Mir-145 Inhibits Breast Cancer Cell Growth Through RTKN
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Plasma Based Protein Signatures Associated with Small Cell Lung Cancer
cancers Article Plasma Based Protein Signatures Associated with Small Cell Lung Cancer Johannes F. Fahrmann 1,†, Hiroyuki Katayama 1,† , Ehsan Irajizad 1,†, Ashish Chakraborty 1 , Taketo Kato 1 , Xiangying Mao 1 , Soyoung Park 1, Eunice Murage 1, Leona Rusling 1, Chuan-Yih Yu 1, Yinging Cai 1, Fu Chung Hsiao 1, Jennifer B. Dennison 1, Hai Tran 2, Edwin Ostrin 3 , David O. Wilson 4, Jian-Min Yuan 5,6, Jody Vykoukal 1 and Samir Hanash 1,* 1 Department of Clinical Cancer Prevention, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030, USA; [email protected] (J.F.F.); [email protected] (H.K.); [email protected] (E.I.); [email protected] (A.C.); [email protected] (T.K.); [email protected] (X.M.); [email protected] (S.P.); [email protected] (E.M.); [email protected] (L.R.); [email protected] (C.-Y.Y.); [email protected] (Y.C.); [email protected] (F.C.H.); [email protected] (J.B.D.); [email protected] (J.V.) 2 Department of Thoracic-Head & Neck Medical Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030, USA; [email protected] 3 Department of Pulmonary Medicine, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030, USA; [email protected] 4 Division of Pulmonary, Allergy and Critical Care Medicine, School of Medicine, University of Pittsburgh, Pittsburgh, PA 15213, USA; [email protected] 5 Division of Cancer Control and Population Sciences, UPMC Hillman Cancer Center, University of Pittsburgh, Pittsburgh, PA 15232, USA; [email protected] 6 Department of Epidemiology, Graduate School of Public Health, University of Pittsburgh, Pittsburgh, PA 15261, USA Citation: Fahrmann, J.F.; Katayama, * Correspondence: [email protected] † These authors contributed equally to this work. -
A Robust 11-Genes Prognostic Model Can
Lin et al. Cancer Cell Int (2020) 20:402 https://doi.org/10.1186/s12935-020-01491-6 Cancer Cell International PRIMARY RESEARCH Open Access A robust 11-genes prognostic model can predict overall survival in bladder cancer patients based on fve cohorts Jiaxing Lin1†, Jieping Yang1†, Xiao Xu2, Yutao Wang1, Meng Yu3* and Yuyan Zhu1* Abstract Background: Bladder cancer is the tenth most common cancer globally, but existing biomarkers and prognostic models are limited. Method: In this study, we used four bladder cancer cohorts from The Cancer Genome Atlas and Gene Expression Omnibus databases to perform univariate Cox regression analysis to identify common prognostic genes. We used the least absolute shrinkage and selection operator regression to construct a prognostic Cox model. Kaplan–Meier analysis, receiver operating characteristic curve, and univariate/multivariate Cox analysis were used to evaluate the prognostic model. Finally, a co-expression network, CIBERSORT, and ESTIMATE algorithm were used to explore the mechanism related to the model. Results: A total of 11 genes were identifed from the four cohorts to construct the prognostic model, including eight risk genes (SERPINE2, PRR11, DSEL, DNM1, COMP, ELOVL4, RTKN, and MAPK12) and three protective genes (FABP6, C16orf74, and TNK1). The 11-genes model could stratify the risk of patients in all fve cohorts, and the prognosis was worse in the group with a high-risk score. The area under the curve values of the fve cohorts in the frst year are all greater than 0.65. Furthermore, this model’s predictive ability is stronger than that of age, gender, grade, and T stage. -
Involvement of Microrna in Solid Cancer: Role and Regulatory Mechanisms
biomedicines Review Involvement of microRNA in Solid Cancer: Role and Regulatory Mechanisms Ying-Chin Lin 1,2,†, Tso-Hsiao Chen 3,†, Yu-Min Huang 4,5 , Po-Li Wei 4,6,7,8,9,* and Jung-Chun Lin 10,11,12,* 1 Department of Family Medicine, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan 2 Department of Family Medicine, Wan Fang Hospital, Taipei Medical University, Taipei 116, Taiwan; [email protected] 3 Division of Nephrology, Wan Fang Hospital, Taipei Medical University, Taipei 116, Taiwan; [email protected] 4 Department of Surgery, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan 5 Division of Gastrointestinal Surgery, Department of Surgery, Taipei Medical University Hospital, Taipei Medical University, Taipei 110, Taiwan; [email protected] 6 Division of Colorectal Surgery, Department of Surgery, Taipei Medical University Hospital, Taipei Medical University, Taipei 110, Taiwan 7 Cancer Research Center, Taipei Medical University Hospital, Taipei Medical University, Taipei 110, Taiwan 8 Translational Laboratory, Department of Medical Research, Taipei Medical University Hospital, Taipei Medical University, Taipei 110, Taiwan 9 Graduate Institute of Cancer Biology and Drug Discovery, Taipei Medical University, Taipei 110, Taiwan 10 School of Medical Laboratory Science and Biotechnology, College of Medical Science and Technology, Taipei Medical University, Taipei 110, Taiwan 11 Program in Medical Biotechnology, College of Medical Science and Technology, Taipei Medical University, Taipei 110, Taiwan 12 Pulmonary Research Center, Wan Fang Hospital, Taipei Medical University, Taipei 110, Taiwan Citation: Lin, Y.-C.; Chen, T.-H.; * Correspondence: [email protected] (P.-L.W.); [email protected] (J.-C.L.); Huang, Y.-M.; Wei, P.-L.; Lin, J.-C. -
Rho/Rhotekin-Mediated NF-Jb Activation Confers Resistance to Apoptosis
Oncogene (2004) 23, 8731–8742 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $30.00 www.nature.com/onc Rho/Rhotekin-mediated NF-jB activation confers resistance to apoptosis Ching-Ann Liu1, Mei-Jung Wang2, Chin-Wen Chi3, Chew-Wun Wu4 and Jeou-Yuan Chen*,2 1Graduate Institute of Life Sciences, National Defense Medical Center, Taiwan, ROC; 2Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan, ROC; 3Department of Medical Research and Education, Taiwan, ROC; 4Department of Surgery, Veterans General Hospital, Taipei, Taiwan, ROC Rhotekin (RTKN), the gene coding for the Rho effector, Introduction RTKN, was shown to be overexpressed in human gastric cancer (GC). In this study, we further showed that RTKN The Rho GTPases are members of the Ras superfamily is expressed at a low level in normal cells and is of monomeric low molecular mass (approx. 21 kDa) overexpressed in many cancer-derived cell lines. The guanine nucleotide-binding proteins. By cycling between function of RTKN as an effector protein in Rho GTPase- an active (GTP-bound) and an inactive (GDP-bound) mediated pathways regulating apoptosis was investigated. state, Rho GTPases function as molecular switches to By transfection and expression of RTKN in cells that control signal transduction pathways in regulation of a expressed endogenous RTKN at a low basal level, we plethora of cellular processes, including cytoskeleton showed that RTKN overexpression conferred cell resis- reorganization, gene transcription, cell-cycle progres- tance to apoptosis induced by serum deprivation or sion, and survival (Bishop and Hall, 2000). The diverse treatment with sodium butyrate, and the increased function of Rho GTPases is mediated through interact- resistance correlated to the level of RTKN. -
Identification of Predictive Biomarkers of Response to HSP90 Inhibitors In
International Journal of Molecular Sciences Article Identification of Predictive Biomarkers of Response to HSP90 Inhibitors in Lung Adenocarcinoma Ángela Marrugal 1, Irene Ferrer 1,2, David Gómez-Sánchez 1,2, Álvaro Quintanal-Villalonga 3, María Dolores Pastor 4, Laura Ojeda 1, Luis Paz-Ares 1,2,5,6,*,† and Sonia Molina-Pinelo 2,4,*,† 1 H12O-CNIO Lung Cancer Clinical Research Unit, Instituto de Investigación Hospital 12 de Octubre & Centro Nacional de Investigaciones Oncológicas (CNIO), 28029 Madrid, Spain; [email protected] (Á.M.); [email protected] (I.F.); [email protected] (D.G.-S.); [email protected] (L.O.) 2 CIBERONC, Respiratory Tract Tumors Program, 28029 Madrid, Spain 3 Program in Molecular Pharmacology, Memorial Sloan Kettering Cancer Center, New York, NY 10065, USA; [email protected] 4 Institute of Biomedicine of Seville (IBIS) (HUVR, CSIC, Universidad de Sevilla), 41013 Sevilla, Spain; [email protected] 5 Medical Oncology Department, Hospital Universitario Doce de Octubre, 28041 Madrid, Spain 6 Medical School, Universidad Complutense, 28040 Madrid, Spain * Correspondence: [email protected] (L.P.-A.); [email protected] (S.M.-P.) † These authors contributed equally to this work. Abstract: Heat shock protein 90 (HSP90) plays an essential role in lung adenocarcinoma, acting as a key chaperone involved in the correct functioning of numerous highly relevant protein drivers of this disease. To this end, HSP90 inhibitors have emerged as promising therapeutic strategies, even Citation: Marrugal, Á.; Ferrer, I.; though responses to them have been limited to date. Given the need to maximize treatment efficacy, Gómez-Sánchez, D.; the objective of this study was to use isobaric tags for relative and absolute quantitation (iTRAQ)- Quintanal-Villalonga, Á.; Pastor, based proteomic techniques to identify proteins in human lung adenocarcinoma cell lines whose M.D.; Ojeda, L.; Paz-Ares, L.; basal abundances were correlated with response to HSP90 inhibitors (geldanamycin and radicicol Molina-Pinelo, S. -
Downloaded from Here
bioRxiv preprint doi: https://doi.org/10.1101/017566; this version posted November 19, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Testing for ancient selection using cross-population allele 2 frequency differentiation 1;∗ 3 Fernando Racimo 4 1 Department of Integrative Biology, University of California, Berkeley, CA, USA 5 ∗ E-mail: [email protected] 6 1 Abstract 7 A powerful way to detect selection in a population is by modeling local allele frequency changes in a 8 particular region of the genome under scenarios of selection and neutrality, and finding which model is 9 most compatible with the data. Chen et al. [2010] developed a composite likelihood method called XP- 10 CLR that uses an outgroup population to detect departures from neutrality which could be compatible 11 with hard or soft sweeps, at linked sites near a beneficial allele. However, this method is most sensitive 12 to recent selection and may miss selective events that happened a long time ago. To overcome this, 13 we developed an extension of XP-CLR that jointly models the behavior of a selected allele in a three- 14 population tree. Our method - called 3P-CLR - outperforms XP-CLR when testing for selection that 15 occurred before two populations split from each other, and can distinguish between those events and 16 events that occurred specifically in each of the populations after the split. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name Rhotekin Gene Symbol Rtkn Organism Rat Gene Summary mouse homolog is a Rho-binding protein Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.233799 Ensembl Gene ID ENSRNOG00000009022 Entrez Gene ID 297383 Assay Information Unique Assay ID qRnoCID0005435 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000031964 Amplicon Context Sequence TGGACAGTGCTGGGGGCTCCGGGAACAGTCCCATCCTGCTCCCTACCCCAGCT GTGGGAGGTCCTCGATACCACCTCTTGGCCCACACCACTCTCACTCTAGCGGCA GTGCAAGATGGATTCCGTACACATGAC Amplicon Length (bp) 104 Chromosome Location 4:179435130-179436964 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9999 cDNA Cq 22.83 cDNA Tm (Celsius) 85.5 gDNA Cq 31.34 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Rtkn, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Microrna-152 Inhibits Tumor Cell Growth by Directly Targeting RTKN in Hepatocellular Carcinoma
ONCOLOGY REPORTS 37: 1227-1234, 2017 MicroRNA-152 inhibits tumor cell growth by directly targeting RTKN in hepatocellular carcinoma JIEJING ZHOU*, YANjUN ZhANG*, YUhoNG QI, DeQUAN YU, QIUjU ShAo and jUN LIANG Department of Radiotherapy, Tangdu Hospital, The 4th Military Medical University, Xi'an, Shaanxi 710038, P.R. China Received june 12, 2016; Accepted october 31, 2016 DOI: 10.3892/or.2016.5290 Abstract. Hepatocellular carcinoma (HCC) is the most Treatment of HCC remains a great challenge for clinical common form of adult liver cancer and accounts for approxi- medicine worldwide. In the current era of rapid development mately 90% of all cases of primary liver cancer annually. of anticancer research, it is particularly important to elucidate Rhotekin (RTKN), which functions as a cancer promoter, the tumor biology of HCC, which may provide hope for the can be frequently detected in many human cancers, including development of effective systemic therapy for this disease (5). gastric cancer, colorectal carcinoma and bladder carcinoma. To this end, the functional mechanisms of many oncogenes or The aim of this study was to investigate the role of RTKN tumor suppressors that may contribute to the development of in HCC. Using HCC cells and tissues from patients with HCC need to be determined. liver cancer, we demonstrated that RTKN was significantly Rhotekin (RTKN) is a Rho effector molecule identified increased in HCC. To examine the effect of RTKN on HCC, in 1996 by yeast two-hybrid screening. RTKN was initially RTKN overexpressed or silenced HepG2 and Hep3B cells isolated as a scaffold protein with high affinity to Rho-GTP were constructed. -
Original Article Eriocalyxin B Induces Apoptosis and Inhibits Migration Through Down-Regulation of RTKN in Human Colon Cancer
Int J Clin Exp Med 2016;9(8):15354-15362 www.ijcem.com /ISSN:1940-5901/IJCEM0020048 Original Article Eriocalyxin B induces apoptosis and inhibits migration through down-regulation of RTKN in human colon cancer Wen-Hui Tao1, Rui Zhou1, Mei-Fang Huang1, You-Li Xie2 1Department of Gastroenterology & Hepatology, 2Department of General Surgery, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071, China Received November 18, 2015; Accepted January 25, 2016; Epub August 15, 2016; Published August 30, 2016 Abstract: Like many epithelial-derived cancers, colon cancer results from a multistep tumorigenic process. However, the detailed mechanisms involved in colon cancer formations are poorly characterized. This study was aimed to elucidate the antitumor effect of Eriocalyxin B in colon cancer LOVO cells and the possible molecular mechanism involved. The results showed that Eriocalyxin B could inhibit the growth and migration, and induce apoptosis of LOVO cells significantly in a dose-dependent manner. The expression level of RTKN was significantly decreased after LOVO cells treated with Eriocalyxin B. However, these effects of Eriocalyxin B were reversed by overexpression of RTKN in LOVO cells. Furthermore, the expression level of NF-κBp65 was significantly increased in Eriocalyxin B-treated LOVO cells with RTKN overexpression. We therefore conclude that Eriocalyxin B exhibited significant growth and migration inhibition of LOVO cells and induced apoptosis of LOVO cells via the down-regulation of RTKN expression and inhibi- tion of NF-κB activation. Keywords: Colon cancer, Eriocalyxin B, RTKN, NF-κBp65 Introduction sidered as one of the most vital sources for the development of novel anticancer drugs [4, Colon cancer is the third most commonly diag- 5]. -
The RHO Family Gtpases: Mechanisms of Regulation and Signaling
cells Review The RHO Family GTPases: Mechanisms of Regulation and Signaling Niloufar Mosaddeghzadeh and Mohammad Reza Ahmadian * Institute of Biochemistry and Molecular Biology II, Medical Faculty of the Heinrich Heine University, Universitätsstrasse 1, Building 22.03.05, 40225 Düsseldorf, Germany; [email protected] * Correspondence: [email protected] Abstract: Much progress has been made toward deciphering RHO GTPase functions, and many studies have convincingly demonstrated that altered signal transduction through RHO GTPases is a recurring theme in the progression of human malignancies. It seems that 20 canonical RHO GTPases are likely regulated by three GDIs, 85 GEFs, and 66 GAPs, and eventually interact with >70 downstream effectors. A recurring theme is the challenge in understanding the molecular determinants of the specificity of these four classes of interacting proteins that, irrespective of their functions, bind to common sites on the surface of RHO GTPases. Identified and structurally verified hotspots as functional determinants specific to RHO GTPase regulation by GDIs, GEFs, and GAPs as well as signaling through effectors are presented, and challenges and future perspectives are discussed. Keywords: CDC42; effectors; RAC1; RHOA; RHOGAP; RHOGDI; RHOGEF; RHO signaling 1. Introduction Citation: Mosaddeghzadeh, N.; The RHO (RAS homolog) family is an integral part of the RAS superfamily of guanine Ahmadian, M.R. The RHO Family nucleotide-binding proteins. RHO family proteins are crucial for several reasons: (i) ap- GTPases: Mechanisms of Regulation proximately 1% of the human genome encodes proteins that either regulate or are regulated and Signaling. Cells 2021, 10, 1831. by direct interaction with RHO proteins; (ii) they control almost all fundamental cellular https://doi.org/10.3390/cells10071831 processes in eukaryotes including morphogenesis, polarity, movement, cell division, gene expression, and cytoskeleton reorganization [1]; and (iii) they are associated with a series Academic Editor: Bor Luen Tang of human diseases (Figure1)[2]. -
393LN V 393P 344SQ V 393P Probe Set Entrez Gene
393LN v 393P 344SQ v 393P Entrez fold fold probe set Gene Gene Symbol Gene cluster Gene Title p-value change p-value change chemokine (C-C motif) ligand 21b /// chemokine (C-C motif) ligand 21a /// chemokine (C-C motif) ligand 21c 1419426_s_at 18829 /// Ccl21b /// Ccl2 1 - up 393 LN only (leucine) 0.0047 9.199837 0.45212 6.847887 nuclear factor of activated T-cells, cytoplasmic, calcineurin- 1447085_s_at 18018 Nfatc1 1 - up 393 LN only dependent 1 0.009048 12.065 0.13718 4.81 RIKEN cDNA 1453647_at 78668 9530059J11Rik1 - up 393 LN only 9530059J11 gene 0.002208 5.482897 0.27642 3.45171 transient receptor potential cation channel, subfamily 1457164_at 277328 Trpa1 1 - up 393 LN only A, member 1 0.000111 9.180344 0.01771 3.048114 regulating synaptic membrane 1422809_at 116838 Rims2 1 - up 393 LN only exocytosis 2 0.001891 8.560424 0.13159 2.980501 glial cell line derived neurotrophic factor family receptor alpha 1433716_x_at 14586 Gfra2 1 - up 393 LN only 2 0.006868 30.88736 0.01066 2.811211 1446936_at --- --- 1 - up 393 LN only --- 0.007695 6.373955 0.11733 2.480287 zinc finger protein 1438742_at 320683 Zfp629 1 - up 393 LN only 629 0.002644 5.231855 0.38124 2.377016 phospholipase A2, 1426019_at 18786 Plaa 1 - up 393 LN only activating protein 0.008657 6.2364 0.12336 2.262117 1445314_at 14009 Etv1 1 - up 393 LN only ets variant gene 1 0.007224 3.643646 0.36434 2.01989 ciliary rootlet coiled- 1427338_at 230872 Crocc 1 - up 393 LN only coil, rootletin 0.002482 7.783242 0.49977 1.794171 expressed sequence 1436585_at 99463 BB182297 1 - up 393 -
Exercise Alters Mouse Sperm Small Noncoding Rnas and Induces a Transgenerational Modification of Male Offspring Conditioned Fear and Anxiety
OPEN Citation: Transl Psychiatry (2017) 7, e1114; doi:10.1038/tp.2017.82 www.nature.com/tp ORIGINAL ARTICLE Exercise alters mouse sperm small noncoding RNAs and induces a transgenerational modification of male offspring conditioned fear and anxiety AK Short1,2, S Yeshurun1, R Powell1, VM Perreau1,AFox1, JH Kim1, TY Pang1,3,4 and AJ Hannan1,3,4 There is growing evidence that the preconceptual lifestyle and other environmental exposures of a father can significantly alter the physiological and behavioral phenotypes of their children. We and others have shown that paternal preconception stress, regardless of whether the stress was experienced during early-life or adulthood, results in offspring with altered anxiety and depression-related behaviors, attributed to hypothalamic–pituitary–adrenal axis dysregulation. The transgenerational response to paternal preconceptual stress is believed to be mediated by sperm-borne small noncoding RNAs, specifically microRNAs. As physical activity confers physical and mental health benefits for the individual, we used a model of voluntary wheel-running and investigated the transgenerational response to paternal exercise. We found that male offspring of runners had suppressed reinstatement of juvenile fear memory, and reduced anxiety in the light–dark apparatus during adulthood. No changes in these affective behaviors were observed in female offspring. We were surprised to find that running had a limited impact on sperm-borne microRNAs. The levels of three unique microRNAs (miR-19b, miR-455 and miR-133a) were found to be altered in the sperm of runners. In addition, we discovered that the levels of two species of tRNA-derived RNAs (tDRs)—tRNA-Gly and tRNA-Pro—were also altered by running.