DOCSLIB.ORG

Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) a Thesis Submitte

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) a Thesis Submitte Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) A thesis submitted in partial fulfilment of the requirements of Nottingham Trent University for the degree of Doctor of Philosophy December 2019 1 Copyright Statement This work is the intellectual property of the author. You may copy up to 5% of this work for private study, or personal, non-commercial research. Any re-use of the information contained within this document should be fully referenced, quoting the author, title, university, degree level and pagination. Queries or requests for any other use, or if a more substantial copy is required, should be directed in the owner(s) of the Intellectual Property Rights. 2 Acknowledgements First, I would like to thank my Director of Studies, Chris Tinsley, for his support and encouragement throughout the course of the PhD. His kind words and ability to find the silver lining in any situation made the past few years that much easier. Thanks also to my supervisory team, Alan Hargreaves, Bob Stevens and Martin McGinnity for their advice and thoughts on experiments and data that helped shape the PhD. Whilst not on my supervisory team, I’m also grateful to Amanda Miles for her help with mass spectrometry and endless technical knowledge and to Rich Hulse for his advice and support throughout. Special thanks go to my colleagues. Notably, to Awais and Jordan for their ability to distract and take my mind out of the lab during stressful times and to Charlotte for being a role model of scientific rigour and discipline. To Fal, Giulia, Joe, Henry, Elisa and Dan, you all helped me find my feet when I started and helped me make it to the end. To Lydia, Chris, Eden and Max, the four of you made the day that much better by putting up with me venting about whatever issue seemed important on the day. My work would also not have been possible without the support of Sarah with her brutal honesty and patient teaching. Last but not least, I owe my thanks to my partner Nic, who has put up with late nights and weekend work for several years to get to this stage. I wouldn’t have tolerated me but Nic has been as supportive as anyone could wish for and understanding in difficult times, constantly pushing me to better myself. I owe you all my gratitude. 3 Abstract Neuroscientific research frequently utilises loss of function experiments to attribute function to a brain region. Gain of function experiments via cortical re-wiring would aid in validation of these studies and could allow the repair of damaged neural circuitry or the creation of novel neural structures. Research into neuronal re-wiring within the central nervous system demonstrates insufficient neurite extension upon implantation and highlights the need for similarity between exogenous and endogenous neurons. An aligned poly-L-lactic acid (PLLA) nanofibre scaffold was developed that induced the three dimensional aggregation of primary cortical neurons into a physiological structure of clustered soma and aligned, fasciculated neurites in a controlled way. Due to the self-assembling and physiological architecture of these 3D structures and subsequent detection of electrophysiological activities, these 3D structures were classified as “organoids”. Cerebral cortical organoids generated using the nanofibre based methodology were demonstrated to be more developmentally advanced than their two- dimensional counterparts and mechanisms were elucidated for the aggregation of the neurons and the development that occurred post-aggregation. Analysis of gene expression suggested that the organoids were also undergoing advanced developmental processes and proposed a mechanism by which this occurs. Optogenetic depolarisation of the implanted neurons and detection of downstream electrophysiological activity was selected as the means of confirming integration of exogenous neurons into endogenous circuitry post-implantation. Methods were optimised to facilitate efficient viral transfection of the optogenetic protein (Channelrhodopsin-2). Aligned PLLA nanofibres were found to significantly enhance transfection rates relative to the 2D control and the process by which this occurs was investigated. The work presented within suggests that aligned PLLA nanofibres may be used to generate a cerebral cortical organoid that is suited to implantation and cortical re-wiring and may have additional in vitro applications within diverse fields such as high throughput pharmacology, computational neuroscience and bioengineering. 4 Abbreviations AAV; adeno-associated virus AIDA; advanced image data analyser AMPA; α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid ANN; artificial neural network ANNI; artificial neural network inference BSA; bovine serum albumin CAM; cell adhesion molecule Chr2; channelrhodopsin-2 CNS; central nervous system DAPI; 4',6-diamidino-2-phenylindole DCM; dichloromethane DIV; days in vitro DMEM; Dulbecco’s modified Eagle’s medium DMF; dimethylformamide DMSO; dimethyl sulfoxide ECM; extracellular matrix ES; electrospun 5 FBS; fetal bovine serum FGF; fibroblast growth factor fMRI; functional magnetic resonance imaging FOV; field of vision GABA; γ-aminobutyric acid HBSS; Hanks’ balanced salt solution HEB; Hibernate-EB HFIP; hexafluoroisopropanol LDH; lactate dehydrogenase LED; light emitting diode MEA; microelectrode array MOI; multiplicity of infection MRI; magnetic resonance imaging MS; mass spectrometry MTT; thiazolyl blue tetrazolium bromide NSC; neural stem cell ofMRI; optogenetic functional magnetic resonance imaging PAN; polyacrylonitrile PBS; phosphate buffered saline PCA; principal components analysis 6 PD; Parkinson’s disease PDLO; poly-DL-ornithine PFA; paraformaldehyde PLA; poly-lactic acid PLL; poly-L-lysine PLLA; poly-L-lactic acid PLO; poly-L-ornithine PNS; peripheral nervous system PVC; polyvinyl chloride ROI; region of interest Rq; roughness TENN; tissue engineered neural network UV; ultraviolet w/v; weight/volume w/w; weight/weight 7 Table of Contents Chapter 1: Literature Review ................................................................................................... 13 1.1 Introduction ........................................................................................................................ 13 1.2 Lesion studies ...................................................................................................................... 13 1.3.1 Limitations to lesion studies ............................................................................................ 14 1.3.2 Use of an implant to overcome these limitations ............................................................ 19 1.4 Additional uses for an implant capable of re-wiring the cortex ......................................... 21 1.4.1 Integration of physiological neural circuit components into the cerebral cortex as a therapy ...................................................................................................................................... 22 1.4.2 Integrating non-physiological components in to the cerebral cortex ............................. 24 1.4.3 Temporal dynamics of neural networks .......................................................................... 28 1.5 How can the cortex be re-wired: considerations and existing methodologies .................. 29 1.5.1 Cellular sub-populations .................................................................................................. 29 1.5.2 Tissue-wide organisation ................................................................................................. 31 1.5.3 Existing methods of re-wiring the cerebral cortex .......................................................... 34 1.5.3.1 Areal Identity ................................................................................................................. 34 1.5.3.2 Cell Survival ................................................................................................................... 35 1.5.3.3 Neurite Extension .......................................................................................................... 36 1.5.3.4 Integration into existing neural circuitry ...................................................................... 37 1.6 Biomaterials and nanofibres ............................................................................................... 37 1.7 Goals of the PhD project ..................................................................................................... 39 Chapter 2: Materials and methods .......................................................................................... 40 2.1 Methods common to all chapters ....................................................................................... 40 2.1.1 Isolation of E18 Sprague Dawley rat cortex ..................................................................... 40 2.1.2 Dissociation of primary cortical neurons ......................................................................... 40 2.1.3 Maintenance of primary cortical neurons ....................................................................... 40 2.1.4 Cryopreservation .............................................................................................................. 41 2.1.5 Thawing ............................................................................................................................ 41 2.1.6 Electrospinning of nanofibres .........................................................................................
Load more

Recommended publications
  • Supplemental Table 1
    Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG
    [Show full text]
  • Rabbit Anti-TAF9 Antibody-SL12968R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF9 antibody SL12968R Product Name: TAF9 Chinese Name: 转录起始因子TFIID亚基9抗体 TAF9 RNA polymerase II, TATA box-binding protein-associated factor, 32kDa; MGC:1603; MGC:3647; MGC:5067; RNA polymerase II TBP-associated factor subunit G; STAF31/32; TAF17; TAF2G; TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa; TAF9 RNA polymerase II, TATA box-binding protein-associated factor, 32kDa; TAFII31; TAFII32; TAFIID32; TATA Alias: box-binding protein-associated factor 2G; TBP associated factor 17 kDa; TBP associated factor 9; TBP associated factor, RNA polymerase II, 32-KD; transcription initiation factor TFIID 31 kD subunit; transcription initiation factor TFIID 31 kDa subunit; transcription initiation factor TFIID 32 kDa subunit; Transcription initiation factor TFIID subunit 9. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Cow, WB=1:500-2000ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100- 500IF=1:100-500（Paraffin sections need antigen repair） Applications: notwww.sunlongbiotech.com yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 29kDa Cellular localization: The nucleus Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human TAF9: Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized Storage: antibody is stable at room temperature for at least one month and for greater than a year when kept at -20°C.
    [Show full text]
  • Chromatin Conformation Links Distal Target Genes to CKD Loci
    BASIC RESEARCH www.jasn.org Chromatin Conformation Links Distal Target Genes to CKD Loci Maarten M. Brandt,1 Claartje A. Meddens,2,3 Laura Louzao-Martinez,4 Noortje A.M. van den Dungen,5,6 Nico R. Lansu,2,3,6 Edward E.S. Nieuwenhuis,2 Dirk J. Duncker,1 Marianne C. Verhaar,4 Jaap A. Joles,4 Michal Mokry,2,3,6 and Caroline Cheng1,4 1Experimental Cardiology, Department of Cardiology, Thoraxcenter Erasmus University Medical Center, Rotterdam, The Netherlands; and 2Department of Pediatrics, Wilhelmina Children’s Hospital, 3Regenerative Medicine Center Utrecht, Department of Pediatrics, 4Department of Nephrology and Hypertension, Division of Internal Medicine and Dermatology, 5Department of Cardiology, Division Heart and Lungs, and 6Epigenomics Facility, Department of Cardiology, University Medical Center Utrecht, Utrecht, The Netherlands ABSTRACT Genome-wide association studies (GWASs) have identified many genetic risk factors for CKD. However, linking common variants to genes that are causal for CKD etiology remains challenging. By adapting self-transcribing active regulatory region sequencing, we evaluated the effect of genetic variation on DNA regulatory elements (DREs). Variants in linkage with the CKD-associated single-nucleotide polymorphism rs11959928 were shown to affect DRE function, illustrating that genes regulated by DREs colocalizing with CKD-associated variation can be dysregulated and therefore, considered as CKD candidate genes. To identify target genes of these DREs, we used circular chro- mosome conformation capture (4C) sequencing on glomerular endothelial cells and renal tubular epithelial cells. Our 4C analyses revealed interactions of CKD-associated susceptibility regions with the transcriptional start sites of 304 target genes. Overlap with multiple databases confirmed that many of these target genes are involved in kidney homeostasis.
    [Show full text]
  • Agricultural University of Athens
    ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΤΩΝ ΖΩΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΖΩΙΚΗΣ ΠΑΡΑΓΩΓΗΣ ΕΡΓΑΣΤΗΡΙΟ ΓΕΝΙΚΗΣ ΚΑΙ ΕΙΔΙΚΗΣ ΖΩΟΤΕΧΝΙΑΣ ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ ΑΘΗΝΑ 2020 ΔΙΔΑΚΤΟΡΙΚΗ ΔΙΑΤΡΙΒΗ Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Genome-wide association analysis and gene network analysis for (re)production traits in commercial broilers ΕΙΡΗΝΗ Κ. ΤΑΡΣΑΝΗ ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ: ΑΝΤΩΝΙΟΣ ΚΟΜΙΝΑΚΗΣ Τριμελής Επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Επταμελής εξεταστική επιτροπή: Aντώνιος Κομινάκης (Αν. Καθ. ΓΠΑ) Ανδρέας Κράνης (Eρευν. B, Παν. Εδιμβούργου) Αριάδνη Χάγερ (Επ. Καθ. ΓΠΑ) Πηνελόπη Μπεμπέλη (Καθ. ΓΠΑ) Δημήτριος Βλαχάκης (Επ. Καθ. ΓΠΑ) Ευάγγελος Ζωίδης (Επ.Καθ. ΓΠΑ) Γεώργιος Θεοδώρου (Επ.Καθ. ΓΠΑ) 2 Εντοπισμός γονιδιωματικών περιοχών και δικτύων γονιδίων που επηρεάζουν παραγωγικές και αναπαραγωγικές ιδιότητες σε πληθυσμούς κρεοπαραγωγικών ορνιθίων Περίληψη Σκοπός της παρούσας διδακτορικής διατριβής ήταν ο εντοπισμός γενετικών δεικτών και υποψηφίων γονιδίων που εμπλέκονται στο γενετικό έλεγχο δύο τυπικών πολυγονιδιακών ιδιοτήτων σε κρεοπαραγωγικά ορνίθια. Μία ιδιότητα σχετίζεται με την ανάπτυξη (σωματικό βάρος στις 35 ημέρες, ΣΒ) και η άλλη με την αναπαραγωγική
    [Show full text]
  • The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
    The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
    [Show full text]
  • Diagnóstico Molecular Do Transtorno Do Espectro Autista Através Do Sequenciamento Completo De Exoma Molecular Diagnosis Of
    Universidade de São Paulo Tatiana Ferreira de Almeida Diagnóstico molecular do transtorno do espectro autista através do sequenciamento completo de exoma Molecular diagnosis of autism spectrum disorder through whole exome sequencing São Paulo 2018 Universidade de São Paulo Tatiana Ferreira de Almeida Diagnóstico molecular do transtorno do espectro autista através do sequenciamento completo de exoma Molecular diagnosis of autism spectrum disorder through whole exome sequencing Tese apresentada ao Instituto de Biociências da Universidade de São Paulo, para a obtenção de Título de Doutor em Ciências, na Área de Biologia/Genética. Versão corrigida. Orientador(a): Maria Rita dos Santos Passos-Bueno São Paulo ii 2018 Dedico esta tese à ciência, e a todos os seus amantes. O, reason not the need! Our basest beggars Are in the poorest thing superfluous. Allow not nature more than nature needs, Man’s life is cheap as beast’s. Thou art a lady: If only to go warm were gorgeous, Why, nature needs not what thou gorgeous wear’st Which scarcely keeps thee warm. But, for true need- You heavens, give me that patience, patience I need! You see me here, you gods, a poor old man, As full of grief as age; wretched in both.” iii King Lear, William Shakespeare, 1608 Agradecimentos Agradeço em primeiro lugar ao meu grande amor Danilo, sem ele, há 11 anos, essa jornada não teria começado, a vida não teria me surpreendido e eu estaria de volta em casa, com todos os peixinhos do mar, e infeliz pelo resto da minha vida. Agradeço minha família, principalmente minha mãe Flávia e meu pai Airton por sacrificarem com mínimos protestos, as melhores horas que passaríamos juntos para que eu cumprisse meu trabalho.
    [Show full text]
  • The Role and Robustness of the Gini Coefficient As an Unbiased Tool For
    www.nature.com/scientificreports OPEN The role and robustness of the Gini coefcient as an unbiased tool for the selection of Gini genes for normalising expression profling data Marina Wright Muelas 1*, Farah Mughal1, Steve O’Hagan2,3, Philip J. Day3,4* & Douglas B. Kell 1,5* We recently introduced the Gini coefcient (GC) for assessing the expression variation of a particular gene in a dataset, as a means of selecting improved reference genes over the cohort (‘housekeeping genes’) typically used for normalisation in expression profling studies. Those genes (transcripts) that we determined to be useable as reference genes difered greatly from previous suggestions based on hypothesis-driven approaches. A limitation of this initial study is that a single (albeit large) dataset was employed for both tissues and cell lines. We here extend this analysis to encompass seven other large datasets. Although their absolute values difer a little, the Gini values and median expression levels of the various genes are well correlated with each other between the various cell line datasets, implying that our original choice of the more ubiquitously expressed low-Gini-coefcient genes was indeed sound. In tissues, the Gini values and median expression levels of genes showed a greater variation, with the GC of genes changing with the number and types of tissues in the data sets. In all data sets, regardless of whether this was derived from tissues or cell lines, we also show that the GC is a robust measure of gene expression stability. Using the GC as a measure of expression stability we illustrate its utility to fnd tissue- and cell line-optimised housekeeping genes without any prior bias, that again include only a small number of previously reported housekeeping genes.
    [Show full text]
  • Download Special Issue
    Complexity Biomolecular Networks for Complex Diseases Guest Editors: Fang X. Wu, Jianxin Wang, Min Li, and Haiying Wang Biomolecular Networks for Complex Diseases Complexity Biomolecular Networks for Complex Diseases Guest Editors: Kazuo Toda, Jorge L. Zeredo, Sae Uchida, and Vitaly Napadow Copyright © 2018 Hindawi. All rights reserved. This is a special issue published in “Complexity.” All articles are open access articles distributed under the Creative Commons Attribu- tion License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board José Ángel Acosta, Spain Mattia Frasca, Italy Daniela Paolotti, Italy Rodrigo Aldecoa, USA Lucia Valentina Gambuzza, Italy Luis M. Rocha, USA Juan A. Almendral, Spain Carlos Gershenson, Mexico Miguel Romance, Spain David Arroyo, Spain Peter Giesl, UK Matilde Santos, Spain Arturo Buscarino, Italy Sergio Gómez, Spain Hiroki Sayama, USA Guido Caldarelli, Italy Sigurdur F. Hafstein, Iceland Michele Scarpiniti, Italy Danilo Comminiello, Italy Giacomo Innocenti, Italy Enzo Pasquale Scilingo, Italy Manlio De Domenico, Italy Jeffrey H. Johnson, UK Samuel Stanton, USA Pietro De Lellis, Italy Vittorio Loreto, Italy Roberto Tonelli, Italy Albert Diaz-Guilera, Spain Didier Maquin, France Shahadat Uddin, Australia Jordi Duch, Spain Eulalia Martínez, Spain Gaetano Valenza, Italy Joshua Epstein, USA Ch. P. Monterola, Philippines Dimitri Volchenkov, USA Thierry Floquet, France Roberto Natella, Italy Christos Volos, Greece Contents Biomolecular
    [Show full text]
  • Quantitative SUMO Proteomics Identifies PIAS1 Substrates Involved
    ARTICLE https://doi.org/10.1038/s41467-020-14581-w OPEN Quantitative SUMO proteomics identifies PIAS1 substrates involved in cell migration and motility Chongyang Li1,2, Francis P. McManus1, Cédric Plutoni1, Cristina Mirela Pascariu1, Trent Nelson1,2, ✉ Lara Elis Alberici Delsin1,2, Gregory Emery 1,3 & Pierre Thibault1,4,5 1234567890():,; The protein inhibitor of activated STAT1 (PIAS1) is an E3 SUMO ligase that plays important roles in various cellular pathways. Increasing evidence shows that PIAS1 is overexpressed in various human malignancies, including prostate and lung cancers. Here we used quantitative SUMO proteomics to identify potential substrates of PIAS1 in a system-wide manner. We identified 983 SUMO sites on 544 proteins, of which 62 proteins were assigned as putative PIAS1 substrates. In particular, vimentin (VIM), a type III intermediate filament protein involved in cytoskeleton organization and cell motility, was SUMOylated by PIAS1 at Lys-439 and Lys-445 residues. VIM SUMOylation was necessary for its dynamic disassembly and cells expressing a non-SUMOylatable VIM mutant showed a reduced level of migration. Our approach not only enables the identification of E3 SUMO ligase substrates but also yields valuable biological insights into the unsuspected role of PIAS1 and VIM SUMOylation on cell motility. 1 Institute for Research in Immunology and Cancer, Université de Montréal, Montréal, Québec, Canada. 2 Molecular Biology Program, Université de Montréal, Montréal, Canada. 3 Department of Pathology and Cell Biology, Université de Montréal, Montréal, Québec, Canada. 4 Department of Chemistry, Université de Montréal, Montréal, Québec, Canada. 5 Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Québec, Canada.
    [Show full text]
  • Chimeric Transcript Discovery by Paired-End Transcriptome Sequencing
    Chimeric transcript discovery by paired-end transcriptome sequencing Christopher A. Mahera,b, Nallasivam Palanisamya,b, John C. Brennera,b, Xuhong Caoa,c, Shanker Kalyana-Sundarama,b, Shujun Luod, Irina Khrebtukovad, Terrence R. Barrettea,b, Catherine Grassoa,b, Jindan Yua,b, Robert J. Lonigroa,b, Gary Schrothd, Chandan Kumar-Sinhaa,b, and Arul M. Chinnaiyana,b,c,e,f,1 aMichigan Center for Translational Pathology, Ann Arbor, MI 48109; Departments of bPathology and eUrology, University of Michigan, Ann Arbor, MI 48109; cHoward Hughes Medical Institute and fComprehensive Cancer Center, University of Michigan Medical School, Ann Arbor, MI 48109; and dIllumina Inc., 25861 Industrial Boulevard, Hayward, CA 94545 Communicated by David Ginsburg, University of Michigan Medical School, Ann Arbor, MI, May 4, 2009 (received for review March 16, 2009) Recurrent gene fusions are a prevalent class of mutations arising from (SAGE)-like sequencing (13), and next-generation DNA sequenc- the juxtaposition of 2 distinct regions, which can generate novel ing (14). Despite unveiling many novel genomic rearrangements, functional transcripts that could serve as valuable therapeutic targets solid tumors accumulate multiple nonspecific aberrations through- in cancer. Therefore, we aim to establish a sensitive, high-throughput out tumor progression; thus, making causal and driver aberrations methodology to comprehensively catalog functional gene fusions in indistinguishable from secondary and insignificant mutations, cancer by evaluating a paired-end transcriptome sequencing strategy. respectively. Not only did a paired-end approach provide a greater dynamic range The deep unbiased view of a cancer cell enabled by massively in comparison with single read based approaches, but it clearly parallel transcriptome sequencing has greatly facilitated gene fu- distinguished the high-level ‘‘driving’’ gene fusions, such as BCR-ABL1 sion discovery.
    [Show full text]
  • Systematic Bromodomain Protein Screens Identify Homologous Recombination and R-Loop Suppression Pathways Involved in Genome Integrity
    Downloaded from genesdev.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press RESOURCE/METHODOLOGY Systematic bromodomain protein screens identify homologous recombination and R-loop suppression pathways involved in genome integrity Jae Jin Kim,1,2,9 Seo Yun Lee,1,2,9 Fade Gong,1,2,8 Anna M. Battenhouse,1,2,3 Daniel R. Boutz,1,2,3 Aarti Bashyal,4 Samantha T. Refvik,1,2,5 Cheng-Ming Chiang,6 Blerta Xhemalce,1,2,7 Tanya T. Paull,1,2,5,7 Jennifer S. Brodbelt,4,7 Edward M. Marcotte,1,2,3 and Kyle M. Miller1,2,7 1Department of Molecular Biosciences, 2Institute for Cellular and Molecular Biology, 3Center for Systems and Synthetic Biology, 4Department of Chemistry, The University of Texas at Austin, Austin, Texas 78712, USA; 5The Howard Hughes Medical Institute; 6Simmons Comprehensive Cancer Center, Department of Biochemistry, Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA; 7Livestrong Cancer Institutes, Dell Medical School, The University of Texas at Austin, Austin, Texas 78712, USA Bromodomain proteins (BRD) are key chromatin regulators of genome function and stability as well as therapeutic targets in cancer. Here, we systematically delineate the contribution of human BRD proteins for genome stability and DNA double-strand break (DSB) repair using several cell-based assays and proteomic interaction network analysis. Applying these approaches, we identify 24 of the 42 BRD proteins as promoters of DNA repair and/or ge- nome integrity. We identified a BRD-reader function of PCAF that bound TIP60-mediated histone acetylations at DSBs to recruit a DUB complex to deubiquitylate histone H2BK120, to allowing direct acetylation by PCAF, and repair of DSBs by homologous recombination.
    [Show full text]
  • Promoter Switching in Response to Changing Environment And
    www.nature.com/scientificreports OPEN Promoter switching in response to changing environment and elevated expression of protein‑coding genes overlapping at their 5’ ends Wojciech Rosikiewicz1, Jarosław Sikora2, Tomasz Skrzypczak2,3, Magdalena R. Kubiak2 & Izabela Makałowska2* Despite the number of studies focused on sense‑antisense transcription, the key question of whether such organization evolved as a regulator of gene expression or if this is only a byproduct of other regulatory processes has not been elucidated to date. In this study, protein‑coding sense‑antisense gene pairs were analyzed with a particular focus on pairs overlapping at their 5’ ends. Analyses were performed in 73 human transcription start site libraries. The results of our studies showed that the overlap between genes is not a stable feature and depends on which TSSs are utilized in a given cell type. An analysis of gene expression did not confrm that overlap between genes causes downregulation of their expression. This observation contradicts earlier fndings. In addition, we showed that the switch from one promoter to another, leading to genes overlap, may occur in response to changing environment of a cell or tissue. We also demonstrated that in transfected and cancerous cells genes overlap is observed more often in comparison with normal tissues. Moreover, utilization of overlapping promoters depends on particular state of a cell and, at least in some groups of genes, is not merely coincidental. Te presence of protein-coding genes located on opposite strands of DNA and sharing fragments of genomic sequences in a sense-antisense orientation (i.e., overlapping genes) was reported in mammalian genomes over 30 years ago1.
    [Show full text]