DOCSLIB.ORG

( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0263256 A1 ZHANG Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0263256 A1 ZHANG Et Al US 20200263256A1 INI ( 19 ) United States ( 12 ) Patent Application Publication ( 10 ) Pub . No .: US 2020/0263256 A1 ZHANG et al . ( 43 ) Pub . Date : Aug. 20 , 2020 ( 54 ) METHYLATION MARKERS FOR ( 60 ) Provisional application No. 62 / 466,328 , filed on Mar. DIAGNOSING HEPATOCELLULAR 2 , 2017 , provisional application No. 62 / 466,329 , filed CARCINOMA AND LUNG CANCER on Mar. 2 , 2017 , provisional application No. 62/569 , 462 , filed on Oct. 6 , 2017 . ( 71 ) Applicants: You Health Oncotech , Limited , Grand Cayman (KY ); The Regents of the Publication Classification University of California , Oakland, CA ( 51 ) Int. Cl . ( US ) C12Q 1/6886 ( 2006.01 ) ( 72 ) Inventors: Kang ZHANG , San Diego , CA ( US ) ; ( 52 ) U.S. CI . Rui HOU , Shenyang ( CN ) ; Lianghong CPC C12Q 1/6886 ( 2013.01 ) ; C12Q 2600/154 ZHENG , Shenyang ( CN ) ( 2013.01 ) ; C12Q 2600/118 ( 2013.01 ) ( 57 ) ABSTRACT ( 21 ) Appl. No .: 16 / 672,365 Disclosed herein , in certain embodiments , are methods and kits for diagnosing a subject as having hepatocellular car cinoma ( HCC ) or lung cancer. In some instances, also ( 22 ) Filed : Nov. 1 , 2019 described herein are methods of determining the prognosis of the subject having HCC or lung cancer . In additional Related U.S. Application Data instances, described herein are methods of determining the ( 63 ) Continuation of application No. 15 / 910,857 , filed on specific staging of HCC or lung cancer in a subject. Mar. 2 , 2018 , now Pat . No. 10,513,739 . Specification includes a Sequence Listing . Patent Application Publication Aug. 20 , 2020 Sheet 1 of 66 US 2020/0263256 A1 FIG . IA Simputation . ... " LISTENT FIG . 1B Karimo base.com on Sat Sample 3 Patent Application Publication Aug. 20 , 2020 Sheet 2 of 66 US 2020/0263256 A1 FIG . 2A ARALLISISSA Truepositiverate MA False positive rate FIG . 2B Composite Patent Application Publication Aug. 20 , 2020 Sheet 3 of 66 US 2020/0263256 A1 FIG . 2C Normal ' ' . ' ' . ? Patent Application Publication Aug. 20 , 2020 Sheet 4 of 66 US 2020/0263256 A1 FIG . 2D Tata Patent Application Publication Aug. 20 , 2020 Sheet 5 of 66 US 2020/0263256 A1 FIG . 3A Compositescore H Healthy control Liver disease HCC FIG . 3B AFPng/ml(Log) ++ Healthy control sease HCC Patent Application Publication Aug. 20 , 2020 Sheet 6 of 66 US 2020/0263256 A1 FIG . 3C LUNC p = 0.04 p < 0.001 Compositescore 1 www Non smoking Smoking LUNC Healthy control Healthy control Patent Application Publication Aug. 20 , 2020 Sheet 7 of 66 US 2020/0263256 A1 FIG . 4A - FIG . 4D FIG . 4A FIG . 4B --- + Compositescore Sefore treatment Response Progression FIG . 4C FIG . 4D Patent Application Publication Aug. 20 , 2020 Sheet Bof 66 US 2020 / 0263256A1 FIG.4E - FIGH FIG . 4E FIG . 4F P14? 11 ? || ?? HT ? ? ??? ?? ? ???? ?? ? ? FIG.4G FIG . 4H Patent Application Publication Aug. 20 , 2020 Sheet 9 of 66 US 2020/0263256 A1 FIG . 41 - FIG . 4L FIG . 41 FIG . 4J LULU wwwwwwwwwww Airte Turepositiverate AFPngimi(Log) ?????? False positive rate Voodoo.pno AFPngimi(Log) AFPng/ml(Log) Mwd FIG . 4K FIG . 4L Patent Application Publication Aug. 20 , 2020 Sheet 10 of 66 US 2020/0263256 A1 FIG . 5 FIG . 5A FIG . 5B wwws FIG . 5C FIG . 5D $% 3.X FIG . 5E FIG . 5F Wybierajinekologiyalarinitieghuliwa ? ? itirsimittarithimpiantiitinutiktu mitihani 20 Patent Application Publication Aug. 20 , 2020 Sheet 11 of 66 US 2020/0263256 A1 FIG . 6A FIG . 6B we Patent Application Publication Aug. 20 , 2020 Sheet 12 of 66 US 2020/0263256 A1 FIG . 7 FIG . 7A ?? VissWwiiwasi Bilder FIG . 7B Patent Application Publication Aug. 20 , 2020 Sheet 13 of 66 US 2020/0263256 A1 FIG . 8 FIG . 8A LUNC WHCC FIG . 8B tiam Tinano Patent Application Publication Aug. 20 , 2020 Sheet 14 of 66 US 2020/0263256 A1 SØSXS3 WXSQ vongipusosoggenstossXL ***** SWEX Was SC $ % : $ YOX . FIG.9 ? ???? *** Xasax XXX8 18733XS $ SHAD $$$ VYYS : * 3 V. $ X883 * XX Patent Application Publication Aug. 20 , 2020 Sheet 15 of 66 US 2020/0263256 A1 FIG . 10 FIG . 10A FIG . 10B Patent Application Publication Aug. 20 , 2020 Sheet 16 of 66 US 2020/0263256 A1 FIG . 11 NANFIG . 11A . FIG . 11B LO Patent Application Publication Aug. 20 , 2020 Sheet 17 of 66 US 2020/0263256 A1 il 02 FIG.12A N W WS wwire Patent Application Publication Aug. 20 , 2020 Sheet 18 of 66 US 2020/0263256 A1 su FIG.12B . Uno Wait Patent Application Publication Aug. 20 , 2020 Sheet 19 of 66 US 2020/0263256 A1 Yesus 232,33DE Fase63%. MS23 433H200W TUBESHIKOPESEBOK Aixmixabink265% FIG.13 XeryDenny ng FaxExtisticaXXX M3 SantosGKC Zekeriyasi WUMVIXX3 vo SSBS3,33333433X316SSSSS Patent Application Publication Aug. 20 , 2020 Sheet 20 of 66 US 2020/0263256 A1 FIG . 14 FIG . 14A FIG . 14B I I FIG . 14C FIG . 14D LUTA XX Patent Application Publication Aug. 20 , 2020 Sheet 21 of 66 US 2020/0263256 A1 21.708 controlSmoking IS P w FIG.15B FIG.15D 17 H MO H 800-134Out HH HE HE NonsmokingSmokingcontrol $ FIG.15A FIG.15C Patent Application Publication Aug. 20 , 2020 Sheet 22 of 66 US 2020/0263256 A1 FIG . 16 FIG . 16A FIG . 16B dowwwwwwwwwwwww wwwwwwwwwwww 1 cdscore FIG . 16C FIG . 16D S FIG . 16E FIG . 16F cdscore FIG . 16G FIG . 16H W Patent Application Publication Aug. 20 , 2020 Sheet 23 of 66 US 2020/0263256 A1 FIG . 16 cont . FIG . 161 FIG . 16J CERA30m FIG . 16K FIG . 16L FIG . 16M FIG . 16N he FIG . 160 FIG . 16P Patent Application Publication Aug. 20 , 2020 Sheet 24 of 66 US 2020/0263256 A1 FIG . 160 Truepositiverate cd - score (AUC :0.977 ) n : norma = 2247, LUNG = 599 WWW o normal956 , LUNC - 205 False positive rate FIG . 16R Truepositiverate n : normat= 2247 , HCC = 889 AFP ( AUC :0.835 ) False positive rate Patent Application Publication Aug. 20 , 2020 Sheet 25 of 66 US 2020/0263256 A1 FIG . 17 FIG . 17A HCC FIG . 17B ??. FIG . 17C FIG . 17D ??? ??? ???? ??? ?????? ????? ?????? ?????? FIG . 17E FIG . 17F "!***tip 0. Patent Application Publication Aug. 20 , 2020 Sheet 26 of 66 US 2020/0263256 A1 FIG . 18 FIG . 18A Stage I LUNC : n = 94 Benign nodules : n = 126 29191m FIG . 18B Stage I LUNC 27 Specificity ( % ) Patent Application Publication Aug.20 , 2020 Sheet 27 of 66 US 2020/0263256 A1 ?? ? ? ? ? ? ?? ? FIG.19B FIG.19D ? ?? ? ? ? ? FIG.19A FIG190. Patent Application Publication Aug. 20 , 2020 Sheet 28 of 66 US 2020/0263256 A1 FIG . 20A FIG . 20B Patent Application Publication Aug. 20 , 2020 Sheet 29 of 66 US 2020/0263256 A1 FIG . 20C HCC Patent Application Publication Aug. 20 , 2020 Sheet 30 of 66 US 2020/0263256 A1 wy 12:2 IT'S tyring 224722727222277 72 3 3 3 ?? ? ? } } 3 3 ?& WMWWW 262 3.12 Patent Application Publication Aug. 20 , 2020 Sheet 31 of 66 US 2020/0263256 A1 32 WS ???? FIG.22 WiKAWXHLWEBWE $ 2 Patent Application Publication Aug. 20 , 2020 Sheet 32 of 66 US 2020/0263256 A1 FIG . 23A I T colore FIG . 23B ????? Patent Application Publication Aug. 20 , 2020 Sheet 33 of 66 US 2020/0263256 A1 FIG . 24 23 TotalBettylationCOB(kg) TotalMethylationof TotalMotinylationcopy min F F B 6 * 3 3 22 CEADom! 34 - - - ~ 23 $ ten ? ta 28 & po vor k RE Patent Application Publication Aug. 20 , 2020 Sheet 34 of 66 US2020 / 0263256 A1 FG 25 - ;??%?daspg#** PS ?? g Patent Application Publication Aug. 20 , 2020 Sheet 35 of 66 US 2020/0263256 A1 Votiskionaset 369HIC1* Hiponosisanesis Pramurydataset HOROKO Maskassaamiot BruwataCox LASSOC0x Prognosispredictivemodelmarkers 8hy FIG.26 HCC(ICGANormatblandGSEL aristhywion marksis100selecttogla Targetedbisulfatesequencing USUONAandamCENA 40tablewu8kers Targetedsisutfstesequisiting inB6mstientsStununtalmod az1933(10984CCMamal} Voittistinaset 3-658038382791ormai Proiasdesign markers)24 DiBgnosisandygis 715HCC560Normalrm1275( akasselestion modelpredictiveDiagnosismarkers overlapping@by 30markers) Patent Application Publication Aug. 20 , 2020 Sheet 36 of 66 US 2020/0263256 A1 FIG . 27A FIG . 27B Patent Application Publication Aug. 20 , 2020 Sheet 37 of 66 US 2020/0263256 A1 FIG . 27C FIG . 27D 28 Patent Application Publication Aug. 20 , 2020 Sheet 38 of 66 US 2020/0263256 A1 FIG . 27E 2000 Trueposiverate AUCCIO !! . SO False positive rate FIG . 27F Truepostiverate auc 80.96 02 False positive rate Patent Application Publication Aug. 20 , 2020 Sheet 39 of 66 US 2020/0263256 A1 FIG . 27G FIG . 27H *** Patent Application Publication Aug. 20 , 2020 Sheet 40 of 66 US 2020/0263256 A1 FIG . 28A p = 0.85 10 cd-score o Healthy controls Liver disease HCC FIG . 28B le 05 1e +03 AFP(Log) + Healthy controls Liver disease HCC Patent Application Publication Aug. 20 , 2020 Sheet 41 of 66 US 2020/0263256 A1 FIG . 28C 20 10 cd-score T Normal HCC HCOWA FIG . 28D 20 1 88 CHA HCC Before HCC with HCC treatment Response Progression Patent Application Publication Aug. 20 , 2020 Sheet 42 of 66 US 2020/0263256 A1 FIG . 28E cd-score surgery Recurrence FIG . 28F 10 cd-score Normal HCC of HCC of HCC of HCC of controls Stage / Stage || Stage III Stage IV Patent Application Publication Aug. 20 , 2020 Sheet 43 of 66 US 2020/0263256 A1 FIG . 28G Truepositiverate AUC of cd score : 0.969 ( 0.926-0.977 ) X2 To False positive rate FIG . 28H 20 7e36 220 cd-score Initial diagnosis Progression Response Recurrence Patent Application Publication Aug. 20 , 2020 Sheet 44 of 66 US 2020/0263256 A1 FIG . 281 5.8 AFP(Log) with HCC HEO Initial diagnosis Progression Response Recurrence FIG . 28J +0.005 cd-score HCC of HCC or Stage 1 Stage II Stage Ill Stage IV Patent Application Publication Aug. 20 , 2020 Sheet 45 of 66 US 2020/0263256 A1 FIG . 28K ** 0 p = 0.001 AFP(Log) Stagel Stage || Stage Ill Stage IV FIG . 29A Survivalprobability(%) Log - rank test o < 0.0001 Hazard Ratio = 0.16 ( 0.09 0.26 ) 200 300 500 600 Overall survival (Days ) Patent Application Publication Aug. 20 , 2020 Sheet 46 of 66 US 2020/0263256 A1 FIG . 29B Survivalprobability(%) Log - rank test p = 0.0014 Hazard Ratio = 0.32 (0.16-0.61 ) 200 300 500 600 Overall survival (Days ) Patent Application Publication Aug.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Redefining the Specificity of Phosphoinositide-Binding by Human
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins Nilmani Singh1†, Adriana Reyes-Ordoñez1†, Michael A. Compagnone1, Jesus F. Moreno Castillo1, Benjamin J. Leslie2, Taekjip Ha2,3,4,5, Jie Chen1* 1Department of Cell & Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801; 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; 3Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218; 4Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21205; 5Howard Hughes Medical Institute, Baltimore, MD 21205, USA †These authors contributed equally to this work. *Correspondence: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. ABSTRACT Pleckstrin homology (PH) domains are presumed to bind phosphoinositides (PIPs), but specific interaction with and regulation by PIPs for most PH domain-containing proteins are unclear. Here we employed a single-molecule pulldown assay to study interactions of lipid vesicles with full-length proteins in mammalian whole cell lysates.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • ARHGAP25 (A-12): Sc-137297
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . ARHGAP25 (A-12): sc-137297 BACKGROUND SOURCE GTPase-activating proteins (GAPs) accelerate the intrinsic rate of GTP ARHGAP25 (A-12) is an affinity purified goat polyclonal antibody raised hydrolysis of Ras-related proteins, resulting in downregulation of their active against a peptide mapping within an internal region of ARHGAP25 of human form. ARHGAP25 (Rho GTPase activating protein 25), also known as Rho-type origin. GTPase-activating protein 25, is a 645 amino acid protein that contains one Pleckstrin homology (PH) domain and one Rho-GAP domain. Encoded by a PRODUCT gene that maps to human chromosome 2p14, ARHGAP25 exists as four alter - Each vial contains 200 µg IgG in 1.0 ml of PBS with < 0.1% sodium azide natively spliced isoforms and shares significant homology with ARHGAP22 and 0.1% gelatin. and ARHGAP24 by exhibiting a common domain structure (PH-RhoGAP-CC); however, tissue expression of ARHGAP25 is myeloid-specific. ARHGAP25 is Blocking peptide available for competition studies, sc-137297 P, (100 µg a candidate epigenetic biomarker for non-invasive prenatal diagnosis of Down peptide in 0.5 ml PBS containing < 0.1% sodium azide and 0.2% BSA). syndrome, as well as a candidate gene in a chromosome 2p susceptibility locus linked to salt-sensitive hypertension and drug response. APPLICATIONS ARHGAP25 (A-12) is recommended for detection of ARHGAP25 isoforms 1 REFERENCES and 2 of mouse, rat and human origin by Western Blotting (starting dilution 1. Katoh, M., et al. 2004. Identification and characterization of ARHGAP24 1:100, dilution range 1:50-1:500), immunofluorescence (starting dilution 1:25, and ARHGAP25 genes in silico.
    [Show full text]
  • A Chromosome Level Genome of Astyanax Mexicanus Surface Fish for Comparing Population
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title 2 A chromosome level genome of Astyanax mexicanus surface fish for comparing population- 3 specific genetic differences contributing to trait evolution. 4 5 Authors 6 Wesley C. Warren1, Tyler E. Boggs2, Richard Borowsky3, Brian M. Carlson4, Estephany 7 Ferrufino5, Joshua B. Gross2, LaDeana Hillier6, Zhilian Hu7, Alex C. Keene8, Alexander Kenzior9, 8 Johanna E. Kowalko5, Chad Tomlinson10, Milinn Kremitzki10, Madeleine E. Lemieux11, Tina 9 Graves-Lindsay10, Suzanne E. McGaugh12, Jeff T. Miller12, Mathilda Mommersteeg7, Rachel L. 10 Moran12, Robert Peuß9, Edward Rice1, Misty R. Riddle13, Itzel Sifuentes-Romero5, Bethany A. 11 Stanhope5,8, Clifford J. Tabin13, Sunishka Thakur5, Yamamoto Yoshiyuki14, Nicolas Rohner9,15 12 13 Authors for correspondence: Wesley C. Warren ([email protected]), Nicolas Rohner 14 ([email protected]) 15 16 Affiliation 17 1Department of Animal Sciences, Department of Surgery, Institute for Data Science and 18 Informatics, University of Missouri, Bond Life Sciences Center, Columbia, MO 19 2 Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 20 3 Department of Biology, New York University, New York, NY 21 4 Department of Biology, The College of Wooster, Wooster, OH 22 5 Harriet L. Wilkes Honors College, Florida Atlantic University, Jupiter FL 23 6 Department of Genome Sciences, University of Washington, Seattle, WA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020.
    [Show full text]
  • Malaria Polyclonal B Cell Activator Activation of the Memory
    Increased B Cell Survival and Preferential Activation of the Memory Compartment by a Malaria Polyclonal B Cell Activator This information is current as Daria Donati, Bobo Mok, Arnaud Chêne, Hong Xu, Mathula of October 2, 2021. Thangarajh, Rickard Glas, Qijun Chen, Mats Wahlgren and Maria Teresa Bejarano J Immunol 2006; 177:3035-3044; ; doi: 10.4049/jimmunol.177.5.3035 http://www.jimmunol.org/content/177/5/3035 Downloaded from References This article cites 35 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/177/5/3035.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 2, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Increased B Cell Survival and Preferential Activation of the Memory Compartment by a Malaria Polyclonal B Cell Activator1 Daria Donati,2† Bobo Mok,* Arnaud Cheˆne,*† Hong Xu,† Mathula Thangarajh,‡ Rickard Glas,† Qijun Chen,§ Mats Wahlgren,* and Maria Teresa Bejarano*† Chronic malaria infection is characterized by polyclonal B cell activation, hyperglobulinemia, and elevated titers of autoantibod- ies.
    [Show full text]
  • Genomic and Functional Profiling of Duplicated Chromosome
    Human Molecular Genetics, 2006, Vol. 15, No. 6 853–869 doi:10.1093/hmg/ddl004 Advance Access published on January 30, 2006 Genomic and functional profiling of duplicated chromosome 15 cell lines reveal regulatory alterations in UBE3A-associated ubiquitin–proteasome pathway processes Colin A. Baron1, Clifford G. Tepper2, Stephenie Y. Liu1, Ryan R. Davis1, Nicholas J. Wang3, N. Carolyn Schanen4 and Jeffrey P. Gregg1,* 1Department of Pathology and 2Department of Biochemistry and Molecular Medicine, University of California, Davis School of Medicine, Sacramento, CA 95817, USA, 3Department of Human Genetics, University of 4 California–Los Angeles, Los Angeles, CA, USA and Center for Pediatric Research, Nemours Biomedical Research, Downloaded from Alfred I. duPont Hospital for Children, Wilmington, DE, USA Received November 21, 2005; Revised and Accepted January 25, 2006 Autism is a complex neurodevelopmental disorder having both genetic and epigenetic etiological elements. hmg.oxfordjournals.org Isodicentric chromosome 15 (Idic15), characterized by duplications of the multi-disorder critical region of 15q11–q14, is a relatively common cytogenetic event. When the duplication involves maternally derived con- tent, this abnormality is strongly correlated with autism disorder. However, the mechanistic links between Idic15 and autism are ill-defined. To gain insight into the potential role of these duplications, we performed a comprehensive, genomics-based characterization of an in vitro model system consisting of lymphoblast cell lines derived from individuals with both autism and Idic15. Array-based comparative genomic hybridiz- ation using commercial single nucleotide polymorphism arrays was conducted and found to be capable of by guest on December 17, 2010 sub-classifying Idic15 samples by virtue of the lengths of the duplicated chromosomal region.
    [Show full text]
  • Phosphoinositide 3-Kinase Enables Phagocytosis of Large Particles by Terminating Actin Assembly Through Rac/Cdc42 Gtpase-Activating Proteins
    ARTICLE Received 13 Apr 2015 | Accepted 11 Sep 2015 | Published 14 Oct 2015 DOI: 10.1038/ncomms9623 OPEN Phosphoinositide 3-kinase enables phagocytosis of large particles by terminating actin assembly through Rac/Cdc42 GTPase-activating proteins Daniel Schlam1,2, Richard D. Bagshaw3, Spencer A. Freeman1, Richard F. Collins1, Tony Pawson3, Gregory D. Fairn2,4 & Sergio Grinstein1,2,4 Phagocytosis is responsible for the elimination of particles of widely disparate sizes, from large fungi or effete cells to small bacteria. Though superficially similar, the molecular mechanisms involved differ: engulfment of large targets requires phosphoinositide 3-kinase (PI3K), while that of small ones does not. Here, we report that inactivation of Rac and Cdc42 at phagocytic cups is essential to complete internalization of large particles. Through a screen of 62 RhoGAP-family members, we demonstrate that ARHGAP12, ARHGAP25 and SH3BP1 are responsible for GTPase inactivation. Silencing these RhoGAPs impairs phagocytosis of large targets. The GAPs are recruited to large—but not small—phagocytic cups by products of PI3K, where they synergistically inactivate Rac and Cdc42. Remarkably, the prominent accumulation of phosphatidylinositol 3,4,5-trisphosphate characteristic of large-phagosome formation is less evident during phagocytosis of small targets, accounting for the contrasting RhoGAP distribution and the differential requirement for PI3K during phagocytosis of dissimilarly sized particles. 1 Division of Cell Biology, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario, Canada M5G1X8. 2 Institute of Medical Science, University of Toronto, Faculty of Medicine, 1 King’s College Circle, Toronto, Ontario, Canada M5S1A8. 3 Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario, Canada M5G1X5.
    [Show full text]
  • Mouse Arhgap25 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Arhgap25 Knockout Project (CRISPR/Cas9) Objective: To create a Arhgap25 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Arhgap25 gene (NCBI Reference Sequence: NM_001037727 ; Ensembl: ENSMUSG00000030047 ) is located on Mouse chromosome 6. 11 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000113637). Exon 3~4 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit altered leukocyte transendothelial migration. Exon 3 starts from about 13.48% of the coding region. Exon 3~4 covers 10.55% of the coding region. The size of effective KO region: ~4074 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 11 Legends Exon of mouse Arhgap25 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 4 is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • WO 2014/210448 Al 31 December 2014 (31.12.2014) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/210448 Al 31 December 2014 (31.12.2014) P O P C T (51) International Patent Classification: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, A61K 45/00 (2006.01) C12N 15/09 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, A61K 48/00 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2014/044554 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, 27 June 2014 (27.06.2014) TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, 61/840,21 1 27 June 2013 (27.06.2013) US UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (71) Applicant: THE BOARD OF REGENTS OF THE UNI¬ EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, VERSITY OF TEXAS SYSTEM [US/US]; 201 W.
    [Show full text]
  • Comparative Analysis of Gene Expression Profiles in Children with Type 1 Diabetes Mellitus
    MOLECULAR MEDICINE REPORTS 19: 3989-4000, 2019 Comparative analysis of gene expression profiles in children with type 1 diabetes mellitus LIWEI QIAN1*, HONGLEI SHI1* and MEILI DING2 1Department of Pediatrics, The Second People's Hospital of Liaocheng, Liaocheng, Shandong 252000; 2Department of Pediatrics, Shandong Jining No. 1 People's Hospital, Jining, Shandong 272011, P.R. China Received December 20, 2017; Accepted June 22, 2018 DOI: 10.3892/mmr.2019.10099 Abstract. Type 1 diabetes (T1D) is an autoimmune disease (IL23A)] was performed in the GEO dataset. Compared with that is typically diagnosed in children. The aim of the present the normal control group, a total of 1,467 DEGs with P<0.05 study was to identify potential genes involved in the pathogen- were identified in children with T1D. CISH and SCAF11 were esis of childhood T1D. Two datasets of mRNA expression in determined to be the most up- and downregulated genes, respec- children with T1D were obtained from the Gene Expression tively. Heterogeneous nuclear ribonucleoprotein D (HNRNPD; Omnibus (GEO). Differentially expressed genes (DEGs) in degree=33), protein kinase AMP-activated catalytic subunit α1 children with T1D were identified. Functional analysis was (PRKAA1; degree=11), integrin subunit α4 (ITGA4; degree=8) performed and a protein-protein interaction (PPI) network was and ESR1 (degree=8) were identified in the PPI network as constructed, as was a transcription factor (TF)-target network. high‑degree genes. ARHGAP25 (degree=12), HNRNPD The expression of selected DEGs was further assessed using (degree=10), HLA‑DRB4 (degree=10) and IL23A (degree=9) reverse transcription-quantitative polymerase chain reaction were high‑degree genes identified in the TF‑target network.
    [Show full text]