DOCSLIB.ORG

Structural and Functional Aspects of RET Receptor Tyrosine Kinase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structural and Functional Aspects of RET Receptor Tyrosine Kinase Structural and functional aspects of RET receptor tyrosine kinase maturation, signalling and chemical inhibition Emily May Burns University College London and Cancer Research UK London Research Institute PhD Supervisor: Neil McDonald A thesis submitted for the degree of Doctor of Philosophy University College London September 2014 Declaration I Emily Burns confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract The RET receptor tyrosine kinase (RTK) is crucial for embryonic and adult development of multiple organs, tissues and neurons. Gain-of-function mutations in the RET gene are found in human cancer, while loss-of-function mutations are associated with congenital anomalies of the kidney and urinary tract (CAGUT) and Hirschsprung's Disease (HSCR). Previous work has identified that some HSCR RET mutations result in a bottleneck in RET folding and a subsequent loss of RET export. This thesis presents work examining the characteristics of wild type (WT) and HSCR RET maturation, export and signalling in stably transfected mammalian cell lines. High throughput siRNA screening was used to identify components involved in WT and HSCR RET maturation and export; preliminary validation has implicated Endoplasmic Reticulum associated degradation (ERAD), autophagy and the N-glycosylation pathway. RET is also a validated cancer target, as a driver of cancers including multiple endocrine neoplasia (MEN) 2A and B. While there are several FDA-approved RET inhibitors available, their lack of specificity and potency has resulted in high levels of off-target toxicity and low life expectancy extensions. As such, a new generation of more optimal inhibitors is required. This thesis presents the investigation of the molecular basis of RET kinase inhibition, through the elucidation of the RET kinase domain (KD) structure bound to several ATP-competitive chemical inhibitors that are known to inhibit RET in vitro. Preliminary development of an updated RET pharmacophore is described, defining key residue interactions and combining observations with biochemical and thermal stability data. 3 Acknowledgement I am eternally grateful to every member of the McDonald Laboratory, with whom I have thoroughly enjoyed spending the last four years. Thank you Neil, for supporting and challenging me, and for your constant enthusiasm throughout the project. Thank you Phil, for teaching me with ceaseless patience. Thank you Andy, for the long nights at the synchrotron and your positive guidance through every aspect of crystallography. Thank you Svend, for all of your work that has heavily influenced my project. This project would not have been possible without the efforts of Rachael Instrell, Ming Jiang and Becky Saunders from the HTS laboratory - thank you. A special thanks to Mike Howell, for refreshingly frank advice. To my friends at the LRI: you have kept me working and smiling, thank you! My family and friends, thank you for your unwavering support throughout the last four years. Thank you for lending your ear, making me laugh and making life outside of the laboratory so satisfying. Mum and dad, thank you for everything. 4 Table of Contents Abstract ............................................................................................................... 3 Acknowledgement .............................................................................................. 4 Table of Contents ................................................................................................ 5 Table of figures ................................................................................................... 9 List of tables ...................................................................................................... 12 Abbreviations .................................................................................................... 13 Chapter 1. Introduction ................................................................................ 19 1.1 Receptor tyrosine kinase structure, regulation and function............ 19 1.1.1 RTK KD structure and phosphorylation ............................................. 21 1.1.2 Structural elements required for catalytic mechanism ....................... 21 1.1.3 RTK autophosphorylation and regulation .......................................... 23 1.1.4 Regulation of RTK activity ................................................................. 23 1.1.5 The regulatory spine ......................................................................... 24 1.2 Synthesis, trafficking and degradation of RTKs ................................. 25 1.2.1 Protein folding and quality control within the ER ............................... 26 1.2.2 ER to Golgi apparatus transport ........................................................ 30 1.2.3 Functions of the Golgi ....................................................................... 31 1.2.4 RTK endocytosis and receptor recycling ........................................... 31 1.2.5 Mechanisms of RTK degradation ...................................................... 33 1.3 RET structure, ligands-co-receptor partners and biological functions ........................................................................................................ 36 1.3.1 Biological functions of RET ............................................................... 36 1.3.2 RET evolution ................................................................................... 37 1.3.3 RET ligands and co-receptors ........................................................... 38 1.3.4 RET-specific signalling pathways ...................................................... 40 1.3.5 Ligand and co-receptor structures..................................................... 41 1.3.6 RET ectodomain structure ................................................................ 41 1.3.7 RET ternary complex formation ........................................................ 43 1.3.8 RET kinase domain structure and regulation .................................... 45 1.4 The role of RET in human disease ....................................................... 46 1.4.1 Loss-of-function mutations and Hirschsprung’s disease ................... 47 1.4.2 RET gain-of-function mutations and MEN2 ....................................... 49 1.4.3 RET fusion mutations and thyroid cancer, lung cancer and leukaemia .................................................................................................... 50 1.4.4 Over-expression of RET in breast and colorectal cancer .................. 51 1.5 Targeted therapy towards tyrosine kinases in cancer ....................... 51 1.5.1 Chemical inhibition of kinases ........................................................... 52 1.5.2 Clinically approved RET inhibitors..................................................... 53 1.6 Project Aims .......................................................................................... 54 Chapter 2. Materials & Methods .................................................................. 55 2.1 Materials ................................................................................................. 55 2.1.1 Reagents ........................................................................................... 55 2.1.2 Plasticware ........................................................................................ 58 2.2 Methods ................................................................................................. 58 2.2.1 Cell culture ........................................................................................ 58 5 2.2.2 Monitoring RET maturation ............................................................... 60 2.2.3 Detecting RET cell surface expression levels ................................... 62 2.2.4 Mammalian cell transfection.............................................................. 63 2.2.5 Cloning .............................................................................................. 66 2.2.6 Protein expression ............................................................................ 68 2.2.7 Protein purification and analysis ....................................................... 69 2.2.8 X-ray crystallography ........................................................................ 71 Chapter 3. Characterisation of the maturation of a RET S100M missense mutation causal in Hirschsprung’s disease ................................................... 74 3.1 Introduction ........................................................................................... 74 3.2 Structure-based sequence alignments of RET CLD1-2 ..................... 76 3.3 Generating inducible RET and RET mutant Flp-In stable mammalian cell lines responsive to GDNF-GFRα1 ......................................................... 77 3.4 Examining RET maturation and cell surface expression levels ........ 79 3.5 Investigating the role of unpaired cysteine residues in RET maturation ...................................................................................................... 82 3.6 Investigating RET signalling ................................................................ 85 3.7 Efforts to manipulate S100M RET export using chemical chaperones .................................................................................................... 87 3.8 Manipulation of RET cell surface expression by siRNA knockdown of
Load more

Recommended publications
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Α Are Regulated by Heat Shock Protein 90
    The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90- α Tomoh Matsumiya, Tadaatsu Imaizumi, Hidemi Yoshida, Kei Satoh, Matthew K. Topham and Diana M. Stafforini This information is current as of October 2, 2021. J Immunol 2009; 182:2717-2725; ; doi: 10.4049/jimmunol.0802933 http://www.jimmunol.org/content/182/5/2717 Downloaded from References This article cites 44 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/182/5/2717.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90-␣1 Tomoh Matsumiya,*‡ Tadaatsu Imaizumi,‡ Hidemi Yoshida,‡ Kei Satoh,‡ Matthew K. Topham,*† and Diana M. Stafforini2*† Retinoic acid-inducible gene I (RIG-I) is an intracellular pattern recognition receptor that plays important roles during innate immune responses to viral dsRNAs.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec
    USOO8609416B2 (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec. 17, 2013 (54) METHODS AND COMPOSITIONS OTHER PUBLICATIONS COMPRISING HEAT SHOCKPROTEINS Novoselova et al., “Treatment with extracellular HSP70/HSC70 pro (75) Inventor: Michael E. Barnett, Manhattan, KS tein can reduce polyglutamine toxicity and aggregation.” J (US) Neurochem 94:597-606, 2005.* Johnson et al., (1993) Exogenous HSP70 becomes cell associated but (73) Assignee: Ventria Bioscience, Fort Collins, CO not internalized, by stressed arterial Smooth muscle cell. In vitro (US) Cellular and Developmental Biology—Animal, vol. 29A. No. 10, pp. 807-821. (*) Notice: Subject to any disclaimer, the term of this Bethke et al., (2002) Different efficiency of heat shock proteins patent is extended or adjusted under 35 (HSP) to activate human monocytes and dendritic cells; Superiority of U.S.C. 154(b) by 244 days. HSP60, The Journal of Immunology, vol. 169, pp. 6141-6148. Khan et al., (2008) Toll-like receptor 4-mediated growth of (21) Appl. No.: 12/972,112 endometriosis by human heat-shock protein 70, Human Reproduc tion, vol. 23, No. 10, pp. 2210-2219. (22) Filed: Dec. 17, 2010 Lasunskaia E.B., et al., (2003) Transfection of NSO myeloma fusion partner cells with HSP70 gene results in higher hybridoma yield by (65) Prior Publication Data improving cellular resistance to apoptosis, Biotechnology and Bioengineering 81 (4):496-504. US 2011 FO189751A1 Aug. 4, 2011 * cited by examiner Related U.S. Application Data (60) Provisional application No. 61/288,234, filed on Dec. Primary Examiner — Rosanne Kosson 18, 2009.
    [Show full text]
  • RET Aberrations in Diverse Cancers: Next-Generation Sequencing of 4,871 Patients Shumei Kato1, Vivek Subbiah2, Erica Marchlik3, Sheryl K
    Published OnlineFirst September 28, 2016; DOI: 10.1158/1078-0432.CCR-16-1679 Personalized Medicine and Imaging Clinical Cancer Research RET Aberrations in Diverse Cancers: Next-Generation Sequencing of 4,871 Patients Shumei Kato1, Vivek Subbiah2, Erica Marchlik3, Sheryl K. Elkin3, Jennifer L. Carter3, and Razelle Kurzrock1 Abstract Purpose: Aberrations in genetic sequences encoding the tyrosine (52/88)], cell cycle–associated genes [39.8% (35/88)], the PI3K kinase receptor RET lead to oncogenic signaling that is targetable signaling pathway [30.7% (27/88)], MAPK effectors [22.7% with anti-RET multikinase inhibitors. Understanding the compre- (20/88)], or other tyrosine kinase families [21.6% (19/88)]. hensive genomic landscape of RET aberrations across multiple RET fusions were mutually exclusive with MAPK signaling cancers may facilitate clinical trial development targeting RET. pathway alterations. All 72 patients harboring coaberrations Experimental Design: We interrogated the molecular portfolio had distinct genomic portfolios, and most [98.6% (71/72)] of 4,871 patients with diverse malignancies for the presence of had potentially targetable coaberrations with either an FDA- RET aberrations using Clinical Laboratory Improvement Amend- approved or an investigational agent. Two cases with lung ments–certified targeted next-generation sequencing of 182 or (KIF5B-RET) and medullary thyroid carcinoma (RET M918T) 236 gene panels. thatrespondedtoavandetanib(multikinase RET inhibitor)- Results: Among diverse cancers, RET aberrations were iden- containing regimen are shown. tified in 88 cases [1.8% (88/4, 871)], with mutations being Conclusions: RET aberrations were seen in 1.8% of diverse the most common alteration [38.6% (34/88)], followed cancers, with most cases harboring actionable, albeit dis- by fusions [30.7% (27/88), including a novel SQSTM1-RET] tinct, coexisting alterations.
    [Show full text]
  • The Plasma Peptides of Alzheimer's Disease
    Florentinus‑Mefailoski et al. Clin Proteom (2021) 18:17 https://doi.org/10.1186/s12014‑021‑09320‑2 Clinical Proteomics RESEARCH Open Access The plasma peptides of Alzheimer’s disease Angelique Florentinus‑Mefailoski1, Peter Bowden1, Philip Scheltens2, Joep Killestein3, Charlotte Teunissen4 and John G. Marshall1,5* Abstract Background: A practical strategy to discover proteins specifc to Alzheimer’s dementia (AD) may be to compare the plasma peptides and proteins from patients with dementia to normal controls and patients with neurological condi‑ tions like multiple sclerosis or other diseases. The aim was a proof of principle for a method to discover proteins and/ or peptides of plasma that show greater observation frequency and/or precursor intensity in AD. The endogenous tryptic peptides of Alzheimer’s were compared to normals, multiple sclerosis, ovarian cancer, breast cancer, female normal, sepsis, ICU Control, heart attack, along with their institution‑matched controls, and normal samples collected directly onto ice. Methods: Endogenous tryptic peptides were extracted from blinded, individual AD and control EDTA plasma sam‑ ples in a step gradient of acetonitrile for random and independent sampling by LC–ESI–MS/MS with a set of robust and sensitive linear quadrupole ion traps. The MS/MS spectra were ft to fully tryptic peptides within proteins identi‑ fed using the X!TANDEM algorithm. Observation frequency of the identifed proteins was counted using SEQUEST algorithm. The proteins with apparently increased observation frequency in AD versus AD Control were revealed graphically and subsequently tested by Chi Square analysis. The proteins specifc to AD plasma by Chi Square with FDR correction were analyzed by the STRING algorithm.
    [Show full text]
  • BLU-667 Is a Potent and Highly Selective RET Inhibitor in Development for RET-Driven Thyroid Cancers
    BLU-667 is a potent and highly selective RET inhibitor in development for RET-driven thyroid cancers Rami Rahal, PhD Blueprint Medicines July 30, 2017 Disclosure ▪ Employee and shareholder of Blueprint Medicines ▪ BLU-667 is an investigational agent currently in development by Blueprint Medicines 2 REarranged during Transfection (RET) ▪ Receptor tyrosine kinase that transduces signals from GDNF-family ligands ▪ One of the first oncogenic kinase fusions cloned from an epithelial tumor Mulligan, NRC, 2014 NRC, Mulligan, 1987 1990 1993 2012 2013 2014 2015 RET = RTK Papillary Thyroid Medullary Thyroid Lung CMML Colon, Breast, Inflammatory Cancer Cancer (MTC) Adeno Salivary, Myofibroblastic PTC1 = RET Ovarian Tumors Tumors 3 RET Kinase Fusions and Mutations are Oncogenic RET fusions RET mutations Kinase RET + Dimerization domain Fusion Partner ECD M918T V804L/M * * * * * Dimerization domain Kinase RET/PTC Fusion Kinase ▪ ~10% of papillary thyroid cancer ▪ ~60% of medullary thyroid cancer patients (MTC) patients harbor oncogenic ▪ 1-2% of NSCLC patients RET mutations ▪ <1% of patients with colon, ovary, ▪ M918T is the most prevalent RET breast, or hematological cancer mutation 4 Kinase Inhibitors Approved for Treating MTC were Not Designed to Selectively Inhibit RET ▪ Broad kinome activity with potent inhibition of VEGFR-2 ▪ Off-target related dose limiting toxicities hamper ability to inhibit fully RET VEGFR-2 RET Overall Compound Intended Serious adverse Biochem. Biochem. Response (Trade Name) Target(s) events IC50 (nM) IC50 (nM) Rate in MTC Cabozantinib Perforations and VEGFR-2 / MET 2 11 27% (Cometriq) fistulas; hemorrhage QT prolongation; Vandetanib VEGFR-2 / EGFR 4 4 Torsades de pointes; 44% (Calpresa*) sudden death *Only available through Calpresa REMS due to safety concerns 5 BLU-667: a Highly Potent and Selective RET Inhibitor 1.
    [Show full text]
  • Heat Shock Proteins in Vascular Diabetic Complications: Review and Future Perspective
    International Journal of Molecular Sciences Review Heat Shock Proteins in Vascular Diabetic Complications: Review and Future Perspective Stefania Bellini 1,†, Federica Barutta 1,†, Raffaella Mastrocola 2 ID , Luigi Imperatore 1, Graziella Bruno 1 and Gabriella Gruden 1,* 1 Laboratory of Diabetic Nephropathy, Department of Medical Sciences, University of Turin, Corso Dogliotti 14, 10126 Turin, Italy; [email protected] (S.B.); [email protected] (F.B.); [email protected] (L.I.); [email protected] (G.B.) 2 Department of Clinical and Biological Sciences, University of Turin, Corso Raffaello 30, 10125 Turin, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-011-633-6035 † These authors contribute equally to this work. Received: 27 November 2017; Accepted: 11 December 2017; Published: 14 December 2017 Abstract: Heat shock proteins (HSPs) are a large family of proteins highly conserved throughout evolution because of their unique cytoprotective properties. Besides assisting protein refolding and regulating proteostasis under stressful conditions, HSPs also play an important role in protecting cells from oxidative stress, inflammation, and apoptosis. Therefore, HSPs are crucial in counteracting the deleterious effects of hyperglycemia in target organs of diabetes vascular complications. Changes in HSP expression have been demonstrated in diabetic complications and functionally related to hyperglycemia-induced cell injury. Moreover, associations between diabetic complications and altered circulating levels of both HSPs and anti-HSPs have been shown in clinical studies. HSPs thus represent an exciting therapeutic opportunity and might also be valuable as clinical biomarkers. However, this field of research is still in its infancy and further studies in both experimental diabetes and humans are required to gain a full understanding of HSP relevance.
    [Show full text]
  • Downloaded 18 July 2014 with a 1% False Discovery Rate (FDR)
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer Permalink https://escholarship.org/uc/item/0t47b9ws Author Spiciarich, David Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Professor Matthew B. Francis Professor Amy E. Herr Fall 2017 Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer © 2017 by David Spiciarich Abstract Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich Doctor of Philosophy in Chemistry University of California, Berkeley Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Changes in glycosylation have long been appreciated to be part of the cancer phenotype; sialylated glycans are found at elevated levels on many types of cancer and have been implicated in disease progression. However, the specific glycoproteins that contribute to cell surface sialylation are not well characterized, specifically in bona fide human cancer. Metabolic and bioorthogonal labeling methods have previously enabled enrichment and identification of sialoglycoproteins from cultured cells and model organisms. The goal of this work was to develop technologies that can be used for detecting changes in glycoproteins in clinical models of human cancer.
    [Show full text]
  • Overcoming MET-Dependent Resistance to Selective RET Inhibition in Patients with RET Fusion–Positive Lung Cancer by Combining Selpercatinib with Crizotinib a C Ezra Y
    Published OnlineFirst October 20, 2020; DOI: 10.1158/1078-0432.CCR-20-2278 CLINICAL CANCER RESEARCH | RESEARCH BRIEFS: CLINICAL TRIAL BRIEF REPORT Overcoming MET-Dependent Resistance to Selective RET Inhibition in Patients with RET Fusion–Positive Lung Cancer by Combining Selpercatinib with Crizotinib A C Ezra Y. Rosen1, Melissa L. Johnson2, Sarah E. Clifford3, Romel Somwar4, Jennifer F. Kherani5, Jieun Son3, Arrien A. Bertram3, Monika A. Davare6, Eric Gladstone4, Elena V. Ivanova7, Dahlia N. Henry5, Elaine M. Kelley3, Mika Lin3, Marina S.D. Milan3, Binoj C. Nair5, Elizabeth A. Olek5, Jenna E. Scanlon3, Morana Vojnic4, Kevin Ebata5, Jaclyn F. Hechtman4, Bob T. Li1,8, Lynette M. Sholl9, Barry S. Taylor10, Marc Ladanyi4, Pasi A. Janne€ 3, S. Michael Rothenberg5, Alexander Drilon1,8, and Geoffrey R. Oxnard3 ABSTRACT ◥ Purpose: The RET proto-oncogene encodes a receptor tyrosine Results: MET amplification was identified in posttreatment kinase that is activated by gene fusion in 1%–2% of non–small biopsies in 4 patients with RET fusion–positive NSCLC treated with cell lung cancers (NSCLC) and rarely in other cancer types. selpercatinib. In at least one case, MET amplification was clearly Selpercatinib is a highly selective RET kinase inhibitor that has evident prior to therapy with selpercatinib. We demonstrate that recently been approved by the FDA in lung and thyroid cancers increased MET expression in RET fusion–positive tumor cells causes with activating RET gene fusions and mutations. Molecular resistance to selpercatinib, and this can be overcome by combining mechanisms of acquired resistance to selpercatinib are poorly selpercatinib with crizotinib. Using SPPs, selpercatinib with crizo- understood.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]