DOCSLIB.ORG

Volume 1 Issue 4 (November 2013)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Volume 1 Issue 4 (November 2013) International Journal of Agricultural Science and Technology (IJAST) Volume 1 Issue 4, November 2013 www.seipub.org/ijast Isolation, Sequence Identification and Tissue Expression of a Novel Tobacco (Nicotiana tabacum) Gene-TBG1 Nian Fuzhao1, Zhang Yonghui2, Su Xiangyun3, Zou Juqiu3, Zhao Leifeng*1 1College of Tobacco Science, Yunnan Agricultural University, Kunming 650201, China 2Technological Center of Tobacco Company of Sichuan Province, Luzhou 646000, China 3Feedstock Supply Department of Industrial Limited-Liability Company of Chinese Tobacco Company of Hunan province, Changsha 410014, China *[email protected] Abstract 1994; Carey et al. 1995; Smith et al. 1998; Smith and The complete coding sequence of one tobacco (nicotiana Gross, 2000; Carey et al. 2001; Shlush et al. 2013; tabacum) gene-β-galactosidase precursor (TBG1), was Fonseca-Berzal et al. 2013; Choi et al. 2013). amplified based on some tobacco ESTs. The complete coding Although β-galactosidases play important roles in sequence of tobacco TBG1 gene was 2,526 bp which encodes biological processes of plants, until today, the tobacco a protein of 841 amino acids. Sequence analysis revealed that β-galactosidase precursor (TBG1) gene has not been the TBG1 of tobacco shares high homology with the TBG1 of reported yet. In present experiment, we would isolate lycopersicon esculentum (91%), cacao (81%), castor bean TBG1 (81%) and papaya (81%). Results also showed that tobacco the complete mRNA sequence of tobacco gene, TBG1 gene has a closer genetic relationship with the TBG1 subsequently perform some necessary sequence gene of lycopersicon esculentum. The expression profile was analysis and tissue expression analysis for this gene; studied and the results indicated that tobacco TBG1 gene was thus the primary foundation of understanding this differentially expressed in detected tobacco tissues including tobacco gene was established. leaf, stem, root and flower. Our experiment established the foundation for further research on this tobacco gene. Materials and Methods Keywords Samples Collection, RNA Extraction and First-strand Tobacco; TBG1; Tissue Expression cDNA Synthesis Tobacco plants (Chinese local variety Yunyan 85) were Introduction grown in a naturally lit glasshouse with normal β-galactosidases are thought to be responsible for the irrigation and fertilization. The tissues including leave, conspicuous reduction in the level of galactosyl residues stem, root, flower were harvested and immediately which occurs in many ripening fruits. These enzymes frozen in liquid nitrogen and stored at -80℃. Total have also been detected in a wide range of plant RNA extraction and first-strand cDNA synthesis for organs and tissues undergoing developmental changes these tissue samples were performed as the methods such as seeds, cotyledons, elongating epicotyls, and in described by Li et al. (2008). freshly harvested asparagus spears. So far, only exo- Isolation of the Coding Sequence acting activities have been found in plants and these enzymes are characterized by their ability to hydrolyse RT-PCR was performed to amplify complete coding terminal non-reducing β-d-galactosyl residues from sequences of tobacco TBG1 gene using the cDNA β-d-galactosides. They are usually assayed by their obtained from the pooled tissues above. The 20 µl ability to release galactosyl residues from artificial reaction system was: 2.0 µl cDNA, 2.0 µl 2 mM mixed substrates such as p-nitrophenyl-β-d-galactopyranoside, dNTPs, 2.0 µl 10×Taq DNA polymerase buffer, 1.2 µl 4-methyl umbelliferyl-β-d-galactopyranoside and X-gal. 25 mM MgCl2, 1.0 µl 10 mM forward primer, 1.0 µl 10 In many cases, however, their natural substrates are mM reverse primer, 2.0 units of Taq DNA polymerase unknown, but probably include chloroplast galactolipids (1 U/1µl), and 9.8 µl sterile water. The primers for as well as cell wall galactans(Gross and Sams,1984; MS , tobacco TBG1 gene isolation were designed based on 57 www.seipub.org/ijast International Journal of Agricultural Science and Technology (IJAST) Volume 1 Issue 4, November 2013 the tobacco EST sequences (GeneBank numbers: Quantitative Real Time PCR (qRT-PCR) for Tissue FS390322, FG200071, FG192756, FG191482, FG164696 Expression Profile Analysis and EB678821) which were highly homologues with qRT-PCR for evaluating the level of mRNA for TBG1 the coding sequence of TBG1 gene of lycopersicon gene was performed on the ABI Prism 7300 Sequence esculentum(TABLE 1). The PCR program initially Detection Systems (Applied Biosystems, Foster City, started with a 94°C denaturation for 4 min, followed CA, USA). PCR reactions for each sample were carried by 35 cycles of 94°C/1 min, 56°C (TABLE 1)/1 min, out in 25 µl reaction volume containing 1µl SYBR 72°C /1 min, then 72°C extension for 10 min, finally 4°C to terminate the reaction. Every PCR was repeated Green real-time PCR Master Mix, 100 ng cDNA five times. The PCR product was then cloned into template and 200 nM each primer. Conditions for PMD18-T vector and sequenced bidirectionally with real-time PCR were: an initial denaturation at 95°C for the commercial fluorometric method. At least five 3 min, 40 cycles of 95°C for 15 s, optimal annealing independent clones were sequenced. temperature for each specific primer for 15 s (TABLE 2), 72°C for 20 s. For each sample, reactions were set up in TABLE 1 RT-PCR PRIMERS FOR TOBACCO TBG1 GENE AND ANNEALING TEMPERATURE triplicate to ensure the reproducibility of the results. The gene relative expression levels were quantified Gene Primer sequence Ta/ °C Length/(bp) Forward 1: 5’- relative to the expression of the reference gene, actin ATGGATTGTTCTTGGATTGC-3’ (GenBank Accession No. GQ339768), by employing the TBG1 56 2526 Reverse 1: 5’- 2 -ΔΔCt value model (Livak and Schmittgen TD, 2001). TCAGCTGCAAACAACCTC-3’ TABLE 2 QRT-PCR PRIMERS FOR TOBACCO TBG1, ACTIN GENES AND Sequence Analysis ANNEALING TEMPERATURE The cDNA sequence prediction was conducted using Gene Primer sequence Ta/ °C Length/(bp) GenScan software (http://genes.mit.edu/ GENSCAN .html). Forward 2: 5’- AGAAGGAGGAGTGGATGT-3’ The protein prediction and analysis were performed TBG1 56 224 Reverse 2: 5’- using the Conserved Domain Architecture Retrieval TGAAACTGATACCTGGAAC-3’ Tool of BLAST at the National Center for Forward 3:5’- Biotechnology Information (NCBI) server (http://www. CCATTCTTCGTTTGGACCTT -3’ Actin 56 257 Reverse 3: 5’- ncbi.nlm.nih.gov/BLAST) and the Clustalw software TTCTGGGCAACGGAACCT-3’ (http://www.ebi.ac.uk/clustalw). 58 International Journal of Agricultural Science and Technology (IJAST) Volume 1 Issue 4, November 2013 www.seipub.org/ijast FIG. 2 THE ALIGNMENT OF THE PROTEINS ENCODED BY TOBACCO TBG1 GENE AND FOUR OTHER KINDS OF TBG1 PROTEINS . 59 www.seipub.org/ijast International Journal of Agricultural Science and Technology (IJAST) Volume 1 Issue 4, November 2013 Based on the results of the alignment of different Results and Discussion species of TBG1 proteins, a phylogenetic tree was Isolation Result for Tobacco TBG1 Gene constructed using the ClustalW software (http://www. ebi.ac.uk/clustalw), as shown in FIG. 3. The For tobacco TBG1 gene, through RT-PCR with pooled phylogenetic tree analysis revealed that the tobacco tissue cDNAs, the resulting PCR products were 2,526 TBG1 gene has a closer genetic relationship with that bp (FIG. 1). of lycopersicon esculentum. Tissue Expression Profile Tissue expression profile analysis was carried out and results revealed that the tobacco TBG1 gene was moderately expressed in flower and leaf, but hardly expressed in root and stem (FIG. 4). FIG. 1 PCR RESULT FOR TOBACCO TBG1 GENE. M DL2000 DNA MARKERS; 1, PCR PRODUCT FOR TOBACCO TBG1 GENE Sequence Analysis These cDNA nucleotide sequences analysis using the BLAST software at NCBI server (http://www.ncbi. nlm.nih.gov/BLAST) revealed that this gene was not homologous to any of the known tobacco gene and it was then deposited into the Genbank database (Accession number: KF267437). FIG. 4 EXPRESSION ANALYSIS OF TBG1 GENE MRNA IN The sequence prediction was carried out using the VARIOUS TISSUES GenScan software and results showed that the 2,526-bp Comparative genomics research has revealed that cDNA sequence represents one single gene which virtually all (99%) of the protein-coding genes in encodes 841 amino acids. The theoretical isoelectric humans align with homologs in mouse, and over 80% point (pI) and molecular weight (Mw) of the deduced are clear 1:1 orthologs for human and mouse both proteins of this tobacco gene were also computed belong to mammalian (Hardison, 2003). This extensive using the Compute pI/Mw Tool (http://www.expasy. conservation in protein-coding regions implied that org/tools/pi_tool.html). The pI of tobacco TBG1 is 6.68. this conservation of protein-coding sequences may be The molecular weight of this putative protein is expected in tobacco and lycopersicon esculentum as 93674.67. they are both plants of solanaceae. From sequence Further BLAST analysis of these proteins revealed that analysis of TBG1 genes, it can be seen that the coding tobacco TBG1 has high homology with the TBG1 of sequences of TBG1 genes were highly conserved in lycopersicon esculentum (Accession number: NP_ some plants. This implied that the some plants can be 001234303, 91%), cacao (Accession number: EOY27097, utilized as model organisms and some tobacco genes 81%), castor bean (Accession number: XP_002527409, can be isolated based on the coding sequence 81%) and papaya (Accesession number: ACP18875, information of these plants. 81%) (FIG. 2). The phylogenetic tree analysis revealed that the tobacco TBG1 gene has a closer genetic relationship with that of lycopersicon esculentum. This implied that lycopersicon esculentum can be regarded as model organism to study the tobacco TBG1 gene or tobacco can be utilized as model organism to study the lycopersicon esculentum TBG1 gene. From the tissue distribution analysis in our experiment, it can be seen that TBG1 gene was obviously differentially expressed in some tissues.
Load more

Recommended publications
  • THE LIBRARY ROUTE Indlela Yamathala Eencwadi Boland Control Area Geographic and Demographic Overview
    THE LIBRARY ROUTE Indlela yamathala eencwadi Boland Control Area geographic and demographic overview Following up on our series, Insider’s View, in which six library depots and one Wheelie readers were introduced to the staff of the West- Wagon in the area. ern Cape Provincial Library Service and all its ac- By the end of December 2010 the tivities and functions, we are embarking on a new total book stock at libraries in the region series, The library route, in which the 336 libraries amounted to 322 430 items. that feed readers’ needs will be introduced. The area served is diverse and ranges We start the series off with the libraries in from well-known coastal towns to inland the Boland Control Area and as background we towns in the Western Cape. publish a breakdown of the libraries in the various Service points municipalities. Overstrand Municipality libraries Gansbaai STEVEN ANDRIES Hangklip Hawston Assistant Director Chief Library Assistant Moreen September who is Hermanus Steven’s right-hand woman Kleinmond Introduction Mount Pleasant Stanford The Western Cape Provincial Library Service: Zwelihle Regional Organisation is divided into three Theewaterskloof Municipality libraries control areas: Boland, Metropole and Outeni- Worcester and Vanrhynsdorp region from Vanrhynsdorp. Caledon qua. Each control area consists of fi ve regional Genadendal libraries and is headed by an assistant director The staff complement for each region in the Boland control area consists normally of Grabouw and supported by a chief library assistant. Greyton The fi ve regional offi ces in the Boland con- a regional librarian, two library assistants, a driver and a general assistant.
    [Show full text]
  • Directory of Organisations and Resources for People with Disabilities in South Africa
    DISABILITY ALL SORTS A DIRECTORY OF ORGANISATIONS AND RESOURCES FOR PEOPLE WITH DISABILITIES IN SOUTH AFRICA University of South Africa CONTENTS FOREWORD ADVOCACY — ALL DISABILITIES ADVOCACY — DISABILITY-SPECIFIC ACCOMMODATION (SUGGESTIONS FOR WORK AND EDUCATION) AIRLINES THAT ACCOMMODATE WHEELCHAIRS ARTS ASSISTANCE AND THERAPY DOGS ASSISTIVE DEVICES FOR HIRE ASSISTIVE DEVICES FOR PURCHASE ASSISTIVE DEVICES — MAIL ORDER ASSISTIVE DEVICES — REPAIRS ASSISTIVE DEVICES — RESOURCE AND INFORMATION CENTRE BACK SUPPORT BOOKS, DISABILITY GUIDES AND INFORMATION RESOURCES BRAILLE AND AUDIO PRODUCTION BREATHING SUPPORT BUILDING OF RAMPS BURSARIES CAREGIVERS AND NURSES CAREGIVERS AND NURSES — EASTERN CAPE CAREGIVERS AND NURSES — FREE STATE CAREGIVERS AND NURSES — GAUTENG CAREGIVERS AND NURSES — KWAZULU-NATAL CAREGIVERS AND NURSES — LIMPOPO CAREGIVERS AND NURSES — MPUMALANGA CAREGIVERS AND NURSES — NORTHERN CAPE CAREGIVERS AND NURSES — NORTH WEST CAREGIVERS AND NURSES — WESTERN CAPE CHARITY/GIFT SHOPS COMMUNITY SERVICE ORGANISATIONS COMPENSATION FOR WORKPLACE INJURIES COMPLEMENTARY THERAPIES CONVERSION OF VEHICLES COUNSELLING CRÈCHES DAY CARE CENTRES — EASTERN CAPE DAY CARE CENTRES — FREE STATE 1 DAY CARE CENTRES — GAUTENG DAY CARE CENTRES — KWAZULU-NATAL DAY CARE CENTRES — LIMPOPO DAY CARE CENTRES — MPUMALANGA DAY CARE CENTRES — WESTERN CAPE DISABILITY EQUITY CONSULTANTS DISABILITY MAGAZINES AND NEWSLETTERS DISABILITY MANAGEMENT DISABILITY SENSITISATION PROJECTS DISABILITY STUDIES DRIVING SCHOOLS E-LEARNING END-OF-LIFE DETERMINATION ENTREPRENEURIAL
    [Show full text]
  • Proposed Ad Hoc Amendment of Bergrivier Spatial Development Framework: Status Quo, 2012 - 2017
    PROPOSED AD HOC AMENDMENT OF BERGRIVIER SPATIAL DEVELOPMENT FRAMEWORK: STATUS QUO, 2012 - 2017 COMPILED BY: CK RUMBOLL & PARTNERS JANUARY 2018 OUR REF: VEL/10146/AC Contents 1. Purpose and approach .......................................................................................................................... 1 2. Detailed Status Quo Analysis and Implications .................................................................................... 3 2.1 Biophysical Environment ............................................................................................................... 3 2.2 Socio- Economic Environment .................................................................................................... 10 2.3 Built Environment ........................................................................................................................ 19 3. Strengths, Weaknesses, Opportunities and Threats (SWOT) ........................................................... 35 4. Recommendation ................................................................................................................................. 38 5. Maps illustrating Status Quo Analysis ................................................................................................ 39 List of Graphs Graph 1: Sectoral GDPR contribution (% share) to West Coast Economy (Quantec 2015 - MERO, 2017) .....................................................................................................................................................................
    [Show full text]
  • Towards Integrated Coastal Management for Saldanha Bay and Langebaan Lagoon, South Africa*
    Africa Africa’ (1997)4 given me the opportunity totackle thisOceanography, issue. UCT, and tocomments the onFlemish a draft ofFundthis article.for I amScientific also indebtedResearch to Dr. Johnin Belgium, Largier of whothe Departmenthave of around the coast ofSouth Africa.3 One ofthese regions is the West Coast extensive processes ofinvolving interested and affectedformulation parties ofin regions a vision for the coast of South Africa identified through Environmental Affairs and Tourism and supported by the United Sowman of the Department of Environmental and Geographical Sciences, UCT, for their Sustainable Coastal set Developmentout South Act.2 Africa’s Kingdom’s futureIts Departmentpolicy for startingon International coastal Development. pointmanagement It is in supposedwas ato (CMPP). new the This programme was launched by South Africa’s productMinistry ofof an extensive process of public participation and specialist with the changing socio-political environment in South Africarevealed the studies carried out through the Coastal Management Policy Programme offact, the present Act only appliesto areas belowthe highwater mark. coastal development through integrated coastal management.1 As inadequacya matter of the existing Seashore Act (1935) to achieve sustainable point for virtually the whole spectrum ofhuman activities and is subjectto increasing development demands and urbanisation. This concern coupled The ecologically varied 3200-km South African coastal zone is the focal AFRICA* Jan Schrijvers** TOWARDS INTEGRATED COASTAL MANAGEMENT FOR 1 1 Introduction SALDANHA ANDBAY LANGEBAAN LAGOON, SOUTH 3 3 See generally CMPP 2 irism in March 1999. 1 1 See further J Glazewski ‘Towards a coastal zone management Act for South * A draft Coastal Policy White Paper was submitted in March 1999 as the as submitted by the Policy Committee to the Minister of Environmental Affairs and See generally CMPP MSc (Gent) PhD(Gent) postdoctoral researcherICZM, University ofGent, Belgium.
    [Show full text]
  • Flower Route Map 2017
    K o n k i e p en w R31 Lö Narubis Vredeshoop Gawachub R360 Grünau Karasburg Rosh Pinah R360 Ariamsvlei R32 e N14 ng Ora N10 Upington N10 IAi-IAis/Richtersveld Transfrontier Park Augrabies N14 e g Keimoes Kuboes n a Oranjemund r Flower Hotlines O H a ib R359 Holgat Kakamas Alexander Bay Nababeep N14 Nature Reserve R358 Groblershoop N8 N8 Or a For up-to-date information on where to see the Vioolsdrif nge H R27 VIEWING TIPS best owers, please call: Eksteenfontein a r t e b e e Namakwa +27 (0)72 760 6019 N7 i s Pella t Lekkersing t Brak u Weskus +27 (0)63 724 6203 o N10 Pofadder S R383 R383 Aggeneys Flower Hour i R382 Kenhardt To view the owers at their best, choose the hottest Steinkopf R363 Port Nolloth N14 Marydale time of the day, which is from 11h00 to 15h00. It’s the s in extended ower power hour. Respect the ower Tu McDougall’s Bay paradise: Walk with care and don’t trample plants R358 unnecessarily. Please don’t pick any buds, bulbs or N10 specimens, nor disturb any sensitive dune areas. Concordia R361 R355 Nababeep Okiep DISTANCE TABLE Prieska Goegap Nature Reserve Sun Run fels Molyneux Buf R355 Springbok R27 The owers always face the sun. Try and drive towards Nature Reserve Grootmis R355 the sun to enjoy nature’s dazzling display. When viewing Kleinzee Naries i R357 i owers on foot, stand with the sun behind your back. R361 Copperton Certain owers don’t open when it’s overcast.
    [Show full text]
  • Proposed Ad Hoc Amendment of Bergrivier Spatial Development Framework: Status Quo and Proposals, 2012 – 2017
    PROPOSED AD HOC AMENDMENT OF BERGRIVIER SPATIAL DEVELOPMENT FRAMEWORK: STATUS QUO AND PROPOSALS, 2012 – 2017 Final Draft COMPILED BY: CK RUMBOLL & PARTNERS September 2018 OUR REF: VEL/10146/AC Contents 3.2.7 Economy 22 3.2.8 Income and Poverty 27 1. Purpose and approach .......................................................................... 1 3.2.9 Investment and Municipal finance 28 2. Issues raised during public participation ............................................... 3 3.2.10 Tourism 28 3. Detailed Status Quo Analysis: Challenges and Opportunities ............... 7 3.2.11 Land reform 30 3.1 Analysis of Biophysical Environment ............................................ 7 3.2.12 Socio-Economic Strengths, Weaknesses, Opportunities 3.1.1 Geology & Soils 7 and Threats 30 3.1.2 Topography 7 3.2.13 Proposals related to Socio-economic Environment ..................... 33 3.1.3 Climate 8 3.3 Analysis of Built Environment ...................................................... 36 3.1.4 Hydrology & Aquatic Ecosystems 10 3.3.1 Urban Settlements: Hierarchy and role of settlements 36 3.1.5 Biodiversity 10 3.3.2 Urban Settlements: Form and functionality 38 3.1.6 Vegetation 11 3.3.3 Urban Settlements: Sense of place 39 3.1.7 Agriculture and Fisheries 12 3.3.4 Urban Settlements: Settlement densities 40 3.1.8 Mining & Building Materials 12 3.3.5 Urban Settlements: Land Use Management Issues 41 3.1.9 Biophysical Strengths, Weaknesses, Opportunities and Threats 13 3.3.6 Transportation 41 3.1.10 Proposals related to Biophysical Environment 15
    [Show full text]
  • Weskus Regional Trends 2017
    Weskus Regional Trends 2017 An inspiring place to know Contents 1. Methodology 2. Participation and sample size 3. Executive Summary 4. Weskus Visitor Trends & Patterns 4.1 Origin of visitors 4.2 Age profile of visitors 4.3 Travel group size 4.4 Mode of transport 4.5 Main purpose of visit 4.6 Top activities undertaken in the Weskus 4.7 Overnight vs. Day Visitors 4.8 Length of stay 4.9 Accommodation usage 4.10 Average spend in the Weskus 4.11 Top Information Sources 5. Weskus Towns 6. Trends and patterns by origin of visitors 7. Performance of the Weskus Attractions 8. Weskus New Routes 9. Weskus New Tourism Developments 10. Acknowledgements 1. Methodology This report provides an overview of the tourism trends and patterns in the Weskus. The findings will illustrate key visitor trends obtained from the regional visitor tracking survey. Responses to the regional visitor tracking surveys are used as a proxy to indicate the key trends within the Western Cape and the various regions. It is important to note that absolute figures cannot be determined from these surveys, as the survey responses are a sample of the tourists into the respective tourism offices across the Western Cape, and would thus represent a sample of the visitors. Therefore, where statistically relevant absolute numbers may be given, however, a share is provided to indicate the trend. This is based on international best practice in the use of surveys within the tourism industry for determining key trends. Definition: Tourist: refers to any visitor travelling to a place other than that of his/her own environment for more than one night, but less than 12 months and for whom the main purpose of the trip is other than the exercise of an activity remunerated for from within the place visited.
    [Show full text]
  • Section B, Chapter 18
    SectionSection B: B: Profile National Western and DistrictCape Province Profiles 18 Western Cape Province Cape Town Metropolitan Municipality (CPT) The City of Cape Town Metropolitan municipality is situated on the southern peninsula of the Western Cape Province.a The City of Cape Town Metropolitan Municipality incorporates eight health sub-districts, namely: Cape Town Eastern, Cape Town Northern, Cape Town Southern, Cape Town Western, Khayelitsha, Klipfontein, Mitchell’s Plain and Tygerberg. Cities/Towns: Athlone, Atlantis, Belhar, Bellville, Blackheath, Blouberg, Blue Downs, Brackenfell, Cape Point, Cape Town, Delft, Durbanville, Elsies Rivier, Fish Hoek, Goodwood, Gordon’s Bay, Grassy Park, Guguletu, Hout Bay, Khayelitsha, Kommetjie, Kraaifontein, Kuils River, Langa, Macassar, Matroosfontein, Melkbosstrand, Milnerton, Mitchells Plain, Muizenberg, Noordhoek, Nyanga, Parow, Philadelphia, Philippi, Robben Island, Scarborough, Simon’s Town, Sir Lowry’s Pass, Somerset West, Southern Suburbs, Strand, Table View Area: 2 446km² Population (2019)b: 4 194 178 DistrictDistrict % percentagepopulation by ag epopulation-gender group cbyom page-genderared to South Af rgroupica compared to South Africa WC, Cape Town MM (CPT) 2000/01 2010/11 2020/21 South Africa % of total population [Male | Female] - lines South Africa % of total population [Male | Female] - lines South Africa % of total population [Male | Female] - lines AgeGrp 8% 6% 4% 2% 0% 2% 4% 6% 8% 8% 6% 4% 2% 0% 2% 4% 6% 8% 8% 6% 4% 2% 0% 2% 4% 6% 8% 65+ 2.0% 3.0% 2.1% 3.1% 2.8% 4.0% 60-64
    [Show full text]
  • Second Generation Coastal Management Programme 2019 - 2024
    WEST COAST DISTRICT MUNICIPALITY SECOND GENERATION COASTAL MANAGEMENT PROGRAMME 2019 - 2024 This Report should be cited as follows: West Coast District Municipality (2019). Draft Coastal Management Programme: Second Generation. This report was developed for the West Coast District Municipality by: The Point, Suite 408, 4th Floor Contact: 76 Regent Road, Sea Point Dr Ted Avis CAPE TOWN Tel: 021 045 0900 8060 Email: [email protected] www.cesnet.co.za Also in Grahamstown, Port Amy Lindsay Elizabeth, East London, Tel: 083 554 9229 Johannesburg & Maputo Email: [email protected] West Coast District Municipality: Charles Malherbe Nick de Jongh CES: Ted Avis Amy Lindsay Acknowledgements: Bergrivier Municipality Cederberg Municipality Matzikama Municipality Saldanha Bay Municipality Swartland Municipality TABLE OF CONTENTS EXECUTIVE SUMMARY ................................................................................................................ VIII 1 INTRODUCTION ...................................................................................................................... 1 1.1 Background ........................................................................................................................ 1 1.2 Defining the Coastal Zone ............................................................................................... 1 1.3 Value of the coast ............................................................................................................. 5 1.4 Context of Coastal Management Programmes in South Africa ...............................
    [Show full text]
  • Report First Part
    Selected building statistics of the private sector derived from data reported by local government institutions, 2001 Report No. 50-11-01 (2001) Published by Statistics South Africa, Private Bag X44, Pretoria 0001 © Statistics South Africa, 2003 This publication, including the data on which it is based, is subject to copyright. Apart from uses permitted under the Copyright Act of 1978, no part of it may be reproduced or copied in any format or by any process, and no copy or reproduction may be sold, without prior permission or licence from Statistics South Africa (Stats SA). Stats SA Library Cataloguing-in-Publication (CIP) Data Selected building statistics of the private sector derived from data reported by local government institutions, 2001 / Statistics South Africa. Pretoria : Statistics South Africa, 2003 xxiv, 349 p. 30 cm. (Report No. 50-11-01(2001)) Title continues in English only ISBN 0-621-33642-4 1. Construction industry - Statistics I. Statistics South Africa II. Title III. Series (LCSH 16) A complete set of Stats SA publications is available at Stats SA Library and the following libraries: National Library of South Africa, Pretoria Division Eastern Cape Library Services, King William's Town National Library of South Africa, Cape Town Division Central Regional Library, Polokwane Library of Parliament, Cape Town Central Reference Library, Nelspruit Bloemfontein Public Library Central Reference Collection, Kimberley Natal Society Library, Pietermaritzburg Central Reference Library, Mmabatho Johannesburg Public Library This publication
    [Show full text]
  • Polygalaceae)
    S.AfrJ.Bot., 1991, 57(5): 229-233 229 A re-evaluation of Nylandtia (Polygalaceae) C.T. Johnson* and F.M. Weitz Department of Botany, University of the Western Cape, Private Bag X17, Bellville, 7535 Republic of South Africa Accepted 10 June 1991 A re-evaluation of the monotypic genus Nylandtia Dumort. is presented in which two varieties, N. spinosa (L.) Dumort. var. spinosa and var. scoparia (Eckl. & Zeyh.) Johnson & Weitz, are recognized. Descriptions, synonymy, distribution data, and a key to the varieties are provided. Variation in the two varieties is covered and pollination ecology is discussed. 'n Re-evaluasie van die monotipiese genus Nylandtia Dumort. word aangebied waarin twee varieteite, N. spinosa (L.) Dumort. var. spinosa en var. scoparia (Eckl. & Zeyh.) Johnson & Weitz, erken word. Beskrywings, sinonimie, verspreidingsdata en 'n sleutel tot die varieteite word voorsien. Variasies tussen die twee varieteite word behandel en die bestuiwingsekologie word bespreek. Keywords: Nylandtia, taxonomy, morphology. ·To whom correspondence should be addressed. History and relationships related. Anatomical data (Johnson, Cyster & Spangenberg The first description referring to this species dates back to 1981) such as cyclocytic stomata, cuticle structure and 1751, when Linnaeus published his Amoenitates academi­ absence of extraxylary fibres, support Levyns (1949) who, cae. An identical description of the species was given by on the basis of floral structure, regarded Nylandtia as a him in 1753 when he published the name Polygala spinosa, specialized off-shoot of the sub-genus Psilocladus of though the collector or supplier of the specimen was not Muraltia. cited. The specimen that is currently housed in the Linnaean The infraspecific taxonomy in Nylandtia has been herbarium was collected by Rijk Tulbagh in May 1769 variously treated.
    [Show full text]
  • Final Provincial Drought Assessment Report.Pdf
    Jody Wentzel Directorate Sustainable Resource Management Email: [email protected] tel: +27 21 808 7805 fax: +27 21 808 5370 Reference: 20/2/Drought Assessment Report - Western Cape (2018) Annexure A: Drought assessment report for disaster relief funding for the drought-stricken areas of livestock and crop farming in the Western Cape Province – February 2018 1. AIM To perform a technical and scientific assessment for the provision of emergency fodder relief within the drought-stricken areas of the Western Cape. 2. INTRODUCTION Drought relief, in the form of fodder, is currently being provided to all qualifying farmers in the West Coast district , Cape Winelands district, Central Karoo district, parts of the Eden district and Overberg district. All these areas need assistance. The consequence of the current situation is that once the drought has been broken, farmers will have to build up their flocks, leading to negative cash flow for a considerable period of time. If government does not intervene to further alleviate the situation, the dire impact of the drought will be felt for years to come, especially in the rural areas, where agriculture is the main generator of the economy. The socio-economic impact on farm workers would be significant should the agricultural activity in the Western Cape collapse. Areas of the Central Karoo district and West Coast district municipality are in a critical drought situation. Livestock farmers are amongst the hardest hit by the drought. The impacts of the drought in the summer rainfall region on beef cattle herds, with high numbers of animals slaughtered and the supply subsequently becoming limited, has led to high meat prices.
    [Show full text]