DOCSLIB.ORG

Copy Number Variations and Cognitive Phenotypes in Unselected Populations

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Copy Number Variations and Cognitive Phenotypes in Unselected Populations Supplementary Online Content Katrin Männik K, Mägi R, Macé A et al. Copy Number Variations and Cognitive Phenotypes in Unselected Populations. JAMA. doi: eMethods eTable 1. Phenotypes of EGCUT individuals with DECIPHER-listed recurrent rearrangements eTable 2. Prevalence and characteristic features of DECIPHER-listed genomic disorders eTable 3. Sample demographics and characteristics eTable 4. Summary scores of ALSPAC participants Standard Assessment Tests (SATs) eTable 5. Prevalence of NAHR-mediated recurrent CNVs in clinical and general population cohorts eTable 6. Follow-up phenotyping of 16p11.2 600kb BP4-BP5 deletions and duplications identified in the EGCUT cohort eTable 7. Individual CNVs in EGCUT discovery and replication cohorts eTable 8. Education attainment in EGCUT replication cohorts separately and combined with discovery cohort eTable 9. Mean Standard Assessment Tests (SATs) scores for English and Mathematics in ALSPAC CNV carriers eTable 10. Education attainment in Italian HYPERGENES cohort eTable 11. Education attainment in European American MCTFR cohort eTable 12. MetaCore Enrichment by GO Processes analysis report eFigure 1. Diagnoses reported in the EGCUT participants according to the WHO ICD-10 classification eFigure 2. Multidimensional scaling analysis of EGCUT population structure eFigure 3. Assessment of CNV deleteriousness This supplementary material has been provided by the authors to give readers additional information about their work. © 2015 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 eMethods EGCUT The Estonian population was influenced by trends encountered by most of the European populations. Before the Second World War, Estonia had a relatively homogenous population (88% of ethnic Estonians in the 1934 population census) with strong cultural influence from previously ruling countries such as Germany, Sweden and Denmark. This make up was modified during the 1941 to 1991 Soviet Union occupation (i.e. mass deportations and executions of local people, flight of many Estonians, as well as of a majority of local German and Swedish minority members to Western Europe and Northern America in the 1940s, followed by implementation of a “russification” ideology). It resulted in the actual distribution of 69.7% Estonians, 25.2% Russians and 5.1% other minorities (2014 population census; Statistics Estonia, http://www.stat.ee/en). Religion plays a minor role in Estonia largely due to the Soviet occupation from 1941-1991 when “elimination of religion” was an ideological objective. As a result, Estonia is one of the least religious countries in the world – less than a third of the population defines itself as “believers”. The majority of these are Lutheran and Eastern Orthodox (Statistics Estonia, http://www.stat.ee/en). It is important to stress here that there is no restrictions to the accessibility of education in Estonia based on ethnicity or religious beliefs (see also below). The Estonian Genome Centre of the University of Tartu (EGCUT) cohort is a longitudinal and prospective population biobank that contains close to 52,000 participants and represents 5% of the Estonian adult population. The long-term recruitment via general practitioners and a widespread network of special recruitment offices (rather than self-initiated and/or web-based) has granted that the samples have been collected throughout the country and diverse social groups. The resulting representation of a wide range of phenotypes (eFigure 1), age and educational groups makes the cohort ideally suited to population-based studies. The distribution of participants’ geographical origin, age, sex and achieved education level closely reflects those of the Estonian population in general. At baseline, the general practitioners (GPs) performed a standardized objective examination of the participants, who also donated blood samples for DNA, white blood cells and plasma tests and filled out a 16-module questionnaire that encompass more than 1000 health- and lifestyle-related questions, as well as uniformed report of clinical diagnoses according to the World Health Organization international classification of diseases (WHO ICD-10, http://www.who.int/classifications/icd). The data are continuously updated through follow-up interviews, as well as national electronic health databases and citizen registries (see1 and www.biobank.ee for details). Analyses of participants’ age, gender, diseases and educational level show that this cohort is representative of the country’s population. EGCUT is conducted according to Estonian Human Genes Research Act and managed in conformity with the standard ISO 9001:2008. The Ethics Review Committee on Human Research of the University of Tartu approved the project. Written informed consent was obtained from all voluntary participants for the baseline and follow-up investigations. All population carriers of 16p11.2 600kb BP4-BP5 (breakpoint) recurrent copy number variants (CNVs) were invited back for follow-up investigations using the clinical and neuropsychological protocol previously used to study 16p11.2 syndrome patients ascertained through clinical cohorts2,3. The EGCUT cohort (and Estonian population in general) is an outbred population with no substantial regional differences. Single-nucleotide polymorphism (SNP) allele frequencies and linkage disequilibrium patterns are similar to the one found in populations with European ancestry4. We do not find small series of non-recurrent CNVs and/or inflation of recurrent rearrangements typical of founder effects5,6 (see also CNV calling section below). Accordingly, its samples have been successfully used to discover or replicate hundreds of SNP associations, which are vulnerable to population frequencies and stratification differences (e.g. genome wide association studies on education attainment, adult height and age of menarche7-9. Of note all quality control (QC) procedures suggested in 10 were applied to results submitted by the EGCUT cohort in these meta-analyses and no problems were uncovered. The identity-by-descent of EGCUT participants was estimated using SNP genotypes and PLINK software. 14.6% and 5.9% of discovery and replication cohort individuals show cryptic relatedness (pi_hat >0.15) on par with enrolling 5% of the population. To exclude the possibility that the EGCUT cohort could be affected by hidden population stratification, multidimensional scaling (MDS) analysis was performed using PLINK1.07 (http://pngu.mgh.harvard.edu/~purcell/plink/strat.shtml). SNPs that passed quality control from a full set of genotyped EGCUT samples were pruned so that all SNPs © 2015 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 within a given window size of 50 had pairwise r2 < 0.5. Pairwise IBS (identical by state) distance was calculated using all autosomal SNPs that remained after pruning. MDS dimensions were extracted using the "MDS-plot" option. R 3.0.2 was used for plotting and visualization of the results. This analysis demonstrated that genetic stratification could not lead to the observed associations (eFigure 2). No differences were observed upon exclusion of pairs with high relatedness (>0.1). CNV calling The genomic DNA of 8110 subjects (7020 for the discovery and 1090 for the replication cohort) was randomly selected among the 52,000 EGCUT participants. A third cohort of 1066 individuals (“high- functioning replication cohort”) was used to further assess the significance of the signal obtained regarding education attainment. The three cohorts were selected and SNP genotyped at three different time-points over a period of four years using Illumina HumanOmniExpress (discovery cohort) and Illumina Human CNV370 BeadChips (both replication cohorts) (Illumina Inc., San Diego, CA; USA). The HumanOmniExpress BeadChip covers the entire human genome with median spacing of 2.1 kb and the HumanCNV370 BeadChip has a genome-wide median spacing of 5 kb. All samples were processed and the assay performed according to a routine protocol provided by the manufacturer. Genotypes were called by GenomeStudio software GT module v3.1 (Illumina Inc). Log R ratio (LRR) and B Allele Frequency (BAF) values produced by the GenomeStudio software were formatted for further CNV calling with Hidden Markov Model-based software PennCNV (ver. June 2011)11 using the parameters suggested by the software authors together with “GC model adjustments” and “Merging adjacent CNV calls” function. The 6819 discovery, 1058 replication and 993 “high-functioning” replication samples with a call rate greater than 98% and less than 50 CNV calls that passed the quality control parameters were retained. To minimize the number of false positive findings, CNVs ≥250kb in size were filtered for the PennCNV confidence score ≥30 (HumanOmniExpress) or ≥40 (HumanCNV370) and visual confirmation in GenomeStudio GenomeViewer. As >1Mb rearrangements have a high likelihood of having pathogenic effect, we used an initial size threshold of 1Mb for both types of CNVs and subsequent series of thresholds half this size (500kb, 250 kb and 125kb) until loss of the association. The genotype of 23 carriers of DECIPHER-listed CNVs was assessed by quantitative PCR and resulted in no false positive findings. The EGCUT genotyping facility is licensed to use the same procedure to provide SNP-array genotyping for diagnostic purpose to the Medical Genetics Center of Tartu University Hospital. This method identified CNVs
Load more

Recommended publications
  • Recherche De Nouvelles Mutations Génétiques À Effet Majeur Dans La Maladie De Crohn Sara Frade Proud’Hon-Clerc
    Recherche de nouvelles mutations génétiques à effet majeur dans la maladie de Crohn Sara Frade Proud’Hon-Clerc To cite this version: Sara Frade Proud’Hon-Clerc. Recherche de nouvelles mutations génétiques à effet majeur dans la maladie de Crohn. Médecine humaine et pathologie. Université de Lille, 2019. Français. NNT : 2019LILUS016. tel-02465045 HAL Id: tel-02465045 https://tel.archives-ouvertes.fr/tel-02465045 Submitted on 3 Feb 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. École doctorale Biologie Santé de Lille THÈSE de DOCTORAT pour obtenir le grade de docteur délivré par l’Université de Lille - Communauté d’Universités et d’Etablissements Lille Nord de France Discipline doctorale “Recherche Clinique, Innovation Technologique, Santé Publique” Spécialité doctorale “Génétique” présentée et soutenue publiquement par Sara FRADE PROUD’HON-CLERC le 12 septembre 2019 Recherche de nouvelles mutations génétiques à effet majeur dans la maladie de Crohn Directeur de thèse : Francis VASSEUR Jury Mme Mouna BARAT-HOUARI, Maitre de conférence T M. Jean-Pierre HUGOT, Professeur M. Edouard LOUIS, Professeur H M. Xavier TRETON, Professeur E EA 2694, 1 Place Verdun, 59045 Lille S E ii iii iv Résumé Résumé : Le gène NOD2, impliqué dans les réponses immunitaires innées contre le peptidogly- cane bactérien, est étroitement associé à la maladie de Crohn (MC) avec des Odd Ratio (OR) allant de 3 à 36 selon le génotype et a été initialement identifié par des analyses de liaisons génétiques.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • Investigating the Genetic Basis of Cisplatin-Induced Ototoxicity in Adult South African Patients
    --------------------------------------------------------------------------- Investigating the genetic basis of cisplatin-induced ototoxicity in adult South African patients --------------------------------------------------------------------------- by Timothy Francis Spracklen SPRTIM002 SUBMITTED TO THE UNIVERSITY OF CAPE TOWN In fulfilment of the requirements for the degree MSc(Med) Faculty of Health Sciences UNIVERSITY OF CAPE TOWN University18 December of Cape 2015 Town Supervisor: Prof. Rajkumar S Ramesar Co-supervisor: Ms A Alvera Vorster Division of Human Genetics, Department of Pathology, University of Cape Town 1 The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgement of the source. The thesis is to be used for private study or non- commercial research purposes only. Published by the University of Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University of Cape Town Declaration I, Timothy Spracklen, hereby declare that the work on which this dissertation/thesis is based is my original work (except where acknowledgements indicate otherwise) and that neither the whole work nor any part of it has been, is being, or is to be submitted for another degree in this or any other university. I empower the university to reproduce for the purpose of research either the whole or any portion of the contents in any manner whatsoever. Signature: Date: 18 December 2015 ' 2 Contents Abbreviations ………………………………………………………………………………….. 1 List of figures …………………………………………………………………………………... 6 List of tables ………………………………………………………………………………….... 7 Abstract ………………………………………………………………………………………… 10 1. Introduction …………………………………………………………………………………. 11 1.1 Cancer …………………………………………………………………………….. 11 1.2 Adverse drug reactions ………………………………………………………….. 12 1.3 Cisplatin …………………………………………………………………………… 12 1.3.1 Cisplatin’s mechanism of action ……………………………………………… 13 1.3.2 Adverse reactions to cisplatin therapy ……………………………………….
    [Show full text]
  • Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79
    www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g.
    [Show full text]
  • Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
    Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation
    [Show full text]
  • C2orf3 (GCFC2) (NM 001201334) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234563 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCFC2 Synonyms: C2orf3; DNABF; GCF; TCF9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone – RG234563 ORF Nucleotide >RG234563 representing NM_001201334 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGAGAGAGCGAAGATGACCCTGAGAGTGAGCCTGATGACCATGAAAAGAGAATACCATTTACTC TAAGACCTCAAACACTTAGACAAAGGATGGCTGAGGAATCAATAAGCAGAAATGAAGAAACAAGTGAAGA AAGTCAGGAAGATGAAAAGCAAGATACTTGGGAACAACAGCAAATGAGGAAAGCAGTTAAAATCATAGAG GAAAGAGACATAGATCTTTCCTGTGGCAATGGATCTTCAAAAGTGAAGAAATTTGATACTTCCATTTCAT TTCCGCCAGTAAATTTAGAAATTATAAAGAAGCAATTAAATACTAGATTAACATTACTACAGGAAACTCA CCGCTCACACCTGAGGGAGTATGAAAAATACGTACAAGATGTCAAAAGCTCAAAGAGTACCATCCAGAAC CTAGAGAGTTCATCAAATCAAGCTCTAAATTGTAAATTCTATAAAAGCATGAAAATTTATGTGGAAAATT TAATTGACTGCCTTAATGAAAAGATTATCAACATCCAAGAAATAGAATCATCCATGCATGCACTCCTTTT
    [Show full text]
  • Table SI. Genes Upregulated ≥ 2-Fold by MIH 2.4Bl Treatment Affymetrix ID
    Table SI. Genes upregulated 2-fold by MIH 2.4Bl treatment Fold UniGene ID Description Affymetrix ID Entrez Gene Change 1558048_x_at 28.84 Hs.551290 231597_x_at 17.02 Hs.720692 238825_at 10.19 93953 Hs.135167 acidic repeat containing (ACRC) 203821_at 9.82 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 1559509_at 9.41 Hs.656636 202957_at 9.06 3059 Hs.14601 hematopoietic cell-specific Lyn substrate 1 (HCLS1) 202388_at 8.11 5997 Hs.78944 regulator of G-protein signaling 2 (RGS2) 213649_at 7.9 6432 Hs.309090 serine and arginine rich splicing factor 7 (SRSF7) 228262_at 7.83 256714 Hs.127951 MAP7 domain containing 2 (MAP7D2) 38037_at 7.75 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 224549_x_at 7.6 202672_s_at 7.53 467 Hs.460 activating transcription factor 3 (ATF3) 243581_at 6.94 Hs.659284 239203_at 6.9 286006 Hs.396189 leucine rich single-pass membrane protein 1 (LSMEM1) 210800_at 6.7 1678 translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A) 238956_at 6.48 1943 Hs.741510 ephrin A2 (EFNA2) 242918_at 6.22 4678 Hs.319334 nuclear autoantigenic sperm protein (NASP) 224254_x_at 6.06 243509_at 6 236832_at 5.89 221442 Hs.374076 adenylate cyclase 10, soluble pseudogene 1 (ADCY10P1) 234562_x_at 5.89 Hs.675414 214093_s_at 5.88 8880 Hs.567380; far upstream element binding protein 1 (FUBP1) Hs.707742 223774_at 5.59 677825 Hs.632377 small nucleolar RNA, H/ACA box 44 (SNORA44) 234723_x_at 5.48 Hs.677287 226419_s_at 5.41 6426 Hs.710026; serine and arginine rich splicing factor 1 (SRSF1) Hs.744140 228967_at 5.37
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • Characterisation, Localisation and Expression of Porcine TACR1, TACR2 and TACR3 Genes
    Veterinarni Medicina, 62, 2017 (08): 443–455 Original Paper doi: 10.17221/23/2017-VETMED Characterisation, localisation and expression of porcine TACR1, TACR2 and TACR3 genes A. Jakimiuk*, P. Podlasz, M. Chmielewska-Krzesinska, K. Wasowicz Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Olsztyn, Poland *Corresponding author: [email protected] ABSTRACT: Substance P is involved in many physiological and pathophysiological processes. This functional diversity is mediated by three neurokinin receptor subtypes (NK1R, NK2R and NK3R) encoded by the TACR1, TACR2 and TACR3 genes, respectively. Despite the increasing interest in using pigs (Sus scrofa) to study human disease mechanisms, the sequences of these receptors are still unconfirmed or in the case of the NK1 receptor, not yet even unpredicted. We employed in silico analysis to define the localisation of the porcine tachykinin receptor genes, and to predict the structures and amino acid sequences of the respective proteins. A reverse transcription polymerase chain reaction (RT-PCR) assay was performed to analyse the expression of tachykinin receptor genes in different porcine tissues. The data show that the TACR1 gene is located on chromosome 3, TACR2 on chromo- some 14 and TACR3 on chromosome 8. All three genes encode proteins with structures that incorporate features of G-protein-coupled receptors with sizes of 407, 381 and 464 amino acids, respectively. The receptors display a high degree of similarity to other mammalian neurokinin receptors. The NK1R subtype is expressed in both the central nervous system and peripheral tissues, while NK2R expression seems to be localised mostly to peripheral tissues. The expression of NK3R is found mainly in the central nervous system.
    [Show full text]
  • Advances in Prognostic Methylation Biomarkers for Prostate Cancer
    cancers Review Advances in Prognostic Methylation Biomarkers for Prostate Cancer 1 1,2 1,2, 1,2, , Dilys Lam , Susan Clark , Clare Stirzaker y and Ruth Pidsley * y 1 Epigenetics Research Laboratory, Genomics and Epigenetics Division, Garvan Institute of Medical Research, Sydney, New South Wales 2010, Australia; [email protected] (D.L.); [email protected] (S.C.); [email protected] (C.S.) 2 St. Vincent’s Clinical School, University of New South Wales, Sydney, New South Wales 2010, Australia * Correspondence: [email protected]; Tel.: +61-2-92958315 These authors have contributed equally. y Received: 22 September 2020; Accepted: 13 October 2020; Published: 15 October 2020 Simple Summary: Prostate cancer is a major cause of cancer-related death in men worldwide. There is an urgent clinical need for improved prognostic biomarkers to better predict the likely outcome and course of the disease and thus inform the clinical management of these patients. Currently, clinically recognised prognostic markers lack sensitivity and specificity in distinguishing aggressive from indolent disease, particularly in patients with localised, intermediate grade prostate cancer. Thus, there is major interest in identifying new molecular biomarkers to complement existing standard clinicopathological markers. DNA methylation is a frequent alteration in the cancer genome and offers potential as a reliable and robust biomarker. In this review, we provide a comprehensive overview of the current state of DNA methylation biomarker studies in prostate cancer prognosis. We highlight advances in this field that have enabled the discovery of novel prognostic genes and discuss the potential of methylation biomarkers for noninvasive liquid-biopsy testing.
    [Show full text]