DOCSLIB.ORG

Genome-Wide Meta-Analysis Uncovers Novel Loci Influencing Circulating Leptin Levels

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Meta-Analysis Uncovers Novel Loci Influencing Circulating Leptin Levels Genome-wide meta-analysis uncovers novel loci influencing circulating leptin levels The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Kilpeläinen, T. O., J. F. M. Carli, A. A. Skowronski, Q. Sun, J. Kriebel, M. F. Feitosa, Å. K. Hedman, et al. 2016. “Genome-wide meta- analysis uncovers novel loci influencing circulating leptin levels.” Nature Communications 7 (1): 10494. doi:10.1038/ncomms10494. http://dx.doi.org/10.1038/ncomms10494. Published Version doi:10.1038/ncomms10494 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26318785 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ARTICLE Received 15 Jun 2015 | Accepted 16 Dec 2015 | Published 1 Feb 2016 DOI: 10.1038/ncomms10494 OPEN Genome-wide meta-analysis uncovers novel loci influencing circulating leptin levels Tuomas O. Kilpela¨inen et al.# Leptin is an adipocyte-secreted hormone, the circulating levels of which correlate closely with overall adiposity. Although rare mutations in the leptin (LEP) gene are well known to cause leptin deficiency and severe obesity, no common loci regulating circulating leptin levels have been uncovered. Therefore, we performed a genome-wide association study (GWAS) of circulating leptin levels from 32,161 individuals and followed up loci reaching Po10 À 6 in 19,979 additional individuals. We identify five loci robustly associated (Po5 Â 10 À 8) with leptin levels in/near LEP, SLC32A1, GCKR, CCNL1 and FTO. Although the association of the FTO obesity locus with leptin levels is abolished by adjustment for BMI, associations of the four other loci are independent of adiposity. The GCKR locus was found associated with multiple metabolic traits in previous GWAS and the CCNL1 locus with birth weight. Knockdown experiments in mouse adipose tissue explants show convincing evidence for adipogenin, a regulator of adipocyte differentiation, as the novel causal gene in the SLC32A1 locus influencing leptin levels. Our findings provide novel insights into the regulation of leptin production by adipose tissue and open new avenues for examining the influence of variation in leptin levels on adiposity and metabolic health. Correspondence and requests for materials should be addressed to T.O.K. (email: [email protected]) or to R.J.F.L. (email: [email protected]). #A full list of authors and their affiliations appears at the end of the paper. NATURE COMMUNICATIONS | 7:10494 | DOI: 10.1038/ncomms10494 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms10494 eptin is an adipocyte-secreted hormone that influences Two loci, near the LEP and SLC32A1 genes, reached long-term regulation of energy homeostasis by informing genome-wide significance (Po5 Â 10 À 8) in the BMI-adjusted Lthe brain about the amount of stored body fat1,2. Circulating meta-analysis of men and women combined (Table 1). leptin levels correlate closely with measures of adiposity, such as To confirm these associations and to identify additional body fat mass and body mass index (BMI)3. Yet, at any given level leptin-associated loci, we took forward all independent (pairwise of adiposity, there is substantial variation in circulating leptin distance 4500 kb and r2o0.1) SNPs reaching Po10 À 6 with levels4, of which estimated 30–50% is explained by genetic leptin levels with or without adjustment for BMI in meta-analyses factors5–7. of all individuals combined, men only or women only, for Rare homozygous loss-of-function mutations in the follow-up in stage 2 (Supplementary Tables 2–4). leptin-encoding gene (LEP) cause leptin deficiency that leads to hyperphagia and severe obesity, which can be corrected by Stage 2 follow-up in 19,979 individuals identifies five loci.We exogenous leptin administration8. Leptin-deficient children examined the associations of the loci taken forward from stage 1 are born with a normal birth weight but exhibit rapid weight in up to 19,979 additional individuals of European descent from gain in the first few months of life. They show marked 13 studies (Supplementary Table 5). All studies performed the abnormalities of T-cell number and function, and have high same association analyses as described in Stage 1; that is, with and rates of childhood infection9. Hypothalamic hypothyroidism is without adjustment for BMI and in men and women present, characterized by a low free thyroxine and high serum combined, as well as separately. Finally, after performing a joint thyroid-stimulating hormone levels10. Pubertal development meta-analysis of the stage 1 and stage 2 results, five independent generally does not occur due to hypogonadotropic SNPs reached genome-wide significance (P 5 Â 10 À 8)in hypogonadism10. Individuals heterozygous for leptin mutations o the combined meta-analyses of men and women (Table 1). In the exhibit a partial leptin deficiency with higher body fat than BMI-adjusted meta-analysis, we confirmed genome-wide control individuals11. significant associations for the loci near LEP and SLC32A1, and Candidate gene studies, typically small in size, have reported identified an additional locus in GCKR. In the BMI-unadjusted associations of two common variants (A19G (rs2167270, meta-analysis, we identified two additional loci near CCNL1 minor allele frequency (MAF) 35%) and G2548A (rs7799039, and in FTO. A locus in COBLL1, previously identified for asso- MAF 49%)) in the promoter or 50-untranslated region of LEP ciation with BMI-adjusted waist–hip ratio (WHR )19, blood with circulating leptin levels in the general population, but these adjBMI triglycerides20 and risk of type 2 diabetes21, reached P ¼ 1 Â 10 À 6 results are inconclusive12–16. The same LEP variants have been with BMI-unadjusted leptin and P ¼ 2 Â 10 À 6 with studied for association with obesity, but a meta-analysis of the BMI-adjusted leptin levels, with the leptin-increasing allele published results (n ¼ 918 and n ¼ 2,174) found no A19G G2548A being associated with lower WHR , triglycerides and risk evidence of such association17. Candidate gene studies of LEP adjBMI of type 2 diabetes. were published before the human genome sequence was The estimated effects of five of the six loci (in/near LEP, extensively characterized and are therefore restricted to the SLC32A1, GCKR, CCNL1 or COBLL1) on leptin levels did not variants known at that time. Furthermore, although LEP is an markedly differ in magnitude between the BMI-unadjusted and obvious candidate, variants in other genes may also influence BMI-adjusted models, suggesting that these associations are not circulating leptin levels by regulating leptin production, secretion, mediated by adiposity per se (Fig. 1). In contrast, the association clearance or response. Identification of such leptin-regulating between the FTO locus and leptin levels was completely abolished genes could provide novel insights into mechanisms that regulate after adjusting for BMI, indicating that the association with leptin energy homeostasis and neuro-endocrine function1,2. is entirely mediated by the well-established association between In this study, we sought to identify genetic loci associated with FTO and BMI22 (Fig. 1). circulating leptin levels by a genome-wide meta-analysis. Given BMI is the most commonly used index of adiposity, but it is the strong correlation between leptin and adiposity, we also not a direct measure of adiposity and it does not distinguish examined genome-wide associations with circulating leptin levels between lean and fat body mass. To assess whether adjustment adjusted for BMI, to identify loci associated with leptin levels for a more direct measure of adiposity could enhance our ability independent of BMI. to identify adiposity-independent loci, we performed secondary analyses in 13 studies that had data on both BMI and body fat Results percentage assessed by dual-energy X-ray absorptiometry or bioimpedance analysis (n ¼ 18,980 or 59% of stage 1 sample). Stage 1 genome-wide meta-analysis in 32,161 individuals.We The analysis showed no marked differences in the effect sizes first performed a meta-analysis of the results from genome-wide between the BMI and body fat percentage-adjusted results for the associations between B2.5 million genotyped and leptin-associated LEP, SLC32A1, CCNL1, GCKR, COBLL1 and HapMap-imputed single-nucleotide polymorphisms (SNPs) and FTO loci (Supplementary Table 6), suggesting that adjustment for circulating leptin levels, including up to 32,161 individuals of BMI as compared with a more direct measure of adiposity did not European descent from 23 studies (Supplementary Table 1). After compromise our ability to identify adiposity-independent leptin- logarithmic transformation that normalized the distribution of associated loci. leptin levels and adjusting for age and sex, we carried out asso- ciation analyses within each study and subsequently meta-analysed the study-specific results. To identify loci Effects on other traits and potential functional roles. We took associated with circulating leptin levels independently of forward the genome-wide significant leptin loci near LEP, near adiposity, we performed a meta-analysis of genome-wide SLC32A1,inGCKR and near CCNL1, to examine their associations in which we additionally adjusted for BMI. associations with obesity-related and metabolic traits and to more We also performed secondary genome-wide meta-analyses directly assess their putative roles in the control of circulating in men (n ¼ 13,363) and women (n ¼ 18,698) separately, as leptin. We also took forward the locus near COBLL1, given its 19 women generally have higher leptin levels than men, primarily robust association with WHRadjBMI , even though it just due to larger percentage of body fat and greater subcutaneous fat missed the genome-wide significance threshold for association storage18.
Load more

Recommended publications
  • Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) a Thesis Submitte
    Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) A thesis submitted in partial fulfilment of the requirements of Nottingham Trent University for the degree of Doctor of Philosophy December 2019 1 Copyright Statement This work is the intellectual property of the author. You may copy up to 5% of this work for private study, or personal, non-commercial research. Any re-use of the information contained within this document should be fully referenced, quoting the author, title, university, degree level and pagination. Queries or requests for any other use, or if a more substantial copy is required, should be directed in the owner(s) of the Intellectual Property Rights. 2 Acknowledgements First, I would like to thank my Director of Studies, Chris Tinsley, for his support and encouragement throughout the course of the PhD. His kind words and ability to find the silver lining in any situation made the past few years that much easier. Thanks also to my supervisory team, Alan Hargreaves, Bob Stevens and Martin McGinnity for their advice and thoughts on experiments and data that helped shape the PhD. Whilst not on my supervisory team, I’m also grateful to Amanda Miles for her help with mass spectrometry and endless technical knowledge and to Rich Hulse for his advice and support throughout. Special thanks go to my colleagues. Notably, to Awais and Jordan for their ability to distract and take my mind out of the lab during stressful times and to Charlotte for being a role model of scientific rigour and discipline.
    [Show full text]
  • Supplemental Table 1
    Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG
    [Show full text]
  • Rabbit Anti-TAF9 Antibody-SL12968R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF9 antibody SL12968R Product Name: TAF9 Chinese Name: 转录起始因子TFIID亚基9抗体 TAF9 RNA polymerase II, TATA box-binding protein-associated factor, 32kDa; MGC:1603; MGC:3647; MGC:5067; RNA polymerase II TBP-associated factor subunit G; STAF31/32; TAF17; TAF2G; TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa; TAF9 RNA polymerase II, TATA box-binding protein-associated factor, 32kDa; TAFII31; TAFII32; TAFIID32; TATA Alias: box-binding protein-associated factor 2G; TBP associated factor 17 kDa; TBP associated factor 9; TBP associated factor, RNA polymerase II, 32-KD; transcription initiation factor TFIID 31 kD subunit; transcription initiation factor TFIID 31 kDa subunit; transcription initiation factor TFIID 32 kDa subunit; Transcription initiation factor TFIID subunit 9. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Cow, WB=1:500-2000ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100- 500IF=1:100-500（Paraffin sections need antigen repair） Applications: notwww.sunlongbiotech.com yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 29kDa Cellular localization: The nucleus Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human TAF9: Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized Storage: antibody is stable at room temperature for at least one month and for greater than a year when kept at -20°C.
    [Show full text]
  • Chromatin Conformation Links Distal Target Genes to CKD Loci
    BASIC RESEARCH www.jasn.org Chromatin Conformation Links Distal Target Genes to CKD Loci Maarten M. Brandt,1 Claartje A. Meddens,2,3 Laura Louzao-Martinez,4 Noortje A.M. van den Dungen,5,6 Nico R. Lansu,2,3,6 Edward E.S. Nieuwenhuis,2 Dirk J. Duncker,1 Marianne C. Verhaar,4 Jaap A. Joles,4 Michal Mokry,2,3,6 and Caroline Cheng1,4 1Experimental Cardiology, Department of Cardiology, Thoraxcenter Erasmus University Medical Center, Rotterdam, The Netherlands; and 2Department of Pediatrics, Wilhelmina Children’s Hospital, 3Regenerative Medicine Center Utrecht, Department of Pediatrics, 4Department of Nephrology and Hypertension, Division of Internal Medicine and Dermatology, 5Department of Cardiology, Division Heart and Lungs, and 6Epigenomics Facility, Department of Cardiology, University Medical Center Utrecht, Utrecht, The Netherlands ABSTRACT Genome-wide association studies (GWASs) have identified many genetic risk factors for CKD. However, linking common variants to genes that are causal for CKD etiology remains challenging. By adapting self-transcribing active regulatory region sequencing, we evaluated the effect of genetic variation on DNA regulatory elements (DREs). Variants in linkage with the CKD-associated single-nucleotide polymorphism rs11959928 were shown to affect DRE function, illustrating that genes regulated by DREs colocalizing with CKD-associated variation can be dysregulated and therefore, considered as CKD candidate genes. To identify target genes of these DREs, we used circular chro- mosome conformation capture (4C) sequencing on glomerular endothelial cells and renal tubular epithelial cells. Our 4C analyses revealed interactions of CKD-associated susceptibility regions with the transcriptional start sites of 304 target genes. Overlap with multiple databases confirmed that many of these target genes are involved in kidney homeostasis.
    [Show full text]
  • Agricultural University of Athens
    ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική
    [Show full text]
  • The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
    The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
    [Show full text]
  • Diagnóstico Molecular Do Transtorno Do Espectro Autista Através Do Sequenciamento Completo De Exoma Molecular Diagnosis Of
    Universidade de São Paulo Tatiana Ferreira de Almeida Diagnóstico molecular do transtorno do espectro autista através do sequenciamento completo de exoma Molecular diagnosis of autism spectrum disorder through whole exome sequencing São Paulo 2018 Universidade de São Paulo Tatiana Ferreira de Almeida Diagnóstico molecular do transtorno do espectro autista através do sequenciamento completo de exoma Molecular diagnosis of autism spectrum disorder through whole exome sequencing Tese apresentada ao Instituto de Biociências da Universidade de São Paulo, para a obtenção de Título de Doutor em Ciências, na Área de Biologia/Genética. Versão corrigida. Orientador(a): Maria Rita dos Santos Passos-Bueno São Paulo ii 2018 Dedico esta tese à ciência, e a todos os seus amantes. O, reason not the need! Our basest beggars Are in the poorest thing superfluous. Allow not nature more than nature needs, Man’s life is cheap as beast’s. Thou art a lady: If only to go warm were gorgeous, Why, nature needs not what thou gorgeous wear’st Which scarcely keeps thee warm. But, for true need- You heavens, give me that patience, patience I need! You see me here, you gods, a poor old man, As full of grief as age; wretched in both.” iii King Lear, William Shakespeare, 1608 Agradecimentos Agradeço em primeiro lugar ao meu grande amor Danilo, sem ele, há 11 anos, essa jornada não teria começado, a vida não teria me surpreendido e eu estaria de volta em casa, com todos os peixinhos do mar, e infeliz pelo resto da minha vida. Agradeço minha família, principalmente minha mãe Flávia e meu pai Airton por sacrificarem com mínimos protestos, as melhores horas que passaríamos juntos para que eu cumprisse meu trabalho.
    [Show full text]
  • The Role and Robustness of the Gini Coefficient As an Unbiased Tool For
    www.nature.com/scientificreports OPEN The role and robustness of the Gini coefcient as an unbiased tool for the selection of Gini genes for normalising expression profling data Marina Wright Muelas 1*, Farah Mughal1, Steve O’Hagan2,3, Philip J. Day3,4* & Douglas B. Kell 1,5* We recently introduced the Gini coefcient (GC) for assessing the expression variation of a particular gene in a dataset, as a means of selecting improved reference genes over the cohort (‘housekeeping genes’) typically used for normalisation in expression profling studies. Those genes (transcripts) that we determined to be useable as reference genes difered greatly from previous suggestions based on hypothesis-driven approaches. A limitation of this initial study is that a single (albeit large) dataset was employed for both tissues and cell lines. We here extend this analysis to encompass seven other large datasets. Although their absolute values difer a little, the Gini values and median expression levels of the various genes are well correlated with each other between the various cell line datasets, implying that our original choice of the more ubiquitously expressed low-Gini-coefcient genes was indeed sound. In tissues, the Gini values and median expression levels of genes showed a greater variation, with the GC of genes changing with the number and types of tissues in the data sets. In all data sets, regardless of whether this was derived from tissues or cell lines, we also show that the GC is a robust measure of gene expression stability. Using the GC as a measure of expression stability we illustrate its utility to fnd tissue- and cell line-optimised housekeeping genes without any prior bias, that again include only a small number of previously reported housekeeping genes.
    [Show full text]
  • Download Special Issue
    Complexity Biomolecular Networks for Complex Diseases Guest Editors: Fang X. Wu, Jianxin Wang, Min Li, and Haiying Wang Biomolecular Networks for Complex Diseases Complexity Biomolecular Networks for Complex Diseases Guest Editors: Kazuo Toda, Jorge L. Zeredo, Sae Uchida, and Vitaly Napadow Copyright © 2018 Hindawi. All rights reserved. This is a special issue published in “Complexity.” All articles are open access articles distributed under the Creative Commons Attribu- tion License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board José Ángel Acosta, Spain Mattia Frasca, Italy Daniela Paolotti, Italy Rodrigo Aldecoa, USA Lucia Valentina Gambuzza, Italy Luis M. Rocha, USA Juan A. Almendral, Spain Carlos Gershenson, Mexico Miguel Romance, Spain David Arroyo, Spain Peter Giesl, UK Matilde Santos, Spain Arturo Buscarino, Italy Sergio Gómez, Spain Hiroki Sayama, USA Guido Caldarelli, Italy Sigurdur F. Hafstein, Iceland Michele Scarpiniti, Italy Danilo Comminiello, Italy Giacomo Innocenti, Italy Enzo Pasquale Scilingo, Italy Manlio De Domenico, Italy Jeffrey H. Johnson, UK Samuel Stanton, USA Pietro De Lellis, Italy Vittorio Loreto, Italy Roberto Tonelli, Italy Albert Diaz-Guilera, Spain Didier Maquin, France Shahadat Uddin, Australia Jordi Duch, Spain Eulalia Martínez, Spain Gaetano Valenza, Italy Joshua Epstein, USA Ch. P. Monterola, Philippines Dimitri Volchenkov, USA Thierry Floquet, France Roberto Natella, Italy Christos Volos, Greece Contents Biomolecular
    [Show full text]
  • Quantitative SUMO Proteomics Identifies PIAS1 Substrates Involved
    ARTICLE https://doi.org/10.1038/s41467-020-14581-w OPEN Quantitative SUMO proteomics identifies PIAS1 substrates involved in cell migration and motility Chongyang Li1,2, Francis P. McManus1, Cédric Plutoni1, Cristina Mirela Pascariu1, Trent Nelson1,2, ✉ Lara Elis Alberici Delsin1,2, Gregory Emery 1,3 & Pierre Thibault1,4,5 1234567890():,; The protein inhibitor of activated STAT1 (PIAS1) is an E3 SUMO ligase that plays important roles in various cellular pathways. Increasing evidence shows that PIAS1 is overexpressed in various human malignancies, including prostate and lung cancers. Here we used quantitative SUMO proteomics to identify potential substrates of PIAS1 in a system-wide manner. We identified 983 SUMO sites on 544 proteins, of which 62 proteins were assigned as putative PIAS1 substrates. In particular, vimentin (VIM), a type III intermediate filament protein involved in cytoskeleton organization and cell motility, was SUMOylated by PIAS1 at Lys-439 and Lys-445 residues. VIM SUMOylation was necessary for its dynamic disassembly and cells expressing a non-SUMOylatable VIM mutant showed a reduced level of migration. Our approach not only enables the identification of E3 SUMO ligase substrates but also yields valuable biological insights into the unsuspected role of PIAS1 and VIM SUMOylation on cell motility. 1 Institute for Research in Immunology and Cancer, Université de Montréal, Montréal, Québec, Canada. 2 Molecular Biology Program, Université de Montréal, Montréal, Canada. 3 Department of Pathology and Cell Biology, Université de Montréal, Montréal, Québec, Canada. 4 Department of Chemistry, Université de Montréal, Montréal, Québec, Canada. 5 Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Québec, Canada.
    [Show full text]
  • Chimeric Transcript Discovery by Paired-End Transcriptome Sequencing
    Chimeric transcript discovery by paired-end transcriptome sequencing Christopher A. Mahera,b, Nallasivam Palanisamya,b, John C. Brennera,b, Xuhong Caoa,c, Shanker Kalyana-Sundarama,b, Shujun Luod, Irina Khrebtukovad, Terrence R. Barrettea,b, Catherine Grassoa,b, Jindan Yua,b, Robert J. Lonigroa,b, Gary Schrothd, Chandan Kumar-Sinhaa,b, and Arul M. Chinnaiyana,b,c,e,f,1 aMichigan Center for Translational Pathology, Ann Arbor, MI 48109; Departments of bPathology and eUrology, University of Michigan, Ann Arbor, MI 48109; cHoward Hughes Medical Institute and fComprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, MI 48109; and dIllumina Inc., 25861 Industrial Boulevard, Hayward, CA 94545 Communicated by David Ginsburg, University of Michigan Medical School, Ann Arbor, MI, May 4, 2009 (received for review March 16, 2009) Recurrent gene fusions are a prevalent class of mutations arising from (SAGE)-like sequencing (13), and next-generation DNA sequenc- the juxtaposition of 2 distinct regions, which can generate novel ing (14). Despite unveiling many novel genomic rearrangements, functional transcripts that could serve as valuable therapeutic targets solid tumors accumulate multiple nonspecific aberrations through- in cancer. Therefore, we aim to establish a sensitive, high-throughput out tumor progression; thus, making causal and driver aberrations methodology to comprehensively catalog functional gene fusions in indistinguishable from secondary and insignificant mutations, cancer by evaluating a paired-end transcriptome sequencing strategy. respectively. Not only did a paired-end approach provide a greater dynamic range The deep unbiased view of a cancer cell enabled by massively in comparison with single read based approaches, but it clearly parallel transcriptome sequencing has greatly facilitated gene fu- distinguished the high-level ‘‘driving’’ gene fusions, such as BCR-ABL1 sion discovery.
    [Show full text]
  • Systematic Bromodomain Protein Screens Identify Homologous Recombination and R-Loop Suppression Pathways Involved in Genome Integrity
    Downloaded from genesdev.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press RESOURCE/METHODOLOGY Systematic bromodomain protein screens identify homologous recombination and R-loop suppression pathways involved in genome integrity Jae Jin Kim,1,2,9 Seo Yun Lee,1,2,9 Fade Gong,1,2,8 Anna M. Battenhouse,1,2,3 Daniel R. Boutz,1,2,3 Aarti Bashyal,4 Samantha T. Refvik,1,2,5 Cheng-Ming Chiang,6 Blerta Xhemalce,1,2,7 Tanya T. Paull,1,2,5,7 Jennifer S. Brodbelt,4,7 Edward M. Marcotte,1,2,3 and Kyle M. Miller1,2,7 1Department of Molecular Biosciences, 2Institute for Cellular and Molecular Biology, 3Center for Systems and Synthetic Biology, 4Department of Chemistry, The University of Texas at Austin, Austin, Texas 78712, USA; 5The Howard Hughes Medical Institute; 6Simmons Comprehensive Cancer Center, Department of Biochemistry, Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA; 7Livestrong Cancer Institutes, Dell Medical School, The University of Texas at Austin, Austin, Texas 78712, USA Bromodomain proteins (BRD) are key chromatin regulators of genome function and stability as well as therapeutic targets in cancer. Here, we systematically delineate the contribution of human BRD proteins for genome stability and DNA double-strand break (DSB) repair using several cell-based assays and proteomic interaction network analysis. Applying these approaches, we identify 24 of the 42 BRD proteins as promoters of DNA repair and/or ge- nome integrity. We identified a BRD-reader function of PCAF that bound TIP60-mediated histone acetylations at DSBs to recruit a DUB complex to deubiquitylate histone H2BK120, to allowing direct acetylation by PCAF, and repair of DSBs by homologous recombination.
    [Show full text]