the ability of β- tropomyosin to polymerize into long filaments (Mokbel et al. 2013). The p.K7del mutation has been predicted to disrupt the N-terminus of the α-helices of dimeric β-tropomyosin, altering protein-protein interactions between β-tropomyosin and other molecules and to disturb head-to-tail polymerization of β-tropomyosin dimers (Davidson et al. 2013). The charge changes in most hypercontractile mutations are hypothesized to destabilise the Off state and favour the equilibrium towards the On state, thus accounting for the higher Ca2+-sensitivity as was demonstrated for the ACTA1 p.Lys326Asn mutation (Orzechowski, Fischer & Lehman 2013). This is shown by the TPM2 mutations p.Lys7del, p.Lys49del, p.Arg91Gly, p.Glu139del and p.Glu181Lys, and the TPM3 mutation p.Lys169Glu. This correlates with hypercontractile or DA phenotypes which are p.Lys7del, p.Arg91Gly, p.Arg133Trp and p.Glu181Lys. Congenital muscle weakness correlates with loss of function at the molecular level. These mutations are not at the interface of the Off state but have an opposite charge change to the gain-of-function mutations and are in a location that could stabilize the Off state relative to the On state. This may account for the loss of function. Alteration of the tropomyosin-troponin interface could also have this effect. Mutations shown causing decreased Ca2+ sensitivity include TPM2-Glu41Lys, TPM2-Glu117Lys, TPM3- Arg168His and TPM3-Arg245Gly (Figure 12). There is no apparent correlation between conventional disease classification and the gain-of-function molecular phenotype, although there were some correlations with the clinical picture caused by hyper- and hypocontractile diseases. Among the seven mutations investigated, diagnoses include NM, cap myopathy, CFTD, core-rod myopathy and DA. When muscle histology provides no clues about the basis of the myopathy, consideration of muscle contractility is more predictive, especially for the gain-of-function mutations (Marston et al. 2013). This was carefully investigated for the p.Lys7del mutation. Some patients were re-diagnosed taking into account the contractility measurements (Mokbel et al. 2013). Four reported mutants in troponins and β-tropomyosin were analysed: Arg63His TnT, Arg91Gly β- tropomyosin, Arg174Gln TnI, and a TnI truncation mutant (Arg156ter). Thin filaments, reconstituted using actin and wt troponin and β-tropomyosin, activated myosin subfragment-1 ATPase in a calcium-dependent, cooperative manner. Thin filaments containing a troponin or β- tropomyosin DA mutant produced significantly enhanced ATPase rates at all calcium concentrations without alternating Ca2+ sensitivity or cooperativity. In troponin-exchanged skinned fibres, each mutant caused a significant increase in Ca2+ sensitivity. It was proposed that the mutations cause increased contractility of developing fast-twitch skeletal muscles, thus causing muscle contractures and the development of the observed limb deformities

(Robinson et al. 2007). These troponin mutations also show the hypercontractile molecular phenotype. There are all together 18 mutations at or close to tropomyosin actin binding residues in TPM2 (Table 6) and 13 mutations in TPM3 (Table 7) genes. In addition to that both genes have one mutation situated at the TnT binding site (Tables 6 and 7). This indicates that perturbations in the interactions of the proteins in the sarcomere is an important disease mechanism in congenital myopathies. We conclude that most of the disease causing mutations show association with actin binding residues in α- and β-tropomyosin.

Figure 12. On-state actin-tropomyosin contacts and disease mutations. The Tm2 (β-Tm) sequence and the Tm3 (γ-Tm) sequence divided into the α- and β-bands as defined by Mclachlan and Stewart (1976). The purple circles highlight residues interacting with actin Asp25; the orange circles highlight the residues interacting with actin R147, K326 and K328 as defined by Li et al (2010). The Tm2 mutations are written above the sequence. The mutations increasing Ca2+-sensitivity are written in green, while those decreasing it are in black. Tm overlapping regions are shown by light blue boxes.

4.4 Identification of novel phosphorylation sites in β-tropomyosin To study the potential role of tropomyosin phosphorylation on pathogenesis, we performed mass spectrometry analyses on purified recombinant tropomyosin, both wt β-tropomyosin and proteins containing known patient mutations (p.Glu41Lys, p.Lys49del, p.Glu117Lys, p.Glu139del and p.Gln147Pro). In addition to four known phosphorylation sites (p.Thr53, p.Thr252, p.Thr282 and p.Ser283) that were present in both the wt and the mutated proteins (Dai et al., 2007; Huttlin et al., 2010), we identified four novel phosphorylation sites (p.Thr79, p.Thr108, p.Ser158 and p.Ser206). The previously unknown phosphorylation sites are situated in the mid-region of β-tropomyosin around the mutational hotspot in or near the fourth α-zone. The phosphorylation patterns were identical between the wt and the mutated proteins, indicating that changes in phosphorylation patterns are not the main cause of disease for the mutations studied. Also, no patient mutations have been found in the phosphorylated residues in β-tropomyosin and α-tropomyosin (Table 8).

Table 8. Phosphorylation sites in β-tropomyosin (Tm2). The novel sites were found in both wild type Tm2 and five mutants, Glu41Lys, Lys49del, Glu117Lys, Glu139del and Gln147Pro. IS represents the ion score in the Mascot search and the threshold value 40 was chosen.

Human Mouse Present study Site Reference Site Reference Known IS Novel IS site site T53-P www.phosphosite.org S87-P Huttlin, E.L. 2010; T53-P 46 T79-P 69 Hsu, P.P. 2011 S63-P www.phosphosite.org Y162- www.phosphosite.org T252-P 59 T108- 60 P P S87-P Brill, L.M. 2009 T252- Dai, J. 2007 T282-P 74 S158- 58 P P Y162-P Rikova, K. 2007 Y261- www.phosphosite.org S283-P 48 S206- 56 P P Y261-P Iliuk, A.B. 2010 T282- Dai, J. 2007; Huttlin, P E.L. 2010 S283- Dai, J. 2007; P Zanivan, S. 2008; Huttlin, E.L. 2010

Phosphorylation has been shown to have an impact on tropomyosin function: it enhances head-to-tail interaction of neighbouring tropomyosin dimers and increases binding to troponin T (Heeley et al. 1989, Hayley et al. 2008). There are conflicting results for the effect of phosphorylation on the activation of thin filaments by Ca2+. In studies on muscle fibres with thin filament replacement, cooperativity was not significantly affected, but in fluorescence studies phosphorylation was shown to slow relaxation of Ca2+ activated force (Heeley 2013). Transgenic animal models have revealed a possible connection between heart disease and

phosphorylation. Mice expressing tropomyosin mutants p.Glu54Lys and p.Asn175Asp showed altered levels of phosphorylation compared with controls (Muthuchamy et al. 1999, Warren et al. 2008).

4.5 Functional analysis by in vitro motility assay In vitro motility assay (IVMA) analyses the movement of fluorescently labelled thin filaments over a bed of immobilized heavy meromyosin (Fraser, Marston 1995). Thin filaments were constracted using rabbit skeletal actin and troponin, together with the baculovirus-expressed wt or mutant β-tropomyosin homodimers. It was observed with wt thin filaments that both the speed of filament sliding over myosin and the fraction of filaments that are motile are regulated by Ca2+. The troponin–tropomyosin complex inhibits the movement of thin filaments under relaxing conditions (Ca2+ ~ 10−9 M) so that the fraction motile is 10% or less. At activating Ca2+ concentrations (3.5 μM) at least 80% of filaments are motile, like actin alone. The sliding speed also increases 2-fold between relaxing and activating Ca2+ concentrations. When mutant β-tropomyosin p.Lys49del, p.Glu139del and p.Gln147Pro were incorporated into thin filaments, it was found that motility was not switched off in low Ca2+ even with high tropomyosin concentrations. Thin filaments with the wt β-tropomyosin switched off at the standard tropomyosin concentration indicating that the abnormal function was due to the mutation in tropomyosin. The β-tropomyosin mutants p.Lys49del, p.Glu139del and p.Gln147Pro appeared to have a lower affinity for actin compared with the wt. This was also indicated by the direct measurements in actin binding experiments. Thin filaments containing the β-tropomyosin mutations p.Glu41Lys and p.Glu117Lys that bound strongly to actin were able to regulate the filaments, with low Ca2+ concentration causing a complete switch off of their motility. Another study of the proposed gain-of-function mutations, i.e. a mutation that changes the gene product such that it gains a new and abnormal function (p.Lys49del, p.Arg91Gly, p.Glu139del and p.Lys169Glu), produced a higher Ca2+ sensitivity and a higher maximum sliding speed (Marston et al. 2013). This was also the case with the previously investigated gain-of-function mutations p.Lys7del (Mokbel et al. 2013) and p.Glu181Lys (Ochala et al. 2012b). In contrast, skeletal muscle myopathy mutations (p.Glu41Lys and p.Glu117Lys in β- tropomyosin and p.Arg168His and p.Arg245Gly in γ-tropomyosin encoded by TPM1) that were expected to give a hypocontractile phenotype showed lower Ca2+ sensitivity and lower sliding speed (Marston et al. 2013). Pharmacological modulators of TnC, also called Ca2+ sensitizers, have been tested in vitro and in vivo for heart disease. They have been proven to minimize the effect of cardiac contractile dysfunction by restoring the impaired cell Ca2+ sensitivity. The molecular mechanisms behind Ca2+ sensitizers are variable, for example binding to troponin C prolonging the time perioid of the open state. This stabilizes the Ca2+ induced conformation of the troponin complex, increasing force generation capacity in cardiac muscle (Ochala 2010). These agents may potentially be useful also for other patients with mutations causing decreased Ca2+ sensitivity.

4.6 Mass spectrometry and three-dimensional models Two of the purified β-tropomyosin samples run on SDS/PAGE gels (p.Lys49del and p.Glu139del) showed slower migration than the wt and other mutant proteins. To find out wether the difference in migration could be due to post-transcriptional modifications, in-gel digestion of the proteins was used followed by LC-MS/MS analysis of the resulting peptides. The mass-spectrometric database (http://www.phosphosite.org) contained eight phosphorylation sites that had been found in mouse and human tropomyosin. Four novel phosphorylation sites were found in addition to previously identified ones. They were present in all samples including the wt. No other significant differences in peptide mass were found. The protein modifications caused by the mutations and the N-terminal acetylation of the tropomyosins known to be important in head-to-tail binding (Perry 2001) were verified using LC-MS/MS. Post-transcriptional modifications were not found to be the reason for the difference in migration. Instead, the reason appeared to be a change in the secondary structure conformation of the p.Lys49del and p.Glu139del mutants, as was previously found with the p.Asp175Asn mutation in α-tropomyosin (Bottinelli et al. 1998). Confirmation that the aberrant migration of the recombinant p.Asp175Asn α-tropomyosin protein reflects the impact of only the single residue substitution was proven in identical observations on SDS- PAGE electrophoresis of recombinant wt and p.Asp175Asn mutant chicken α- tropomyosin (Bottinelli et al. 1998). Therefore, in this study three-dimensional models of the differentially migrating mutants were created. The molecular models created showed that α-helical conformation was changed in the p.Lys49del and p.Glu139del mutants compared with wt structure. The p.Glu41Lys mutant was used as comparison to show that not all mutants result in gross effect on the secondary structure (Figure 13).

Figure 13. Structural alignments of wt and mutant tropomyosin using the Discovery Studio 2.1 program. The mutations K49del (A), E139del (B and C) and E41K (D) were made in rat Tm2 (P58775.1) and were superimposed over the wt structure 1C1GA (A, C and D) or 2B9CA (B). 2B9CA was used as it provided a better resolution. Amino acids before deletions are marked in deletion mutants and E41 in E41K. Amino acids used in comparison are shown. Modified from Biochem J. 2012 15;442(1):231-9 with permission from the Biochemical Society.

4.7 Circular dichroism spectra of β-tropomyosin To further study the structures of the mutant proteins, and the effect of disease causing mutations on overall secondary structure, circular dichroism (CD) spectra were produced. At +20°C all recombinant tropomyosin proteins showed CD spectra characteristic of α-helical proteins, featuring a minimum at 222 and 208 nm and a maximum at 190 nm. At +20°C wt tropomyosin had a calculated α-helical content of 97.3±2.8%. E117K, which shows increased actin binding, displayed an α-helical content higher than that of the wt (99.8±0.2%). Two of the mutant proteins displayed lower calculated α-helical content: E139del (79.5±0.7%) and K49del (84.6±3.1%), which also showed aberrant migration on SDS-PAGE. At +37°C wt and mutant tropomyosin proteins also displayed CD spectra characteristic of α-helical proteins. wt tropomyosin was calculated to be 81.9±1.8% α-helical, whereas the Q147P and p.Glu117Lys showed the highest α-helical contents (88.3±0.8% and 87.9±4.3% respectively). The lowest α-helical contents were seen with the K49del and E139del mutants (65.0±1.6% and 68.2±1.2% respectively). At both of the temperatures used, K49del and E139del displayed lower α-helical content than wt tropomyosin. p.Glu117Lys showed higher α-helical content than wt at both temperatures and Q147P at +37°C (Figure 14). The circular dichroism was used to investigate the secondary structure of p.Lys7del mutant. The results indicate that p.Lys7del and wt β-tropomyosin are folded in solution and are predominantly α-helical. The secondary structure of p.Lys7del mutant was not changed by the mutation (Mokbel et al. 2013). This shows that not all the mutations, even as deleterious as a deletion, have an impact on the secondary structure of β-tropomyosin.

Figure 14. Circular dicroism (CD) spectra (250–190 nm) of tropomyosins measured at 20°C and 37°C. Modified from Biochem J. 2012 15;442(1):231-9. Modified from Marttila et al. 2012 Biochem J. 15;442(1):231-9 with permission from the Biochemical Society.

4.8 Nebulin interactions with actin and tropomyosin We wanted to study the function of nebulin mutations causing NM and distal myopathy. In this study nebulin mutations causing NM and distal myopathy were investigated on their ability to bind actin and tropomyosin. Due to the enormous size of nebulin, functional studies of full-length nebulin are difficult and we opted for studying protein domains (super repeats) with introduced mutations.

4.8.1 Nebulin-actin affinity Super repeat 9 of nebulin containing the p.Glu2431Lys (exon 54, c.7291G>A) mutation, and nebulin super repeat 9 lacking 35 amino acids due to deletion of the entire exon 55 (p.Arg2478_Asp2512del, c.7431+1916_7536+372del), showed consistently reduced affinity for F-actin compared with the wt fragments, but the reduction was not statistically significant using the Kruskal-Wallis test. The p.Ser6366Ile (exon 122, c.19097G>T) mutation in super repeat 18 at an actin-binding site showed increased actin affinity (P=0.048). Super repeat 14 containing an in-frame deletion of six amino acids (exon 78, p.Val3924_Asn3929del) and 22 containing the p.Thr7382Pro (exon 151, c.22144A>C) mutation did not show any change in affinity for actin compared to the wt fragments (Figure 15).

Figure 15. Mutations affect nebulin binding to F-actin. Nebulin protein domains were incubated with F-actin and centrifuged. Pellet and supernatant fractions were separated, run on SDS-PAGE gels and stained with Coomassie Blue. The relative intensity of nebulin protein in the pellet was quantified from three independent experiments. The mean value and standard deviations from three experiments are shown in the bar chart to the left, and gel pictures of representative experiments are shown to the right. Nebulin domains containing the mutation p.Ser6366Ile (ex122m) showed significantly increased actin affinity (P value 0.048). P values were calculated using the Kruskal-Wallis test when comparing three groups (S9) and the Mann-Whitney test when comparing two groups (S14, S18, S22). Asterisks mark significant differences compared with the wt protein. Modified from Marttila et al. 2014 Skeletal Muscle 1;4:15.

The mutation p.Glu117Lys was found to have stronger affinity for actin than wt β- tropomyosin. Tighter binding was speculated to result in the sarcomeric proteins remaining in the thin filaments and the Z disc, and not forming nemaline bodies (Marttila et al. 2012). The contractile deficiency at the level of the troponin switch parallels that previously reported for CFTD mutations (Clarke et al. 2007). Immunofluorescence confocal microscopy studies on mice with nebulin exon 55 deleted revealed that thin filament length is significantly reduced (Ottenheijm et al. 2013). This is one of the pathogenetic mechanisms causing severe muscle weakness in exon 55 deleted mice. In our study the affinity for F-actin was consistently reduced, but was not shown to be statistically significant. Nebulin fragments used in the binding experiments are easily degradable resulting in great deviation between the results but they all showed reduced affinity to F-actin. With more replication of the experiments, the statistical power would have been increased and we could perhaps have been able to prove that reduced actin affinity would be the other pathogenetic factor in the disease process.

4.8.2 Nebulin-tropomyosin affinity We tested nebulin affinity to tropomyosin using four wt nebulin super repeats (9, 14, 18 and 22) and wt α- and β-tropomyosins. All four nebulin super repeats bound to tropomyosin with high affinity. This is the first direct evidence that there is a tropomyosin binding motif in these super repeats of nebulin (Marttila et al. 2014b). Super repeat 9 containing the p.Glu2431Lys mutation consistently showed higher affinity for tropomyosin but this was not shown to be statistically significant. The in-frame deletion of exon 55 (p.Arg2478_Asp2512del) in super repeat 9 and the in-frame deletion p.Val3924_Asn3929del in super repeat 14 showed slight, but not statistically significant, increase in affinity for tropomyosin. Super repeat 18 containing the p.Ser6366Ile mutation displayed similar affinity for tropomyosin as wt fragments. The nebulin exon 151 containing super repeat 22 with the missense mutation p.Thr7382Pro showed greatly reduced affinity for tropomyosin compared with the wt protein fragment (P=0.039) (Figure 16). Proline is not present in any wt β-tropomyosin or in coiled-coil proteins in general, as it produces a kink in the coiled-coil helix (East et al. 2010). The β-tropomyosin mutant p.Gln147Pro bound actin significantly weaker than the wt β-tropomyosin, which is to be expected with the disruption of the continuous α-helix (Marttila et al. 2012). Since the nebulin repeat regions have been shown to have transient α-helical conformations (Pfuhl, Winder & Pastore 1994), the p.Thr7382Pro mutation could similarly disrupt the structure in nebulin.

Figure 16. Nebulin mutations affect binding to tropomyosin. Purified GST-nebulin domains bound to beads were incubated with purified α- and β-tropomyosin, beads were washed and bound proteins run on SDS-PAGE gels and stained with Coomassie Blue. The relative intensity of bound α- and β- tropomyosin was quantified from three independent experiments. The mean value and standard deviations from three experiments are shown in the bar chart on the left and gel pictures of representative experiments are shown on the right. Nebulin domains containing the p.Thr7382Pro (ex151m) mutation showed significantly lower affinity to tropomyosin than wt proteins (P value 0.039). P values were calculated using the Kruskal-Wallis test when comparing three groups (S9) and the Mann-Whitney test when comparing two groups (S14, S18, S22). Asterisks mark significant differences compared with the wt protein. Modified from Marttila et al. 2014 Skeletal Muscle 1;4:15.

When testing the affinity of wt nebulin super repeats for wt and six β–tropomyosin mutants (p.Lys7del, p.Glu41Lys, p.Lys49del, p.Glu117Lys, p.Glu139del and p.Gln147Pro) nebulin super repeat 18 containing the wt exon 122 consistently showed slightly reduced affinity for the β-tropomyosin Glu41Lys mutant, but using the Kruskal-Wallis test this was not shown to be statistically significant. The other mutant tropomyosins did not show significant changes in binding affinity for wt nebulin compared with wt tropomyosin (Figure 17).

Figure 17. Nebulin wt super repeat domain affinity for mutant tropomyosins. Purified GST-nebulin domains bound to beads were incubated with purified α- and β-tropomyosin, beads were washed and bound proteins run on SDS-PAGE gels and stained with Coomassie Blue. The relative intensity of bound α- and β-tropomyosin was quantified from three independent experiments. The mean values and standard deviations from three experiments are shown in the bar chart to the left, and gel pictures of representative experiments are shown on the right. No statistically significant differences in binding affinities were found. Modified from Marttila et al. 2014 Skeletal Muscle 1;4:15.

The mechanical studies using skinned muscle fibres revealed that NEB knockout mice fibres had increased tension cost and reductions in calcium sensitivity and cooperativity of activation. The findings indicate that in skeletal muscle, nebulin increases thin filament activation, and through altering cross-bridge cycling kinetics, nebulin increases the force and efficiency of contraction (Chandra et al. 2009). In nebulin exon55del mice it has been shown that regulation of contraction is impaired by marked changes in crossbridge cycling kinetics and by a reduction of the calcium sensitivity of force generation (Ottenheijm et al. 2013). It would be interesting to test whether any of the other nebulin mutations (p.Val3924_Asn3929del, c.7291G>A, c.19097G>T, c.22144A>C) would have such effects. Cardiac α-actin over-expression therapy worked for some mutations in ACTA1 causing NM (Ravenscroft et al. 2013a). This would not be easily applied to nebulin caused NM due to the large size of the gene. The X-ray diffraction patterns of human membrane-permeabilized single muscle fibres expressing nebulin mutations g.6357dupT and g.47420A>C were recorded and analyzed. Results demonstrated that, during contraction, the cycling rate of myosin heads attaching to actin was dramatically perturbed, causing a reduction in the fraction of myosin-actin interactions in the strong binding state. This reduces the force-generating capacity and provokes muscle weakness (Ochala et al. 2011). Fast skeletal muscle troponin activator CK- 2066260, has been investigated as a potential therapeutic agent of nebulin-caused NM. Nebulin protein concentrations were severely reduced in muscle cells from patients treated with the troponin activator compared with controls, while myofibrillar ultrastructure was largely preserved. Both maximal active tension and the calcium-sensitivity of force generation were lower in patients compared to controls. CK-2066260 greatly increased the Ca2+ sensitivity of force generation without affecting the cooperativity of activation in patients, to

levels that exceed those observed in untreated control muscle. This implies that CK-2066260 could be used as a therapeutic agent for NM caused by nebulin, but further studies are needed (de Winter et al. 2013). Recent advances in research show that abnormal excitation-contraction coupling may be a common phenomenon in the congenital myopathies, either as a result of malformed contractile filaments in the NMs or disruption of Ca2+ homeostasis at the level of the triad in the centronuclear/myotubular and core myopathies (Nance et al. 2012). Our results suggest that the disease-causing mutations have a great impact on the structure and function of the thin filaments.

4.9 Conclusions and future prospects We show that most TPM mutations affect actin association (18/30 in TPM2, 13/20 in TPM3), causing NM, cap myopathy, core-rod myopathy, CFTD, CM, DA and Escobar syndrome with myopathy. Six mutations resulted in increased Ca2+ sensitivity and hypercontractile phenotypes. Amongst the remaining mutations, all 5 so far tested caused decreased Ca2+ sensitivity. Three of the TPM2 and four of the TPM3 mutations were located in the tropomyosin overlapping region affecting head-to-tail binding. We report 4 novel phosphorylation sites in β-tropomyosin. Although phosphorylation is known to be linked to tropomyosin-actin association, we found no mutations in phosphorylated residues, nor altered phosphorylation patterns in purified tropomyosin proteins containing known patient mutations. There was no clear relationship between conventional disease classification and the gain- of-function phenotype but there were clinical correlations with hypercontractile versus non- hypercontractile molecular phenotypes. In many cases the muscle histology does not provide clear cut diagnosis because of the overlap in muscle histology. Patients with TPM2 mutations tended to present with milder symptoms than those with TPM3 mutations and DA was present only in the TPM2 group. Recessive disease was usually more severe than the dominantly inherited forms. FSD was consistent in the TPM3 group and common also with mutations of TPM2. Patients with hypercontractile molecular phenotypes more often had contractures of the limb joints and jaw than those with non-hypercontractile molecular phenotypes, while those with no hypercontractility more commonly had spinal deformities or rigidity. There was no difference in age of onset. In the study of tropomyosin-actin affinity, actin binding was weak in three of five mutants suggesting that abnormal binding between actin and aberrant tropomyosin is the pathogenetic mechanism causing muscle weakness in these patients. Ca2+ activation of contractility was defective in the two other mutants, suggesting an alternative cause of contractile dysfunction. In future studies, human tissue cultures could be used for studying the early stages of altered myofibrillogenesis and morphological changes linked to myopathy- related tropomyosin mutants. The X-ray diffraction patterns of human membrane permeabilized muscle cells expressing β-tropomyosin mutation p.Glu41Lys were measured. The results indicated that, in the presence of the p.Glu41Lys β-tropomyosin mutation, the myofilament lattice geometry is well maintained and therefore may not have any detrimental influence on the contraction

mechanisms. The X-ray diffraction pattern investigations could be broadened to other β- tropomyosin mutations used in our studies (p.Lys49del, p.Glu117Lys, p.Glu139del and p.Gln147Pro), which exhibited changes in their 3D structure (p.Lys49del and p.Glu139del) and Ca2+ sensitivity (p.Glu117Lys). The last study demonstrates the results of nebulin-actin and nebulin-tropomyosin interactions in vitro, and shows that mutations in nebulin and tropomyosin can alter these interactions. Both actin and tropomyosin binding affinity was affected by nebulin mutations. This suggests that abnormal interaction between aberrant thin filament proteins is a pathogenetic mechanism in NM and related disorders. However, we only studied nebulin superrepeats 9, 14, 18 and 22 and five disease mutations in these domains. There are currently 211 mutations known in nebulin. In the future it would be interesting to study the interactions of more disease mutations with actin and tropomyosin to see how common aberrant binding of thin filament proteins is as a disease mechanism. The protein interaction studies could include additional proteins such as the pointed-end capping protein tropomodulin and the troponins. The phosphorylation studies could be broadened to include nebulin, since phosphorylation has been shown to be critical for normal cardiac telethonin function. We could also use X-ray diffraction studies to investigate the effect of further mutations on contractility. Improving our understanding of the mechanisms underlying muscle weakness in patients with NM, mouse or zebrafish models that harbour mutations in nebulin found in patients should be further developed. Our studies have added to the knowledge of the pathogenetic mechanisms underlying congenital myopathies caused by mutations in the tropomyosin and nebulin genes. In addition we have collected the known and novel mutations in the TPM2 and TPM3 genes and presented genotype-phenotype correlations.

5 Acknowledgements Väitöskirja tehtiin Folkhälsanin tutkimuskeskuksen perinnöllisyystieteen laitoksella ja Helsingin yliopiston lääketieteellisen tiedekunnan lääketieteellisen genetiikan osastolla. Kiitos laitosten professoreille Anna-Elina Lehesjoelle ja Päivi Peltomäelle ensiluokkaisen tutkimusympäristön tarjoamisesta.

Haluan kiittää väitöstilaisuuden kustosta professori Minna Nyströmiä ja väitöskirjan esitarkastajina toimineita dosentti Jukka Moilasta ja dosentti Pirta Hilpelää. Haluan myös kiittää Vanessa Fulleria tehokkaasta kielentarkastuksesta.

I am grateful for help in collaborative efforts and in writing articles for colleagues world wide. Especially I would like to thank Professors Steven Marston, Nigel Clarke, Nigel Laing, Kristen Nowak and Nicole Monnier.

Olen kiitollinen taloudellisesta tuesta jonka olen saanut väitöskirjalleni säätiöiltä: The Association Francaise contre les myopathies, Suomen Akatemia, Sigrid Juséliuksen säätiö, Finska läkaresjällskapet ja Medicinska understödsföreningen Liv och Hälsa.

Haluan kiittää Madeleine Avellania, Jaana Wellinia ja Marjatta Valkamaa käytännön asioiden hoitamisesta.

Kiitän väitöskirjan ohjaamisesta ja joustavuudesta dosentti Carina Wallgren-Petterssonia ja dosentti Mikaela Grönholmia. Carinan kansainväliset suhteet ovat olleet tärkeässä osassa artikkeleiden kokoamisessa ja Mikaela on tuonut kokouksiimme asiantuntemusta proteiinitekniikoista. Haluaisin kiittää myös Katarina Peliniä loppumetrien helpottamisesta ja korvaamattomasta avusta väitöskirjan kirjoituksen aikana. Tuula Nymanille kuuluu kiitos fosforylaatiotuloksista.

Haluan kiittää entisiä ja nykyisiä nemaliinimyopatiaryhmäläisiä. Kiitos rennosta työilmapiiristä menee Vilmalle, Elinalle, Mubashirille, Ferille, Liinalle, Pauliinalle, Maria LH:lle, Marilotalle, Jennille ja Kirsille. Elinalle erityiskiitos proteiinien tuotosta Viikissä ja reippaasta asenteesta tutkimukseen.

Kiitos kuuluu myös Folkhälsanin työkavereille Annalle, Saaralle, Marialle, Kristiinalle, Jaakolle, Ph:lle, Anni L:lle, Anni E:lle Ann-Lizille, Tarjalle, Outille, Helenalle, Edulle, Inkenille, Merville, Peterille, Olesyalle, Otolle, Hannalle, Jannelle, Jukalle, Markulle, Minnalle, Merjalle, Katarinille, Paulalle ja Teijalle. Sekä kaikille niille, jotka olen tahattomasti unohtanut.

Haluan kiittää naapureitamme tapaamisista ja seurasta: Tiina, Touko, Sari, Mika, Leena, Ari Pekka, Minna, Marko, Pauliina, Virpi ja Martti. Tiinalle ja Toukolle kiitos lähikoulumme puolesta taistelusta, Sarille ja Mikalle Emman kyläilyistä/yökylistä, Pauliinalle Venlan kyläilyistä, Leenalle ja Ari Pekalle luontoelämyksistä ja Virpille ja Martille mökkireissusta.

Piristävästä seurasta perheineen ja aikuisten kesken haluan kiittää ystäviäni Elliä, Terenceä, Karinea, Joea, Tinkaa, Annia, Teroa, Petraa ja Satua. Maijalle, Sophille ja kaksosille terveiset

New Yorkiin. Tinkalle kiitos avusta väitöskirjan kuvien kanssa ja Joelle ja Karinelle toivottavasti musiikista.

Haluan kiittää mieheni perhettä lukuisista juhlista, mökkeilyistä, matkoista ja serkkujen tapaamisista. Kiitos Mari, Mikko, Vilma, Tilda, Hilma ja Vinski, Tuomas, Laura, Oiva, Elmo, Alma ja Uuno, Maija ja Juhana, Joosua ja Tiitus, Maarit ja Tuomo. Kiitän myös tätejä Marianne, Maj-Lis, Siski, Maria, Marketta sekä Miikaa, Kirsiä, Moshea ja Mauria sekä Marjaanaa ja Villeä lukuisista sukujuhlista ja tapaamisista.

Kiitos Ritvalle, Matille, Suokulle, Eskolle ja Jannalle juhlista ja turistioppaana toimimisesta sekä majoituksesta Luxemburgissa. Kiitos veljilleni Tuomakselle ja Jussille lastenvahtina/ viihdyttäjänä olemisesta. Tuomasta kiitän erityisesti serkusten Miljan ja Sofian kaitsemisesta. Vanhemmilleni Raijalle ja Veikolle kiitos suuresta avusta lastenhoidossa, jota ilman väitöskirja ei olisi tullut valmiiksi. Kiitos myös mökkireissuista Emman ja Venlan kanssa.

Suuri kiitos perheelleni, joka on tukenut minua väitöskirjatyön aikana. Tyttärilleni Emmalle, Venlalle ja Miljalle jotka tuovat iloa ja väriä elämään. Miehelleni Tomille, joka on tehnyt lukuisia reissuja uimaan, leikkipuistoihin ja futistreeneihin sillä aikaa kun olen kirjoittanut.

Helsingissä 14.10.2014 Minttu Marttila

6 References

Abdul-Hussein, S., Rahl, K., Moslemi, A.R. & Tajsharghi, H. 2013, "Phenotypes of myopathy-related beta-tropomyosin mutants in human and mouse tissue cultures", PloS one, vol. 8, no. 9, pp. e72396. Adams, J., Kelso, R. & Cooley, L. 2000, "The kelch repeat superfamily of proteins: propellers of cell function", Trends in cell biology, vol. 10, no. 1, pp. 17-24. Agrawal, P.B., Greenleaf, R.S., Tomczak, K.K., Lehtokari, V.L., Wallgren-Pettersson, C., Wallefeld, W., Laing, N.G., Darras, B.T., Maciver, S.K., Dormitzer, P.R. & Beggs, A.H. 2007, "Nemaline myopathy with minicores caused by mutation of the CFL2 gene encoding the skeletal muscle actin-binding protein, cofilin-2", American Journal of Human Genetics, vol. 80, no. 1, pp. 162-167. Akkari, P.A., Song, Y., Hitchcock-DeGregori, S., Blechynden, L. & Laing, N. 2002, "Expression and biological activity of Baculovirus generated wild-type human slow alpha tropomyosin and the Met9Arg mutant responsible for a dominant form of nemaline myopathy", Biochemical and biophysical research communications, vol. 296, no. 2, pp. 300-304. Alberts, B., Bray, d., Lewis, J., Raff, M., Roberts, K. & Watson, J. 1994, "Molecular biology of the cell, Garland publishing ", . Anderson, S.L., Ekstein, J., Donnelly, M.C., Keefe, E.M., Toto, N.R., LeVoci, L.A. & Rubin, B.Y. 2004, "Nemaline myopathy in the Ashkenazi Jewish population is caused by a deletion in the nebulin gene", Human genetics, vol. 115, no. 3, pp. 185-190. Bang, M.L., Caremani, M., Brunello, E., Littlefield, R., Lieber, R.L., Chen, J., Lombardi, V. & Linari, M. 2009, "Nebulin plays a direct role in promoting strong actin-myosin interactions", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 23, no. 12, pp. 4117-4125. Bang, M.L., Centner, T., Fornoff, F., Geach, A.J., Gotthardt, M., McNabb, M., Witt, C.C., Labeit, D., Gregorio, C.C., Granzier, H. & Labeit, S. 2001, "The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system", Circulation research, vol. 89, no. 11, pp. 1065-1072. Bang, M.L., Li, X., Littlefield, R., Bremner, S., Thor, A., Knowlton, K.U., Lieber, R.L. & Chen, J. 2006, "Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle", The Journal of cell biology, vol. 173, no. 6, pp. 905-916. Barua, B., Fagnant, P.M., Winkelmann, D.A., Trybus, K.M. & Hitchcock-DeGregori, S.E. 2013, "A periodic pattern of evolutionarily conserved basic and acidic residues constitutes the binding interface of actin-tropomyosin", The Journal of biological chemistry, vol. 288, no. 14, pp. 9602-9609. Barua, B., Pamula, M.C. & Hitchcock-DeGregori, S.E. 2011, "Evolutionarily conserved surface residues constitute actin binding sites of tropomyosin", Proceedings of the National Academy of Sciences of the United States of America, vol. 108, no. 25, pp. 10150-10155. Barua, B., Winkelmann, D.A., White, H.D. & Hitchcock-Degregori, S.E. 2012, "Regulation of actin-myosin interaction by conserved periodic sites of tropomyosin", Proceedings of the National Academy of Sciences of the United States of America, . Behrmann, E., Muller, M., Penczek, P.A., Mannherz, H.G., Manstein, D.J. & Raunser, S. 2012, "Structure of the rigor actin-tropomyosin-myosin complex", Cell, vol. 150, no. 2, pp. 327-338.

Berg, J.S., Powell, B.C. & Cheney, R.E. 2001, "A millennial myosin census", Molecular biology of the cell, vol. 12, no. 4, pp. 780-794. Bonne, G., Carrier, L., Richard, P., Hainque, B. & Schwartz, K. 1998, "Familial hypertrophic cardiomyopathy: from mutations to functional defects", Circulation research, vol. 83, no. 6, pp. 580-593. Bottinelli, R., Coviello, D.A., Redwood, C.S., Pellegrino, M.A., Maron, B.J., Spirito, P., Watkins, H. & Reggiani, C. 1998, "A mutant tropomyosin that causes hypertrophic cardiomyopathy is expressed in vivo and associated with an increased calcium sensitivity", Circulation research, vol. 82, no. 1, pp. 106-115. Brandis, A., Aronica, E. & Goebel, H.H. 2008, "TPM2 mutation", Neuromuscular disorders : NMD, vol. 18, no. 12, pp. 1005. Brooke, M.H. 1973, "Congenital fiber type disproportion.", in Kakulas BA (ed): Clinical Studies in Myology: Proceedings of the 2nd International Congress on Muscle Diseases, Perth, Australia, Nov. 22-29, 1971. Amsterdam, Exerpta Medica, , pp. 147-159. Brooke, M.H. & Kaiser, K.K. 1970, "Muscle fiber types: how many and what kind?", Archives of Neurology, vol. 23, no. 4, pp. 369-379. Brown, J.H., Zhou, Z., Reshetnikova, L., Robinson, H., Yammani, R.D., Tobacman, L.S. & Cohen, C. 2005, "Structure of the mid-region of tropomyosin: bending and binding sites for actin", Proceedings of the National Academy of Sciences of the United States of America, vol. 102, no. 52, pp. 18878-18883. Buck, D., Hudson, B.D., Ottenheijm, C.A., Labeit, S. & Granzier, H. 2010, "Differential splicing of the large sarcomeric protein nebulin during skeletal muscle development", Journal of structural biology, vol. 170, no. 2, pp. 325-333. Burke, R.E., Levine, D.N., Tsairis, P. & Zajac, F.E.,3rd 1973, "Physiological types and histochemical profiles in motor units of the cat gastrocnemius", The Journal of physiology, vol. 234, no. 3, pp. 723-748. Carlsson, L., Yu, J.G., Moza, M., Carpen, O. & Thornell, L.E. 2007, "Myotilin: a prominent marker of myofibrillar remodelling", Neuromuscular disorders : NMD, vol. 17, no. 1, pp. 61-68. Castillo, A., Nowak, R., Littlefield, K.P., Fowler, V.M. & Littlefield, R.S. 2009, "A nebulin ruler does not dictate thin filament lengths", Biophysical journal, vol. 96, no. 5, pp. 1856- 1865. Chahin, N., Selcen, D. & Engel, A.G. 2005, "Sporadic late onset nemaline myopathy", Neurology, vol. 65, no. 8, pp. 1158-1164. Chandra, M., Mamidi, R., Ford, S., Hidalgo, C., Witt, C., Ottenheijm, C., Labeit, S. & Granzier, H. 2009, "Nebulin alters cross-bridge cycling kinetics and increases thin filament activation: a novel mechanism for increasing tension and reducing tension cost", The Journal of biological chemistry, vol. 284, no. 45, pp. 30889-30896. Chauveau, C., Bonnemann, C.G., Julien, C., Kho, A.L., Marks, H., Talim, B., Maury, P., Arne-Bes, M.C., Uro-Coste, E., Alexandrovich, A., Vihola, A., Schafer, S., Kaufmann, B., Medne, L., Hubner, N., Foley, A.R., Santi, M., Udd, B., Topaloglu, H., Moore, S.A., Gotthardt, M., Samuels, M.E., Gautel, M. & Ferreiro, A. 2014, "Recessive TTN truncating mutations define novel forms of core myopathy with heart disease", Human molecular genetics, vol. 23, no. 4, pp. 980-991. Chitose, R., Watanabe, A., Asano, M., Hanashima, A., Sasano, K., Bao, Y., Maruyama, K. & Kimura, S. 2010, "Isolation of nebulin from rabbit skeletal muscle and its interaction with actin", Journal of biomedicine & biotechnology, vol. 2010, pp. 108495. Citirak, G., Witting, N., Duno, M., Werlauff, U., Petri, H. & Vissing, J. 2014, "Frequency and phenotype of patients carrying TPM2 and TPM3 gene mutations in a cohort of 94

patients with congenital myopathy", Neuromuscular disorders : NMD, vol. 24, no. 4, pp. 325-330. Clarke, N.F. 2008, "Skeletal Muscle Disease Due to Mutations in Tropomyosin, Troponin and Cofilin", Advances in Experimental Medicine and Biology, The Sarcomere and Skeletal Muscle Disease, vol. 642, pp. 40-54. Clarke, N.F. 2011a, "Congenital fiber-type disproportion", Seminars in pediatric neurology, vol. 18, no. 4, pp. 264-271. Clarke, N.F. 2011b, "Congenital fibre type disproportion--a syndrome at the crossroads of the congenital myopathies", Neuromuscular disorders : NMD, vol. 21, no. 4, pp. 252-253. Clarke, N.F., Domazetovska, A., Waddell, L., Kornberg, A., McLean, C. & North, K.N. 2009, "Cap disease due to mutation of the beta-tropomyosin gene (TPM2)", Neuromuscular disorders : NMD, vol. 19, no. 5, pp. 348-351. Clarke, N.F., Ilkovski, B., Cooper, S., Valova, V.A., Robinson, P.J., Nonaka, I., Feng, J.J., Marston, S. & North, K. 2007, "The pathogenesis of ACTA1-related congenital fiber type disproportion", Annals of Neurology, vol. 61, no. 6, pp. 552-561. Clarke, N.F., Kolski, H., Dye, D.E., Lim, E., Smith, R.L., Patel, R., Fahey, M.C., Bellance, R., Romero, N.B., Johnson, E.S., Labarre-Vila, A., Monnier, N., Laing, N.G. & North, K.N. 2008, "Mutations in TPM3 are a common cause of congenital fiber type disproportion", Annals of Neurology, vol. 63, no. 3, pp. 329-337. Clarke, N.F., Smith, R.L., Bahlo, M. & North, K.N. 2005, "A novel X-linked form of congenital fiber-type disproportion", Annals of Neurology, vol. 58, no. 5, pp. 767-772. Clarke, N.F., Waddell, L.B., Cooper, S.T., Perry, M., Smith, R.L., Kornberg, A.J., Muntoni, F., Lillis, S., Straub, V., Bushby, K., Guglieri, M., King, M.D., Farrell, M.A., Marty, I., Lunardi, J., Monnier, N. & North, K.N. 2010, "Recessive mutations in RYR1 are a common cause of congenital fiber type disproportion", Human mutation, vol. 31, no. 7, pp. E1544-50. Conley, C.A., Fritz-Six, K.L., Almenar-Queralt, A. & Fowler, V.M. 2001, "Leiomodins: larger members of the tropomodulin (Tmod) gene family", Genomics, vol. 73, no. 2, pp. 127-139. Colpan, M., Moroz, N.A. & Kostyukova, A.S. 2013, "Tropomodulins and tropomyosins: working as a team", Journal of muscle research and cell motility, vol. 34, no. 3-4, pp. 247-260. Conen, P.E., Murphy, E.G. & Donohue, W.L. 1963, "Light and Electron Microscopic Studies of "Myogranules" in a Child with Hypotonia and Muscle Weakness", Canadian Medical Association journal, vol. 89, pp. 983-986. Cooley, B.C. & Bergtrom, G. 2001, "Multiple combinations of alternatively spliced exons in rat tropomyosin-alpha gene mRNA: evidence for 20 new isoforms in adult tissues and cultured cells", Archives of Biochemistry and Biophysics, vol. 390, no. 1, pp. 71-77. Corbett, M.A., Akkari, P.A., Domazetovska, A., Cooper, S.T., North, K.N., Laing, N.G., Gunning, P.W. & Hardeman, E.C. 2005, "An alphaTropomyosin mutation alters dimer preference in nemaline myopathy", Annals of Neurology, vol. 57, no. 1, pp. 42-49. Corbett, M.A., Robinson, C.S., Dunglison, G.F., Yang, N., Joya, J.E., Stewart, A.W., Schnell, C., Gunning, P.W., North, K.N. & Hardeman, E.C. 2001, "A mutation in alpha- tropomyosin(slow) affects muscle strength, maturation and hypertrophy in a mouse model for nemaline myopathy", Human molecular genetics, vol. 10, no. 4, pp. 317-328. Craig, R. & Lehman, W. 2001, "Crossbridge and tropomyosin positions observed in native, interacting thick and thin filaments", Journal of Molecular Biology, vol. 311, no. 5, pp. 1027-1036.

Daentl, D.L., Berg, B.O., Layzer, R.B. & Epstein, C.J. 1974, "A new familial arthrogryposis without weakness.", Neurology, vol. 24, pp. 55-60. Davidson, A.E., Siddiqui, F.M., Lopez, M.A., Lunt, P., Carlson, H.A., Moore, B.E., Love, S., Born, D.E., Roper, H., Majumdar, A., Jayadev, S., Underhill, H.R., Smith, C.O., von der Hagen, M., Hubner, A., Jardine, P., Merrison, A., Curtis, E., Cullup, T., Jungbluth, H., Cox, M.O., Winder, T.L., Abdel Salam, H., Li, J.Z., Moore, S.A. & Dowling, J.J. 2013, "Novel deletion of lysine 7 expands the clinical, histopathological and genetic spectrum of TPM2-related myopathies", Brain : a journal of neurology, vol. 136, no. Pt 2, pp. 508- 521. De Paula, A.M., Franques, J., Fernandez, C., Monnier, N., Lunardi, J., Pellissier, J.F., Figarella-Branger, D. & Pouget, J. 2009, "A TPM3 mutation causing cap myopathy", Neuromuscular disorders : NMD, vol. 19, no. 10, pp. 685-688. De Winter, J.M., Buck, D., Hidalgo, C., Jasper, J.R., Malik, F.I., Clarke, N.F., Stienen, G.J., Lawlor, M.W., Beggs, A.H., Ottenheijm, C.A. & Granzier, H. 2013, "Troponin activator augments muscle force in nemaline myopathy patients with nebulin mutations", Journal of medical genetics, vol. 50, no. 6, pp. 383-392. Donner, K., Nowak, K.J., Aro, M., Pelin, K. & Wallgren-Pettersson, C. 2006, "Developmental and muscle-type-specific expression of mouse nebulin exons 127 and 128", Genomics, vol. 88, no. 4, pp. 489-495. Donner, K., Ollikainen, M., Ridanpaa, M., Christen, H.J., Goebel, H.H., de Visser, M., Pelin, K. & Wallgren-Pettersson, C. 2002, "Mutations in the beta-tropomyosin (TPM2) gene--a rare cause of nemaline myopathy", Neuromuscular disorders : NMD, vol. 12, no. 2, pp. 151-158. Donner, K., Sandbacka, M., Lehtokari, V.L., Wallgren-Pettersson, C. & Pelin, K. 2004, "Complete genomic structure of the human nebulin gene and identification of alternatively spliced transcripts", European journal of human genetics : EJHG, vol. 12, no. 9, pp. 744-751. Dubowitz, V. & Sewry, C. 2007, "Muscle biopsy-a practical approach. Saunders Elsevier ", vol. UK. Dubowitz, V. & Pearse, A.G. 1960, "Reciprocal relationship of phosphorylase and oxidative enzymes in skeletal muscle", Nature, vol. 185, pp. 701-702. Dufour, C., Weinberger, R.P., Schevzov, G., Jeffrey, P.L. & Gunning, P. 1998, "Splicing of two internal and four carboxyl-terminal alternative exons in nonmuscle tropomyosin 5 pre-mRNA is independently regulated during development", The Journal of biological chemistry, vol. 273, no. 29, pp. 18547-18555. Dulhunty, A.F., Haarmann, C.S., Green, D., Laver, D.R., Board, P.G. & Casarotto, M.G. 2002, "Interactions between dihydropyridine receptors and ryanodine receptors in striated muscle", Progress in biophysics and molecular biology, vol. 79, no. 1-3, pp. 45-75. Durling, H.J., Reilich, P., Muller-Hocker, J., Mendel, B., Pongratz, D., Wallgren-Pettersson, C., Gunning, P., Lochmuller, H. & Laing, N.G. 2002, "De novo missense mutation in a constitutively expressed exon of the slow alpha-tropomyosin gene TPM3 associated with an atypical, sporadic case of nemaline myopathy", Neuromuscular disorders : NMD, vol. 12, no. 10, pp. 947-951. East, D., Sousa, D., Lehman, W. & Mulvihill, D.P. 2010, "Precise Modulation of Tropomyosin Polymer Length is Crucial for its Association with Actin and Ability to Regulate Myosin Function", Biophysical Journal, vol. 98, pp. 156-158. Eaton, B.L., Kominz, D.R. & Eisenberg, E. 1975, "Correlation between the inhibition of the acto-heavy meromyosin ATPase and the binding of tropomyosin to F-actin: effects of Mg2+, KCl, troponin I, and troponin C", Biochemistry, vol. 14, no. 12, pp. 2718-2725.

Ferreiro, A., Quijano-Roy, S., Pichereau, C., Moghadaszadeh, B., Goemans, N., Bonnemann, C., Jungbluth, H., Straub, V., Villanova, M., Leroy, J.P., Romero, N.B., Martin, J.J., Muntoni, F., Voit, T., Estournet, B., Richard, P., Fardeau, M. & Guicheney, P. 2002, "Mutations of the selenoprotein N gene, which is implicated in rigid spine muscular dystrophy, cause the classical phenotype of multiminicore disease: reassessing the nosology of early-onset myopathies", American Journal of Human Genetics, vol. 71, no. 4, pp. 739-749. Fidzianska, A. 2002, ""Cap disease"--a failure in the correct muscle fibre formation", Journal of the neurological sciences, vol. 201, no. 1-2, pp. 27-31. Fidzianska, A., Badurska, B., Ryniewicz, B. & Dembek, I. 1981, ""Cap disease": new congenital myopathy", Neurology, vol. 31, no. 9, pp. 1113-1120. Fidzianska, A., Madej-Pilarczyk, A. & Hausmanowa-Petrusewicz, I. 2014, "Is mutation p.Arg168Gly in TPM3 gene responsible for Type 1 fiber hypoplasia and cap structure formation?", Clinical neuropathology, vol. 33, no. 1, pp. 61-64. Fowler, V.M. 1987, "Identification and purification of a novel Mr 43,000 tropomyosin- binding protein from human erythrocyte membranes", The Journal of biological chemistry, vol. 262, no. 26, pp. 12792-12800. Fowler, V.M., Sussmann, M.A., Miller, P.G., Flucher, B.E. & Daniels, M.P. 1993, "Tropomodulin is associated with the free (pointed) ends of the thin filaments in rat skeletal muscle", The Journal of cell biology, vol. 120, no. 2, pp. 411-420. Franzini-Armstrong, C. 1999, "The sarcoplasmic reticulum and the control of muscle contraction", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 13 Suppl 2, pp. S266-70. Fraser, I.D. & Marston, S.B. 1995, "In vitro motility analysis of actin-tropomyosin regulation by troponin and calcium. The thin filament is switched as a single cooperative unit", The Journal of biological chemistry, vol. 270, no. 14, pp. 7836-7841. Gautel, M., Mues, A. & Young, P. 1999, "Control of sarcomeric assembly: the flow of information on titin", Reviews of physiology, biochemistry and pharmacology, vol. 138, pp. 97-137. Gokhin, D.S., Tierney, M.T., Sui, Z., Sacco, A. & Fowler, V.M. 2014, "Calpain-mediated proteolysis of tropomodulin isoforms leads to thin filament elongation in dystrophic skeletal muscle", Molecular biology of the cell, vol. 25, no. 6, pp. 852-865. Gordon, A.M., Homsher, E. & Regnier, M. 2000, "Regulation of contraction in striated muscle", Physiological Reviews, vol. 80, no. 2, pp. 853-924. Granzier, H. & Labeit, S. 2002, "Cardiac titin: an adjustable multi-functional spring", The Journal of physiology, vol. 541, no. Pt 2, pp. 335-342. Granzier, H.L. & Labeit, S. 2006, "The giant muscle protein titin is an adjustable molecular spring", Exercise and sport sciences reviews, vol. 34, no. 2, pp. 50-53. Greaser, M.L. & Gergely, J. 1973, "Purification and properties of the components from troponin", The Journal of biological chemistry, vol. 248, no. 6, pp. 2125-2133. Gregorio, C.C., Trombitas, K., Centner, T., Kolmerer, B., Stier, G., Kunke, K., Suzuki, K., Obermayr, F., Herrmann, B., Granzier, H., Sorimachi, H. & Labeit, S. 1998, "The NH2 terminus of titin spans the Z-disc: its interaction with a novel 19-kD ligand (T-cap) is required for sarcomeric integrity", The Journal of cell biology, vol. 143, no. 4, pp. 1013- 1027. Gunning, P., Gordon, M., Wade, R., Gahlmann, R., Lin, C.S. & Hardeman, E. 1990, "Differential control of tropomyosin mRNA levels during myogenesis suggests the existence of an isoform competition-autoregulatory compensation control mechanism", Developmental biology, vol. 138, no. 2, pp. 443-453.

Gunning, P., O'Neill, G. & Hardeman, E. 2008, "Tropomyosin-based regulation of the actin cytoskeleton in time and space", Physiological Reviews, vol. 88, no. 1, pp. 1-35. Gupta, V.A. & Beggs, A.H. 2014, "Kelch proteins: emerging roles in skeletal muscle development and diseases", Skeletal muscle, vol. 4, pp. 11-5040-4-11. eCollection 2014. Gupta, V.A., Ravenscroft, G., Shaheen, R., Todd, E.J., Swanson, L.C., Shiina, M., Ogata, K., Hsu, C., Clarke, N.F., Darras, B.T., Farrar, M.A., Hashem, A., Manton, N.D., Muntoni, F., North, K.N., Sandaradura, S.A., Nishino, I., Hayashi, Y.K., Sewry, C.A., Thompson, E.M., Yau, K.S., Brownstein, C.A., Yu, T.W., Allcock, R.J., Davis, M.R., Wallgren- Pettersson, C., Matsumoto, N., Alkuraya, F.S., Laing, N.G. & Beggs, A.H. 2013, "Identification of KLHL41 Mutations Implicates BTB-Kelch-Mediated Ubiquitination as an Alternate Pathway to Myofibrillar Disruption in Nemaline Myopathy", American Journal of Human Genetics, vol. 93, no. 6, pp. 1108-1117. Hackman, P., Vihola, A., Haravuori, H., Marchand, S., Sarparanta, J., De Seze, J., Labeit, S., Witt, C., Peltonen, L., Richard, I. & Udd, B. 2002, "Tibial muscular dystrophy is a titinopathy caused by mutations in TTN, the gene encoding the giant skeletal-muscle protein titin", American Journal of Human Genetics, vol. 71, no. 3, pp. 492-500. Hai, H., Sano, K., Maeda, K., Maeda, Y. & Miki, M. 2002, "Ca2+- and S1-induced conformational changes of reconstituted skeletal muscle thin filaments observed by fluorescence energy transfer spectroscopy: structural evidence for three States of thin filament", Journal of Biochemistry, vol. 131, no. 3, pp. 407-418. Hayley, M., Chevaldina, T., Mudalige, W.A., Jackman, D.M., Dobbin, A.D. & Heeley, D.H. 2008, "Shark skeletal muscle tropomyosin is a phosphoprotein", Journal of muscle research and cell motility, vol. 29, no. 2-5, pp. 101-107. Heeley, D.H. 2013, "Phosphorylation of tropomyosin in striated muscle", Journal of muscle research and cell motility, vol. 34, no. 3-4, pp. 233-237. Heeley, D.H., Watson, M.H., Mak, A.S., Dubord, P. & Smillie, L.B. 1989, "Effect of phosphorylation on the interaction and functional properties of rabbit striated muscle alpha alpha-tropomyosin", The Journal of biological chemistry, vol. 264, no. 5, pp. 2424- 2430. Holmes, K.C. & Lehman, W. 2008, "Gestalt-binding of tropomyosin to actin filaments", Journal of muscle research and cell motility, vol. 29, no. 6-8, pp. 213-219. Holmes, K.C., Popp, D., Gebhard, W. & Kabsch, W. 1990, "Atomic model of the actin filament", Nature, vol. 347, no. 6288, pp. 44-49. Hung, R.M., Yoon, G., Hawkins, C.E., Halliday, W., Biggar, D. & Vajsar, J. 2010, "Cap myopathy caused by a mutation of the skeletal alpha-actin gene ACTA1", Neuromuscular disorders : NMD, vol. 20, no. 4, pp. 238-240. Huxley, A. & Niedergerke, R. 1954, " Structural Changes in Muscle During Contraction: Interference Microscopy of Living Muscle Fibres", Nature, vol. 173, pp. 971-973. Huxley, H. & Hanson, J. 1954, "Changes in the cross-striations of muscle during contraction and stretch and their structural interpretation", Nature, vol. 173, no. 4412, pp. 973-976. Huxley, H.E. 1963, "Electron Microscope Studies on the Structure of Natural and Synthetic Protein Filaments from Striated Muscle", Journal of Molecular Biology, vol. 7, pp. 281- 308. Ilkovski, B., Cooper, S.T., Nowak, K., Ryan, M.M., Yang, N., Schnell, C., Durling, H.J., Roddick, L.G., Wilkinson, I., Kornberg, A.J., Collins, K.J., Wallace, G., Gunning, P., Hardeman, E.C., Laing, N.G. & North, K.N. 2001, "Nemaline myopathy caused by mutations in the muscle alpha-skeletal-actin gene", American Journal of Human Genetics, vol. 68, no. 6, pp. 1333-1343.

Ilkovski, B., Nowak, K.J., Domazetovska, A., Maxwell, A.L., Clement, S., Davies, K.E., Laing, N.G., North, K.N. & Cooper, S.T. 2004, "Evidence for a dominant-negative effect in ACTA1 nemaline myopathy caused by abnormal folding, aggregation and altered polymerization of mutant actin isoforms", Human molecular genetics, vol. 13, no. 16, pp. 1727-1743. Improta, S., Politou, A.S. & Pastore, A. 1996, "Immunoglobulin-like modules from titin I- band: extensible components of muscle elasticity", Structure (London, England : 1993), vol. 4, no. 3, pp. 323-337. Jin, J.P. & Wang, K. 1991a, "Cloning, expression, and protein interaction of human nebulin fragments composed of varying numbers of sequence modules", The Journal of biological chemistry, vol. 266, no. 31, pp. 21215-21223. Jin, J.P. & Wang, K. 1991b, "Nebulin as a giant actin-binding template protein in skeletal muscle sarcomere. Interaction of actin and cloned human nebulin fragments", FEBS letters, vol. 281, no. 1-2, pp. 93-96. Jockusch, B.M., Veldman, H., Griffiths, G.W., van Oost, B.A. & Jennekens, F.G. 1980, "Immunofluorescence microscopy of a myopathy. alpha-Actinin is a major constituent of nemaline rods", Experimental cell research, vol. 127, no. 2, pp. 409-420. Johnston, J.J., Kelley, R.I., Crawford, T.O., Morton, D.H., Agarwala, R., Koch, T., Schaffer, A.A., Francomano, C.A. & Biesecker, L.G. 2000, "A novel nemaline myopathy in the Amish caused by a mutation in troponin T1", American Journal of Human Genetics, vol. 67, no. 4, pp. 814-821. Jungbluth, H. & Wallgren-Pettersson, C. 2013, "Congenital (Structural) Myopathies", In: Emery&Rimoin's Principles and Practice of Medical Genetics, Eds David Rimoin, Reed Pyeritz and Bruce Korf, pp. 1-15. Kazmierski, S.T., Antin, P.B., Witt, C.C., Huebner, N., McElhinny, A.S., Labeit, S. & Gregorio, C.C. 2003, "The complete mouse nebulin gene sequence and the identification of cardiac nebulin", Journal of Molecular Biology, vol. 328, no. 4, pp. 835-846. Kiiski, K., Laari, L., Lehtokari, V.L., Lunkka-Hytonen, M., Angelini, C., Petty, R., Hackman, P., Wallgren-Pettersson, C. & Pelin, K. 2013, "Targeted array comparative genomic hybridization--a new diagnostic tool for the detection of large copy number variations in nemaline myopathy-causing genes", Neuromuscular disorders : NMD, vol. 23, no. 1, pp. 56-65. Krakowiak, P.A., O'Quinn, J.R., Bohnsack, J.F., Watkins, W.S., Carey, J.C., Jorde, L.B. & Bamshad, M. 1997, "A variant of Freeman-Sheldon syndrome maps to 11p15.5-pter", American Journal of Human Genetics, vol. 60, no. 2, pp. 426-432. Kruger, M., Wright, J. & Wang, K. 1991, "Nebulin as a length regulator of thin filaments of vertebrate skeletal muscles: correlation of thin filament length, nebulin size, and epitope profile", The Journal of cell biology, vol. 115, no. 1, pp. 97-107. Labeit, S., Gibson, T., Lakey, A., Leonard, K., Zeviani, M., Knight, P., Wardale, J. & Trinick, J. 1991, "Evidence that nebulin is a protein-ruler in muscle thin filaments", FEBS letters, vol. 282, no. 2, pp. 313-316. Labeit, S. & Kolmerer, B. 1995, "The complete primary structure of human nebulin and its correlation to muscle structure", Journal of Molecular Biology, vol. 248, no. 2, pp. 308- 315. Laing, N.G., Clarke, N.F., Dye, D.E., Liyanage, K., Walker, K.R., Kobayashi, Y., Shimakawa, S., Hagiwara, T., Ouvrier, R., Sparrow, J.C., Nishino, I., North, K.N. & Nonaka, I. 2004, "Actin mutations are one cause of congenital fibre type disproportion", Annals of Neurology, vol. 56, no. 5, pp. 689-694.

Laing, N.G., Dye, D.E., Wallgren-Pettersson, C., Richard, G., Monnier, N., Lillis, S., Winder, T.L., Lochmuller, H., Graziano, C., Mitrani-Rosenbaum, S., Twomey, D., Sparrow, J.C., Beggs, A.H. & Nowak, K.J. 2009, "Mutations and polymorphisms of the skeletal muscle alpha-actin gene (ACTA1)", Human mutation, vol. 30, no. 9, pp. 1267-1277. Laing, N.G., Wilton, S.D., Akkari, P.A., Dorosz, S., Boundy, K., Kneebone, C., Blumbergs, P., White, S., Watkins, H. & Love, D.R. 1995, "A mutation in the alpha tropomyosin gene TPM3 associated with autosomal dominant nemaline myopathy NEM1", Nature genetics, vol. 10, no. 2, pp. 249. Laitila, J., Hanif, M., Paetau, A., Hujanen, S., Keto, J., Somervuo, P., Huovinen, S., Udd, B., Wallgren-Pettersson, C., Auvinen, P., Hackman, P. & Pelin, K. 2012, "Expression of multiple nebulin isoforms in human skeletal muscle and brain", Muscle & nerve, vol. 46, no. 5, pp. 730-737. Lake, B.D. & Wilson, J. 1975, "Zebra body myopathy. Clinical, histochemical and ultrastructural studies", Journal of the neurological sciences, vol. 24, no. 4, pp. 437-446. Laporte, J., Hu, L.J., Kretz, C., Mandel, J.L., Kioschis, P., Coy, J.F., Klauck, S.M., Poustka, A. & Dahl, N. 1996, "A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast", Nature genetics, vol. 13, no. 2, pp. 175-182. Lawlor, M.W. & Beggs, A.H. 2013, "Thin Filament Proteins: Nemaline and Related Congenital Myopathies", Muscle Diseases, Pathology and Genetics, Wiley Blackwell, , pp. 145. Lawlor, M.W., Dechene, E.T., Roumm, E., Geggel, A.S., Moghadaszadeh, B. & Beggs, A.H. 2010, "Mutations of tropomyosin 3 (TPM3) are common and associated with type 1 myofiber hypotrophy in congenital fiber type disproportion.", Hum Mutat., vol. 31, no. 2, pp. 176. Lawlor, M.W., Ottenheijm, C.A., Lehtokari, V.L., Cho, K., Pelin, K., Wallgren-Pettersson, C., Granzier, H. & Beggs, A.H. 2011, "Novel mutations in NEB cause abnormal nebulin expression and markedly impaired muscle force generation in severe nemaline myopathy", Skeletal muscle, vol. 1, no. 1, pp. 23-5040-1-23. Lehman, W., Orzechowski, M., Li, X.E., Fischer, S. & Raunser, S. 2013, "Gestalt-binding of tropomyosin on actin during thin filament activation", Journal of muscle research and cell motility, vol. 34, no. 3-4, pp. 155-163. Lehtokari, V.L., Ceuterick-de Groote, C., de Jonghe, P., Marttila, M., Laing, N.G., Pelin, K. & Wallgren-Pettersson, C. 2007, "Cap disease caused by heterozygous deletion of the beta-tropomyosin gene TPM2", Neuromuscular disorders : NMD, vol. 17, no. 6, pp. 433- 442. Lehtokari, V.L., Greenleaf, R.S., DeChene, E.T., Kellinsalmi, M., Pelin, K., Laing, N.G., Beggs, A.H. & Wallgren-Pettersson, C. 2009, "The exon 55 deletion in the nebulin gene-- one single founder mutation with world-wide occurrence", Neuromuscular disorders : NMD, vol. 19, no. 3, pp. 179-181. Lehtokari, V.L., Pelin, K., Donner, K., Voit, T., Rudnik-Schoneborn, S., Stoetter, M., Talim, B., Topaloglu, H., Laing, N.G. & Wallgren-Pettersson, C. 2008, "Identification of a founder mutation in TPM3 in nemaline myopathy patients of Turkish origin", European journal of human genetics : EJHG, vol. 16, no. 9, pp. 1055-1061. Lehtokari, V.L., Pelin, K., Herczegfalvi, A., Karcagi, V., Pouget, J., Franques, J., Pellissier, J.F., Figarella-Branger, D., von der Hagen, M., Huebner, A., Schoser, B., Lochmuller, H. & Wallgren-Pettersson, C. 2011, "Nemaline myopathy caused by mutations in the nebulin gene may present as a distal myopathy", Neuromuscular disorders : NMD, vol. 21, no. 8, pp. 556-562.

Lehtokari, V.L., Pelin, K., Sandbacka, M., Ranta, S., Donner, K., Muntoni, F., Sewry, C., Angelini, C., Bushby, K., Van den Bergh, P., Iannaccone, S., Laing, N.G. & Wallgren- Pettersson, C. 2006, "Identification of 45 novel mutations in the nebulin gene associated with autosomal recessive nemaline myopathy", Human mutation, vol. 27, no. 9, pp. 946- 956. Lehtokari, V.L., Kiiski, K., Sandaradura, S.A., Laporte, J., Repo, P., Frey, J.A., Donner, K., Marttila, M., Saunders, C., Barth, P.G., den Dunnen, J.T., Beggs, A., Clarke, N.F., North, K.N., Laing, N.G., Romero, N.B., Winder, T.L., Pelin, K. & Wallgren-Pettersson, C. 2014, "Mutation Update: The Spectra of Nebulin Variants and Associated Myopathies", Human mutation, doi: 10.1002/humu.22693. Li, X.E., Tobacman, L.S., Mun, J.Y., Craig, R., Fischer, S. & Lehman, W. 2011, "Tropomyosin position on F-actin revealed by EM reconstruction and computational chemistry", Biophysical journal, vol. 100, no. 4, pp. 1005-1013. Lin, J.J., Warren, K.S., Wamboldt, D.D., Wang, T. & Lin, J.L. 1997, "Tropomyosin isoforms in nonmuscle cells", International review of cytology, vol. 170, pp. 1-38. Lukoyanova, N., VanLoock, M.S., Orlova, A., Galkin, V.E., Wang, K. & Egelman, E.H. 2002, "Each actin subunit has three nebulin binding sites: implications for steric blocking", Current biology : CB, vol. 12, no. 5, pp. 383-388. Lupas, A. 1996, "Coiled coils: new structures and new functions", Trends in biochemical sciences, vol. 21, no. 10, pp. 375-382. Luther, P.K., Padron, R., Ritter, S., Craig, R. & Squire, J.M. 2003, "Heterogeneity of Z-band structure within a single muscle sarcomere: implications for sarcomere assembly", Journal of Molecular Biology, vol. 332, no. 1, pp. 161-169. Marston, S., Memo, M., Messer, A., Papadaki, M., Nowak, K., McNamara, E., Ong, R., El- Mezgueldi, M., Li, X. & Lehman, W. 2013, "Mutations in repeating structural motifs of tropomyosin cause gain of function in skeletal muscle myopathy patients", Human molecular genetics, vol. 22, no. 24, pp. 4978-4987. Marttila, M., Lehtokari, V.L., Marston, S., Nyman, T.A., Barnerias, C., Beggs, A.H., Bertini, E., Ceyhan-Birsoy, O., Cintas, P., Gerard, M., Gilbert-Dussardier, B., Hogue, J.S., Longman, C., Eymard, B., Frydman, M., Kang, P.B., Klinge, L., Kolski, H., Lochmuller, H., Magy, L., Manel, V., Mayer, M., Mercuri, E., North, K.N., Peudenier-Robert, S., Pihko, H., Probst, F.J., Reisin, R., Stewart, W., Taratuto, A.L., de Visser, M., Wilichowski, E., Winer, J., Nowak, K., Laing, N.G., Winder, T.L., Monnier, N., Clarke, N.F., Pelin, K., Gronholm, M. & Wallgren-Pettersson, C. 2014a, "Mutation Update and Genotype-Phenotype Correlations of Novel and Previously Described Mutations in TPM2 and TPM3 Causing Congenital Myopathies", Human mutation, vol. 35, no. 7, pp.779-790. Marttila, M., Hanif, M., Lemola, E., Nowak, K.J., Laitila, J., Grönholm, M., Wallgren- Pettersson, C., Pelin, K. 2014b, "Nebulin interactions with actin and tropomyosin are altered by disease-causing mutations",Skeletal Muscle, vol. 1, no 4, pp. 15. Marttila, M., Lemola, E., Wallefeld, W., Memo, M., Donner, K., Laing, N.G., Marston, S., Gronholm, M. & Wallgren-Pettersson, C. 2012, "Abnormal actin binding of aberrant beta-tropomyosins is a molecular cause of muscle weakness in TPM2-related nemaline and cap myopathy", The Biochemical journal, vol. 442, no. 1, pp. 231-239. Matsumura, F., Yamashiro-Matsumura, S. & Lin, J.J. 1983, "Isolation and characterization of tropomyosin-containing microfilaments from cultured cells", The Journal of biological chemistry, vol. 258, no. 10, pp. 6636-6644.

McKillop, D.F. & Geeves, M.A. 1993, "Regulation of the interaction between actin and myosin subfragment 1: evidence for three states of the thin filament", Biophysical journal, vol. 65, no. 2, pp. 693-701. McLachlan, A.D. & Stewart, M. 1976, "The 14-fold periodicity in alpha-tropomyosin and the interaction with actin", Journal of Molecular Biology, vol. 103, no. 2, pp. 271-298. Memo, M. & Marston, S. 2013, "Skeletal muscle myopathy mutations at the actin tropomyosin interface that cause gain- or loss-of-function", Journal of muscle research and cell motility, vol. 34, no. 3-4, pp. 165-169. Mokbel, N., Ilkovski, B., Kreissl, M., Memo, M., Jeffries, C.M., Marttila, M., Lehtokari, V.L., Lemola, E., Gronholm, M., Yang, N., Menard, D., Marcorelles, P., Echaniz- Laguna, A., Reimann, J., Vainzof, M., Monnier, N., Ravenscroft, G., McNamara, E., Nowak, K.J., Laing, N.G., Wallgren-Pettersson, C., Trewhella, J., Marston, S., Ottenheijm, C., North, K.N. & Clarke, N.F. 2013, "K7del is a common TPM2 gene mutation associated with nemaline myopathy and raised myofibre calcium sensitivity", Brain : a journal of neurology, vol. 136, no. Pt 2, pp. 494-507. Moncman, C.L. & Wang, K. 1995, "Nebulette: a 107 kD nebulin-like protein in cardiac muscle", Cell motility and the cytoskeleton, vol. 32, no. 3, pp. 205-225. Monnier, N., Lunardi, J., Marty, I., Mezin, P., Labarre-Vila, A., Dieterich, K. & Jouk, P.S. 2009, "Absence of beta-tropomyosin is a new cause of Escobar syndrome associated with nemaline myopathy", Neuromuscular disorders : NMD, vol. 19, no. 2, pp. 118-123. Morgan, D.L. & Allen, D.G. 1999, "Early events in stretch-induced muscle damage", Journal of applied physiology (Bethesda, Md.: 1985), vol. 87, no. 6, pp. 2007-2015. Murakami, K., Stewart, M., Nozawa, K., Tomii, K., Kudou, N., Igarashi, N., Shirakihara, Y., Wakatsuki, S., Yasunaga, T. & Wakabayashi, T. 2008, "Structural basis for tropomyosin overlap in thin (actin) filaments and the generation of a molecular swivel by troponin-T", Proceedings of the National Academy of Sciences of the United States of America, vol. 105, no. 20, pp. 7200-7205. Muthuchamy, M., Pieples, K., Rethinasamy, P., Hoit, B., Grupp, I.L., Boivin, G.P., Wolska, B., Evans, C., Solaro, R.J. & Wieczorek, D.F. 1999, "Mouse model of a familial hypertrophic cardiomyopathy mutation in alpha-tropomyosin manifests cardiac dysfunction", Circulation research, vol. 85, no. 1, pp. 47-56. Nance, J.R., Dowling, J.J., Gibbs, E.M. & Bonnemann, C.G. 2012, "Congenital myopathies: an update", Current neurology and neuroscience reports, vol. 12, no. 2, pp. 165-174. North, K. & Ryan, M.M. 1993-2014, "Nemaline Myopathy", Gene Reviews, edited by Roberta A Pagon, University of Washington, Seattle, . North, K.N., Wang, C.H., Clarke, N., Jungbluth, H., Vainzof, M., Dowling, J.J., Amburgey, K., Quijano-Roy, S., Beggs, A.H., Sewry, C., Laing, N.G., Bonnemann, C.G. & International Standard of Care Committee for Congenital Myopathies 2014, "Approach to the diagnosis of congenital myopathies", Neuromuscular disorders : NMD, vol. 24, no. 2, pp. 97-116. Nowak, K.J., Davis, M.R., Wallgren-Pettersson, C., Lamont, P.J. & Laing, N.G. 2012, "Clinical utility gene card for: nemaline myopathy", European journal of human genetics : EJHG, vol. 20, no. 6, pp. 10.1038/ejhg.2012.70. Epub 2012 Apr 18. Nowak, K.J., Ravenscroft, G. & Laing, N.G. 2013, "Skeletal muscle alpha-actin diseases (actinopathies): pathology and mechanisms", Acta Neuropathologica, vol. 125, no. 1, pp. 19-32. Nowak, K.J., Wattanasirichaigoon, D., Goebel, H.H., Wilce, M., Pelin, K., Donner, K., Jacob, R.L., Hubner, C., Oexle, K., Anderson, J.R., Verity, C.M., North, K.N., Iannaccone, S.T., Muller, C.R., Nurnberg, P., Muntoni, F., Sewry, C., Hughes, I., Sutphen, R., Lacson,

A.G., Swoboda, K.J., Vigneron, J., Wallgren-Pettersson, C., Beggs, A.H. & Laing, N.G. 1999, "Mutations in the skeletal muscle alpha-actin gene in patients with actin myopathy and nemaline myopathy", Nature genetics, vol. 23, no. 2, pp. 208-212. Ochala, J. 2010, "Ca2+ sensitizers: An emerging class of agents for counterbalancing weakness in skeletal muscle diseases?", Neuromuscular disorders : NMD, vol. 20, no. 2, pp. 98-101. Ochala, J., Lehtokari, V.L., Iwamoto, H., Li, M., Feng, H.Z., Jin, J.P., Yagi, N., Wallgren- Pettersson, C., Penisson-Besnier, I. & Larsson, L. 2011, "Disrupted myosin cross-bridge cycling kinetics triggers muscle weakness in nebulin-related myopathy", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 25, no. 6, pp. 1903-1913. Ochala, J., Li, M., Tajsharghi, H., Kimber, E., Tulinius, M., Oldfors, A. & Larsson, L. 2007, "Effects of a R133W beta-tropomyosin mutation on regulation of muscle contraction in single human muscle fibres", The Journal of physiology, vol. 581, no. Pt 3, pp. 1283- 1292. Ochala, J. 2008, "Thin filament proteins mutations associated with skeletal myopathies: defective regulation of muscle contraction", Journal of Molecular Medicine (Berlin, Germany), vol. 86, no. 11, pp. 1197-1204. Ochala, J., Gokhin, D.S., Iwamoto, H. & Fowler, V.M. 2014, "Pointed-end capping by tropomodulin modulates actomyosin crossbridge formation in skeletal muscle fibers", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 28, no. 1, pp. 408-415. Ochala, J., Ravenscroft, G., Laing, N.G. & Nowak, K.J. 2012a, "Nemaline myopathy-related skeletal muscle alpha-actin (ACTA1) mutation, Asp286Gly, prevents proper strong myosin binding and triggers muscle weakness", PloS one, vol. 7, no. 9, pp. e45923. Ochala, J., Gokhin, D.S., Penisson-Besnier, I., Quijano-Roy, S., Monnier, N., Lunardi, J., Romero, N.B. & Fowler, V.M. 2012b, "Congenital myopathy-causing tropomyosin mutations induce thin filament dysfunction via distinct physiological mechanisms", Human molecular genetics, vol. 21, no. 20, pp. 4473-4485. Ochala, J. & Iwamoto, H. 2013a, "Myofilament lattice structure in presence of a skeletal myopathy-related tropomyosin mutation", Journal of muscle research and cell motility, vol. 34, no. 3-4, pp. 171-175. Ochala, J., Iwamoto, H., Ravenscroft, G., Laing, N.G. & Nowak, K.J. 2013b, "Skeletal and cardiac alpha-actin isoforms differently modulate myosin cross-bridge formation and myofibre force production", Human molecular genetics, vol. 22, no. 21, pp. 4398-4404. Ochala, J., Iwamoto, H., Larsson, L. & Yagi, N. 2010, "A myopathy-linked tropomyosin mutation severely alters thin filament conformational changes during activation", Proceedings of the National Academy of Sciences of the United States of America, vol. 107, no. 21, pp. 9807-9812. Ochala, J., Li, M., Ohlsson, M., Oldfors, A. & Larsson, L. 2008, "Defective regulation of contractile function in muscle fibres carrying an E41K beta-tropomyosin mutation", The Journal of physiology, vol. 586, no. Pt 12, pp. 2993-3004. Ockeloen, C.W., Gilhuis, H.J., Pfundt, R., Kamsteeg, E.J., Agrawal, P.B., Beggs, A.H., Dara Hama-Amin, A., Diekstra, A., Knoers, N.V., Lammens, M. & van Alfen, N. 2012, "Congenital myopathy caused by a novel missense mutation in the CFL2 gene", Neuromuscular disorders : NMD, vol. 22, no. 7, pp. 632-639. Ohlsson, M., Tajsharghi, H., Lindberg, C. & Oldfors, A. 2006, "Cap disease – a variant of nemaline myopathy. ", Neuromuscul Disord, vol. 16, pp. 707.

Ohlsson, M., Quijano-Roy, S., Darin, N., Brochier, G., Lacene, E., Avila-Smirnow, D., Fardeau, M., Oldfors, A. & Tajsharghi, H. 2008, "New morphologic and genetic findings in cap disease associated with beta-tropomyosin (TPM2) mutations", Neurology, vol. 71, no. 23, pp. 1896-1901. Oldfors A, L.P. 2008, "Thick filament diseases", In Nigel G. Laign, editor. The sarcomere and skeletal muscle disease, Landes biosciense, , pp. 78-91. Ong, R.W., AlSaman, A., Selcen, D., Arabshahi, A., Yau, K.S., Ravenscroft, G., Duff, R.M., Atkinson, V., Allcock, R.J. & Laing, N.G. 2014, "Novel cofilin-2 (CFL2) four base pair deletion causing nemaline myopathy", Journal of neurology, neurosurgery, and psychiatry, vol. 85, no. 9, pp. 1058-1060. Ortolano, S., Tarrio, R., Blanco-Arias, P., Teijeira, S., Rodriguez-Trelles, F., Garcia-Murias, M., Delague, V., Levy, N., Fernandez, J.M., Quintans, B., Millan, B.S., Carracedo, A., Navarro, C. & Sobrido, M.J. 2011, "A novel MYH7 mutation links congenital fiber type disproportion and myosin storage myopathy", Neuromuscular disorders : NMD, vol. 21, no. 4, pp. 254-262. Orzechowski, M., Fischer, S. & Lehman, W. 2013, "Influence of Actin Mutation on the Energy Landscape of Actin-Tropomyosin Filaments", Biophys J. Biophysical Society, vol. 29;104(S1):480a. Ottenheijm, C.A., Buck, D., de Winter, J.M., Ferrara, C., Piroddi, N., Tesi, C., Jasper, J.R., Malik, F.I., Meng, H., Stienen, G.J., Beggs, A.H., Labeit, S., Poggesi, C., Lawlor, M.W. & Granzier, H. 2013, "Deleting exon 55 from the nebulin gene induces severe muscle weakness in a mouse model for nemaline myopathy", Brain : a journal of neurology, vol. 136, no. Pt 6, pp. 1718-1731. Ottenheijm, C.A. & Granzier, H. 2010, "Lifting the nebula: novel insights into skeletal muscle contractility", Physiology (Bethesda, Md.), vol. 25, no. 5, pp. 304-310. Ottenheijm, C.A., Hooijman, P., DeChene, E.T., Stienen, G.J., Beggs, A.H. & Granzier, H. 2010, "Altered myofilament function depresses force generation in patients with nebulin- based nemaline myopathy (NEM2)", Journal of structural biology, vol. 170, no. 2, pp. 334-343. Pappas, C.T., Bhattacharya, N., Cooper, J.A. & Gregorio, C.C. 2008, "Nebulin interacts with CapZ and regulates thin filament architecture within the Z-disc", Molecular biology of the cell, vol. 19, no. 5, pp. 1837-1847. Pappas, C.T., Bliss, K.T., Zieseniss, A. & Gregorio, C.C. 2011, "The Nebulin family: an actin support group", Trends in cell biology, vol. 21, no. 1, pp. 29-37. Pappas, C.T., Krieg, P.A. & Gregorio, C.C. 2010, "Nebulin regulates actin filament lengths by a stabilization mechanism", The Journal of cell biology, vol. 189, no. 5, pp. 859-870. Pelin, K., Donner, K., Holmberg, M., Jungbluth, H., Muntoni, F. & Wallgren-Pettersson, C. 2002, "Nebulin mutations in autosomal recessive nemaline myopathy: an update", Neuromuscular disorders : NMD, vol. 12, no. 7-8, pp. 680-686. Pelin, K., Hilpela, P., Donner, K., Sewry, C., Akkari, P.A., Wilton, S.D., Wattanasirichaigoon, D., Bang, M.L., Centner, T., Hanefeld, F., Odent, S., Fardeau, M., Urtizberea, J.A., Muntoni, F., Dubowitz, V., Beggs, A.H., Laing, N.G., Labeit, S., de la Chapelle, A. & Wallgren-Pettersson, C. 1999, "Mutations in the nebulin gene associated with autosomal recessive nemaline myopathy", Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 5, pp. 2305-2310. Pelin, K. & Wallgren-Pettersson, C. 2008, "Nebulin--a giant chameleon", Advances in Experimental Medicine and Biology, vol. 642, pp. 28-39. Penisson-Besnier, I., Monnier, N., Toutain, A., Dubas, F. & Laing, N. 2007, "A second pedigree with autosomal dominant nemaline myopathy caused by TPM3 mutation: a

clinical and pathological study", Neuromuscular disorders : NMD, vol. 17, no. 4, pp. 330-337. Perry, S.V. 2001, "Vertebrate tropomyosin: distribution, properties and function", Journal of muscle research and cell motility, vol. 22, no. 1, pp. 5-49. Pfuhl, M., Winder, S.J. & Pastore, A. 1994, "Nebulin, a helical actin binding protein", The EMBO journal, vol. 13, no. 8, pp. 1782-1789. Phillips, G.N.,Jr, Lattman, E.E., Cummins, P., Lee, K.Y. & Cohen, C. 1979, "Crystal structure and molecular interactions of tropomyosin", Nature, vol. 278, no. 5703, pp. 413-417. Pinotsis, N., Lange, S., Perriard, J.C., Svergun, D.I. & Wilmanns, M. 2008, "Molecular basis of the C-terminal tail-to-tail assembly of the sarcomeric filament protein myomesin", The EMBO journal, vol. 27, no. 1, pp. 253-264. Pittenger, M.F., Kazzaz, J.A. & Helfman, D.M. 1994, "Functional properties of non-muscle tropomyosin isoforms", Current opinion in cell biology, vol. 6, no. 1, pp. 96-104. Prag, S. & Adams, J.C. 2003, "Molecular phylogeny of the kelch-repeat superfamily reveals an expansion of BTB/kelch proteins in animals", BMC bioinformatics, vol. 4, pp. 42. Raheem, O., Huovinen, S., Suominen, T., Haapasalo, H. & Udd, B. 2010, "Novel myosin heavy chain immunohistochemical double staining developed for the routine diagnostic separation of I, IIA and IIX fibers", Acta Neuropathologica, vol. 119, no. 4, pp. 495-500. Ravenscroft, G., Jackaman, C., Sewry, C.A., McNamara, E., Squire, S.E., Potter, A.C., Papadimitriou, J., Griffiths, L.M., Bakker, A.J., Davies, K.E., Laing, N.G. & Nowak, K.J. 2011a, "Actin nemaline myopathy mouse reproduces disease, suggests other actin disease phenotypes and provides cautionary note on muscle transgene expression", PloS one, vol. 6, no. 12, pp. e28699. Ravenscroft, G., Jackaman, C., Bringans, S., Papadimitriou, J.M., Griffiths, L.M., McNamara, E., Bakker, A.J., Davies, K.E., Laing, N.G. & Nowak, K.J. 2011b, "Mouse models of dominant ACTA1 disease recapitulate human disease and provide insight into therapies", Brain : a journal of neurology, vol. 134, no. Pt 4, pp. 1101-1115. Ravenscroft, G., McNamara, E., Griffiths, L.M., Papadimitriou, J.M., Hardeman, E.C., Bakker, A.J., Davies, K.E., Laing, N.G. & Nowak, K.J. 2013a, "Cardiac alpha-actin overexpression therapy in dominant ACTA1 disease", Human molecular genetics, vol. 22, no. 19, pp. 3987-3997. Ravenscroft, G., Miyatake, S., Lehtokari, V.L., Todd, E.J., Vornanen, P., Yau, K.S., Hayashi, Y.K., Miyake, N., Tsurusaki, Y., Doi, H., Saitsu, H., Osaka, H., Yamashita, S., Ohya, T., Sakamoto, Y., Koshimizu, E., Imamura, S., Yamashita, M., Ogata, K., Shiina, M., Bryson-Richardson, R.J., Vaz, R., Ceyhan, O., Brownstein, C.A., Swanson, L.C., Monnot, S., Romero, N.B., Amthor, H., Kresoje, N., Sivadorai, P., Kiraly-Borri, C., Haliloglu, G., Talim, B., Orhan, D., Kale, G., Charles, A.K., Fabian, V.A., Davis, M.R., Lammens, M., Sewry, C.A., Manzur, A., Muntoni, F., Clarke, N.F., North, K.N., Bertini, E., Nevo, Y., Willichowski, E., Silberg, I.E., Topaloglu, H., Beggs, A.H., Allcock, R.J., Nishino, I., Wallgren-Pettersson, C., Matsumoto, N. & Laing, N.G. 2013b, "Mutations in KLHL40 are a frequent cause of severe autosomal-recessive nemaline myopathy", American Journal of Human Genetics, vol. 93, no. 1, pp. 6-18. Rebbeck, R.T., Karunasekara, Y., Board, P.G., Beard, N.A., Casarotto, M.G. & Dulhunty, A.F. 2014, "Skeletal muscle excitation-contraction coupling: who are the dancing partners?", The international journal of biochemistry & cell biology, vol. 48, pp. 28-38. Revera, M., van der Merwe, L., Heradien, M., Goosen, A., Corfield, V.A., Brink, P.A. & Moolman-Smook, J.C. 2008, "Troponin T and beta-myosin mutations have distinct cardiac functional effects in hypertrophic cardiomyopathy patients without hypertrophy", Cardiovascular research, vol. 77, no. 4, pp. 687-694.

Robinson, P., Lipscomb, S., Preston, L.C., Altin, E., Watkins, H., Ashley, C.C. & Redwood, C.S. 2007, "Mutations in fast skeletal troponin I, troponin T, and beta-tropomyosin that cause distal arthrogryposis all increase contractile function", FASEB journal : official publication of the Federation of American Societies for Experimental Biology, vol. 21, no. 3, pp. 896-905. Ruppel, K.M. & Spudich, J.A. 1996a, "Structure-function analysis of the motor domain of myosin", Annual Review of Cell and Developmental Biology, vol. 12, pp. 543-573. Ruppel, K.M. & Spudich, J.A. 1996b, "Structure-function studies of the myosin motor domain: importance of the 50-kDa cleft", Molecular biology of the cell, vol. 7, no. 7, pp. 1123-1136. Romero, N.B., Lehtokari, V.L., Quijano-Roy, S., Monnier, N., Claeys, K.G., Carlier, R.Y., Pellegrini, N., Orlikowski, D., Barois, A., Laing, N.G., Lunardi, J., Fardeau, M., Pelin, K. & Wallgren-Pettersson, C. 2009, "Core-rod myopathy caused by mutations in the nebulin gene", Neurology, vol. 73, no. 14, pp. 1159-1161. Ryan, M.M., Ilkovski, B., Strickland, C.D., Schnell, C., Sanoudou, D., Midgett, C., Houston, R., Muirhead, D., Dennett, X., Shield, L.K., De Girolami, U., Iannaccone, S.T., Laing, N.G., North, K.N. & Beggs, A.H. 2003, "Clinical course correlates poorly with muscle pathology in nemaline myopathy", Neurology, vol. 60, no. 4, pp. 665-673. Sambuughin, N., Yau, K.S., Olive, M., Duff, R.M., Bayarsaikhan, M., Lu, S., Gonzalez-Mera, L., Sivadorai, P., Nowak, K.J., Ravenscroft, G., Mastaglia, F.L., North, K.N., Ilkovski, B., Kremer, H., Lammens, M., van Engelen, B.G., Fabian, V., Lamont, P., Davis, M.R., Laing, N.G. & Goldfarb, L.G. 2010, "Dominant mutations in KBTBD13, a member of the BTB/Kelch family, cause nemaline myopathy with cores", American Journal of Human Genetics, vol. 87, no. 6, pp. 842-847. Sandow, A. 1952, "Excitation-contraction coupling in muscular response", The Yale journal of biology and medicine, vol. 25, no. 3, pp. 176-201. Schessl, J., Goemans, N.M., Magold, A.I., Zou, Y., Hu, Y., Kirschner, J., Sciot, R. & Bonnemann, C.G. 2008, "Predominant fiber atrophy and fiber type disproportion in early ullrich disease", Muscle & nerve, vol. 38, no. 3, pp. 1184-1191. Schiaffino, S., Hanzlikova, V. & Pierobon, S. 1970, "Relations between structure and function in rat skeletal muscle fibers", The Journal of cell biology, vol. 47, no. 1, pp. 107-119. Schiaffino, S. & Reggiani, C. 1994, "Myosin isoforms in mammalian skeletal muscle", Journal of applied physiology (Bethesda, Md.: 1985), vol. 77, no. 2, pp. 493-501. Schreckenbach, T., Schroder, J.M., Voit, T., Abicht, A., Neuen-Jacob, E., Roos, A., Bulst, S., Kuhl, C., Schulz, J.B., Weis, J. & Claeys, K.G. 2014, "Novel TPM3 mutation in a family with cap myopathy and review of the literature", Neuromuscular disorders : NMD, vol. 24, no. 2, pp. 117-124. Schröder JM 1982, "Pathologie der muskulatur", Berlin Heidelberg, New York: Springer, , pp. 262-264. Schroder, R., Reimann, J., Salmikangas, P., Clemen, C.S., Hayashi, Y.K., Nonaka, I., Arahata, K. & Carpen, O. 2003, "Beyond LGMD1A: myotilin is a component of central core lesions and nemaline rods", Neuromuscular disorders : NMD, vol. 13, no. 6, pp. 451-455. Selcen, D. & Engel, A.G. 2004, "Mutations in myotilin cause myofibrillar myopathy", Neurology, vol. 62, no. 8, pp. 1363-1371. Sellers, J.R. 2000, "Myosins: a diverse superfamily", Biochimica et biophysica acta, vol. 1496, no. 1, pp. 3-22. Sewry, C. 2008, "Pathological defects in congenital myopathies", J. Muscle Res. Cell. Motil., vol. 29, no. 6-8, pp. 231-238.

Shy, G.M., Engel, W.K., Somers, J.E. & Wanko, T. 1963, "Nemaline Myopathy. a New Congenital Myopathy", Brain : a journal of neurology, vol. 86, pp. 793-810. Shy, G.M. & Magee, K.R. 1956, "A new congenital non-progressive myopathy", Brain, vol. 79, pp. 610-621. Skwarek-Maruszewska, A., Hotulainen, P., Mattila, P.K. & Lappalainen, P. 2009, "Contractility-dependent actin dynamics in cardiomyocyte sarcomeres", Journal of cell science, vol. 122, no. Pt 12, pp. 2119-2126. Slayter, H.S. & Lowey, S. 1967, "Substructure of the myosin molecule as visualized by electron microscopy", Proceedings of the National Academy of Sciences of the United States of America, vol. 58, no. 4, pp. 1611-1618. Stromer, M.H. 1995, "Immunocytochemistry of the muscle cell cytoskeleton", Microscopy research and technique, vol. 31, no. 2, pp. 95-105. Sung, S.S., Brassington, A.M., Grannatt, K., Rutherford, A., Whitby, F.G., Krakowiak, P.A., Jorde, L.B., Carey, J.C. & Bamshad, M. 2003a, "Mutations in genes encoding fast-twitch contractile proteins cause distal arthrogryposis syndromes", American Journal of Human Genetics, vol. 72, no. 3, pp. 681-690. Sung, S.S., Brassington, A.M., Krakowiak, P.A., Carey, J.C., Jorde, L.B. & Bamshad, M. 2003b, "Mutations in TNNT3 cause multiple congenital contractures: a second locus for distal arthrogryposis type 2B", American Journal of Human Genetics, vol. 73, no. 1, pp. 212-214. Szent-Györgyi, A. 1943, "The contraction of myosin threads", Stud. Inst. Med. Chem. Univ. Szeged., , no. 1, pp. 17-26. Tajsharghi, H., Kimber, E., Holmgren, D., Tulinius, M. & Oldfors, A. 2007a, "Distal arthrogryposis and muscle weakness associated with a beta-tropomyosin mutation", Neurology, vol. 68, no. 10, pp. 772-775. Tajsharghi, H., Ohlsson, M., Lindberg, C. & Oldfors, A. 2007b, "Congenital myopathy with nemaline rods and cap structures caused by a mutation in the beta-tropomyosin gene (TPM2)", Archives of Neurology, vol. 64, no. 9, pp. 1334-1338. Tajsharghi, H. & Oldfors, A. 2013, "Myosinopathies: pathology and mechanisms", Acta Neuropathologica, vol. 125, no. 1, pp. 3-18. Takada, F., Vander Woude, D.L., Tong, H.Q., Thompson, T.G., Watkins, S.C., Kunkel, L.M. & Beggs, A.H. 2001, "Myozenin: an alpha-actinin- and gamma-filamin-binding protein of skeletal muscle Z lines", Proceedings of the National Academy of Sciences of the United States of America, vol. 98, no. 4, pp. 1595-1600. Tan, P., Briner, J., Boltshauser, E., Davis, M.R., Wilton, S.D., North, K., Wallgren- Pettersson, C. & Laing, N.G. 1999, "Homozygosity for a nonsense mutation in the alpha- tropomyosin slow gene TPM3 in a patient with severe infantile nemaline myopathy", Neuromuscular disorders : NMD, vol. 9, no. 8, pp. 573-579. Tasca, G., Fattori, F., Ricci, E., Monforte, M., Rizzo, V., Mercuri, E., Bertini, E. & Silvestri, G. 2013, "Somatic mosaicism in TPM2-related myopathy with nemaline rods and cap structures", Acta Neuropathologica, vol. 125, no. 1, pp. 169-171. Telfer, W.R., Nelson, D.D., Waugh, T., Brooks, S.V. & Dowling, J.J. 2012, "Neb: a zebrafish model of nemaline myopathy due to nebulin mutation", Disease models & mechanisms, vol. 5, no. 3, pp. 389-396. Tobacman, L.S. 1996, "Thin filament-mediated regulation of cardiac contraction", Annual Review of Physiology, vol. 58, pp. 447-481. Tonino, P., Pappas, C.T., Hudson, B.D., Labeit, S., Gregorio, C.C. & Granzier, H. 2010, "Reduced myofibrillar connectivity and increased Z-disk width in nebulin-deficient skeletal muscle", Journal of cell science, vol. 123, no. Pt 3, pp. 384-391.

Udd, B. 2008, "Third Filament Diseases", Advances in experimental medicine and biology, The sarcomere and skeletal muscle disease, vol. 642, pp. 99-113. Vainzof, M., Moreira, E.S., Suzuki, O.T., Faulkner, G., Valle, G., Beggs, A.H., Carpen, O., Ribeiro, A.F., Zanoteli, E., Gurgel-Gianneti, J., Tsanaclis, A.M., Silva, H.C., Passos- Bueno, M.R. & Zatz, M. 2002, "Telethonin protein expression in neuromuscular disorders", Biochimica et biophysica acta, vol. 1588, no. 1, pp. 33-40. van Spaendonck-Zwarts, K.Y., Posafalvi, A., van den Berg, M.P., Hilfiker-Kleiner, D., Bollen, I.A., Sliwa, K., Alders, M., Almomani, R., van Langen, I.M., van der Meer, P., Sinke, R.J., van der Velden, J., Van Veldhuisen, D.J., van Tintelen, J.P. & Jongbloed, J.D. 2014, "Titin gene mutations are common in families with both peripartum cardiomyopathy and dilated cardiomyopathy", European heart journal, . Vandekerckhove, J. & Weber, K. 1978, "At least six different actins are expressed in a higher mammal: An analysis based on the amino acid sequence of the amino-terminal tryptic peptide", Journal of Molecular Biology, vol. 126, no. 4, pp. 783-802. van der Pol, W.L., Leijenaar, J.F., Spliet, W.G., Lavrijsen, S.W., Jansen, N.J., Braun, K.P., Mulder, M., Timmers-Raaijmakers, B., Ratsma, K., Dooijes, D. & van Haelst, M.M. 2014, "Nemaline myopathy caused byTNNT1 mutations in a Dutch pedigree", Molecular genetics & genomic medicine, vol. 2, no. 2, pp. 134-137. von der Hagen, M., Kress, W., Hahn, G., Brocke, K.S., Mitzscherling, P., Huebner, A., Muller-Reible, C., Stoltenburg-Didinger, G. & Kaindl, A.M. 2008, "Novel RYR1 missense mutation causes core rod myopathy", European journal of neurology : the official journal of the European Federation of Neurological Societies, vol. 15, no. 4, pp. e31-2. Wallgren-Pettersson, C., Sainio, K. & Salmi, T. 1989, "Electromyography in congenital nemaline myopathy", Muscle & nerve, vol. 12, no. 7, pp. 587-593. Wallgren-Pettersson, C., Kalimo, H. & Lammens, M. 2013, "Nebulin: Nemaline myopathies and associated disorders", Muscle Diseases, Pathology and Genetics, Wiley Blackwell, , pp. p.152. Wallgren-Pettersson, C., Arjomaa, P. & Holmberg, C. 1990, "Alpha-actinin and myosin light chains in congenital nemaline myopathy", Pediatric neurology, vol. 6, no. 3, pp. 171-174. Wallgren-Pettersson, C. & Laing, N.G. 2000, "Report of the 70th ENMC International Workshop: nemaline myopathy, 11-13 June 1999, Naarden, The Netherlands", Neuromuscular disorders : NMD, vol. 10, no. 4-5, pp. 299-306. Wallgren-Pettersson, C., Lehtokari, V.L., Kalimo, H., Paetau, A., Nuutinen, E., Hackman, P., Sewry, C., Pelin, K. & Udd, B. 2007, "Distal myopathy caused by homozygous missense mutations in the nebulin gene", Brain : a journal of neurology, vol. 130, no. Pt 6, pp. 1465-1476. Wallgren-Pettersson, C., Pelin, K., Nowak, K.J., Muntoni, F., Romero, N.B., Goebel, H.H., North, K.N., Beggs, A.H., Laing, N.G. & ENMC International Consortium On Nemaline Myopathy 2004, "Genotype-phenotype correlations in nemaline myopathy caused by mutations in the genes for nebulin and skeletal muscle alpha-actin", Neuromuscular disorders : NMD, vol. 14, no. 8-9, pp. 461-470. Wallgren-Pettersson, C., Rapola, J. & Donner, M. 1988, "Pathology of congenital nemaline myopathy. A follow-up study", Journal of the neurological sciences, vol. 83, no. 2-3, pp. 243-257. Wallgren-Pettersson, C., Sewry, C.A., Nowak, K.J. & Laing, N.G. 2011, "Nemaline myopathies", Seminars in pediatric neurology, vol. 18, no. 4, pp. 230-238. Wang, K. & Wright, J. 1988, "Architecture of the sarcomere matrix of skeletal muscle: immunoelectron microscopic evidence that suggests a set of parallel inextensible nebulin

filaments anchored at the Z line", The Journal of cell biology, vol. 107, no. 6 Pt 1, pp. 2199-2212. Warren, C.M., Arteaga, G.M., Rajan, S., Ahmed, R.P., Wieczorek, D.F. & Solaro, R.J. 2008, "Use of 2-D DIGE analysis reveals altered phosphorylation in a tropomyosin mutant (Glu54Lys) linked to dilated cardiomyopathy", Proteomics, vol. 8, no. 1, pp. 100-105. Weber, A., Pennise, C.R., Babcock, G.G. & Fowler, V.M. 1994, "Tropomodulin caps the pointed ends of actin filaments", The Journal of cell biology, vol. 127, no. 6 Pt 1, pp. 1627-1635. Witt, C.C., Burkart, C., Labeit, D., McNabb, M., Wu, Y., Granzier, H. & Labeit, S. 2006, "Nebulin regulates thin filament length, contractility, and Z-disk structure in vivo", The EMBO journal, vol. 25, no. 16, pp. 3843-3855. Yamaguchi, M., Robson, R.M., Stromer, M.H., Dahl, D.S. & Oda, T. 1982, "Nemaline myopathy rod bodies. Structure and composition", Journal of the neurological sciences, vol. 56, no. 1, pp. 35-56. Young, P., Ferguson, C., Banuelos, S. & Gautel, M. 1998, "Molecular structure of the sarcomeric Z-disk: two types of titin interactions lead to an asymmetrical sorting of alpha-actinin", The EMBO journal, vol. 17, no. 6, pp. 1614-1624. Yuen, M., Sandaradura, S.A., Dowling, J.J., Kostyukova, A.S., Moroz, N., Quinlan, K.G., Lehtokari, V.L., Ravenscroft, G., Todd, E.J., Ceyhan-Birsoy, O., Gokhin, D.S., Maluenda, J., Lek, M., Nolent, F., Pappas, C.T., Novak, S.M., D'Amico, A., Malfatti, E., Thomas, B.P., Gabriel, S.B., Gupta, N., Daly, M.J., Ilkovski, B., Houweling, P.J., Davidson, A.E., Swanson, L.C., Brownstein, C.A., Gupta, V.A., Medne, L., Shannon, P., Martin, N., Bick, D.P., Flisberg, A., Holmberg, E., Van den Bergh, P., Lapunzina, P., Waddell, L.B., Sloboda, D.D., Bertini, E., Chitayat, D., Telfer, W.R., Laquerriere, A., Gregorio, C.C., Ottenheijm, C.A., Bonnemann, C.G., Pelin, K., Beggs, A.H., Hayashi, Y.K., Romero, N.B., Laing, N.G., Nishino, I., Wallgren-Pettersson, C., Melki, J., Fowler, V.M., MacArthur, D.G., North, K.N. & Clarke, N.F. 2014, "Leiomodin-3 dysfunction results in thin filament disorganization and nemaline myopathy", The Journal of clinical investigation, doi: 10.1172/JCI75199. Zhu, M., Yang, T., Wei, S., DeWan, A.T., Morell, R.J., Elfenbein, J.L., Fisher, R.A., Leal, S.M., Smith, R.J. & Friderici, K.H. 2003, "Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26)", American Journal of Human Genetics, vol. 73, no. 5, pp. 1082-1091.