DOCSLIB.ORG

Download Special Issue

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download Special Issue Complexity Biomolecular Networks for Complex Diseases Guest Editors: Fang X. Wu, Jianxin Wang, Min Li, and Haiying Wang Biomolecular Networks for Complex Diseases Complexity Biomolecular Networks for Complex Diseases Guest Editors: Kazuo Toda, Jorge L. Zeredo, Sae Uchida, and Vitaly Napadow Copyright © 2018 Hindawi. All rights reserved. This is a special issue published in “Complexity.” All articles are open access articles distributed under the Creative Commons Attribu- tion License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board José Ángel Acosta, Spain Mattia Frasca, Italy Daniela Paolotti, Italy Rodrigo Aldecoa, USA Lucia Valentina Gambuzza, Italy Luis M. Rocha, USA Juan A. Almendral, Spain Carlos Gershenson, Mexico Miguel Romance, Spain David Arroyo, Spain Peter Giesl, UK Matilde Santos, Spain Arturo Buscarino, Italy Sergio Gómez, Spain Hiroki Sayama, USA Guido Caldarelli, Italy Sigurdur F. Hafstein, Iceland Michele Scarpiniti, Italy Danilo Comminiello, Italy Giacomo Innocenti, Italy Enzo Pasquale Scilingo, Italy Manlio De Domenico, Italy Jeffrey H. Johnson, UK Samuel Stanton, USA Pietro De Lellis, Italy Vittorio Loreto, Italy Roberto Tonelli, Italy Albert Diaz-Guilera, Spain Didier Maquin, France Shahadat Uddin, Australia Jordi Duch, Spain Eulalia Martínez, Spain Gaetano Valenza, Italy Joshua Epstein, USA Ch. P. Monterola, Philippines Dimitri Volchenkov, USA Thierry Floquet, France Roberto Natella, Italy Christos Volos, Greece Contents Biomolecular Networks for Complex Diseases Fang-Xiang Wu , Jianxin Wang ,MinLi ,andHaiyingWang Volume 2018, Article ID 4210160, 3 pages SDTRLS: Predicting Drug-Target Interactions for Complex Diseases Based on Chemical Substructures Cheng Yan, Jianxin Wang, Wei Lan, Fang-Xiang Wu, and Yi Pan Volume 2017, Article ID 2713280, 10 pages Complex Brain Network Analysis and Its Applications to Brain Disorders: A Survey Jin Liu, Min Li, Yi Pan, Wei Lan, Ruiqing Zheng, Fang-Xiang Wu, and Jianxin Wang Volume 2017, Article ID 8362741, 27 pages Building Up a Robust Risk Mathematical Platform to Predict Colorectal Cancer Le Zhang, Chunqiu Zheng, Tian Li, Lei Xing, Han Zeng, Tingting Li, Huan Yang, Jia Cao, Badong Chen, and Ziyuan Zhou Volume 2017, Article ID 8917258, 14 pages miRNA-Disease Association Prediction with Collaborative Matrix Factorization ZhenShen,You-HuaZhang,KyungsookHan,AsokeK.Nandi,BarryHonig,andDe-ShuangHuang Volume 2017, Article ID 2498957, 9 pages Exploring the Limitations of Peripheral Blood Transcriptional Biomarkers in Predicting Influenza Vaccine Responsiveness Luca Marchetti, Emilio Siena, Mario Lauria, Denise Maffione, Nicola Pacchiani, Corrado Priami, and Duccio Medini Volume 2017, Article ID 3017632, 9 pages FAACOSE: A Fast Adaptive Ant Colony Optimization Algorithm for Detecting SNP Epistasis Lin Yuan, Chang-An Yuan, and De-Shuang Huang Volume 2017, Article ID 5024867, 10 pages Predicting Protein Complexes in Weighted Dynamic PPI Networks Based on ICSC Jie Zhao, Xiujuan Lei, and Fang-Xiang Wu Volume 2017, Article ID 4120506, 11 pages DriverFinder: A Gene Length-Based Network Method to Identify Cancer Driver Genes Pi-Jing Wei, Di Zhang, Hai-Tao Li, Junfeng Xia, and Chun-Hou Zheng Volume 2017, Article ID 4826206, 10 pages Identifying the Risky SNP of Osteoporosis with ID3-PEP Decision Tree Algorithm Jincai Yang, Huichao Gu, Xingpeng Jiang, Qingyang Huang, Xiaohua Hu, and Xianjun Shen Volume 2017, Article ID 9194801, 8 pages A Resting-State Brain Functional Network Study in MDD Based on Minimum Spanning Tree Analysis and the Hierarchical Clustering Xiaowei Li, Zhuang Jing, Bin Hu, Jing Zhu, Ning Zhong, Mi Li, Zhijie Ding, Jing Yang, Lan Zhang, Lei Feng, and Dennis Majoe Volume 2017, Article ID 9514369, 11 pages Robust Nonnegative Matrix Factorization via Joint Graph Laplacian and Discriminative Information for Identifying Differentially Expressed Genes Ling-Yun Dai, Chun-Mei Feng, Jin-Xing Liu, Chun-Hou Zheng, Jiguo Yu, and Mi-Xiao Hou Volume 2017, Article ID 4216797, 11 pages Hindawi Complexity Volume 2018, Article ID 4210160, 3 pages https://doi.org/10.1155/2018/4210160 Editorial Biomolecular Networks for Complex Diseases Fang-Xiang Wu ,1,2 Jianxin Wang ,3 Min Li ,3 and Haiying Wang4 1 School of Mathematical Sciences, Nankai University, Tianjin 300071, China 2Division of Biomedical Engineering and Department of Mechanical Engineering, University of Saskatchewan, Saskatoon, SK, Canada S7N 5A9 3School of Information Science and Engineering, Central South University, Changsha, Hunan 410012, China 4School of Computing and Mathematics, Ulster University, Belfast BT37 0QB, UK Correspondence should be addressed to Fang-Xiang Wu; [email protected] Received 18 January 2018; Accepted 18 January 2018; Published 15 February 2018 Copyright © 2018 Fang-Xiang Wu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. It is widely acknowledged that complex diseases or disorders potential miRNA-disease associations by integrating miRNA (e.g., cancer, AIDS, and obesity) stem from the dysfunction functional similarity, disease semantic similarity, and experi- of biomolecular networks, not only their isolated compo- mentally verified miRNA-disease associations. Experiments nents (e.g., genes, proteins, and metabolites). Biomolecu- verified that CMFMDA achieved intended purpose and lar networks typically include gene regulatory networks, application values with its short consuming-time and high protein-protein interaction networks, metabolic networks, prediction accuracy. In addition, CMFMDA was applied to and signal transduction networks. With advances in high reveal the potential related miRNAs of Esophageal Neo- throughput measurement techniques such as microarray, plasms and Kidney Neoplasms. RNA-seq, ChIP-chip, yeast two-hybrid analysis, and mass The identification of target molecules associated with spectrometry, large-scale biological data have been and will specific complex diseases is the basis of modern drug discov- continuously be produced. Such data contain insightful ery and development. The computational methods provide information for understanding the mechanism of molecular biological systems and have proved useful in diagnosis, a low-cost and high-efficiency way for predicting drug- treatment, and drug design for complex diseases or disorders. target interactions (DTIs) from biomolecular networks. In For this special issue, we have invited the researchers to the paper “SDTRLS: Predicting Drug-Target Interactions for contribute their original studies in modeling/construction, Complex Diseases Based on Chemical Substructures,” C. Yan analysis, synthesis, and control of complex disease-related et al. proposed a method (called SDTRLS) for predicting biomolecular networks. This special issue accepted eleven DTIs through RLS-Kron model with chemical substructure articles for inclusion after rigorous review. We would like to similarity fusion and Gaussian Interaction Profile (GIP) ker- introduceeachofthembyashortdescription. nels. Their computational experiments showed that SDTRLS Existing studies have shown that microRNAs (miRNAs) outperformed the state-of-the-art methods such as SDTNBI. are involved in the development and progression of various Vaccines represent one of the most effective interven- complex diseases. Experimental identification of miRNA- tions to control infectious diseases. Despite the many suc- disease association is expensive and time-consuming and cesses, an effective vaccine against current global pandemics thus it is appealing to design efficient algorithms to identify such as HIV, malaria, and tuberculosis is still missing. In novel miRNA-disease association. In the paper “miRNA- the paper “Exploring the Limitations of Peripheral Blood Disease Association Prediction with Collaborative Matrix Transcriptional Biomarkers in Predicting Influenza Vaccine Factorization,” Z. Shen et al. developed the computational Responsiveness,” L. Marchetti et al. applied systems biology method of Collaborative Matrix Factorization for miRNA- tovaccinologyandemployedarecentlyestablishedalgorithm Disease Association (CMFMDA) prediction to identify for signature-based clustering of expression profiles, SCUDO, 2 Complexity to provide new insights into why blood-derived transcrip- dataset showed that the proposed method outperformed tome biomarkers often fail to predict the seroresponse to other methods in epistasis detection and could contribute to the influenza virus vaccination. Their analysis revealed that the research of mechanism underlying the disease. composite measures provided a more accurate assessment of Clinical disorders of human brains, such as Alzheimer’s the seroresponse to multicomponent influenza vaccines. disease (AD), schizophrenia (SCZ), and Parkinson’s disease Protein complexes are involved in multiple biological pro- (PD), are among the most complex diseases and therapeu- cesses, and thus detection of protein complexes is essential to tically intractable health problems. In recent years, brain the understanding of complex diseases. In the paper “Predict- regions and their interactions can be modeled as complex ing Protein Complexes in Weighted Dynamic PPI Networks brain networks, which describe highly efficient informa- BasedonICSC,”J.Zhaoetal.proposedanovelalgorithm tion transmission in a brain.
Load more

Recommended publications
  • Compact Explicit Matrix Representations of the Flexoelectric Tensor and a Graphic Method for Identifying All of Its Rotation and Reflection Symmetries H
    Compact explicit matrix representations of the flexoelectric tensor and a graphic method for identifying all of its rotation and reflection symmetries H. Le Quang, Q.-C. He To cite this version: H. Le Quang, Q.-C. He. Compact explicit matrix representations of the flexoelectric tensor and a graphic method for identifying all of its rotation and reflection symmetries. Journal of Applied Physics, American Institute of Physics, 2021, 129 (24), pp.244103. 10.1063/5.0048386. hal-03267829 HAL Id: hal-03267829 https://hal.archives-ouvertes.fr/hal-03267829 Submitted on 22 Jun 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Compact explicit matrix representations of the flexoelectric tensor and a graphic method for identifying all of its rotation and reflection symmetries H. Le Quang1, a) and Q.-C. He1, 2 1)Universit´eGustave Eiffel, CNRS, MSME UMR 8208, F-77454 Marne-la-Vall´ee, France. 2)Southwest Jiaotong University, School of Mechanical Engineering, Chengdu 610031, PR China. (Dated: 17 May 2021) Flexoelectricity is an electromechanical phenomenon produced in a dielectric material, with or without cen- trosymmetric microstructure, undergoing a non-uniform strain. It is characterized by the fourth-order flexo- electric tensor which links the electric polarization vector with the gradient of the second-order strain tensor.
    [Show full text]
  • Historiography and Narratives of the Later Tang (923-936) and Later Jin (936-947) Dynasties in Tenth- to Eleventh- Century Sources
    Historiography and Narratives of the Later Tang (923-936) and Later Jin (936-947) Dynasties in Tenth- to Eleventh- century Sources Inauguraldissertation zur Erlangung des Doktorgrades der Philosophie an der Ludwig‐Maximilians‐Universität München vorgelegt von Maddalena Barenghi Aus Mailand 2014 Erstgutachter: Prof. Dr. Hans van Ess Zweitgutachter: Prof. Tiziana Lippiello Datum der mündlichen Prüfung: 31.03.2014 ABSTRACT Historiography and Narratives of the Later Tang (923-36) and Later Jin (936-47) Dynasties in Tenth- to Eleventh-century Sources Maddalena Barenghi This thesis deals with historical narratives of two of the Northern regimes of the tenth-century Five Dynasties period. By focusing on the history writing project commissioned by the Later Tang (923-936) court, it first aims at questioning how early-tenth-century contemporaries narrated some of the major events as they unfolded after the fall of the Tang (618-907). Second, it shows how both late- tenth-century historiographical agencies and eleventh-century historians perceived and enhanced these historical narratives. Through an analysis of selected cases the thesis attempts to show how, using the same source material, later historians enhanced early-tenth-century narratives in order to tell different stories. The five cases examined offer fertile ground for inquiry into how the different sources dealt with narratives on the rise and fall of the Shatuo Later Tang and Later Jin (936- 947). It will be argued that divergent narrative details are employed both to depict in different ways the characters involved and to establish hierarchies among the historical agents. Table of Contents List of Rulers ............................................................................................................ ii Aknowledgements ..................................................................................................
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Life and Writings of Xu Hui (627–650), Worthy Consort, at the Early Tang Court
    life and writings of xu hui paul w. kroll The Life and Writings of Xu Hui (627–650), Worthy Consort, at the Early Tang Court mong the women poets of the Tang dynasty (618–907) surely the A.best known are Xue Tao 薛濤 (770–832), the literate geisha from Shu 蜀, and the volatile, sometime Daoist priestess Yu Xuanji 魚玄機 (ca. 844–870?). More interesting strictly as a poet than these two fig- ures are Li Ye 李冶 who was active during the late-eighth century and whose eighteen remaining poems show more range and skill than either Xue Tao or Yu Xuanji, and the “Lady of the Flower Stamens” (“Hua- rui furen” 花蕊夫人) whose 157 heptametric quatrains in the “palace” style occupy all of juan 798 in Quan Tang shi 全唐詩, even though she lived in the mid-tenth century and served at the court of the short-lived kingdom of Later Shu 後蜀.1 Far more influential in her day than any of these, though barely two dozen of her poems are now preserved, was the elegant Shangguan Wan’er 上官婉兒 (ca. 664–710), granddaughter of the executed courtier and poet Shangguan Yi 上官儀 (?–665) who had paid the ultimate price for opposing empress Wu Zhao’s 吳曌 (625–705) usurpation of imperial privileges.2 After the execution of Shangguan Yi and other members of his family, Wan’er, then just an infant, was taken into the court as a sort of expiation by empress Wu.3 By the end I should like to thank David R.
    [Show full text]
  • Leveraging Whole Genome Sequences to Compare Mutational Mechanism and Identify Medically Relevant Variation in African Versus Non-African Descend Populations
    Leveraging Whole Genome Sequences to Compare Mutational Mechanism and Identify Medically Relevant Variation in African versus Non-African Descend Populations By Shatha Mobarak Alosaimi ALSSHA003 Town Dissertation submitted to the University of Cape Town in fulfilment of the requirements for the degree of Master of Science (MSc) in Human Genetics. Cape of Faculty of Health Sciences UniversityUniversity of Cape Twon Date of Submission: 10/02/2020 Supervised by: Assoc/Prof. Emile R. Chimusa Division of Human genetics Department of Pathology University of Cape Town, SA The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgement of the source. The thesis is to be used for private study or non- commercial research purposes only. Published by the University of Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University of Cape Town Declaration I, Shatha Alosaimi, hereby declare that the work on which this dissertation/thesis is based is my original work (except where acknowledgements indicate otherwise) and that neither the whole work nor any part of it has been, is being, or is to be submitted for another degree in this or any other university. I empower the university to reproduce for the purpose of research either the whole or any portion of the contents in any manner whatsoever Signature: Date: 01/02/2020. i Publications I confirm that I have been granted permission by the University of Cape Town's Master's Degrees Board to include the following publications in my thesis, and where co-authorships are involved, my co-authors have agreed that I may include the publications.
    [Show full text]
  • Discrepancies Between Zhang Tianyi and Dickens
    This thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Zhang Tianyi’s Selective Acceptance of Charles Dickens Chunxu Ge School of Languages, Literatures and Cultures Submitted for the Degree of Doctor of Philosophy June 2019 1 Abstract This research is a comparative study on the works of Charles Dickens (1812-1870) and Zhang Tianyi 張天翼 (1906-1985). The former was one of the greatest novelists of the Victorian era; the latter, a Left-wing writer in Republican China. The study analyses five short stories from Zhang’s corpus and compares his works with ten novles of Dickens. The study argues that Dickens is one among other writers that have parallels with Zhang, through the exploration of several aspects of their works. At the beginning of the twentieth century, Dickens’s novels were introduced to China by Lin Shu.
    [Show full text]
  • Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) a Thesis Submitte
    Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) A thesis submitted in partial fulfilment of the requirements of Nottingham Trent University for the degree of Doctor of Philosophy December 2019 1 Copyright Statement This work is the intellectual property of the author. You may copy up to 5% of this work for private study, or personal, non-commercial research. Any re-use of the information contained within this document should be fully referenced, quoting the author, title, university, degree level and pagination. Queries or requests for any other use, or if a more substantial copy is required, should be directed in the owner(s) of the Intellectual Property Rights. 2 Acknowledgements First, I would like to thank my Director of Studies, Chris Tinsley, for his support and encouragement throughout the course of the PhD. His kind words and ability to find the silver lining in any situation made the past few years that much easier. Thanks also to my supervisory team, Alan Hargreaves, Bob Stevens and Martin McGinnity for their advice and thoughts on experiments and data that helped shape the PhD. Whilst not on my supervisory team, I’m also grateful to Amanda Miles for her help with mass spectrometry and endless technical knowledge and to Rich Hulse for his advice and support throughout. Special thanks go to my colleagues. Notably, to Awais and Jordan for their ability to distract and take my mind out of the lab during stressful times and to Charlotte for being a role model of scientific rigour and discipline.
    [Show full text]
  • Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation Chip-Sequencing Data Processing Pipeline
    Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation ChIP-Sequencing Data Processing Pipeline Erinija Pranckeviciene Thesis submitted to the Faculty of Graduate and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Cellular and Molecular Medicine Department of Cellular and Molecular Medicine Faculty of Medicine University of Ottawa c Erinija Pranckeviciene, Ottawa, Canada, 2015 Abstract The rapidly advancing high-throughput and next generation sequencing technologies facilitate deeper insights into the molecular mechanisms underlying the expression of phenotypes in living organisms. Experimental data and scientific publications following this technological advance- ment have rapidly accumulated in public databases. Meaningful analysis of currently avail- able data in genomic databases requires sophisticated computational tools and algorithms, and presents considerable challenges to molecular biologists without specialized training in bioinfor- matics. To study their phenotype of interest molecular biologists must prioritize large lists of poorly characterized genes generated in high-throughput experiments. To date, prioritization tools have primarily been designed to work with phenotypes of human diseases as defined by the genes known to be associated with those diseases. There is therefore a need for more prioritiza- tion tools for phenotypes which are not related with diseases generally or diseases with which no genes have yet been associated in particular. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) is a method of choice to study the gene regulation processes responsible for the expression of cellular phenotypes. Among publicly available computational pipelines for the processing of ChIP-Seq data, there is a lack of tools for the downstream analysis of composite motifs and preferred binding distances of the DNA binding proteins.
    [Show full text]
  • Mouse Parp16 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Parp16 Knockout Project (CRISPR/Cas9) Objective: To create a Parp16 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Parp16 gene (NCBI Reference Sequence: NM_177460 ; Ensembl: ENSMUSG00000032392 ) is located on Mouse chromosome 9. 7 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 7 (Transcript: ENSMUST00000069000). Exon 3~5 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 3 starts from about 18.12% of the coding region. Exon 3~5 covers 53.52% of the coding region. The size of effective KO region: ~7788 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 7 Legends Exon of mouse Parp16 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 5 is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Ehrlichia Chaffeensis
    RESEARCH ARTICLE Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with signal transduction, cytoskeletal organization, and immune response a1111111111 1 1 2 1 1 a1111111111 Clayton E. KiblerID , Sarah L. Milligan , Tierra R. Farris , Bing Zhu , Shubhajit Mitra , Jere a1111111111 W. McBride1,2,3,4,5* a1111111111 a1111111111 1 Department of Pathology, University of Texas Medical Branch, Galveston, Texas, United States of America, 2 Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, Texas, United States of America, 3 Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, Texas, United States of America, 4 Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas, United States of America, 5 Institute for Human Infections and Immunity, University of Texas Medical Branch, Galveston, Texas, United States of OPEN ACCESS America Citation: Kibler CE, Milligan SL, Farris TR, Zhu B, * [email protected] Mitra S, McBride JW (2018) Ehrlichia chaffeensis TRP47 enters the nucleus via a MYND-binding domain-dependent mechanism and predominantly binds enhancers of host genes associated with Abstract signal transduction, cytoskeletal organization, and immune response. PLoS ONE 13(11): e0205983. Ehrlichia chaffeensis is an obligately intracellular bacterium that establishes infection in https://doi.org/10.1371/journal.pone.0205983 mononuclear phagocytes through largely undefined reprogramming strategies including Editor: Gary M. Winslow, State University of New modulation of host gene transcription. In this study, we demonstrate that the E. chaffeensis York Upstate Medical University, UNITED STATES effector TRP47 enters the host cell nucleus and binds regulatory regions of host genes rele- Received: April 25, 2018 vant to infection.
    [Show full text]
  • The Mosaic Genome of Indigenous African Cattle As a Unique Genetic Resource for African
    1 The mosaic genome of indigenous African cattle as a unique genetic resource for African 2 pastoralism 3 4 Kwondo Kim1,2, Taehyung Kwon1, Tadelle Dessie3, DongAhn Yoo4, Okeyo Ally Mwai5, Jisung Jang4, 5 Samsun Sung2, SaetByeol Lee2, Bashir Salim6, Jaehoon Jung1, Heesu Jeong4, Getinet Mekuriaw 6 Tarekegn7,8, Abdulfatai Tijjani3,9, Dajeong Lim10, Seoae Cho2, Sung Jong Oh11, Hak-Kyo Lee12, 7 Jaemin Kim13, Choongwon Jeong14, Stephen Kemp5,9, Olivier Hanotte3,9,15*, and Heebal Kim1,2,4* 8 9 1Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, 10 Seoul National University, Seoul, Republic of Korea. 11 2C&K Genomics, Seoul, Republic of Korea. 12 3International Livestock Research Institute (ILRI), Addis Ababa, Ethiopia. 13 4Interdisciplinary Program in Bioinformatics, Seoul National University, Seoul, Republic of Korea. 14 5International Livestock Research Institute (ILRI), Nairobi, Kenya. 15 6Department of Parasitology, Faculty of Veterinary Medicine, University of Khartoum, Khartoum 16 North, Sudan. 17 7Department of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, Uppsala, 18 Sweden. 19 8Department of Animal Production and Technology, Bahir Dar University, Bahir Dar, Ethiopia. 20 9The Centre for Tropical Livestock Genetics and Health (CTLGH), The Roslin Institute, The 21 University of Edinburgh, Easter Bush Campus, Midlothian, UK. 1 22 10Division of Animal Genomics & Bioinformatics, National Institute of Animal Science, RDA, Jeonju, 23 Republic of Korea. 24 11International Agricultural Development and Cooperation Center, Jeonbuk National University, 25 Jeonju, Republic of Korea. 26 12Department of Animal Biotechnology, College of Agriculture & Life Sciences, Jeonbuk National 27 University, Jeonju, Republic of Korea. 28 13Department of Animal Science, College of Agriculture and Life Sciences, Gyeongsang National 29 University, Jinju, Republic of Korea.
    [Show full text]
  • Supplemental Table 1
    Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG
    [Show full text]