DOCSLIB.ORG

Role of Mitogen-Activated Protein Kinase Kinase 4 in Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of Mitogen-Activated Protein Kinase Kinase 4 in Cancer Oncogene (2007) 26, 3172–3184 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW Role of mitogen-activated protein kinase kinase 4 in cancer AJ Whitmarsh1 and RJ Davis2 1Faculty of Life Sciences, University of Manchester, Manchester, UK and 2Howard Hughes Medical Institute, Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA, USA Mitogen-activated protein (MAP) kinase kinase 4 of the extracellular signal-regulated kinase (ERK), (MKK4) is a component of stress activated MAP kinase ERK5, c-Jun N-terminal kinase (JNK) and p38 (Chang signaling modules.It directly phosphorylates and activates and Karin, 2001). the c-Jun N-terminal kinase (JNK) and p38 families of The JNK and p38 MAP kinases are collectively MAP kinases in response to environmental stress, pro- referred to as stress-activated MAP kinases. They are inflammatory cytokines and developmental cues.MKK4 is activated in response to a variety of environmental ubiquitously expressed and the targeted deletion of the stresses and pro-inflammatory cytokines, and also play Mkk4 gene in mice results in early embryonic lethality. important roles in development (Davis, 2000; Kyriakis Further studies in mice have indicated a role for MKK4 in and Avruch, 2001). A number of MKKs can phosphor- liver formation, the immune system and cardiac hyper- ylate and activate JNK and p38. MKK3 and MKK6 trophy.In humans, it is reported that loss of function activate p38, MKK7 activates JNK, whereas MKK4 mutations in the MKK4 gene are found in approximately can activate both JNK and p38 (Davis, 2000; Kyriakis 5% of tumors from a variety of tissues, suggesting it may and Avruch, 2001) (Figure 1a). The JNK and p38 have a tumor suppression function.Furthermore, MKK4 pathways are implicated in tumor suppression (Kennedy has been identified as a suppressor of metastasis of and Davis, 2003; Bulavin and Fornace Jr, 2004) and this prostate and ovarian cancers.However, the role of MKK4 is supported by the presence of loss of function in cancer development appears complex as other studies mutations in the MKK4 gene in approximately 5% of support a pro-oncogenic role for MKK4 and JNK.Here human tumors from a variety of tissues (Teng et al., we review the biochemical and functional properties of 1997; Su et al., 1998). However, it is also reported that MKK4 and discuss the likely mechanisms by which it may MKK4 and JNK can participate in tumor formation regulate the steps leading to the formation of cancers. suggesting a more complex role for this pathway in Oncogene (2007) 26, 3172–3184. doi:10.1038/sj.onc.1210410 tumor development (Kennedy and Davis, 2003; Wang et al., 2004). Keywords: MAP kinase; MKK4; JNK; p38; tumor In this review, we describe the properties of MKK4 suppressor and examine how this protein kinase and its down- stream targets contribute to controlling the development of cancers. Introduction Biochemical properties of MKK4 The mitogen-activated protein (MAP) kinase signaling Cloning, structure and tissue distribution of MKK4 pathways are important mediators of cellular responses MKK4 was first identified in screens for novel MKK to extracellular signals that include growth factors, family members in Xenopus laevis and termed XMEK2 hormones, cytokines and environmental stresses (Chang (Yashar et al., 1993). Subsequently the Drosophila, and Karin, 2001). These pathways are evolutionarily mouse and human homologs were cloned and named conserved among eukaryotes and feature a triple kinase DMKK4, stress-activate protein kinase/extracellular- cascade comprised of the MAP kinase which is signal-regulated protein kinase kinase-1 and MKK4, phosphorylated and activated by a MAP kinase kinase respectively (Sanchez et al., 1994; De´ rijard et al., 1995; (MKK), which itself is phosphorylated and activated by Lin et al., 1995; Han et al., 1998). The human MKK4 a MAP kinase kinase kinase (MKKK) (Chang and gene is located on chromosome 17 and encodes a protein Karin, 2001). In mammals, four distinct MAP kinase of 399 amino acids (De´ rijard et al., 1995; Yoshida et al., pathways have been identified that lead to the activation 1999). Overall the mammalian MKK family share about 40% homology within their catalytic domains and Correspondence: Professor RJ Davis, Howard Hughes Medical MKK4 is most similar to MKK7 in this region (50% Institute, Program in Molecular Medicine, University of Massachu- setts Medical School, 373 Plantation Street, Worcester, MA 01605, identity; Tournier et al., 1997; Cuenda, 2000). The USA. catalytic domains of MKKs, like other Ser/Thr kinases, E-mail: [email protected] contain 11 subdomains (Hanks et al., 1988). The crystal MKK4 in cancer AJ Whitmarsh and RJ Davis 3173 a binding determinant is the domain for versatile docking Ras and Rho-family GTPases (DVD) located in the C-terminus of MKKs (Xia et al., 1998; Takekawa et al., 2005; Figure 1b). The interac- tions between MKKs and the upstream and downstream kinases of the cascade appear to be critical for efficient MEKK MLK TAK1 ASK1 TPL2 signal transfer through MAP kinase pathways (Xia et al., 1998; Ho et al., 2003; Takekawa et al., 2005). MKK4 mRNA is ubiquitously expressed in adult MKK7MKK4 MKK3 MKK6 mouse and human tissue with the highest levels of expression in brain, in particular in the cerebral cortex, hypothalamus, hippocampus and cerebellum (Sanchez et al., 1994; De´ rijard et al., 1995; Carboni et al., 1997; JNK p38 Lee et al., 1999). In early embryogenesis in mice (up to embryonic day 10 (E10)), Mkk4 transcripts are confined to the central nervous system. Later, starting at E12, Cyclin D1 MAPKAPK2 Mkk4 becomes highly expressed in the developing liver c-Jun Bax p53 p53 Bcl2 coincident with a period of active differentiation and an Bax increase in liver size (Lee et al., 1999). Subcellular 14-3-3 Bim AR CDC25 RXRα Bmf localization studies demonstrate that MKK4 protein is RARα Bcl-XL mainly found in the cytoplasm, although some nuclear AR Mcl-1 localization has been detected (Tournier et al., 1999; Coffey et al., 2000). 257 261 b S-I-A-K-T 1 94 399 D KD DVD MKK4 activation of JNK and p38 MAP kinases 39 45 364 387 MKK4 is unique among the mammalian MKK family Figure 1 (a) Mammalian stress-activated MAP kinase pathways. in its ability to phosphorylate and activate two MAP JNK is activated by phosphorylation by MKK4 and MKK7 kinase groups: JNK and p38 (De´ rijard et al., 1995; Lin whereas p38 is activated by MKK4, MKK3 and MKK6. These et al., 1995). MKK3 and MKK6 are specific for p38, MKKs can be activated by many different MKKKs depending on whereas MKK7 is a specific JNK activator (Davis, 2000; the stimulus. JNK and p38 phosphorylate many known regulators of tumorigenesis. (b) Domain structure of MKK4. The kinase Kyriakis and Avruch, 2001). MKK4 activates all the domain (KD) of MKK4 contains eleven subdomains. MKK4 is mammalian JNK isoforms (JNK1, JNK2 and JNK3) activated by phosphorylation of the Ser and Thr residues (in bold) and a subset of p38 isoforms (p38a, p38b) (De´ rijard within the S-I-A-K-T motif located between subdomains VII and et al., 1995; Lin et al., 1995; Jiang et al., 1996). VIII. At the N-terminus there is a D-domain (D) motif for binding to JNK and p38, and at the C-terminus a DVD domain that All MAP kinases are activated by phosphorylation of mediates interactions with various MKKKs. The numbers refer to the Thr and Tyr residues of a Thr-X-Tyr motif located amino acids in human MKK4. within kinase subdomain VIII (Chang and Karin, 2001). Both residues need to be phosphorylated for full activation of the MAP kinase (Chang and Karin, 2001). However, it was observed in vitro that MKK4 structures of MEK1 and MEK2, the MKKs in the ERK preferentially phosphorylated the Tyr residue on JNK pathway, demonstrate that MKKs fold into a small b- (Sanchez et al., 1994; Lin et al., 1995), whereas the stranded N-terminal lobe and a larger helical C-terminal second JNK activator, MKK7, preferentially targeted lobe (Ohren et al., 2004). The adenosine triphosphate the Thr residue (Lawler et al., 1998). These observations binding site is located in the cleft formed between the led to the hypothesis that JNK isoforms are activated two lobes and is surrounded by residues that are synergistically by MKK4 and MKK7 (Lawler et al., conserved between the MKK family members (Cuenda, 1998; Fleming et al., 2000; Lisnock et al., 2000). Some 2000; Ohren et al., 2004). in vivo evidence to support this model has come from MKK4, similar to the other MKKs, also contains studies using mouse embryonic stem (ES) cells and docking sites for both upstream and downstream mouse embryonic fibroblasts (MEFs) that feature components of the JNK and p38 signaling cascades targeted deletions of the Mkk4 and Mkk7 genes (Xia et al., 1998; Ho et al., 2003; Takekawa et al., 2005; (Tournier et al., 2001; Wada et al., 2001; Kishimoto Figure 1b). At the N-terminus there is a D-domain type et al., 2003). These studies also demonstrated that docking site that binds to JNK and p38 (Ho et al., distinct stimuli might differentially utilize MKK4 and 2003). In addition to MKKs, D-domain docking sites MKK7. For example, the activation of JNK in response that bind to MAP kinases are found in many proteins to the pro-inflammatory cytokines tumor necrosis involved in MAP kinase signaling including MAP factor-a (TNFa) and interleukin-1 (IL-1) was almost kinase phosphatases, substrates, and scaffold or adaptor completely abolished in Mkk7À/À MEFs, but reduced proteins (Sharrocks et al., 2000). The region encom- to around 50% activation in Mkk4À/À cells (Tournier passing the D-domain may also participate in the et al., 2001).
Load more

Recommended publications
  • Regulation of Calcium/Calmodulin-Dependent Protein Kinase II Activation by Intramolecular and Intermolecular Interactions
    8394 • The Journal of Neuroscience, September 29, 2004 • 24(39):8394–8398 Mini-Review Regulation of Calcium/Calmodulin-Dependent Protein Kinase II Activation by Intramolecular and Intermolecular Interactions Leslie C. Griffith Department of Biology and Volen Center for Complex Systems, Brandeis University, Waltham, Massachusetts 02454-9110 Key words: calcium; calmodulin; learning; localization; NMDA; phosphatase; protein kinase As its name implies, calcium/calmodulin-dependent protein ki- The overlap of these subdomains is no accident. Binding of nase II (CaMKII) is calcium dependent. In its basal state, the Ca 2ϩ/CaM is the primary signal for release of autoinhibition. activity of CaMKII is extremely low. Regulation of intracellular Current models of activation posit that the binding of Ca 2ϩ/CaM calcium levels allows the neuron to link activity with phosphor- serves to disrupt the interactions of specific residues within the ylation by CaMKII. This review will briefly summarize our cur- autoinhibitory domain with the catalytic domain (Smith et al., rent understanding of the intramolecular mechanisms of activity 1992). Because there is no crystal structure for the catalytic and regulation and their modulation by Ca 2ϩ/CaM and will then regulatory parts of CaMKII, the interaction face of these two focus on the growing number of other modes of intermolecular domains has been inferred using the effects of charge-reversal regulation of CaMKII activity by substrate and scaffolding mutagenesis on activity and molecular modeling (Yang and molecules. Schulman, 1999). This study confirmed the role of Arg 297 at the P-3 position of the pseudosubstrate ligand (Mukherji and Soder- Regulation of CaMKII by its autoinhibitory domain ling, 1995) and identified residues in the catalytic domain that All members of the CaMKII family (␣, ␤, ␥, and ␦ isozymes) share may have direct interactions with the regulatory region.
    [Show full text]
  • Plant Mitogen-Activated Protein Kinase Signaling Cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§
    392 Plant mitogen-activated protein kinase signaling cascades Guillaume Tena*, Tsuneaki Asai†, Wan-Ling Chiu‡ and Jen Sheen§ Mitogen-activated protein kinase (MAPK) cascades have components that link sensors/receptors to target genes emerged as a universal signal transduction mechanism that and other cellular responses. connects diverse receptors/sensors to cellular and nuclear responses in eukaryotes. Recent studies in plants indicate that In the past few years, it has become apparent that mitogen- MAPK cascades are vital to fundamental physiological functions activated protein kinase (MAPK) cascades play some of the involved in hormonal responses, cell cycle regulation, abiotic most essential roles in plant signal transduction pathways stress signaling, and defense mechanisms. New findings have from cell division to cell death (Figure 1). MAPK cascades revealed the complexity and redundancy of the signaling are evolutionarily conserved signaling modules with essen- components, the antagonistic nature of distinct pathways, and tial regulatory functions in eukaryotes, including yeasts, the use of both positive and negative regulatory mechanisms. worms, flies, frogs, mammals and plants. The recent enthu- siasm for plant MAPK cascades is backed by numerous Addresses studies showing that plant MAPKs are activated by hor- Department of Molecular Biology, Massachusetts General Hospital, mones, abiotic stresses, pathogens and pathogen-derived Department of Genetics, Harvard Medical School, Wellman 11, elicitors, and are also activated at specific stages during the 50 Blossom Street, Boston, Massachusetts 02114, USA cell cycle [2]. Until recently, studies of MAPK cascades in *e-mail: [email protected] †e-mail: [email protected] plants were focused on cDNA cloning [3,4] and used a ‡e-mail: [email protected] MAPK in-gel assay, MAPK and tyrosine-phosphate anti- §e-mail: [email protected] bodies, and kinase inhibitors to connect signals to MAPKs Current Opinion in Plant Biology 2001, 4:392–400 [2].
    [Show full text]
  • Diverse Physiological Functions for Dual-Specificity MAP Kinase
    Commentary 4607 Diverse physiological functions for dual-specificity MAP kinase phosphatases Robin J. Dickinson and Stephen M. Keyse* Cancer Research UK Stress Response Laboratory, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK *Author for correspondence (e-mail: [email protected]) Accepted 19 September 2006 Journal of Cell Science 119, 4607-4615 Published by The Company of Biologists 2006 doi:10.1242/jcs.03266 Summary A structurally distinct subfamily of ten dual-specificity functions in mammalian cells and tissues. However, recent (Thr/Tyr) protein phosphatases is responsible for the studies employing a range of model systems have begun to regulated dephosphorylation and inactivation of mitogen- reveal essential non-redundant roles for the MKPs in activated protein kinase (MAPK) family members in determining the outcome of MAPK signalling in a variety mammals. These MAPK phosphatases (MKPs) interact of physiological contexts. These include development, specifically with their substrates through a modular kinase- immune system function, metabolic homeostasis and the interaction motif (KIM) located within the N-terminal non- regulation of cellular stress responses. Interestingly, these catalytic domain of the protein. In addition, MAPK binding functions may reflect both restricted subcellular MKP is often accompanied by enzymatic activation of the C- activity and changes in the levels of signalling through terminal catalytic domain, thus ensuring specificity of multiple MAPK pathways. action. Despite our knowledge of the biochemical and structural basis for the catalytic mechanism of the MKPs, we know much less about their regulation and physiological Key words: MAPK, MKP, Signal transduction, Phosphorylation Introduction the activation motif is required for MAPK activity, Mitogen-activated protein kinases (MAPKs) constitute a dephosphorylation of either residue inactivates these enzymes.
    [Show full text]
  • Regulation of Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase (PDE1): Review
    95-105 5/6/06 13:44 Page 95 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 95-105, 2006 95 Regulation of calmodulin-stimulated cyclic nucleotide phosphodiesterase (PDE1): Review RAJENDRA K. SHARMA, SHANKAR B. DAS, ASHAKUMARY LAKSHMIKUTTYAMMA, PONNIAH SELVAKUMAR and ANURAAG SHRIVASTAV Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Cancer Research Division, Saskatchewan Cancer Agency, 20 Campus Drive, Saskatoon SK S7N 4H4, Canada Received January 16, 2006; Accepted March 13, 2006 Abstract. The response of living cells to change in cell 6. Differential inhibition of PDE1 isozymes and its environment depends on the action of second messenger therapeutic applications molecules. The two second messenger molecules cAMP and 7. Role of proteolysis in regulating PDE1A2 Ca2+ regulate a large number of eukaryotic cellular events. 8. Role of PDE1A1 in ischemic-reperfused heart Calmodulin-stimulated cyclic nucleotide phosphodiesterase 9. Conclusion (PDE1) is one of the key enzymes involved in the complex interaction between cAMP and Ca2+ second messenger systems. Some PDE1 isozymes have similar kinetic and 1. Introduction immunological properties but are differentially regulated by Ca2+ and calmodulin. Accumulating evidence suggests that the A variety of cellular activities are regulated through mech- activity of PDE1 is selectively regulated by cross-talk between anisms controlling the level of cyclic nucleotides. These Ca2+ and cAMP signalling pathways. These isozymes are mechanisms include synthesis, degradation, efflux and seque- also further distinguished by various pharmacological agents. stration of cyclic adenosine 3':5'-monophosphate (cAMP) and We have demonstrated a potentially novel regulation of PDE1 cyclic guanosine 3':5'- monophosphate (cGMP) within the by calpain.
    [Show full text]
  • G Protein Regulation of MAPK Networks
    Oncogene (2007) 26, 3122–3142 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW G Protein regulation of MAPK networks ZG Goldsmith and DN Dhanasekaran Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, USA G proteins provide signal-coupling mechanisms to hepta- the a-subunits has been used as a basis for the helical cell surface receptors and are criticallyinvolved classification of G proteins into Gs,Gi,Gq and G12 in the regulation of different mitogen-activated protein families in which the a-subunits that show more than kinase (MAPK) networks. The four classes of G proteins, 50% homology are grouped together (Simon et al., defined bythe G s,Gi,Gq and G12 families, regulate 1991). In G-protein-coupled receptor (GPCR)-mediated ERK1/2, JNK, p38MAPK, ERK5 and ERK6 modules by signaling pathways, ligand-activated receptors catalyse different mechanisms. The a- as well as bc-subunits are the exchange of the bound GDP to GTP in the a-subunit involved in the regulation of these MAPK modules in a following which the GTP-bound a-subunit disassociate context-specific manner. While the a- and bc-subunits from the receptor as well as the bg-subunit. The GTP- primarilyregulate the MAPK pathwaysvia their respec- bound a-subunit and the bg-subunit stimulate distinct tive effector-mediated signaling pathways, recent studies downstream effectors including enzymes, ion channels have unraveled several novel signaling intermediates and small GTPase, thus regulating multiple signaling including receptor tyrosine kinases and small GTPases pathways including those involved in the activation of through which these G-protein subunits positivelyas well mitogen-activated protein kinase (MAPK) modules as negativelyregulate specific MAPK modules.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course
    8516 Vol. 10, 8516–8520, December 15, 2004 Clinical Cancer Research MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course Wei Xin,1 Ki J. Yun,4 Francesca Ricci,2 ing patterns were also evaluated among unresectable pri- Marianna Zahurak,3 Wanglong Qiu,4 mary and metastatic cancer tissues from autopsy specimens, Gloria H. Su,4 Charles J. Yeo,5,6 indicating intact Mkk4 immunolabeling in 88.8% of the unresectable primary carcinomas as compared with 63.3% Ralph H. Hruban,4,5 Scott E. Kern,4,5 and 4,5 of distant metastases (P < 0.001). Our data indicate that the Christine A. Iacobuzio-Donahue loss of Mkk4 protein expression in pancreatic carcinomas 1 Department of Pathology, The University of Michigan Medical may be more frequent than suggested by the rates of genetic Center, Ann Arbor, Michigan; 2Department of Pathology, University La Sapienza, Rome, Italy; and the Departments of 3Biostatistics, inactivation alone and that MKK4 loss may contribute to 4Pathology, 5Oncology, and 6Surgery, The Johns Hopkins University disease progression. The correlation of MKK4 genetic status Hospital, Baltimore, Maryland with immunolabeling patterns validate this approach for the evaluation of MKK4 status in routine histologic sections and ABSTRACT may provide useful information regarding patient prognosis. MKK4 (MAP2K4/SEK1) is a member of the mitogen- activated protein kinase family, originally identified as a INTRODUCTION kinase involved in the stress-activated protein kinase path- The mitogen-activated protein (MAP) kinase cascades are way by directly phosphorylating c-Jun NH -terminal kinase. 2 multifunctional signaling pathways that are evolutionally well MKK4 genetic inactivation has been observed in a subset of conserved in all of the eukaryotic cells.
    [Show full text]
  • G Protein-Coupled Receptor Signalling in Neuroendocrine Systems
    117 G PROTEIN-COUPLED RECEPTOR SIGNALLING IN NEUROENDOCRINE SYSTEMS ‘Location, location, location’: activation and targeting of MAP kinases by G protein-coupled receptors L M Luttrell Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA and The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, Durham, North Carolina 27705, USA (Requests for offprints should be addressed to L M Luttrell, N3019 The Geriatrics Research, Education and Clinical Center, Durham Veterans Affairs Medical Center, 508 Fulton Street, Durham, North Carolina 27710, USA; Email: [email protected]) Abstract A growing body of data supports the conclusion that G protein-coupled receptors can regulate cellular growth and differentiation by controlling the activity of MAP kinases. The activation of heterotrimeric G protein pools initiates a complex network of signals leading to MAP kinase activation that frequently involves cross-talk between G protein-coupled receptors and receptor tyrosine kinases or focal adhesions. The dominant mechanism of MAP kinase activation varies significantly between receptor and cell type. Moreover, the mechanism of MAP kinase activation has a substantial impact on MAP kinase function. Some signals lead to the targeting of activated MAP kinase to specific extranuclear locations, while others activate a MAP kinase pool that is free to translocate to the nucleus and contribute to a mitogenic response. Journal of Molecular Endocrinology (2003) 30, 117–126 Introduction between intracellular receptor domains and the GDP-bound G subunit of a heterotrimeric G The G protein-coupled receptors (GPCRs) make protein triggers GTP for GDP exchange on the G up the largest superfamily of cell surface receptors subunit and dissociation of the GTP-bound G in the human genome, where they are represented subunit from the G heterodimer.
    [Show full text]
  • Calcium/Calmodulin-Dependent Protein Kinase II: an Unforgettable Kinase
    The Journal of Neuroscience, September 29, 2004 • 24(39):8391–8393 • 8391 Mini-Review Calcium/Calmodulin-Dependent Protein Kinase II: An Unforgettable Kinase Leslie C. Griffith Department of Biology and Volen Center for Complex Systems, Brandeis University, Waltham, Massachusetts 02454-9110 Key words: calcium; calmodulin; learning; localization; LTP; NMDA; phosphatase; protein kinase; knock-out mice The search for “memory molecules” and why CaMKII is an mers of different isozymes are able to coassemble, allowing for a appealing candidate large number of possible holoenzyme compositions. Measure- Since the time neuroscientists first recognized that biochemical ment of the Stoke’s radii and sedimentation coefficients of rat events inside neurons could influence the function of the brain, brain and Drosophila CaMKIIs suggested a holoenzyme of 8–12 there have been people looking for “memory molecules.” This subunits (Bennett et al., 1983; Kuret and Schulman, 1984; elusive ion, small molecule, protein, or nucleic acid would be the GuptaRoy and Griffith, 1996). Early electron microscopic studies keystone on which memory was built; understanding the mem- of CaMKII purified from rat brain found some heterogeneity in ory molecule would allow us to unlock the mysteries of cognition. holoenzyme size, reporting both 8 and 10 subunit particles (Ka- Models of how this molecule could work abounded, but the idea naseki et al., 1991). More recent single-particle studies, using of a memory molecule as a kinase/phosphatase-based molecular recombinant rat CaMKII, have provided much higher-resolution switch emerged as an important contender (Lisman, 1985). The (21–25 Å) images (Kolodziej et al., 2000; Gaertner et al., 2004).
    [Show full text]
  • Juvenile Hormone-Activated Phospholipase C Pathway PNAS PLUS Enhances Transcriptional Activation by the Methoprene-Tolerant Protein
    Juvenile hormone-activated phospholipase C pathway PNAS PLUS enhances transcriptional activation by the methoprene-tolerant protein Pengcheng Liua, Hong-Juan Pengb, and Jinsong Zhua,1 aDepartment of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061; and bDepartment of Pathogen Biology, School of Public Health and Tropical Medicine, Southern Medical University, Guangzhou, Guangdong, 510515, China Edited by Lynn M. Riddiford, Howard Hughes Medical Institute Janelia Farm Research Campus, Ashburn, VA, and approved March 11, 2015 (received for review December 4, 2014) Juvenile hormone (JH) is a key regulator of a wide diversity of in the regulatory regions of JH-responsive genes, leading to developmental and physiological events in insects. Although the the transcriptional activation of these genes (12). This function intracellular JH receptor methoprene-tolerant protein (MET) func- of MET–TAI in the JH-induced gene expression seems to be tions in the nucleus as a transcriptional activator for specific JH- evolutionarily conserved in Ae. aegypti, D. melanogaster, the red regulated genes, some JH responses are mediated by signaling flour beetle Tribolium castaneum, the silkworm Bombyx mori,and pathways that are initiated by proteins associated with plasma the cockroach Bombyx mori (9, 13–16). membrane. It is unknown whether the JH-regulated gene expres- The mechanisms by which JH exerts pleiotropic functions are sion depends on the membrane-mediated signal transduction. In manifold in insects. Several studies suggest that JH can act via a Aedes aegypti mosquitoes, we found that JH activated the phos- receptor on plasma membrane (3, 17). For example, develop- pholipase C (PLC) pathway and quickly increased the levels of ino- ment of ovarian patency during vitellogenesis is stimulated by JH sitol 1,4,5-trisphosphate, diacylglycerol, and intracellular calcium, in some insects via transmembrane signaling cascades that in- leading to activation and autophosphorylation of calcium/calmod- volve second messengers (18, 19).
    [Show full text]
  • Mitogen-Activated Protein Kinase and Its Activator Are Regulated by Hypertonic Stress in Madin-Darby Canine Kidney Cells
    Mitogen-activated protein kinase and its activator are regulated by hypertonic stress in Madin-Darby canine kidney cells. T Itoh, … , N Ueda, Y Fujiwara J Clin Invest. 1994;93(6):2387-2392. https://doi.org/10.1172/JCI117245. Research Article Madin-Darby canine kidney cells behave like the renal medulla and accumulate small organic solutes (osmolytes) in a hypertonic environment. The accumulation of osmolytes is primarily dependent on changes in gene expression of enzymes that synthesize osmolytes (sorbitol) or transporters that uptake them (myo-inositol, betaine, and taurine). The mechanism by which hypertonicity increases the transcription of these genes, however, remains unclear. Recently, it has been reported that yeast mitogen-activated protein (MAP) kinase and its activator, MAP kinase-kinase, are involved in osmosensing signal transduction and that mutants in these kinases fail to accumulate glycerol, a yeast osmolyte. No information is available in mammals regarding the role of MAP kinase in the cellular response to hypertonicity. We have examined whether MAP kinase and MAP kinase-kinase are regulated by extracellular osmolarity in Madin-Darby canine kidney cells. Both kinases were activated by hypertonic stress in a time- and osmolarity-dependent manner and reached their maximal activity within 10 min. Additionally, it was suggested that MAP kinase was activated in a protein kinase C- dependent manner. These results indicate that MAP kinase and MAP kinase-kinase(s) are regulated by extracellular osmolarity. Find the latest version:
    [Show full text]